TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-659-5p
miRNA Sequence: AGGACCUUCCCUGAACCAAGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr585892 5675 5172 4622 4260 1881 1697 1333 --14853 12023
NM_000368chr944604 1070 129 92 1564 --24684 1000
NM_000633chr1854929 4632 3249 2101 1408 --13929 140
NM_001003652chr1877278 6433 5630 5592 3019 279 124 --12531 12063
NM_001007097chr944197 1879 651 606 14384 11530 13439
NM_001008408chr7115803 5776 4855 4520 2418 1777 1757 1499 1086 735 97 --24302 2183 --
NM_001008801chr1962150 617 397 276 264 107 11555 ----
NM_001017440chr797590 6928 6657 5789 1850 1449 434 410 145 --46247 2934 1663 1042 --
NM_001029884chr61746 ----22622 2377
NM_001042533chr342965 2360 1289 1005 ----11013
NM_001042555chr1233166 1621 1533 ----1998
NM_001100108chr1118369 8337 7317 7074 6738 6119 5477 3207 2806 2281 901 --38035 7027 6985 12698
NM_001204chr267033 4888 2668 1683 623 359 22244 920 --13074
NM_001695chr853630 3064 1604 766 210 --22894 276 13752
NM_001699chr1931438 278 149 11575 41601 1181 384 302 11567
NM_001859chr943630 3379 2770 2618 ----31573 812 504
NM_001918chr1108642 8109 7492 6766 5992 2866 2424 1681 1412 1240 13045 --21268 1134
NM_002737chr17116336 6299 5886 5703 5298 5225 5131 4119 2374 1369 165 14773 12068 --
NM_003253chr2121821 1271 11900 --11880
NM_003392chr354163 2657 1101 929 388 13860 1478 13048
NM_004136chr1542820 2484 1265 1195 --32187 1218 612 --
NM_004171chr1199507 8855 8585 8404 7468 6181 3699 1884 1482 29009 3805 28636 3067 --
NM_004719chr123837 627 163 ----22806 2552
NM_004815chr133545 1331 184 ----21441 1086
NM_005359chr1855450 4889 4639 847 791 35917 5112 1975 11731 --
NM_005596chr976230 4408 4274 2186 2004 306 280 --34745 3943 1172 --
NM_005665chr123387 1840 1590 1247 24400 1379
NM_005759chr254420 3690 3668 1024 43 11436 2825 816 --
NM_005840chrX107373 7193 6813 6517 6135 5542 5163 4897 2840 2254 16424 16980 --
NM_005901chr1877278 6433 5630 5592 3019 279 124 --12531 12063
NM_006094chr842289 2193 443 179 1562 11486 22120 2087
NM_006654chr1233166 1621 1533 ----1998
NM_007050chr2086524 6159 6112 5835 3177 2512 2488 1259 12655 17685 27355 2215
NM_007249chr1389374 8831 6612 6386 2055 1393 521 340 17743 37295 2239 1730 --
NM_012096chr332748 1219 542 13012 --11132
NM_014421chr431803 1607 447 ----181
NM_014787chr122090 1092 ----12245
NM_015144chr1673580 3498 3322 3064 3029 2474 1314 ----1772
NM_015879chr1838081 6932 6374 17793 26382 613 --
NM_016260chr267501 5345 4955 2729 1222 661 --25578 1131 12243
NM_016530chr1523187 1204 1927 --12899
NM_017644chr335015 4910 1630 11205 --24551 3459
NM_017813chr855377 4515 4109 1145 813 1588 23814 802 --
NM_017848chrX63646 3008 1492 1404 1164 234 --1335 12904
NM_017919chr955729 5635 5257 4634 4180 --14111 25276 1484
NM_018650chr141895 1868 593 133 2208 23 --11476
NM_018999chr1021304 820 --34787 1617 1074 11223
NM_020228chr1142092 1628 444 164 12417 --11727
NM_020640chr312184 --1675 11497
NM_020772chr1758415 7158 2863 2591 2181 11838 --11358
NM_020792chr352360 1949 1083 537 311 --12072 1956
NM_021072chr542308 2133 1686 198 11038 --12423
NM_021913chr1931438 278 149 11575 41601 1181 384 302 11567
NM_022048chr1574839 4502 2470 1833 1812 578 216 21453 885 35079 4280 1558 --
NM_022166chr1672189 1264 1205 1039 430 266 147 24377 377 11386 1768
NM_024989chr277208 3220 2708 1557 851 725 486 ----17418
NM_030647chr765355 4750 4620 902 448 249 ----15615
NM_030806chr1139357 8833 8519 8242 7480 7054 6476 6207 5708 5698 3154 2391 77 29377 3363 ----
NM_031468chr797590 6928 6657 5789 1850 1449 434 410 145 --46247 2934 1663 1042 --
NM_032778chr342965 2360 1289 1005 ----11013
NM_052906chr22114843 4654 4615 4396 3993 3683 3540 3489 3336 558 26 11804 33140 832 436 24572 65
NM_053043chr7115803 5776 4855 4520 2418 1777 1757 1499 1086 735 97 --24302 2183 --
NM_133170chr2086524 6159 6112 5835 3177 2512 2488 1259 12655 17685 27355 2215
NM_133445chr973769 3607 3135 2782 860 188 126 21367 110 1598 --
NM_138959chr186745 6642 6261 5280 4366 2395 2131 531 16621 14393 --
NM_139207chr121714 --11786 21701 1463
NM_144571chr456697 5903 4835 4317 1350 ----16172
NM_152277chr52836 728 --21955 797 12179
NM_153182chr342965 2360 1289 1005 ----11013
NM_175736chr12167224 7066 7047 7038 6497 5287 5199 3075 2630 1933 1207 608 247 237 177 169 --26632 214 --
NM_182643chr842289 2193 443 179 1562 11486 22120 2087
NM_198900chr12167224 7066 7047 7038 6497 5287 5199 3075 2630 1933 1207 608 247 237 177 169 --26632 214 --
NM_199132chr1962150 617 397 276 264 107 11555 ----
NM_199324chr463311 3251 2904 2398 2326 1187 ----13103
NM_199437chr1142092 1628 444 164 12417 --11727
NM_199438chr1142092 1628 444 164 12417 --11727
NM_199439chr1142092 1628 444 164 12417 --11727
NM_207306chr1234246 3895 1413 1392 1356 1320 1284 1248 1212 1176 1104 1068 1032 996 924 856 820 784 712 640 568 496 460 12841 ----