TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-660-3p
miRNA Sequence: ACCUCCUGUGUGCAUGGAUUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1574764 4649 4200 1251 1115 421 253 34444 286 274 11219 --
NM_000332chr696873 6562 6417 5411 818 368 338 226 159 --25968 1385 1211
NM_000368chr964080 3635 3040 1198 1122 811 23613 3364 34394 3729 53 21371 463
NM_000599chr2154021 3794 3779 3755 3441 3260 3056 3016 2967 2848 1796 1603 1535 435 397 53415 3341 1649 1579 919 11477 1517
NM_000719chr12115689 4806 4357 4308 2414 2284 2232 2067 949 504 209 44367 805 646 489 35892 4377 799 32201 463 171
NM_001001665chr2143295 2916 2772 2752 2740 2636 2605 2559 2364 2332 2229 2198 1347 616 1630 23264 782 33306 2212 764
NM_001002762chr1062123 2079 1116 608 273 98 42478 542 117 106 32608 1048 786 --
NM_001005473chr586009 4952 4109 1059 1039 974 962 663 51889 1068 1048 1016 955 --22467 1000
NM_001005502chr12143772 3760 3652 3621 1493 1473 1461 1354 1323 831 591 483 451 413 24584 4577 1579 --
NM_001008220chr5133847 3586 2927 2897 2869 2746 2681 580 533 465 428 242 134 63853 3383 3164 2984 1139 222 23696 250 33421 933 326
NM_001008701chr19112436 2258 989 855 743 377 278 268 152 43 21 32215 1940 249 22448 2355 22426 560
NM_001013659chr19155048 5013 4424 4308 4277 3736 3710 3698 3594 3563 3454 3282 2167 1830 362 15437 24444 4412 13577
NM_001013693chr1142669 2581 2561 2289 1846 1160 1116 1078 739 605 539 530 510 448 2811 515 52343 2228 475 81 24 1499
NM_001013693chr1142669 2581 2561 2289 1846 1160 1116 1078 739 605 539 530 510 448 2811 515 52343 2228 475 81 24 1499
NM_001014797chr10137653 7587 7473 7276 7174 6875 6676 6128 6119 6052 2868 2643 140 --21031 877 --
NM_001017440chr7187587 6949 6503 6446 5533 5438 2741 2639 2564 2552 2423 2115 1899 1808 935 917 483 418 47744 6378 5409 2432 11206 --
NM_001018050chr22143410 3354 2980 2793 2677 2282 1271 1063 1054 980 804 661 390 129 --43121 2388 1204 869 21246 758
NM_001018052chr22143410 3354 2980 2793 2677 2282 1271 1063 1054 980 804 661 390 129 --43121 2388 1204 869 21246 758
NM_001031690chr7123089 2680 2519 1943 860 850 603 557 526 496 381 119 21045 613 22511 644 1923
NM_001031695chr2294352 4170 4146 3486 3304 1499 1398 577 363 65405 3659 3538 2172 1984 346 14509 --
NM_001033045chr2123562 3245 3128 3099 1423 1264 1233 1055 557 537 419 388 12798 23233 525 --
NM_001040441chr1105196 5048 4642 4495 1704 1674 1082 965 849 820 11382 55216 4662 4630 1839 953 24804 1821
NM_001100108chr1147425 6454 6124 5599 5587 5482 5305 5043 2680 2544 2520 2028 787 194 17732 26254 5619 --
NM_001106chr3158364 6668 6549 3922 3842 3722 3692 3668 3339 3315 3059 2888 2727 2234 1045 59747 6235 3517 2918 643 ----
NM_001310chr1253055 2427 2124 884 274 43019 2937 2505 878 ----
NM_001874chr12143772 3760 3652 3621 1493 1473 1461 1354 1323 831 591 483 451 413 24584 4577 1579 --
NM_001918chr1187411 5748 3232 3010 2544 2429 2400 1999 1810 1798 1686 1655 1553 1522 503 483 471 336 28207 3297 28640 2532 11536
NM_002360chr7111645 1025 973 882 785 709 680 611 583 462 360 1503 --21832 964
NM_002855chr11133535 3329 3233 2521 2417 2353 2334 1330 1321 1258 1102 148 89 23208 555 13365 23424 1088
NM_003043chr3124217 2749 1730 1546 1449 1165 1108 954 848 693 586 544 14113 23733 895 1576
NM_003099chr15196013 5511 5504 4963 4780 4742 4484 4385 4289 4229 4189 4089 4054 1729 1399 1101 1047 986 688 35548 5496 5325 36293 4640 1020 --
NM_003108chr2146996 2863 2793 2680 2467 2371 1929 1916 1788 1718 1698 1689 417 403 32304 2221 59 32502 2361 2324 --
NM_003371chr992002 1966 1467 1450 682 642 349 256 136 11573 31988 1918 494 41410 1382 562 475
NM_003644chr17136132 6057 5721 5574 5174 4603 2290 1447 1414 758 567 403 38 25553 578 15708 15910
NM_003714chr5121927 1072 815 523 514 508 492 456 326 313 194 89 42976 2066 1954 601 ----
NM_004200chr11133030 2633 2516 2481 2284 2050 1270 1227 449 413 216 130 101 1107 43010 2435 931 25 12677
NM_004588chr11133797 3473 1303 1291 1170 1021 891 866 725 393 328 319 268 --3612 430 275 --
NM_004647chr193306 240 122 2109 101 --195
NM_004774chr17103011 2999 1078 854 815 565 552 298 275 264 12064 ----
NM_004976chr11174914 4278 4220 4116 4039 3518 3358 3149 2057 1769 1611 1547 778 572 298 268 192 24749 1642 64397 1274 1212 935 458 276 --
NM_004992chrX167824 7357 6572 6564 6138 5815 5737 3166 2584 1668 1421 898 711 662 489 476 27271 914 57602 7539 6046 3215 1870 --
NM_004992chrX167824 7357 6572 6564 6138 5815 5737 3166 2584 1668 1421 898 711 662 489 476 27271 914 57602 7539 6046 3215 1870 --
NM_005477chr15122358 2230 2149 2135 1941 1834 1751 1673 930 306 223 76 2238 231 ----
NM_005477chr15122358 2230 2149 2135 1941 1834 1751 1673 930 306 223 76 2238 231 ----
NM_005497chr17115638 5540 5509 5198 5167 5100 4294 4265 3784 593 136 --35675 4429 4399 12361
NM_005569chr2231576 589 328 --2151 25 31327 432 277
NM_005828chr17103852 3696 3396 3163 3143 3131 2010 673 144 31 33430 3379 1236 ----
NM_005909chr573936 3555 3458 3047 2662 375 336 1490 13614 --
NM_005910chr1794033 3640 3490 3379 2558 1099 887 553 541 13387 31278 797 529 --
NM_005937chr17174002 3975 3494 3436 3226 2931 2880 2795 1375 1242 1146 714 662 587 531 330 262 1643 --22689 2667
NM_006306chrX125815 5698 5642 5594 5425 5191 5140 4172 1837 797 494 218 25731 3839 14192 --
NM_006650chr5133847 3586 2927 2897 2869 2746 2681 580 533 465 428 242 134 63853 3383 3164 2984 1139 222 23696 250 33421 933 326
NM_006750chr1673124 2672 2480 1566 927 786 779 11672 36816 5943 5911 26798 1598
NM_007030chr5143866 3854 3831 3761 3644 3621 3236 3229 1195 672 458 401 383 119 34427 1644 1037 43316 1424 1083 345 24567 3926
NM_007050chr20157704 6231 6170 5410 5252 2219 2157 1993 1383 954 720 487 392 365 87 ------
NM_012296chr11133857 3568 3479 3458 3126 1510 1259 1062 974 900 518 260 166 --32672 2634 28 --
NM_012306chr1292731 2704 2608 2207 1339 792 609 481 325 42792 2482 918 296 42964 1350 702 689 --
NM_012316chr1165141 5122 5110 4967 4799 4787 4683 4654 1027 961 674 481 474 293 285 23 32094 794 307 34819 2220 1293 --
NM_012334chr5104712 4249 3860 3781 3230 1443 1420 395 259 136 33812 475 265 14281 --
NM_014240chr3113881 3861 3746 2967 1574 1401 1391 1005 160 102 31 12551 1111 11208
NM_014293chr22133664 3627 3390 3333 3091 3078 2591 1627 1492 1461 1164 846 56 2349 205 43251 3202 1595 699 --
NM_014309chr2294342 4160 4136 3476 3294 1489 1388 567 353 65395 3649 3528 2162 1974 336 14499 --
NM_014331chr4107133 5771 5455 1532 1520 1417 1396 1387 642 265 --11552 --
NM_014690chr7123089 2680 2519 1943 860 850 603 557 526 496 381 119 21045 613 22511 644 1923
NM_014921chr19112436 2258 989 855 743 377 278 268 152 43 21 32215 1940 249 22448 2355 22426 560
NM_014952chr15131456 1443 1412 1340 755 335 316 183 168 142 135 88 56 42014 1666 1383 403 21807 791 --
NM_015023chr141820 1789 1593 68 1326 31307 230 61 1383
NM_015035chr20166646 6522 6250 6092 5976 5903 5819 5338 5317 5307 5120 4831 4766 2641 2603 1716 14996 35474 5442 4489 --
NM_015082chr562345 2291 2254 2058 429 423 52452 2371 2362 2353 1953 22471 2269 --
NM_015111chr5143262 3150 3022 1575 882 876 820 752 509 353 262 178 135 120 --23696 1388 11028
NM_015375chr1184647 4488 4323 4304 4188 3939 3931 3416 1922 1910 1560 1194 1069 899 879 733 632 291 13099 34292 1942 867 13581
NM_016169chr1083075 2746 2736 2525 2262 2233 818 192 --1375 32707 2164 762
NM_016206chr378019 7138 5844 3219 2552 2518 1438 ----12535
NM_016239chr173771 581 127 2860 573 --2223 135
NM_016733chr2231576 589 328 --2151 25 31327 432 277
NM_016834chr1794033 3640 3490 3379 2558 1099 887 553 541 13387 31278 797 529 --
NM_016835chr1794033 3640 3490 3379 2558 1099 887 553 541 13387 31278 797 529 --
NM_016841chr1794033 3640 3490 3379 2558 1099 887 553 541 13387 31278 797 529 --
NM_017596chr1114068 3284 2957 2858 1811 1697 1384 930 767 577 221 43623 1715 796 247 13137 13077
NM_017644chr384279 3677 3205 936 645 447 308 47 2675 632 --1919
NM_017741chr4102275 2255 2243 2139 2107 997 989 378 359 212 12654 1347 11005
NM_017902chr10135670 5301 5169 4241 3635 2112 2040 1920 1756 1404 604 135 73 13746 ----
NM_017919chr9125505 4832 4339 4298 4177 3960 3797 2174 1935 1474 1012 660 11385 ----
NM_017952chr294503 4121 3964 3777 3032 1834 1736 1705 1427 11719 13283 --
NM_018085chr1167798 7306 6641 6288 6141 5511 2985 2499 1800 1780 1664 1359 1241 1210 586 356 47987 6959 5099 2478 26308 1768 1497
NM_019044chr2104380 4195 3218 1834 1679 1243 1081 952 856 451 14636 11105 1906
NM_020205chr1143164 2993 2971 2934 2853 2550 887 579 380 344 318 198 149 28 63184 2159 897 623 366 90 ----
NM_020443chr186265 5595 5212 2334 955 420 326 143 14648 1121 1111
NM_020466chr684317 4216 3388 1183 486 474 369 337 ----14751
NM_020699chr1135160 5118 4970 4877 4359 4177 3950 3690 3679 2063 1179 592 551 44562 4463 812 725 --11092
NM_020956chr19174744 4719 4571 4544 4172 4160 4007 3692 3548 3538 3370 3329 3239 3152 3056 935 884 34269 4095 114 24690 4388 13531
NM_021116chr7278209 8140 7738 7703 7569 6887 6716 6609 6394 6310 6279 6084 5934 5871 3299 2912 2842 2836 2782 2480 2171 1766 1699 1677 1632 1499 1298 31278 210 130 56451 6419 3147 1199 714 --
NM_021949chrX42156 2015 755 264 5588 561 549 540 528 1711 --
NM_022648chr2133582 3573 3540 3438 3116 3091 2920 1797 915 853 846 731 52 33217 167 93 44025 3600 3526 3476 --
NM_022719chr22123458 3161 3054 2924 2807 2506 1223 1083 1070 904 770 124 21178 916 --11247
NM_024046chr381134 981 926 851 501 150 29 21 --2309 41 --
NM_024770chr294890 4263 2102 1983 1964 1955 1294 818 715 1833 56264 5794 2122 2090 1059 --
NM_024963chr7235531 5221 5083 5052 5006 4800 4780 4663 4633 3778 2357 2341 2171 1766 1478 1283 1124 1104 988 959 222 95 51 11266 75416 5190 4768 2376 2165 1732 1092 25204 5066
NM_030806chr1138525 7786 7122 6852 6742 6679 6655 3355 2673 1444 1379 610 27 38864 5744 2666 --13228
NM_030918chr1114944 4716 4661 4331 4300 4205 4160 3954 3942 3329 213 24913 1545 44773 4519 1747 411 --
NM_031427chr14105885 5641 4321 4204 4173 1711 1595 1564 1268 1224 14672 44341 4309 1731 1699 --
NM_031468chr7187587 6949 6503 6446 5533 5438 2741 2639 2564 2552 2423 2115 1899 1808 935 917 483 418 47744 6378 5409 2432 11206 --
NM_032932chr17206326 5705 5023 5007 4557 4526 4378 4301 3918 3901 2409 2324 1677 1111 1087 823 796 449 288 151 31408 862 267 16261 14153
NM_033387chr952303 2248 604 376 350 2898 364 32645 1942 1889 1358
NM_052906chr22184797 4741 4651 4479 4090 3713 3703 3424 3309 3241 2036 1923 1830 1467 1157 818 516 109 31906 1050 321 64638 3767 3631 3228 3107 1896 --
NM_053016chr997691 7672 6015 5636 3204 3198 3178 3165 3057 --26814 6798 26780 6637
NM_080491chr11133857 3568 3479 3458 3126 1510 1259 1062 974 900 518 260 166 --32672 2634 28 --
NM_080669chr17134441 3825 3511 3303 3040 1915 1758 1685 1266 1168 722 480 257 33772 1621 1036 24716 1450 34455 3435 3241
NM_130446chr372775 1607 730 591 560 410 116 23436 2689 2698 209 23284 712
NM_133170chr20157704 6231 6170 5410 5252 2219 2157 1993 1383 954 720 487 392 365 87 ------
NM_138338chr22143410 3354 2980 2793 2677 2282 1271 1063 1054 980 804 661 390 129 --43121 2388 1204 869 21246 758
NM_138959chr1145699 4825 4815 4554 4332 2479 2192 1387 1373 927 879 492 381 172 11733 16465 --
NM_144973chr12104946 4653 4357 3865 3357 1807 1702 1673 650 95 1996 11795 13340
NM_148955chr15196013 5511 5504 4963 4780 4742 4484 4385 4289 4229 4189 4089 4054 1729 1399 1101 1047 986 688 35548 5496 5325 36293 4640 1020 --
NM_152348chr176830 683 624 582 575 95 ----2590 266
NM_152470chr18143394 2914 2685 2560 2545 1417 1295 958 774 766 673 270 229 166 21205 179 33175 3001 680 --
NM_152529chr2123562 3245 3128 3099 1423 1264 1233 1055 557 537 419 388 12798 23233 525 --
NM_152826chr15196013 5511 5504 4963 4780 4742 4484 4385 4289 4229 4189 4089 4054 1729 1399 1101 1047 986 688 35548 5496 5325 36293 4640 1020 --
NM_152854chr206602 314 179 151 85 31 ----1120
NM_173582chr11105282 5167 5136 1840 1660 1629 1442 1423 1307 1278 14823 35302 5270 1411 11643
NM_173595chr12204715 4658 4577 4518 4434 4285 4083 3992 3761 3575 1726 1612 1473 1325 1111 980 794 516 179 111 44456 4061 1240 540 13893 --
NM_173642chr1138615 8000 7185 6423 6352 5761 3483 2872 2860 2776 2259 2194 944 23572 3490 12747 --
NM_175624chr12106752 5417 5405 5271 2858 2388 2264 2224 1771 33 57201 6052 2872 2371 2358 25437 3028 --
NM_175625chr12106752 5417 5405 5271 2858 2388 2264 2224 1771 33 57201 6052 2872 2371 2358 25437 3028 --
NM_182515chr1996704 4732 4617 4079 1001 980 865 50 30 --44752 4720 4207 4175 --
NM_182970chr20174229 4137 4044 3924 3747 3707 3589 3074 2617 1647 1439 1270 1195 1094 983 500 75 43037 1217 848 663 21494 974 192
NM_194286chr12155590 4003 2463 2372 1865 1848 1709 1354 1157 781 633 626 617 182 153 --35732 2416 376 --
NM_198098chr7101723 1716 721 485 305 255 58 44 38 32 1456 1471 --
NM_198320chr12143772 3760 3652 3621 1493 1473 1461 1354 1323 831 591 483 451 413 24584 4577 1579 --
NM_198549chr183240 3124 3093 3056 1144 979 832 635 21158 114 33260 967 667 1649
NM_199044chr162756 2736 2393 2221 660 312 --12362 22627 2376
NM_199462chr1184647 4488 4323 4304 4188 3939 3931 3416 1922 1910 1560 1194 1069 899 879 733 632 291 13099 34292 1942 867 13581
NM_201432chr17136132 6057 5721 5574 5174 4603 2290 1447 1414 758 567 403 38 25553 578 15708 15910
NM_201433chr17136132 6057 5721 5574 5174 4603 2290 1447 1414 758 567 403 38 25553 578 15708 15910
NM_207380chr15113205 3138 3103 2918 2708 2618 2388 1180 1171 1118 474 33158 612 538 11068 23151 2693