TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-660-5p
miRNA Sequence: UACCCAUUGCAUAUCGGAGUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_004956chr753699 1581 286 243 190 --1236 1623
NM_022166chr16145401 4613 4225 4067 3853 2517 2016 1846 1451 1366 1199 905 736 552 15576 1112 --
NM_032826chr795467 5328 4332 4253 1993 1192 1182 797 605 11373 --15385
NM_207306chr1194590 4315 3759 2933 1564 1411 1308 1272 1236 1200 1164 1128 1056 1020 772 736 556 520 484 ----11609