TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-663b
miRNA Sequence: GGUGGCCCGGCCGUGCCUGAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832029 1790 1633 --22091 115 12106
NM_000038chr5--1583 ----
NM_000068chr196501 439 301 275 216 207 199 161 1290
NM_000080chr173860 727 183 1171 ----
NM_000081chr111398 ------
NM_000084chrX35573 4693 1563 35026 4472 2798 26259 5185 --
NM_000092chr233022 1112 51 14056 ----
NM_000104chr22372 184 ------
NM_000125chr643312 3299 1051 138 ------
NM_000127chr8147 ------
NM_000138chr1541861 1691 870 280 --1964 --
NM_000176chr543264 2986 2792 160 ------
NM_000194chrX186 ------
NM_000216chrX32479 1621 60 ------
NM_000217chr1211861 13504 24590 2009 --
NM_000222chr42526 284 --122 --
NM_000232chr421282 1091 11258 ----
NM_000240chrX----189 --
NM_000245chr741976 405 201 75 11553 ----
NM_000248chr322513 2267 ------
NM_000259chr1524620 4224 14698 14867 --
NM_000262chr2221572 492 --11341 1465
NM_000288chr61267 ------
NM_000289chr121392 ------
NM_000297chr411811 ------
NM_000330chrX72006 1672 907 749 205 92 52 --1846 --
NM_000332chr655619 4663 4572 1668 474 ------
NM_000334chr1731718 681 625 1140 1402 --
NM_000337chr532154 1974 609 --22089 1335 16021
NM_000340chr311197 ------
NM_000361chr203703 587 340 ------
NM_000368chr953285 1078 1044 881 254 ------
NM_000408chr213105 ------
NM_000430chr1723401 2669 2496 249 ----
NM_000444chrX1251 1311 ----
NM_000449chr11270 --1498 --
NM_000480chr1121126 302 --1461 --
NM_000489chrX12771 --12955 --
NM_000555chrX67691 7218 6748 2450 1595 87 13095 1185 --
NM_000618chr1216382 --12341 --
NM_000618chr1216382 --12341 --
NM_000621chr131940 ------
NM_000633chr1855163 3258 1997 1313 943 ----11411
NM_000682chr251762 1594 1554 677 380 --149 --
NM_000686chrX2580 36 ------
NM_000719chr12116624 6086 5946 5679 5461 4345 2420 2097 1314 534 278 --25743 599 --
NM_000722chr7185 ------
NM_000792chr1--2995 168 ----
NM_000793chr1434420 1249 473 13493 14274 1773
NM_000813chr512008 ------
NM_000816chr51653 ------
NM_000818chr101196 ------
NM_000829chr111876 --11682 --
NM_000831chr1135904 5084 5001 4383 4205 3954 2431 1860 1523 1302 1113 668 125 22509 752 26079 3833 14064
NM_000841chr63221 204 63 ----171
NM_000855chr11----156 --
NM_000870chr53479 360 50 ------
NM_000873chr17237 22 ------
NM_000875chr1586441 6246 6050 4928 4773 2777 895 465 1742 21571 545 --
NM_000891chr1721464 100 1114 ----
NM_000924chr123912 340 241 ------
NM_000926chr111887 27809 2363 ----
NM_000944chr421903 129 ------
NM_000950chrX12454 ------
NM_001001395chr1212458 ------
NM_001001433chr2052616 2137 1163 961 648 --22897 975 --
NM_001001436chr16----1105 --
NM_001001479chr221831 167 ----
NM_001001481chr812734 ------
NM_001001484chr10--22317 777 ----
NM_001001521chr2136 ------
NM_001001557chr83526 230 43 ------
NM_001001664chr233374 1319 820 11189 ----
NM_001001890chr213725 125 112 23955 1570 34162 1046 37 --
NM_001001994chrX1552 ------
NM_001001996chrX1552 ------
NM_001002032chr17----190 --
NM_001002233chr8162 ------
NM_001002843chr15--1117 ----
NM_001002860chr1434078 2855 1772 11159 ----
NM_001002909chr1731820 1789 29 ------
NM_001003712chr1233947 3812 2873 ------
NM_001003845chr2----1565 --
NM_001003940chr1573664 3420 3330 2810 961 944 444 1461 22967 1453 --
NM_001003942chr1573664 3420 3330 2810 961 944 444 1461 22967 1453 --
NM_001003943chr1573668 3424 3334 2814 965 948 448 1465 22971 1457 --
NM_001004023chr12193 166 ------
NM_001004304chr1232393 1146 855 ------
NM_001004317chr621443 734 ----11391
NM_001004360chr22549 339 ------
NM_001004419chr1234284 905 775 ------
NM_001005353chr11198 11251 ----
NM_001005353chr11198 11251 ----
NM_001005375chrY------11441
NM_001005404chr1734378 2877 1022 ------
NM_001005463chr103803 486 314 12279 ----
NM_001005473chr535436 4094 1697 16557 ----
NM_001005739chr2--1760 ----
NM_001005743chr141384 ------
NM_001005744chr141384 ------
NM_001005745chr141384 ------
NM_001005782chr21250 1962 ----
NM_001005920chr163416 393 250 130 1409 --
NM_001006600chr5--1248 ----
NM_001006605chr12857 849 ------
NM_001006605chr12857 849 ------
NM_001006617chr941247 1130 240 55 11051 ----
NM_001006619chr941247 1130 240 55 11051 ----
NM_001006620chr941247 1130 240 55 11051 ----
NM_001006621chr941247 1130 240 55 11051 ----
NM_001006624chr131872 790 675 11984 ----
NM_001006935chrX128 ------
NM_001006936chrX128 ------
NM_001006937chrX128 ------
NM_001006944chr113668 582 545 ------
NM_001007023chr1434420 1249 473 13493 14274 1773
NM_001007102chr611532 ------
NM_001007237chr152471 1777 1049 787 30 ------
NM_001007257chr1--1444 ----
NM_001007277chr114999 936 119 109 ------
NM_001007553chr111077 11024 ----
NM_001008222chrX4507 489 350 43 --1331 --
NM_001008239chr1833492 2932 2521 1880 --12779
NM_001008541chr104836 795 143 46 1730 ----
NM_001008541chr104836 795 143 46 1730 ----
NM_001008701chr1932432 2075 1005 2751 549 21104 105 --
NM_001008707chr142133 67 1320 11536 --
NM_001008711chr831163 137 28 ------
NM_001008738chr5----11788 --
NM_001008938chr11----1408 --
NM_001009555chr411169 11363 ----
NM_001009993chr274171 2981 2969 1684 1532 1366 1157 14222 13517 --
NM_001010854chr14--1740 --1129
NM_001010861chr121835 383 ------
NM_001010888chrX23983 1087 ----2920 222
NM_001010924chr101894 ------
NM_001010934chr721021 767 --122 --
NM_001011537chr3--12089 ----
NM_001011708chr212367 ------
NM_001012410chr31337 ------
NM_001012642chr1551817 623 434 379 360 1794 12031 --
NM_001012755chrX23275 1115 21017 456 ----
NM_001012974chr62103 72 ------
NM_001012977chrX11006 ----11084
NM_001013031chr1032717 2543 1168 2554 524 ----
NM_001013635chr121119 1839 --1813
NM_001013693chr152347 2262 2075 1189 773 --1135 --
NM_001013693chr152347 2262 2075 1189 773 --1135 --
NM_001014283chr13--11705 ----
NM_001014435chr163467 136 25 ------
NM_001014442chr13----161 --
NM_001014797chr1057623 7501 7087 1237 537 26652 2279 45223 2973 2145 1673 36818 6695 5334
NM_001015045chr41697 --1454 --
NM_001015877chrX12986 ------
NM_001015880chr1021101 1048 11487 ----
NM_001015887chr31151 21627 1346 ----
NM_001017371chr211342 ------
NM_001017926chr81382 ------
NM_001017928chr3151 ------
NM_001018025chrX1152 ------
NM_001018050chr22103270 2983 2863 2583 2417 1339 1194 873 539 487 33477 3198 569 11131 --
NM_001018052chr22103270 2983 2863 2583 2417 1339 1194 873 539 487 33477 3198 569 11131 --
NM_001018054chr12310 272 ------
NM_001018067chr145093 4037 3752 948 13686 ----
NM_001018068chr145093 4037 3752 948 13686 ----
NM_001018069chr145093 4037 3752 948 13686 ----
NM_001018074chr543264 2986 2792 160 ------
NM_001018075chr543264 2986 2792 160 ------
NM_001018076chr543264 2986 2792 160 ------
NM_001018077chr543264 2986 2792 160 ------
NM_001020825chr52461 267 ------
NM_001024094chr543264 2986 2792 160 ------
NM_001024226chr12339 107 ------
NM_001024227chr12339 107 ------
NM_001024228chr12339 107 ------
NM_001024401chr1642202 1838 1056 255 12317 1173 22613 346
NM_001024455chrX51061 456 307 258 21 --1196 --
NM_001024649chr532370 1053 766 ------
NM_001024808chr1242267 2233 1018 934 22576 2043 ----
NM_001024858chr1472932 2374 2065 1193 560 175 117 --2668 438 --
NM_001024959chr32594 234 2657 190 2694 665 --
NM_001024960chr32594 234 2657 190 2694 665 --
NM_001025076chr1055135 4957 2459 561 400 ------
NM_001025077chr1046493 6315 1919 1758 --1197 --
NM_001025079chr334002 2984 507 ------
NM_001025081chr184378 289 147 141 11506 1621 --
NM_001025090chr184378 289 147 141 11506 1621 --
NM_001025092chr184378 289 147 141 11506 1621 --
NM_001025101chr184378 289 147 141 11506 1621 --
NM_001025266chr364611 4262 1675 1519 843 557 ------
NM_001025389chr1121126 302 --1461 --
NM_001025390chr1121126 302 --1461 --
NM_001025580chrX11724 1813 ----
NM_001025603chr11270 --1498 --
NM_001025616chr4188 ------
NM_001029858chr631089 690 42 ------
NM_001029863chr622711 704 --1591 --
NM_001030001chr142169 25 ------
NM_001030007chr162850 219 --13179 --
NM_001030019chr7122 ------
NM_001030055chr142502 493 ------
NM_001031685chr1--1215 ----
NM_001031690chr711094 13113 145 --
NM_001031711chr511548 11143 --1719
NM_001031717chr34198 134 124 64 ------
NM_001031732chr423033 2832 ----13241
NM_001031740chr14674 481 220 108 157 ----
NM_001031812chr511856 ------
NM_001032280chr6--11260 ----
NM_001032296chr1342952 2680 2581 206 1549 12410 --
NM_001032380chr10--21365 413 ----
NM_001033044chr12745 174 ------
NM_001033045chr244408 3058 1192 916 ------
NM_001033047chr42115 107 --11633 --
NM_001033049chr2131579 833 431 12031 22068 894 --
NM_001033056chr12745 174 ------
NM_001033087chr2012134 1368 --22786 293
NM_001033117chr344457 3680 1626 1243 24450 3007 11552 --
NM_001033507chr111677 --21653 64 --
NM_001033551chr17154009 3750 3468 3451 3104 3010 2897 1556 1358 1236 1217 1111 739 695 71 --13895 1899
NM_001033925chr1011822 11724 ----
NM_001033953chr11--127 ----
NM_001034841chr1655505 3774 3483 1877 518 1822 23509 3361 --
NM_001035chr111088 1408 ----
NM_001035003chr4--11253 ----
NM_001035004chr4--11253 ----
NM_001035254chr952008 975 764 491 435 12036 ----
NM_001035511chr151591 453 366 272 200 ------
NM_001035512chr151698 560 473 379 307 ------
NM_001035513chr151698 560 473 379 307 ------
NM_001037132chr7----12079 --
NM_001037133chr7----12079 --
NM_001037164chr721567 754 ------
NM_001037317chr121835 383 ------
NM_001037872chr21654 ------
NM_001038707chr132160 1841 203 1181 ----
NM_001038707chr132160 1841 203 1181 ----
NM_001039459chr71221 ------
NM_001039465chr141460 ------
NM_001039538chr222889 803 --12817 --
NM_001039577chr154273 3701 2893 822 662 13064 14120 34461 3996 655
NM_001039580chr414205 --15071 --
NM_001039618chr1123638 1169 11401 ----
NM_001039715chr1--2995 168 ----
NM_001039716chr1--21059 232 ----
NM_001039762chr1021685 750 ------
NM_001039770chr321755 883 2241 127 --11589
NM_001039840chrX1370 1727 ----
NM_001039888chr12706 297 ------
NM_001039916chr122929 326 ------
NM_001039917chr122929 326 ------
NM_001039918chr122929 326 ------
NM_001039919chr122929 326 ------
NM_001039920chr122929 326 ------
NM_001039960chr122282 31 ----11583
NM_001040057chr71603 ----1166
NM_001040100chr31410 --1834 --
NM_001040110chr72642 513 21192 585 ----
NM_001040142chr21262 ------
NM_001040143chr21262 ------
NM_001040152chr764180 3511 1254 1238 731 23 --11299 14291
NM_001040172chr53479 360 50 ------
NM_001040173chr53479 360 50 ------
NM_001040214chr62451 333 ------
NM_001040272chr922121 917 136 11544 --
NM_001040284chr1645074 3839 995 262 ------
NM_001040402chr412421 --11134 --
NM_001040429chr131430 ------
NM_001040431chr171393 ------
NM_001040441chr125007 153 ------
NM_001040446chr531940 1102 639 --1984 --
NM_001040458chr521796 173 ------
NM_001040624chr821871 1018 ------
NM_001040625chr821871 1018 ------
NM_001040626chr821871 1018 ------
NM_001040627chr821871 1018 ------
NM_001040628chr821871 1018 ------
NM_001040629chr821871 1018 ------
NM_001040630chr821871 1018 ------
NM_001040653chr322148 33 2936 887 ----
NM_001040661chr721096 891 --1775 1317
NM_001040708chr811057 ------
NM_001040709chr162255 2219 2201 2180 1011 989 ------
NM_001040712chr922431 2270 13303 ----
NM_001042404chr111707 ------
NM_001042425chr6--11260 ----
NM_001042453chrX11358 ------
NM_001042481chr14--11839 ----
NM_001042498chrX1134 ------
NM_001042510chr8------1118
NM_001042511chr8------1118
NM_001042555chr1224517 726 ------
NM_001042599chr255085 4979 2703 1494 787 ----12504
NM_001042601chr32714 637 ------
NM_001042632chr2042080 1885 679 327 --1200 --
NM_001042633chr2042080 1885 679 327 --1200 --
NM_001042669chr4188 ------
NM_001042749chrX11261 ------
NM_001042750chrX11261 ------
NM_001042751chrX11261 ------
NM_001043318chr1481369 1158 1127 1080 1057 391 259 184 ------
NM_001044722chr511856 ------
NM_001044723chr511856 ------
NM_001049chr1432299 236 139 --3906 484 35 --
NM_001071775chr13--11715 ----
NM_001079874chr131516 867 798 ------
NM_001092chr1722139 912 ------
NM_001095chr121444 1637 ----
NM_001096chr17----1604 --
NM_001099678chr346242 4735 4161 3976 1908 --23912 1871
NM_001106chr399217 3539 3161 2954 2279 1832 1793 1679 724 --17986 --
NM_001113490chrX13327 ------
NM_001116chr1652856 1009 947 295 222 11984 22324 1019 --
NM_001122631chr11----1506 --
NM_001128chr162850 219 --13179 --
NM_001148chr43887 782 428 ------
NM_001173chr142502 493 ------
NM_001174chrX1878 21845 522 1237 1705
NM_001177chr1232205 1929 728 ------
NM_001198chr62863 471 31845 877 194 ----
NM_001204chr232809 2303 1055 37085 6548 529 --15085
NM_001219chr71703 ----1529
NM_001231chr11471 ------
NM_001238chr191206 ------
NM_001241chr212352 ------
NM_001241chr212352 ------
NM_001259chr735849 4418 2218 ----32065 1478 1288
NM_001260chr13----185 --
NM_001271chr1543299 3058 2700 359 --1189 --
NM_001288chr61179 ------
NM_001290chr4--1342 ----
NM_001292chr152931 454 1138 1964 --
NM_001356chrX2411 21 1156 ----
NM_001364chr111175 11878 ----
NM_001386chr842034 663 459 453 ------
NM_001396chr2122301 1008 21054 714 ----
NM_001404chr11156 ------
NM_001406chr1741567 1444 644 204 ------
NM_001408chr151279 1212 559 237 180 ------
NM_001412chrX13132 ------
NM_001419chr1963915 3691 3380 3061 1436 592 --34046 600 581 --
NM_001420chr1973125 2902 2842 2684 2394 1051 768 --1939 1786
NM_001427chr731372 576 70 ------
NM_001428chr1128 2301 40 ----
NM_001430chr241625 1250 593 142 ------
NM_001433chr175906 886 864 839 55 --1751 --
NM_001448chrX21385 128 11392 ----
NM_001478chr122738 654 ------
NM_001494chr101635 ------
NM_001498chr61118 144 ----
NM_001518chr73894 886 723 ------
NM_001527chr624824 3229 13413 ----
NM_001530chr14--1100 ----
NM_001542chr152471 1777 1049 787 30 ------
NM_001552chr1731083 768 741 1911 ----
NM_001563chr6191 ------
NM_001584chr111238 ------
NM_001616chr21735 ------
NM_001658chr12339 107 ------
NM_001663chr14--11772 ----
NM_001664chr31810 1761 ----
NM_001678chr1751283 1259 469 248 238 ------
NM_001695chr821605 695 ------
NM_001699chr19--11841 11763 --
NM_001701chr921400 1184 ------
NM_001704chr61375 ------
NM_001746chr532370 1053 766 ------
NM_001754chr213725 125 112 23955 1570 34162 1046 37 --
NM_001755chr1611720 22272 1409 ----
NM_001759chr1244617 3827 3537 1563 --14874 24129 778
NM_001760chr64792 689 265 28 --147 --
NM_001777chr334002 2984 507 ------
NM_001796chr16----156 --
NM_001845chr13----11094 --
NM_001854chr111547 ------
NM_001878chr1143 --1131 --
NM_001895chr201862 1966 ----
NM_001923chr11189 ------
NM_001927chr22203 139 1186 --1545
NM_001939chrX42377 1098 1042 295 33704 3691 1080 12474 --
NM_001945chr511161 ------
NM_001955chr6--11017 ----
NM_001987chr1234281 1135 29 --1801 --
NM_002009chr1522446 1105 ------
NM_002015chr1313102 ------
NM_002017chr111207 1925 ----
NM_002024chrX--1162 ----
NM_002025chrX48807 8584 3712 66 --12876 --
NM_002028chr1421299 1258 --11162 --
NM_002063chrX2326 120 11162 ----
NM_002065chr12745 174 ------
NM_002071chr181141 ------
NM_002072chr9143 --1964 --
NM_002074chr11670 --1239 --
NM_002086chr171314 --31581 471 120 --
NM_002092chr425073 1838 ------
NM_002093chr3171 ------
NM_002107chr11109 ------
NM_002126chr1743213 2988 2882 2856 13073 ----
NM_002130chr51272 ------
NM_002139chrX1557 ------
NM_002140chr91357 ------
NM_002146chr171368 ------
NM_002147chr172787 578 ------
NM_002148chr21166 ------
NM_002165chr202284 124 ------
NM_002193chr231624 771 386 ------
NM_002199chr4----1233 --
NM_002205chr123621 349 147 --1789 --
NM_002210chr223463 1029 ------
NM_002241chr122072 445 ------
NM_002250chr192221 28 ------
NM_002254chr21257 --12011 --
NM_002264chr354983 4439 4381 1456 42 ------
NM_002265chr171241 ------
NM_002267chr13158 11987 ----
NM_002268chr3--1304 --1297
NM_002270chr513835 --15584 --
NM_002271chr131116 ------
NM_002293chr12617 420 32354 2256 57 ----
NM_002332chr122543 498 ----1675
NM_002356chr61393 ----1427
NM_002359chr1733653 3335 1586 42722 1580 1435 403 2264 38 --
NM_002372chr5196 ------
NM_002373chr152142 59 ------
NM_002374chr222889 803 --12817 --
NM_002380chr8--1368 ----
NM_002383chr164840 689 657 579 ------
NM_002385chr184378 289 147 141 11506 1621 --
NM_002387chr541958 1180 169 54 1548 13793 --
NM_002397chr53610 484 455 ------
NM_002427chr1121143 796 ------
NM_002499chr1551987 1976 1756 256 165 11897 ----
NM_002501chr1983779 3708 3504 2963 1241 1023 681 510 ------
NM_002515chr1451426 1342 1296 648 388 ------
NM_002522chr1753831 3335 2561 2408 721 11051 23290 1060 --
NM_002527chr121280 ------
NM_002536chrX41163 245 181 61 --21562 595 --
NM_002569chr1561173 1077 613 430 197 156 1339 ----
NM_002576chr111204 1932 ----
NM_002577chr314062 --1267 --
NM_002588chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_002590chr13136 ------
NM_002599chr1151047 1037 1023 744 33 1983 ----
NM_002601chr2--1347 ----
NM_002607chr711112 1407 ----
NM_002613chr1665284 4802 4311 4040 865 62 --35180 4518 1286 21778 491
NM_002628chr3--159 ----
NM_002632chr141727 --1824 --
NM_002633chr1--1496 ----
NM_002651chr12853 357 ------
NM_002655chr831748 1551 863 ----14462
NM_002657chr2043453 2773 1322 459 1793 ----
NM_002660chr2041149 799 407 291 ------
NM_002687chr1411040 ------
NM_002698chr1962892 2661 1164 1158 821 301 ----1767
NM_002703chr431580 1450 275 164 ----
NM_002717chr81587 ------
NM_002731chr122214 356 ------
NM_002734chr17197 1404 ----
NM_002737chr1786532 5824 5549 5425 5177 5159 2504 88 25301 4636 --15016
NM_002745chr2244431 3451 735 436 ------
NM_002752chr51492 ------
NM_002755chr151227 ------
NM_002829chr92526 379 ------
NM_002834chr1222690 924 11338 11318 --
NM_002837chr1234402 414 365 13615 ----
NM_002839chr922431 2270 13303 ----
NM_002843chr1153076 2833 2575 2534 239 12524 12871 --
NM_002844chr611118 ------
NM_002858chr121272 388 ------
NM_002867chr11214 ------
NM_002868chr1221539 226 11794 ----
NM_002869chr1122014 542 ------
NM_002885chr1--2958 45 ----
NM_002892chr1411732 ------
NM_002941chr3----11149 --
NM_002945chr17--1703 ----
NM_002973chr121206 ------
NM_002994chr41642 ------
NM_003001chr151698 560 473 379 307 ------
NM_003010chr17----11981 --
NM_003012chr812509 --1215 183
NM_003034chr1237417 6790 5440 25005 1436 ----
NM_003045chr13124421 4309 1683 1140 1007 991 776 584 575 330 242 196 --1224 --
NM_003069chrX----127 --
NM_003099chr1566492 5352 4443 4218 1407 1320 24936 393 ----
NM_003106chr31781 ------
NM_003108chr266717 5270 2674 2471 2351 2280 16794 22822 2012 12319
NM_003111chr211342 ------
NM_003112chr71144 ------
NM_003131chr641827 1461 481 449 12242 21413 578 196
NM_003133chr11779 ------
NM_003140chrY--124 ----
NM_003150chr1722279 423 ------
NM_003155chr821061 467 ------
NM_003161chr1713143 ----11214
NM_003174chr10132 ------
NM_003183chr21654 ------
NM_003199chr1814503 ------
NM_003200chr1921699 65 ------
NM_003204chr172652 141 --1735 --
NM_003214chr631438 1258 327 ------
NM_003216chr22103296 2927 2802 1283 797 786 675 370 192 137 11180 11267 --
NM_003220chr6--11260 ----
NM_003236chr212738 --22942 372 --
NM_003239chr142373 367 --1329 --
NM_003257chr1511047 ------
NM_003274chr211348 1414 ----
NM_003281chr153624 1015 861 668 516 24058 1993 11820 14568
NM_003319chr21691 ------
NM_003320chr1133809 3784 892 2464 331 21480 1203 --
NM_003325chr222551 270 ----142
NM_003336chrX--131 ----
NM_003340chr411247 ------
NM_003341chr3171 ------
NM_003342chr1722422 1254 ------
NM_003352chr21250 1962 ----
NM_003369chr1142363 812 464 176 --1596 --
NM_003392chr324305 1073 ------
NM_003394chr122149 88 ------
NM_003404chr20--1192 ----
NM_003406chr831774 1530 300 11550 ----
NM_003410chrX12523 ------
NM_003412chr342085 896 296 266 22135 1228 ----
NM_003413chrX--1103 --1115
NM_003439chr712939 12871 ----
NM_003454chr162982 196 1268 ----
NM_003458chr353767 3719 2747 1198 1081 1683 ----
NM_003463chr622913 774 ------
NM_003468chr221204 76 --11608 --
NM_003469chr21137 ------
NM_003473chr101359 ------
NM_003474chr1022130 1553 --12141 --
NM_003490chr221799 ------
NM_003559chr1753520 3353 2695 318 83 13174 12586 12927
NM_003574chr182667 189 ------
NM_003575chr7126 ----21254 295
NM_003576chr1342952 2680 2581 206 1549 12410 --
NM_003582chr12193 166 ------
NM_003583chr121285 ----13368
NM_003590chr213783 ------
NM_003620chr171298 ------
NM_003635chr101504 ------
NM_003644chr1785470 4876 2626 2114 2095 1819 1410 989 11147 3964 314 103 --
NM_003673chr172118 84 ------
NM_003701chr132797 293 --1872 --
NM_003704chr41629 ------
NM_003713chr11310 ------
NM_003714chr552963 794 517 297 180 ----1362
NM_003718chr71465 ------
NM_003735chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_003736chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_003737chr112112 101 ------
NM_003743chr2--11547 ----
NM_003744chr141384 ------
NM_003749chr1322339 176 11723 ----
NM_003758chr1511515 ------
NM_003758chr1511515 ------
NM_003763chr2052616 2137 1163 961 648 --22897 975 --
NM_003766chr171458 ------
NM_003768chr141477 268 223 216 ------
NM_003872chr231119 1051 672 ----32776 2524 280
NM_003873chr1021551 676 ------
NM_003888chr1531189 467 144 --1201 --
NM_003913chr611624 1418 ----
NM_003924chr441482 1047 570 267 ------
NM_003927chr18--1918 ----
NM_003942chr113668 582 545 ------
NM_003947chr3----1177 --
NM_003949chr1741533 628 534 411 ----31486 810 498
NM_003957chr114815 261 215 22 ------
NM_003972chr10--11207 ----
NM_003983chr1674127 3662 3467 1521 644 179 132 11653 23728 1200 --
NM_004055chr1182077 2023 1948 1652 1578 1499 842 835 ----11489
NM_004074chr11----1170 --
NM_004080chr7----148 --
NM_004081chrY------11441
NM_004083chr12162 ----135
NM_004085chrX1175 ------
NM_004093chr1362712 2513 1021 455 391 292 ------
NM_004124chr141436 11063 ----
NM_004136chr1522486 440 1584 ----
NM_004183chr112708 700 ------
NM_004186chr34785 716 251 29 1911 1647 --
NM_004193chr10----1385 180
NM_004200chr1173047 2666 2645 2416 2409 379 28 ------
NM_004225chr811219 11413 ----
NM_004227chr762672 2492 2426 2409 793 267 12058 --12747
NM_004229chrX11703 ------
NM_004240chr191252 --152 --
NM_004272chr5--2338 251 ----
NM_004274chr1411178 ------
NM_004281chr101151 ------
NM_004296chr1473715 3139 1138 1017 870 520 103 21078 386 1885 13730
NM_004302chr1262334 2321 1051 925 827 342 ------
NM_004321chr273412 3306 2627 1332 740 570 252 2615 531 11312 --
NM_004323chr94610 593 329 110 --1249 11741
NM_004342chr7159 ------
NM_004364chr192200 30 1390 1820 --
NM_004376chr1021291 373 ------
NM_004379chr211603 154 --1417
NM_004384chr511856 ------
NM_004395chr55650 587 142 38 23 ------
NM_004397chr1122950 629 ------
NM_004414chr212215 74 --1387 --
NM_004420chr1182232 2153 2122 2012 1491 916 811 246 --11855 --
NM_004432chr9------1558
NM_004433chr11461 ------
NM_004434chr142133 67 1320 11536 --
NM_004438chr212276 ------
NM_004441chr3148 --1996 --
NM_004459chr172661 309 ------
NM_004494chr13261 181 72 ------
NM_004496chr1411051 1897 ----
NM_004499chr5--1209 ----
NM_004503chr121569 ------
NM_004504chr21749 144 ----
NM_004506chr61250 ------
NM_004520chr5----174 --
NM_004532chr3124 ------
NM_004535chr204457 188 157 118 21645 1289 --1696
NM_004575chr4--11224 ----
NM_004583chr171620 --193 --
NM_004586chrX33412 3368 1277 ------
NM_004588chr1152877 2625 2473 895 616 23561 982 33261 729 335 --
NM_004603chr721027 296 1437 3909 278 38 --
NM_004620chr111134 ------
NM_004631chr12310 272 ------
NM_004637chr31462 ------
NM_004655chr1711165 ------
NM_004670chr1021101 1048 11487 ----
NM_004685chr1312168 ------
NM_004687chr17--1286 ----
NM_004703chr173664 507 500 ------
NM_004723chr1155 1179 1152 --
NM_004742chr311381 ------
NM_004755chr141281 ------
NM_004759chr141898 1808 790 161 1510 21762 1642 --
NM_004768chr1--11125 ----
NM_004774chr1742278 2109 361 30 ------
NM_004776chr2032928 921 700 11142 12698 --
NM_004788chr1122015 943 ------
NM_004791chr13----144 --
NM_004796chr1411824 11752 ----
NM_004805chr221138 899 11172 --1265
NM_004815chr123779 3661 ----1187
NM_004822chr17113819 3577 2750 2573 1241 1231 1126 858 322 76 47 --33608 3570 560 43320 3299 1317 134
NM_004827chr42684 625 ------
NM_004831chr191389 ------
NM_004836chr21209 ------
NM_004840chrX1720 1390 ----
NM_004841chr11995 --1232 --
NM_004842chr6----11235 --
NM_004845chrX43863 3657 3441 2553 ------
NM_004860chr171176 ------
NM_004865chr6--1126 ----
NM_004866chr51134 ------
NM_004879chr112877 814 ------
NM_004898chr4--12019 ----
NM_004906chr61260 ------
NM_004925chr92227 191 --168 1604
NM_004926chr1411758 ------
NM_004947chr341898 1779 1586 656 1182 --1512
NM_004949chr1812058 --12148 --
NM_004959chr95956 538 215 138 22 ----165
NM_004978chr11462 1166 11173 --
NM_004985chr124957 765 659 576 13180 ----
NM_004992chrX138140 6522 6488 6343 5664 3389 3202 2901 2588 1873 825 783 230 13405 16430 --
NM_004992chrX138140 6522 6488 6343 5664 3389 3202 2901 2588 1873 825 783 230 13405 16430 --
NM_004993chr1411280 ------
NM_004995chr1441368 1190 975 361 11174 11352 11008
NM_005010chr7----12079 --
NM_005011chr72642 513 21192 585 ----
NM_005020chr71465 ------
NM_005022chr17----191 --
NM_005028chr1012043 --1156 --
NM_005032chrX2960 100 ------
NM_005045chr71872 1371 ----
NM_005056chr1241179 881 759 163 ------
NM_005065chr1433334 1223 93 ----14519
NM_005080chr221679 ------
NM_005095chr11388 ------
NM_005096chrX153 ------
NM_005098chr8--1189 158 --
NM_005099chr121069 407 ----1259
NM_005103chr11137 1282 ----
NM_005114chr4--1546 ----
NM_005116chr2084001 2906 1199 711 692 582 244 238 129 ----
NM_005121chr1753624 2822 942 922 157 ------
NM_005147chr163353 304 66 1188 ----
NM_005156chr911670 11822 ----
NM_005160chr2276718 6188 5442 4448 4298 2244 144 14849 ----
NM_005180chr10------1325
NM_005181chr81137 --1708 --
NM_005182chr163467 136 25 ------
NM_005188chr1166839 6827 6406 6172 5506 818 --35757 3251 661 --
NM_005197chr1455583 4092 2359 2044 603 14057 14225 --
NM_005206chr1741084 991 924 70 --1976 --
NM_005219chr531137 453 103 --11620 --
NM_005220chr1731371 1282 547 ------
NM_005229chrX2289 228 1503 137 --
NM_005230chr12161 ------
NM_005233chr322292 1816 1481 ----
NM_005235chr255085 4979 2703 1494 787 ----12504
NM_005241chr3----1111 --
NM_005249chr142695 684 ------
NM_005257chr182440 188 --1211 --
NM_005259chr21597 ------
NM_005261chr8150 ------
NM_005269chr121127 ------
NM_005277chr4--1525 157 --
NM_005278chrX1552 ------
NM_005279chr21125 ------
NM_005281chr12886 786 ----1868
NM_005302chr7122 ------
NM_005318chr2221107 920 ------
NM_005324chr1731832 1472 1347 ------
NM_005339chr4----1370 --
NM_005342chrX52449 2325 1968 626 181 11975 11008 --
NM_005347chr941642 1453 283 209 ------
NM_005376chr11751 ----1740
NM_005399chr131747 730 689 --11359 --
NM_005400chr23780 233 157 ------
NM_005426chr1--1215 ----
NM_005465chr121749 750 --21969 1726 --
NM_005475chr1252934 1169 939 770 313 ------
NM_005477chr1572477 1963 1773 902 680 485 181 --12382 --
NM_005477chr1572477 1963 1773 902 680 485 181 --12382 --
NM_005479chr1041424 1085 286 176 1346 11161 --
NM_005502chr921133 759 12265 ----
NM_005504chr1244873 1062 997 97 15485 11033 11005
NM_005507chr112465 459 ------
NM_005522chr711377 ----11170
NM_005525chr1--1323 --1125
NM_005527chr61397 ------
NM_005540chr121539 94 11037 ----
NM_005544chr21805 1299 ----
NM_005552chr141161 ------
NM_005566chr11--139 ----
NM_005574chr111474 1231 ----
NM_005576chr15--1248 ----
NM_005595chr1--1123 ----
NM_005596chr916213 15114 --16061
NM_005613chr112000 ------
NM_005614chr721045 125 ------
NM_005647chrX42999 1206 1193 1058 32625 2197 138 ----
NM_005655chr8--2185 174 ----
NM_005668chr511058 ------
NM_005670chr61373 ------
NM_005688chr321231 873 ------
NM_005704chr14792 198 135 41 11004 ----
NM_005718chr32594 234 2657 190 2694 665 --
NM_005731chr21407 ------
NM_005736chr1031347 1258 614 ----11466
NM_005737chr242635 698 631 399 1565 1293 --
NM_005738chr721567 754 ------
NM_005739chr1522126 2074 --12274 --
NM_005746chr712252 ------
NM_005748chr1212136 ----1912
NM_005751chr71359 ------
NM_005822chr631861 380 149 ------
NM_005828chr17114931 4232 4216 4092 4076 3521 3365 2015 1834 1276 962 24204 1384 --13537
NM_005840chrX47683 7025 2412 301 11252 17650 --
NM_005859chr521095 621 11308 ----
NM_005883chr1982629 2568 2228 2130 1859 821 781 223 ----12443
NM_005898chr112731 559 1943 ----
NM_005907chr621377 1198 ------
NM_005910chr1793253 3097 1133 1000 974 723 683 533 227 1270 11066 --
NM_005911chr211323 143 ----
NM_005920chr152772 1277 1227 804 681 1910 13653 --
NM_005933chr1143031 2685 1938 403 --146 --
NM_005938chrX31246 968 492 1128 ----
NM_005941chr884204 4161 3442 3124 3042 2638 877 665 ------
NM_005955chr175064 5006 4806 3445 1649 1617 77 ------
NM_005962chr104836 795 143 46 1730 ----
NM_005962chr104836 795 143 46 1730 ----
NM_006011chr15--21225 223 ----
NM_006034chr1152471 1830 1003 340 39 ----1715
NM_006037chr264834 4666 4116 3328 1962 863 13536 13368 --
NM_006038chr2031590 508 409 12040 --134
NM_006047chr2033346 3242 395 13469 ----
NM_006067chr1621012 718 ------
NM_006091chr1531560 1329 111 1616 11596 --
NM_006094chr812291 --12195 --
NM_006108chr1112335 --12324 --
NM_006113chr131516 867 798 ------
NM_006116chr2231011 269 214 1604 11605 --
NM_006133chr116748 659 643 448 380 331 --1666 1272
NM_006136chr71389 ------
NM_006139chr22792 96 --1117 --
NM_006145chr19------2992 717
NM_006153chr31518 ------
NM_006156chr141184 ------
NM_006166chr1212425 ------
NM_006186chr21355 ------
NM_006190chr211029 ------
NM_006201chrX11066 ------
NM_006203chr5--186 --15107
NM_006206chr421183 612 1270 139 --
NM_006224chr1732349 1894 84 ----12267
NM_006237chr1332284 1886 812 ------
NM_006243chr1--1177 ----
NM_006245chr62891 645 ----2710 28
NM_006247chr193428 377 66 ------
NM_006251chr513091 ------
NM_006256chr121104 250 ------
NM_006258chr101422 1512 1103 --
NM_006275chr201514 ------
NM_006277chr21276 ------
NM_006279chr13908 669 217 122 ----
NM_006281chr821127 476 ------
NM_006281chr821127 476 ------
NM_006293chr152235 48 --127 --
NM_006306chrX45686 5404 2232 927 35039 3613 748 1239 11263
NM_006321chr32749 199 ----1606
NM_006328chr111410 ------
NM_006336chr931048 280 22 11004 1565 --
NM_006338chr13418 130 72 --1204 --
NM_006351chr19137 ------
NM_006372chr61489 ------
NM_006373chr1741256 416 233 68 --11218 --
NM_006390chr1231219 713 67 ------
NM_006416chr6--1310 ----
NM_006451chr5----1834 --
NM_006464chr254510 4185 3043 1485 783 ------
NM_006465chr151639 22024 1924 2886 410 --
NM_006474chr131872 790 675 11984 ----
NM_006482chr121285 ----13368
NM_006489chr1451426 1342 1296 648 388 ------
NM_006494chr192201 194 --2855 277 1609
NM_006496chr11580 ------
NM_006504chr1022551 134 ------
NM_006520chrX21249 21 ------
NM_006521chrX31341 1206 1061 ------
NM_006534chr2021107 364 11031 ----
NM_006544chr1445292 3775 1716 1177 ------
NM_006559chr11958 1457 ----
NM_006561chr1055135 4957 2459 561 400 ------
NM_006572chr17--1797 ----
NM_006575chr1421128 435 ------
NM_006599chr1686370 3205 2260 2220 1880 1578 1215 943 ------
NM_006603chrX11261 ------
NM_006621chr111456 ------
NM_006624chr101547 1496 11405 --
NM_006626chr912075 ------
NM_006628chr1534543 4077 3302 1451 ----
NM_006654chr1224517 726 ------
NM_006690chr2042154 821 310 96 2869 495 11880 1618
NM_006696chr51194 ----1118
NM_006699chr111805 1255 ----
NM_006700chr121134 ------
NM_006703chr61458 ------
NM_006717chr922075 779 ------
NM_006722chr322513 2267 ------
NM_006726chr41851 ------
NM_006729chrX25646 448 ------
NM_006734chr611283 11152 ----
NM_006756chr821207 1061 ------
NM_006759chr2136 ------
NM_006762chr151225 1121 954 286 185 ------
NM_006763chr131541 1518 58 ------
NM_006769chr11214 ------
NM_006772chr621349 1168 --1623 --
NM_006788chr1841327 865 410 71 1626 ----
NM_006805chr5166 1426 ----
NM_006826chr2----11242 --
NM_006832chr141930 135 1224 --
NM_006852chr172391 246 ------
NM_006854chr711897 ------
NM_006875chrX2726 55 ------
NM_006902chr1129 ------
NM_006912chr12553 464 ------
NM_006924chr1723074 106 ------
NM_006925chr141460 ------
NM_006940chr1211353 ----11498
NM_006948chr2112106 ------
NM_006950chrX1234 ------
NM_006981chr91786 ------
NM_006990chr152506 1855 1774 492 118 1922 --12037
NM_006999chr541955 1384 621 61 ------
NM_007007chr1234775 793 281 ------
NM_007008chr2171 ------
NM_007011chr1536176 5253 2743 35264 4608 2167 --11672
NM_007017chr51318 ------
NM_007023chr21233 1809 ----
NM_007034chr11144 ------
NM_007038chr2135128 4500 1737 ------
NM_007042chr352269 2215 1648 426 281 ------
NM_007050chr20117022 6859 6778 6702 6525 5497 4946 3100 3076 2327 1195 27191 549 37326 2514 454 --
NM_007067chr1741034 573 377 120 ------
NM_007073chr641582 1396 1238 144 ------
NM_007125chrY1487 ------
NM_007126chr91547 ----1415
NM_007137chrX43774 3752 3433 805 ------
NM_007146chr17--22919 2061 12494 --
NM_007158chr111077 11024 ----
NM_007159chr31134 ------
NM_007167chr1--1834 ----
NM_007174chr1221922 759 ------
NM_007189chr721313 23 ----191
NM_007192chr14--1876 1135 --
NM_007212chr121997 1431 ------
NM_007216chr11--1393 1128 --
NM_007222chr81382 ------
NM_007238chr2084528 3831 3232 1972 1480 1311 283 253 1733 24041 3733 11745
NM_007249chr1338495 1282 342 ------
NM_007260chr1------1270
NM_007275chr31730 1365 --1100
NM_007284chr32341 23 1328 2364 149 --
NM_007350chr1214402 ----1770
NM_007353chr753019 2951 1951 1006 554 12457 ----
NM_007363chrX--1683 ----
NM_012074chr1421132 1009 ------
NM_012081chr512700 13535 ----
NM_012083chr103888 878 33 --1247 --
NM_012098chr951406 1312 1227 55 32 21127 65 11256 --
NM_012104chr1153501 3158 2782 1491 243 165 12750 --
NM_012104chr1153501 3158 2782 1491 243 165 12750 --
NM_012164chr946301 4674 628 153 11602 ----
NM_012166chr921293 24 --21361 1115 --
NM_012197chr91139 ------
NM_012199chr123088 165 --13535 --
NM_012218chr1922375 478 --32456 629 149 --
NM_012238chr1011467 11511 ----
NM_012244chr1431610 434 21 1379 --1299
NM_012249chr222762 791 11305 --1507
NM_012279chr551371 1335 347 157 33 ----1132
NM_012287chr343852 887 265 228 --13650 --
NM_012288chr661113 995 718 518 237 41 --11089 --
NM_012296chr11133874 3700 3631 2902 1547 1328 1164 837 820 653 532 405 236 --1413 --
NM_012300chr5261 53 ------
NM_012301chr7--11517 ----
NM_012302chr1------130
NM_012309chr1133779 1449 638 --23970 3875 23195 1468
NM_012325chr2021048 495 ----1278
NM_012333chr111121 ------
NM_012334chr544715 4450 3678 1281 13019 ----
NM_012384chr2042249 1690 402 313 181 22408 106 1653
NM_012396chr12692 191 ------
NM_012398chr194954 802 721 611 11884 12382 1885
NM_012399chr22--11417 ----
NM_012405chr143258 1380 1291 74 23103 294 23669 2793 --
NM_012412chr7------1691
NM_012414chr11747 ------
NM_012416chr911177 ------
NM_012419chr62432 111 ------
NM_012421chr11347 ------
NM_012470chr71176 ------
NM_012471chrX31688 619 504 ----11976
NM_012482chr11604 ------
NM_013230chrY--31583 1543 404 ----
NM_013231chr1454035 3883 3559 1657 1470 --13123 --
NM_013261chr413355 --13131 --
NM_013269chr1234211 832 702 ------
NM_013272chr15144 ------
NM_013279chr1152089 1894 764 756 251 --11957 --
NM_013281chr201404 ------
NM_013286chr323368 1398 13769 1438 --
NM_013312chr191108 ------
NM_013316chr71165 --1875 --
NM_013341chr212367 ------
NM_013377chr121566 ------
NM_013386chr12156 139 1216 ----
NM_013392chr2----1398 --
NM_013396chr211433 ------
NM_013410chr11198 11251 ----
NM_013423chrX176 1807 ----
NM_013427chrX176 1807 ----
NM_013433chr1951482 816 458 297 274 1421 1201 --
NM_013434chr271947 1851 1605 645 427 309 221 31914 1454 28 1680 --
NM_013434chr271947 1851 1605 645 427 309 221 31914 1454 28 1680 --
NM_013438chr931382 1153 204 ------
NM_013447chr1933650 1423 253 ------
NM_013943chr152176 2058 1094 207 66 ----13127
NM_013989chr1434420 1249 473 13493 14274 1773
NM_014001chr172588 376 1228 --11061
NM_014016chr31415 ------
NM_014023chr1042950 2101 1937 817 --11925 --
NM_014030chr1711148 148 161 --
NM_014060chrX126 ------
NM_014112chr855110 5002 1251 540 397 ------
NM_014117chr1621685 88 ------
NM_014139chr32193 67 ------
NM_014142chr10122 ------
NM_014155chr1126569 1348 37453 6980 1233 ----
NM_014181chr212593 ------
NM_014191chr121734 1808 ----
NM_014216chr1441506 363 214 57 1578 ----
NM_014232chr1721109 1089 11061 ----
NM_014232chr1721109 1089 11061 ----
NM_014235chrX31683 521 39 --2617 280 --
NM_014240chr343538 3414 2976 839 ----11407
NM_014243chr4--22011 812 ----
NM_014253chrX21691 386 ------
NM_014268chr181202 ----1227
NM_014283chr1--11019 ----
NM_014292chr221534 21276 661 21408 182 --
NM_014293chr22103647 3425 3292 3221 3209 2612 1218 746 379 60 ----1433
NM_014294chr8--1383 ----
NM_014299chr1932234 2019 1377 ----11740
NM_014317chr101292 ------
NM_014325chr1221454 1435 22237 149 ----
NM_014338chr223950 149 83 ------
NM_014368chr922000 764 --11872 --
NM_014372chr11424 ------
NM_014423chr534924 1559 339 14404 ----
NM_014470chr121116 --1692 --
NM_014488chr11----151 --
NM_014491chr7--1814 ----
NM_014507chr2211117 ------
NM_014552chr211456 ------
NM_014574chr14--11545 ----
NM_014583chr31196 ------
NM_014614chr2------1450
NM_014616chr332969 2666 303 177 ----
NM_014620chr121277 ------
NM_014630chr1523650 2560 1858 ----
NM_014655chr141450 505 117 48 ------
NM_014657chr20126 2293 79 ----
NM_014661chr1093454 3415 3400 2854 2821 993 841 399 177 --1407 12975
NM_014663chr11280 --1878 --
NM_014665chr8133039 1377 1359 1338 1314 1186 1142 837 748 621 582 517 30 1953 13496 22925 1068
NM_014667chr342432 2052 1507 304 ------
NM_014671chr72240 177 --1432 --
NM_014690chr711094 13113 145 --
NM_014701chr1533148 2263 573 ------
NM_014702chr623252 298 22869 1182 ----
NM_014712chr161404 --1497 --
NM_014720chr101200 ------
NM_014729chr8----1143 --
NM_014731chr2031575 413 371 11643 1559 --
NM_014735chrX11338 11548 ----
NM_014747chr155183 3893 2013 366 123 24802 536 ----
NM_014751chr8----1605 --
NM_014752chr1111726 --1325 --
NM_014755chr222908 833 14021 ----
NM_014756chr11----1408 --
NM_014758chr1121750 52 2649 96 1487 --
NM_014766chr743730 3425 2716 1215 ------
NM_014767chr1053059 1314 1109 638 596 11482 12776 --
NM_014772chr1873469 3215 2656 1230 642 393 58 12246 ----
NM_014774chr122815 944 12900 ----
NM_014779chr31752 ------
NM_014781chr8187 ------
NM_014786chr1141205 915 449 182 --1324 --
NM_014788chr952509 2194 1978 1164 1079 12435 ----
NM_014790chr51360 ------
NM_014797chr61474 --12417 --
NM_014800chr71221 ------
NM_014803chr1032857 848 270 ------
NM_014804chr1731017 417 22 ------
NM_014812chr111707 ------
NM_014819chr51901 ------
NM_014820chr321696 279 ------
NM_014824chr11--1458 ----
NM_014827chr11165 ------
NM_014830chr1253246 2994 856 843 233 ------
NM_014832chr131597 --11724 --
NM_014836chr10--21365 413 ----
NM_014839chr11399 12087 128 --
NM_014841chr611140 ------
NM_014848chr1542504 2475 2237 359 --12409 --
NM_014850chr344457 3680 1626 1243 24450 3007 11552 --
NM_014871chr121438 ----1130
NM_014873chr123046 27 24754 3003 ----
NM_014876chr2221710 1699 31740 557 230 11885 --
NM_014883chr41697 --1454 --
NM_014893chrY------1411
NM_014903chr1231862 1775 1769 1454 ----
NM_014904chr1042862 2483 582 219 --13492 --
NM_014906chr1733003 2851 1083 ------
NM_014912chr102850 330 --1515 --
NM_014921chr1932432 2075 1005 2751 549 21104 105 --
NM_014926chr3------1206
NM_014932chr311696 ------
NM_014935chr163597 3438 2901 1185 637 252 --22716 157 12801
NM_014939chr1811026 11330 11371 --
NM_014946chr2--2222 79 12488 --
NM_014949chr11696 ------
NM_014951chr1032567 2336 320 1343 ----
NM_014952chr153693 413 289 --126 193
NM_014962chr2021154 643 ------
NM_014977chr142370 148 159 1382 --
NM_014978chr10--31622 1532 519 11431 --
NM_014991chr421297 777 ------
NM_015020chr16--12644 1177 --
NM_015023chr13656 622 578 --11312 --
NM_015025chr211681 ------
NM_015032chr13--1163 ----
NM_015033chr952517 2310 777 271 233 --1185 12086
NM_015039chr163878 3861 1734 1472 1046 464 12991 --1643
NM_015042chr15124238 4166 4151 4132 3805 3071 3040 2635 1424 1225 1171 995 11095 33000 1720 1218 --
NM_015057chr131250 ------
NM_015063chr1941159 1103 354 42 ------
NM_015069chr161129 --163 --
NM_015071chr554731 2060 1835 1303 73 15224 ----
NM_015075chrX52156 1395 716 559 498 21469 233 22163 1878 1441
NM_015076chr6--13994 ----
NM_015077chr1763951 3907 3196 1785 1548 1351 34462 1627 1427 24679 844 14523
NM_015079chr1521976 631 13096 12323 --
NM_015080chr11----1890 --
NM_015090chr1106142 5787 5324 4240 4105 3968 1979 1768 1472 556 15475 26133 4638 1998
NM_015092chr1621869 217 ------
NM_015093chr621479 565 ------
NM_015094chr2264515 4277 3769 1613 1005 350 23119 1330 53735 3660 720 280 256 --
NM_015097chr3--12267 ----
NM_015101chr131935 756 60 1110 ----
NM_015107chrX31625 1580 757 1746 1596 --
NM_015115chr412421 --11134 --
NM_015132chr712003 11856 ----
NM_015136chr3----1131 --
NM_015144chr1653622 2622 618 422 246 11176 ----
NM_015149chr131659 597 383 ------
NM_015153chr61600 ------
NM_015155chr1063215 3191 2246 2061 491 442 --1620 --
NM_015161chr1611213 1387 ----
NM_015171chr16--195 ----
NM_015176chr1----1646 --
NM_015187chr4170 --1257 --
NM_015192chr2042612 2285 1156 36 1720 12758 --
NM_015194chr1731970 815 551 21883 35 ----
NM_015205chr13134247 1906 1856 991 935 817 777 637 548 415 304 44 21 34306 4166 4151 34241 1879 643 1272
NM_015206chr1532455 786 693 --1527 --
NM_015215chr122076 414 ------
NM_015225chr922683 2138 1742 ----
NM_015236chr41478 ------
NM_015265chr222173 1662 ------
NM_015267chr1231402 744 183 --1829 --
NM_015270chr123959 875 281 1585 32230 1960 186 --
NM_015284chr121489 497 --11963 --
NM_015288chr5103718 3066 1043 1032 891 869 800 783 383 220 23320 2610 11288 --
NM_015293chr6153 ------
NM_015299chr1433840 3075 1237 12807 1481 --
NM_015315chr532591 2193 159 --22823 2583 --
NM_015326chr162577 2454 2261 639 369 279 --12609 --
NM_015328chr742379 1143 1033 748 12743 1206 12112
NM_015336chr121117 ------
NM_015344chr82567 52 11985 ----
NM_015346chr1411548 11166 --11681
NM_015347chr122832 80 12386 ----
NM_015349chr612490 ------
NM_015358chr211386 1148 ----
NM_015365chrX11724 1813 ----
NM_015393chr463567 2894 686 619 610 233 ------
NM_015397chr9----11581 --
NM_015443chr1711109 ----1363
NM_015455chr523227 79 --13922 --
NM_015477chr151127 --1171 --
NM_015488chr241610 693 617 48 ------
NM_015497chr15133 ------
NM_015503chr16--1208 1610 --
NM_015520chr332610 498 384 ------
NM_015526chr1921345 508 1421 ----
NM_015557chr163421 3017 2957 950 682 186 --22288 64 --
NM_015567chr13--1297 21270 998 --
NM_015569chr124610 1149 24811 2977 ----
NM_015576chr352700 2437 1028 687 42 11927 ----
NM_015601chr101769 ------
NM_015630chr2--1977 ----
NM_015640chr145093 4037 3752 948 13686 ----
NM_015649chr19122 ------
NM_015678chr1311266 ------
NM_015686chrX2976 731 11862 1945 --
NM_015726chr131813 1509 396 ------
NM_015833chr2131579 833 431 12031 22068 894 --
NM_015866chr1--1444 ----
NM_015878chr821357 600 ------
NM_015955chr2------1528
NM_015963chr2138 ------
NM_015981chr532667 1004 891 1195 ----
NM_015995chr15105366 4896 4841 4545 4190 3770 1826 1740 1413 785 24116 1304 24006 2034 21700 793
NM_016019chr7--1765 ----
NM_016022chr12916 718 ------
NM_016025chr16--1253 ----
NM_016032chrX4507 489 350 43 --1331 --
NM_016041chr171332 ------
NM_016057chr12195 ------
NM_016072chr1211671 ------
NM_016076chr133190 2479 925 ------
NM_016083chr612855 1276 ----
NM_016090chr112383 34 ------
NM_016096chr8------1118
NM_016107chr521162 914 ------
NM_016125chr17--124 189 --
NM_016131chr222137 751 ------
NM_016132chr1522917 2890 ------
NM_016169chr1042869 2265 812 460 1163 --1197
NM_016201chr3--12106 21896 609 --
NM_016206chr336548 1354 439 18715 13044 17127
NM_016227chr1--11019 ----
NM_016231chr1711686 ------
NM_016255chr623178 56 1522 ----
NM_016257chr183484 3159 3146 3096 2281 1248 384 45 ------
NM_016260chr246901 5347 2640 1237 --1642 --
NM_016269chr41160 ------
NM_016272chr2252622 1832 747 607 23 --11848 1587
NM_016284chr161662 1824 ----
NM_016287chr1------1609
NM_016290chr5----151 --
NM_016298chr343130 2617 789 298 --1853 --
NM_016315chr221671 538 ------
NM_016316chr21654 ------
NM_016351chr71481 ------
NM_016374chr11318 --149 --
NM_016374chr11318 --149 --
NM_016377chr6----11235 --
NM_016396chr151916 ------
NM_016424chr1721467 1239 ------
NM_016436chr2042061 1895 160 128 ------
NM_016441chr21842 12154 ----
NM_016456chr1122 --175 --
NM_016507chr1731102 207 114 ------
NM_016516chr2--1760 ----
NM_016530chr1531535 1296 69 1571 ----
NM_016531chr433387 762 200 --1723 13324
NM_016542chrX11358 ------
NM_016548chr92616 35 11171 ----
NM_016570chr121510 1483 ----
NM_016588chr61664 --1350 --
NM_016598chr321105 23 ------
NM_016603chr5--1612 ----
NM_016605chr542440 1775 84 51 11891 --128
NM_016621chr1133363 2794 1493 --33779 3561 794 --
NM_016623chr8----1222 --
NM_016823chr172954 861 --1846 --
NM_016829chr32705 62 2317 273 ----
NM_016830chr12----195 --
NM_016834chr1793253 3097 1133 1000 974 723 683 533 227 1270 11066 --
NM_016835chr1793253 3097 1133 1000 974 723 683 533 227 1270 11066 --
NM_016841chr1793253 3097 1133 1000 974 723 683 533 227 1270 11066 --
NM_017415chr533608 1056 748 1558 11662 --
NM_017488chr22420 217 21525 536 ----
NM_017519chr61274 ----2947 47
NM_017522chr12310 272 ------
NM_017551chr101592 11011 12054 --
NM_017553chr152439 41 1214 ----
NM_017572chr19162 ------
NM_017590chr22111937 1748 997 929 804 642 567 514 75 54 36 11664 22002 102 --
NM_017593chr4195 --1398 --
NM_017602chrX2817 614 ------
NM_017623chr232734 1834 107 ------
NM_017631chr4156 ------
NM_017633chr611473 --13789 --
NM_017635chr11--1319 ----
NM_017637chr968021 6421 6172 6105 6041 1066 1140 1548 --
NM_017643chr172530 504 --182 --
NM_017645chr922593 2513 --12007 --
NM_017646chr1----1480 --
NM_017658chr14----1586 --
NM_017661chr15--1117 ----
NM_017668chr164829 599 293 41 ------
NM_017684chr151229 ------
NM_017686chr11182 ------
NM_017709chr154222 3919 3522 1418 45 1997 ----
NM_017739chr1----1107 --
NM_017742chr1821925 1342 --11777 --
NM_017744chr142357 2125 1972 419 12171 1261 --
NM_017754chr654916 3254 805 476 397 --1313 --
NM_017762chr1552026 1605 927 584 498 ------
NM_017772chr631458 569 65 ------
NM_017778chr8--11340 ----
NM_017790chr91123 ------
NM_017799chr1411797 --1351 --
NM_017811chr9175 ------
NM_017813chr825213 102 ------
NM_017842chr121717 --1284 --
NM_017848chrX11493 12842 ----
NM_017849chr242616 1024 495 154 ----21144 1091
NM_017851chr1531091 282 103 --127 11038
NM_017864chr8143 ------
NM_017893chr1011177 11366 160 --
NM_017902chr1064953 4632 1231 572 492 384 33691 1941 1183 11477 --
NM_017910chr2----1256 --
NM_017933chr221141 39 1444 1350 --
NM_017938chrX------1462
NM_017944chr111396 22804 2405 1165 --
NM_017955chr141892 ------
NM_017982chr11442 171 ----
NM_018011chr131138 ------
NM_018027chr102739 408 --12278 --
NM_018045chr162911 2887 2661 1188 529 99 21211 979 22478 2149 --
NM_018085chr157828 7460 5310 2851 37 --12544 --
NM_018107chr14--1340 1140 --
NM_018110chr1641032 889 503 339 1173 --1434
NM_018120chr8144 1189 ----
NM_018131chr10--1627 1901 --
NM_018133chr341589 887 525 305 ------
NM_018157chr1242594 1310 1278 220 ------
NM_018159chrX--11630 ----
NM_018184chr322166 338 ------
NM_018200chr152850 149 12022 ----
NM_018203chr11599 --187 --
NM_018206chr162505 311 ------
NM_018266chr31784 ------
NM_018299chr812734 ------
NM_018313chr321955 133 --11947 --
NM_018320chr111844 --1115 --
NM_018330chr1021156 312 ------
NM_018340chr1644044 1530 670 429 --13620 --
NM_018357chr151376 ------
NM_018362chr1112532 ------
NM_018364chr123537 1537 ------
NM_018381chr192304 44 ----1163
NM_018403chr313884 ------
NM_018406chr3124 ------
NM_018440chr867821 7409 6629 5518 2634 1721 25761 3325 15868 --
NM_018445chr15--1198 ----
NM_018452chr6_random22630 664 --13010 --
NM_018471chr2--1177 ----
NM_018489chr12658 412 --1121 --
NM_018553chr1721740 737 11426 ----
NM_018566chr114211 24363 1628 ----
NM_018571chr21588 ------
NM_018638chr1225051 1600 11406 ----
NM_018640chr1212458 ------
NM_018667chr1631984 548 521 11143 32513 2440 60 --
NM_018695chr5--1248 ----
NM_018699chr41290 ------
NM_018718chr73740 171 74 ------
NM_018834chr511011 1844 ----
NM_018898chr532222 420 403 ------
NM_018899chr532222 420 403 ------
NM_018900chr532222 420 403 ------
NM_018901chr532222 420 403 ------
NM_018902chr532222 420 403 ------
NM_018903chr532222 420 403 ------
NM_018904chr532222 420 403 ------
NM_018905chr532222 420 403 ------
NM_018906chr532222 420 403 ------
NM_018907chr532222 420 403 ------
NM_018908chr532222 420 403 ------
NM_018909chr532222 420 403 ------
NM_018910chr532222 420 403 ------
NM_018911chr532222 420 403 ------
NM_018912chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018913chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018914chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018915chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018916chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018917chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018918chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018919chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018920chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018921chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018922chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018923chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018924chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018925chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018926chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018927chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018928chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018929chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_018947chr734965 3233 1787 1629 ----
NM_018948chr1--11085 ----
NM_018970chr723175 2360 ------
NM_018976chr121977 --11807 --
NM_018999chr1043899 1305 1137 617 ------
NM_019024chr23348 78 60 ------
NM_019030chr5174 ------
NM_019072chr532601 742 342 ------
NM_019091chr21419 ------
NM_019096chr62428 62 1374 1698 --
NM_019106chr22103071 2741 2606 2345 2271 2218 959 712 546 415 --23250 2716 --
NM_019556chrX1326 ------
NM_019595chr21276 ------
NM_019610chr11566 --11506 --
NM_019842chr6--1403 ----
NM_019848chrX1137 ------
NM_019857chrX2640 341 ------
NM_019860chr1011037 ------
NM_019884chr191514 ----167
NM_020039chr121444 1637 ----
NM_020137chrX3343 177 129 ------
NM_020148chr1832067 1202 869 ------
NM_020168chr1541302 934 358 159 11079 1439 --
NM_020178chr1711213 ------
NM_020179chr111361 ------
NM_020180chr1831280 1224 468 ----167
NM_020184chr231992 621 220 ------
NM_020199chr51840 ------
NM_020214chr15----1106 --
NM_020225chr41141 ------
NM_020239chr132160 1841 203 1181 ----
NM_020246chr72271 83 --1296 --
NM_020310chr1732565 2422 1788 --22462 174 --
NM_020336chr2031375 1056 172 ------
NM_020341chr201206 ------
NM_020362chr11294 ------
NM_020384chrX31453 165 135 ----21857 70
NM_020420chrY------11441
NM_020429chr722726 38 1272 ----
NM_020440chr152823 1029 944 935 865 ------
NM_020443chr156937 6438 6336 2541 958 24597 4409 26106 4537 --
NM_020449chrX----1104 --
NM_020463chr21418 ------
NM_020474chr18----147 --
NM_020475chr831966 1727 1570 --22028 52 12043
NM_020476chr831966 1727 1570 --22028 52 12043
NM_020477chr831966 1727 1570 --22028 52 12043
NM_020478chr832029 1790 1633 --22091 115 12106
NM_020480chr831966 1727 1570 --22028 52 12043
NM_020532chr2171 ------
NM_020640chr321717 434 12291 1209 --
NM_020644chr111691 ------
NM_020647chr82327 244 ------
NM_020654chr311311 1415 ----
NM_020673chr2057370 5730 5629 5622 5529 26557 6503 22765 907 --
NM_020680chr11195 ------
NM_020692chr14124 --1714 1869
NM_020717chrX63450 3343 3228 3063 1931 1558 11990 24254 775 --
NM_020718chr1615973 24623 2572 ----
NM_020732chr61274 ----2947 47
NM_020734chr1223241 287 ------
NM_020742chrX12185 ------
NM_020747chr51371 ------
NM_020755chr61241 ------
NM_020760chr211594 ------
NM_020766chrX12824 --13786 --
NM_020769chrX1614 ------
NM_020772chr1737309 6339 2277 ------
NM_020783chr1851842 1797 1766 935 907 ------
NM_020805chr181484 ------
NM_020809chr1131675 526 274 ------
NM_020810chr1433146 2503 165 ------
NM_020814chr231273 375 26 ------
NM_020820chr2031535 205 165 31274 1001 333 41088 605 342 27 --
NM_020821chr151229 ------
NM_020841chr1233947 3812 2873 ------
NM_020844chr827232 1461 ------
NM_020845chr124760 728 707 364 1513 12429 1137
NM_020850chr1672914 2871 2787 2530 2386 2206 769 --1676 1806
NM_020854chr1811530 --1991 --
NM_020858chr15----1270 --
NM_020868chr22549 339 ------
NM_020871chrX21919 110 12503 ----
NM_020896chr111277 ----1147
NM_020899chr1762410 1595 868 850 248 142 11735 ----
NM_020920chr141363 ------
NM_020925chr111178 ------
NM_020946chr941441 1415 1293 295 --11507 --
NM_020947chr1642150 2037 1924 598 --1234 1118
NM_020956chr19174685 4323 4239 4166 4154 4010 3962 3886 3612 3513 3290 3242 3028 2879 831 205 26 23919 3755 23622 923 --
NM_020962chr1532157 1555 303 ------
NM_020972chr45319 198 185 97 36 --4763 412 363 61 --
NM_020977chr43887 782 428 ------
NM_020983chr122875 281 1585 32230 1960 186 --
NM_020993chr1242267 2233 1018 934 22576 2043 ----
NM_021003chr141684 ------
NM_021007chr21262 ------
NM_021033chr131997 12556 ----
NM_021064chr63396 364 266 --168 11291
NM_021072chr52566 199 ------
NM_021081chr20----125 --
NM_021127chr1821165 548 ------
NM_021132chr101196 ------
NM_021183chrX11667 126 ----
NM_021194chr1--1112 ----
NM_021255chr1422823 2543 13964 --12884
NM_021267chr1991252 1165 1125 1023 900 302 162 72 53 --41206 526 228 109 --
NM_021630chr86322 315 240 144 43 37 ------
NM_021637chrX1251 ------
NM_021638chr4113935 3596 3504 3413 1940 1898 934 817 475 436 306 23728 3637 23347 1618 --
NM_021643chr211679 --1275 --
NM_021722chr71440 ------
NM_021723chr71481 ------
NM_021738chr10132 ------
NM_021813chr654102 3563 1766 1373 875 15357 11875 --
NM_021911chr512008 ------
NM_021913chr19--11841 11763 --
NM_021947chr171495 ------
NM_021959chr62682 60 ------
NM_021961chr1156396 2826 2387 1190 132 --17516 --
NM_021962chr1722139 912 ------
NM_021965chr931036 291 28 ------
NM_021976chr6----186 --
NM_022037chr2--141 ----
NM_022047chr62314 266 154 1296 --
NM_022048chr1596199 4433 2403 1813 1343 855 186 178 150 15886 --11489
NM_022062chr1151552 1469 1439 776 239 11372 ----
NM_022064chr3------1197
NM_022068chr18----1224 --
NM_022075chr1----175 --
NM_022079chr101769 ------
NM_022085chr63541 219 75 1456 ----
NM_022114chr193405 3014 1362 1045 997 334 240 101 22 --22944 1141 1728
NM_022123chr141205 ------
NM_022129chr102950 135 ------
NM_022140chr531710 921 421 ------
NM_022166chr1612307 21168 126 22420 2076 24395 25
NM_022173chr2--141 ----
NM_022459chr131101 14518 --25515 1666
NM_022473chr1534224 1145 70 13915 --11612
NM_022483chr511711 1683 11890 --
NM_022497chr343123 3028 699 575 1312 1938 11222
NM_022572chr241610 693 617 48 ------
NM_022574chr741698 739 631 534 1486 22086 510 --
NM_022648chr263454 3095 1462 445 103 23 ------
NM_022659chr8--1185 ----
NM_022719chr2242851 755 154 101 11374 --1967
NM_022730chr23730 242 39 ------
NM_022735chr11450 ------
NM_022739chr171908 1220 ----
NM_022757chr31992 ------
NM_022758chr672954 2616 2560 2398 1158 286 218 --12235 --
NM_022763chr321126 434 12897 ----
NM_022779chr91555 ----1139
NM_022781chr922606 112 --1765 --
NM_022823chr2158 ------
NM_022841chr1511816 ------
NM_022845chr1611674 12226 ----
NM_022893chr21863 ------
NM_022898chr1433192 3116 1110 23014 941 ----
NM_022918chr112666 552 ------
NM_023000chr1411732 ------
NM_023001chr1411732 ------
NM_023009chr12115 62 ------
NM_023016chr222519 2320 ------
NM_023929chr81136 ------
NM_024016chr175762 228 110 57 32 --126 --
NM_024054chr7--1327 --1286
NM_024090chr4136 ------
NM_024117chr941247 1130 240 55 11051 ----
NM_024293chr24800 609 583 248 ------
NM_024294chr672954 2616 2560 2398 1158 286 218 --12235 --
NM_024295chr821667 1300 21635 496 1337 1681
NM_024306chr162746 339 1291 --1194
NM_024345chr934880 1326 104 1858 ----
NM_024423chr1834145 4053 2734 ------
NM_024496chr141257 ------
NM_024513chr343331 1519 439 176 1320 ----
NM_024529chr1--181 ----
NM_024539chrX1912 ----1394
NM_024551chr1241938 1817 905 72 ------
NM_024551chr1241938 1817 905 72 ------
NM_024572chr2----129 --
NM_024612chr17--1969 1859 --
NM_024627chr2233147 1003 531 34039 4029 3904 13943 --
NM_024631chr113237 164 128 ------
NM_024636chr71248 ----1457
NM_024639chr642534 2498 2223 932 11949 ----
NM_024657chrX1234 1606 ----
NM_024665chr311527 ------
NM_024667chr1291724 1621 1437 1431 1074 625 526 416 112 --21425 478 --
NM_024674chr152832 2498 2380 594 91 12921 ----
NM_024704chr201733 --2318 139 --
NM_024740chr1133570 866 139 21231 426 --11577
NM_024742chr1631553 1510 660 1188 --11452
NM_024772chr1--1420 ----
NM_024785chr231436 517 336 ------
NM_024798chr1552468 2327 1867 1186 220 ------
NM_024811chr1131473 471 83 11599 21454 1257 --
NM_024834chr1011302 1541 ----
NM_024837chr15--11691 1195 --
NM_024863chrX128 ------
NM_024887chr12711 240 1153 --1269
NM_024930chr5--22479 1956 --12451
NM_024933chr23703 594 67 1492 1102 --
NM_024947chr313252 --26656 253 --
NM_024949chr431975 1320 534 1682 ----
NM_024989chr222747 46 ------
NM_025054chr8--22925 161 166 --
NM_025134chr161579 ------
NM_025146chr321029 895 ------
NM_025151chr8162 ------
NM_025160chr134056 2806 148 ------
NM_025176chr20180 1680 ----
NM_025179chr164673 3231 1838 1773 1047 242 --13644 --
NM_025182chr92812 29 --1325 --
NM_025191chr112151 11312 ----
NM_025195chr821474 411 ------
NM_025221chr4--11253 ----
NM_025222chr342764 2123 885 549 ----12693
NM_025224chr2072041 1832 1740 831 472 160 80 1712 187 --
NM_025238chr151431 169 ----
NM_025250chr762575 1902 728 490 442 132 1312 52889 703 687 418 77 1210
NM_030583chr8--1368 ----
NM_030621chr1421499 363 ------
NM_030634chr1--22457 2037 1114 22230 976
NM_030648chr444523 4493 1943 710 --22201 1894 --
NM_030650chr244076 4005 908 670 ------
NM_030660chr1411280 ------
NM_030664chr10--22317 777 ----
NM_030670chr12--21526 170 ----
NM_030671chr12--21526 170 ----
NM_030674chr1224862 1943 --11499 --
NM_030756chr10--1123 ----
NM_030759chr101272 ------
NM_030761chr121914 351 ------
NM_030762chr121323 --1709 --
NM_030786chr131281 680 409 ------
NM_030802chr171356 ------
NM_030806chr177266 7229 7090 6876 6856 3329 3100 59111 8414 7449 7080 2153 18254 --
NM_030810chr63541 219 75 1456 ----
NM_030816chr112782 ------
NM_030918chr135246 5167 812 2794 124 14383 --
NM_030937chr111237 128 11084 21425 960
NM_030962chr111306 ------
NM_031262chr91300 ------
NM_031263chr91357 ------
NM_031266chr5--1209 ----
NM_031267chr71465 ------
NM_031268chr1665284 4802 4311 4040 865 62 --35180 4518 1286 21778 491
NM_031305chr4188 ------
NM_031371chr11318 --149 --
NM_031371chr11318 --149 --
NM_031372chr411426 ------
NM_031411chr532222 420 403 ------
NM_031417chr1952479 2400 2071 687 345 156 21880 435 --
NM_031442chrX12676 ------
NM_031445chr232569 843 39 1324 ----
NM_031459chr121393 302 11019 --1494
NM_031476chr1622348 551 1643 12759 --
NM_031845chr222889 803 --12817 --
NM_031847chr222889 803 --12817 --
NM_031849chr532222 420 403 ------
NM_031857chr532222 420 403 ------
NM_031860chr532222 420 403 ------
NM_031936chr13659 143 40 ----1258
NM_032017chr161985 1787 1647 611 352 153 1143 11473 1105
NM_032041chr821871 1018 ------
NM_032047chr332253 2199 1918 ------
NM_032088chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_032092chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_032105chr167310 5050 5012 1826 1278 914 16181 ----
NM_032127chr11148 --127 --
NM_032139chr19--1302 ----
NM_032146chr31172 ------
NM_032160chr1823950 281 13045 ----
NM_032189chr13124049 2006 1708 1658 793 737 619 579 439 350 217 106 34108 3968 3953 34043 1681 445 174
NM_032195chr211333 ------
NM_032281chr1973125 2902 2842 2684 2394 1051 768 --1939 1786
NM_032288chr3--12089 ----
NM_032289chr531725 1512 51 11243 178 --
NM_032294chr1741555 538 402 222 11307 21253 24 --
NM_032312chr21197 ------
NM_032327chr102419 320 ------
NM_032352chr141961 1520 ----
NM_032373chr1035854 4383 126 --14339 14261
NM_032403chr581426 1311 1155 1145 1117 124 117 92 11346 ----
NM_032431chr113773 725 208 --1258 --
NM_032438chr611532 ------
NM_032440chr1022124 578 ------
NM_032457chr412733 --1101 --
NM_032458chrX13316 ------
NM_032491chr122274 113 ------
NM_032505chr3--1813 1953 --
NM_032523chr2196 ----1431
NM_032552chr941465 1318 1297 233 31634 1347 756 1631 --
NM_032557chr4130 ------
NM_032575chr1641847 1752 1646 683 --11560 --
NM_032582chr1711521 ------
NM_032632chr142639 140 ------
NM_032682chr332562 2463 665 ----13595
NM_032711chr1733653 3335 1586 42722 1580 1435 403 2264 38 --
NM_032796chrX1590 ------
NM_032800chr131758 1717 942 --2738 78 --
NM_032837chr1712064 ------
NM_032846chr142608 341 ------
NM_032873chr1133080 1763 995 11336 11179 --
NM_032884chr1--1118 ----
NM_032892chr15153 ------
NM_032898chr32393 30 ------
NM_032905chr101798 179 ----
NM_032924chr71727 ------
NM_032949chr13136 ------
NM_032961chr4190 ------
NM_032999chr73894 886 723 ------
NM_033000chr73894 886 723 ------
NM_033001chr73894 886 723 ------
NM_033012chr132797 293 --1872 --
NM_033018chrX11066 ------
NM_033023chr711088 1383 ----
NM_033036chr1111359 11443 1224 11341
NM_033055chr11448 ------
NM_033071chr6153 ------
NM_033081chr201440 ------
NM_033082chr12--164 ----
NM_033121chr122651 81 1278 ----
NM_033129chr2062072 1545 1517 1486 644 228 11945 ----
NM_033133chr1773753 2522 2512 1038 888 661 259 1443 11345 1278
NM_033138chr7159 ------
NM_033139chr7159 ------
NM_033140chr7159 ------
NM_033157chr7159 ------
NM_033181chr612855 1276 ----
NM_033201chr162162 137 --2825 26 --
NM_033211chr531878 1399 144 ------
NM_033222chr911134 ------
NM_033224chr736279 5146 2583 1112 ----
NM_033260chr61655 ----1615
NM_033274chr592340 1398 1305 992 984 926 497 92 64 --23584 630 --
NM_033290chrX32308 1466 51 22439 688 ----
NM_033300chr12310 272 ------
NM_033360chr1241078 886 780 697 13301 ----
NM_033375chr173226 193 170 ----1205
NM_033386chr222960 174 ----1419
NM_033389chr1723696 459 43468 1572 1442 976 23757 1951 --
NM_033421chr2041424 1229 445 23 2588 529 ----
NM_033429chr1522292 450 ------
NM_033449chr511672 --1365 --
NM_033495chrX1862 ------
NM_033503chr1573664 3420 3330 2810 961 944 444 1461 22967 1453 --
NM_033551chr532591 2193 159 --22823 2583 --
NM_033644chr5261 53 ------
NM_033645chr5261 53 ------
NM_033656chr2165643 2129 1268 918 563 530 ------
NM_052868chr11227 ------
NM_052874chr161643 --1166 --
NM_052879chr1223936 3556 ------
NM_052880chr221985 ----1993
NM_052898chr8--164 ----
NM_052899chr54868 379 208 200 3966 755 271 ----
NM_052900chr811715 --1111 --
NM_052906chr22103326 1919 1563 1495 1471 1243 383 364 301 98 24768 3339 --23235 561
NM_052910chr131435 ------
NM_052911chr18----183 --
NM_052918chr1032916 2742 1367 2753 723 ----
NM_052934chr1--21802 261 --177
NM_052961chr6263 25 ------
NM_053016chr997871 7531 6626 6582 6337 5676 5229 2068 1805 15789 --16924
NM_053024chr3--1381 ----
NM_053042chr42594 517 --12905 --
NM_054027chr51364 1382 11553 --
NM_054111chr621052 34 ------
NM_057182chr191206 ------
NM_058167chr151115 794 493 316 201 --21009 208 --
NM_058175chr215795 739 674 326 301 ----1685
NM_058241chr212252 ------
NM_058241chr212252 ------
NM_078487chr942836 827 642 193 12664 1261 --
NM_078625chr631020 530 523 ------
NM_080415chr17278 39 ------
NM_080476chr203295 59 47 ----1125
NM_080491chr11133874 3700 3631 2902 1547 1328 1164 837 820 653 532 405 236 --1413 --
NM_080546chr91463 ------
NM_080629chr111547 ------
NM_080630chr111547 ------
NM_080669chr1764078 3689 1955 1634 1145 760 11361 24415 3221 --
NM_080672chr201231 ------
NM_080676chr2012134 1368 --22786 293
NM_080872chr832624 382 70 23876 3741 ----
NM_080881chr55650 587 142 38 23 ------
NM_130391chr922431 2270 13303 ----
NM_130392chr922431 2270 13303 ----
NM_130393chr922431 2270 13303 ----
NM_130435chr1022551 134 ------
NM_130436chr2122301 1008 21054 714 ----
NM_130438chr2112878 21291 236 ----
NM_130439chr104836 795 143 46 1730 ----
NM_130439chr104836 795 143 46 1730 ----
NM_130442chr71221 ------
NM_130446chr324178 3622 1107 1167 --
NM_130459chr951389 1364 1299 1224 242 --1359 --
NM_130809chr533026 590 555 12283 ----
NM_130830chr322508 220 --12643 11610
NM_133170chr20117022 6859 6778 6702 6525 5497 4946 3100 3076 2327 1195 27191 549 37326 2514 454 --
NM_133171chr201917 21119 954 1245 --
NM_133177chr14792 198 135 41 11004 ----
NM_133178chr14792 198 135 41 11004 ----
NM_133264chr1743744 3372 3162 1530 12838 23811 3284 --
NM_133265chrX13327 ------
NM_133329chr221692 1518 ------
NM_133334chr455547 4958 4949 4794 187 24965 4911 35560 5118 2332 --
NM_133370chr423033 2832 ----13241
NM_133372chr5----11788 --
NM_133378chr21691 ------
NM_133432chr21691 ------
NM_133437chr21691 ------
NM_133476chr122929 326 ------
NM_133499chrX1304 ------
NM_133631chr3----11149 --
NM_133638chr531426 1351 307 ------
NM_133650chr6153 ------
NM_134442chr211603 154 --1417
NM_138270chrX12771 --12955 --
NM_138297chr3124 ------
NM_138316chr1011200 ------
NM_138338chr22103270 2983 2863 2583 2417 1339 1194 873 539 487 33477 3198 569 11131 --
NM_138385chr421158 1007 --11297 --
NM_138423chr1511822 --11596 --
NM_138444chr132908 880 1346 --13036
NM_138468chr243958 2538 2230 437 --15269 14450
NM_138473chr12------136
NM_138479chr132043 518 236 --11715 --
NM_138499chr10121 ------
NM_138576chr1433192 3116 1110 23014 941 ----
NM_138619chr172588 376 1228 --11061
NM_138633chr6----11235 --
NM_138713chr1686370 3205 2260 2220 1880 1578 1215 943 ------
NM_138714chr1686370 3205 2260 2220 1880 1578 1215 943 ------
NM_138727chr142357 2125 1972 419 12171 1261 --
NM_138728chr142357 2125 1972 419 12171 1261 --
NM_138732chr11----1890 --
NM_138734chr11----1890 --
NM_138793chr1771572 1272 515 419 229 182 29 ------
NM_138811chr721131 1001 ------
NM_138927chr211716 ------
NM_138961chr11----157 --
NM_138969chr82472 290 ------
NM_138970chr1411824 11752 ----
NM_138971chr1153501 3158 2782 1491 243 165 12750 --
NM_138971chr1153501 3158 2782 1491 243 165 12750 --
NM_138972chr1153501 3158 2782 1491 243 165 12750 --
NM_138972chr1153501 3158 2782 1491 243 165 12750 --
NM_138973chr1153501 3158 2782 1491 243 165 12750 --
NM_138973chr1153501 3158 2782 1491 243 165 12750 --
NM_139035chrX----127 --
NM_139057chr1562239 1806 971 843 486 81 ------
NM_139068chr51623 ------
NM_139069chr51623 ------
NM_139070chr51492 ------
NM_139136chr122326 312 ------
NM_139168chr51148 ------
NM_139177chr172338 239 134 ----
NM_139276chr1722279 423 ------
NM_139280chr1731350 1112 596 ------
NM_139283chr1212447 12532 ----
NM_139321chr2033618 3381 594 ------
NM_139323chr20--1192 ----
NM_144567chr11471 ------
NM_144568chr141487 ------
NM_144571chr497032 6952 6032 4319 1314 1246 1125 1095 87 ------
NM_144635chr311098 21020 253 --2882 871
NM_144660chr101400 ------
NM_144664chr1112399 ------
NM_144726chr5--11044 ----
NM_144967chrX1135 ------
NM_144973chr1233942 2143 874 ----13250
NM_145004chr8--179 ----
NM_145055chr1833492 2932 2521 1880 --12779
NM_145117chr1142160 1234 551 173 22755 512 11298 --
NM_145185chr19111960 1927 1696 1588 311 292 252 199 111 70 33 147 ----
NM_145206chr1032854 2716 324 2681 68 ----
NM_145234chrX1948 ------
NM_145259chr215726 --15616 --
NM_145279chr1126 1668 ----
NM_145284chrX12012 ------
NM_145296chr193342 227 182 1315 ----
NM_145307chr1023786 857 ------
NM_145330chr2160 ------
NM_145349chr1791666 1602 1469 1383 881 790 666 657 29 --1457 --
NM_145350chr1731018 233 142 --1436 1551
NM_145351chr1762158 2094 1961 1875 521 359 --1949 11691
NM_145638chr111277 ----1147
NM_145690chr831774 1530 300 11550 ----
NM_145733chr224860 395 134 60 --11039 --
NM_145735chr13----12366 --
NM_145739chr2196 ----1431
NM_145803chr111134 ------
NM_145805chr15171 ------
NM_145891chr1611358 ----1297
NM_145892chr1611358 ----1297
NM_145893chr1611480 ----1419
NM_147147chr641582 1396 1238 144 ------
NM_147171chr71359 ------
NM_147181chr4--11253 ----
NM_147182chr4--11253 ----
NM_147183chr4--11253 ----
NM_147185chr71359 ------
NM_147233chr2--11547 ----
NM_147686chr62383 35 ------
NM_148174chr821357 600 ------
NM_148894chr4--172 ----
NM_148898chr7--1814 ----
NM_148899chr7--1814 ----
NM_148955chr1566492 5352 4443 4218 1407 1320 24936 393 ----
NM_148977chr1011200 ------
NM_148978chr1011200 ------
NM_152271chr81422 ------
NM_152280chr143425 3162 2450 34 ------
NM_152317chr12183 ------
NM_152330chr14--11839 ----
NM_152335chr15--1162 --182
NM_152344chr1721436 123 1366 ----
NM_152371chr161719 1566 657 536 424 403 --1448 11543
NM_152384chr291700 1663 1605 1556 1381 1254 791 225 194 ------
NM_152409chr5122 12684 ----
NM_152410chr6----1135 --
NM_152424chrX43067 3044 180 116 13172 ----
NM_152470chr1843447 3140 3074 1018 31277 1151 57 ----
NM_152519chr221924 752 ------
NM_152529chr244408 3058 1192 916 ------
NM_152538chr31151 21627 1346 ----
NM_152553chr62473 416 ----1180
NM_152588chr1221782 130 ------
NM_152594chr15--1702 ----
NM_152608chr11230 ------
NM_152609chr121079 375 ------
NM_152613chr221234 11257 ----
NM_152622chr521234 358 1779 1716 --
NM_152660chr11330 ------
NM_152667chr2011271 11415 ----
NM_152678chr31834 --1283 --
NM_152699chr313418 --1116 --
NM_152733chr696269 6142 6066 5888 5838 5797 4947 4867 1393 --25480 1528 1677
NM_152739chr7--1144 11012 --
NM_152740chr7198 1126 ----
NM_152745chr711037 181 ----
NM_152748chr7----1120 --
NM_152756chr524113 1263 ------
NM_152782chr7122 ------
NM_152787chrX2790 416 ------
NM_152789chr71603 ----1166
NM_152793chr744089 3188 2077 818 24598 1407 157 --
NM_152826chr1566492 5352 4443 4218 1407 1320 24936 393 ----
NM_152838chr2033346 3242 395 13469 ----
NM_152860chr122599 138 ------
NM_152862chr21407 ------
NM_152903chr1311898 --1763 --
NM_152919chr1933650 1423 253 ------
NM_152924chr1536176 5253 2743 35264 4608 2167 --11672
NM_152989chr1211353 ----11498
NM_152996chr13794 659 574 11467 ----
NM_153035chr132606 601 27 ------
NM_153040chr15178 ------
NM_153188chr513835 --15584 --
NM_153228chr17173 ------
NM_153234chr532839 2129 1072 ------
NM_153247chr721096 891 --1775 1317
NM_153267chr91213 ------
NM_153335chr172459 115 --11358 --
NM_153341chr1--1121 ----
NM_153347chr1132189 763 735 --12394 --
NM_153354chr51258 1670 ----
NM_153453chr61976 ------
NM_153456chr1355889 5288 2191 2084 244 21230 885 ----
NM_153498chr102736 650 1147 ----
NM_153499chr1251206 541 503 304 85 ------
NM_153500chr1251206 541 503 304 85 ------
NM_153607chr511163 ----1481
NM_153616chr15----1270 --
NM_153617chr15----1270 --
NM_153618chr15----1270 --
NM_153619chr152410 379 ------
NM_153620chr741768 279 66 58 --11167 11561
NM_153633chr121277 ------
NM_153685chr123956 279 45 ----198
NM_153687chr121339 ------
NM_153693chr121569 ------
NM_153705chr11--138 ----
NM_153748chr122326 312 ------
NM_153756chr11304 1416 21282 279 --
NM_153828chr2171 ------
NM_170692chr11995 --1232 --
NM_170696chr1531189 467 144 --1201 --
NM_170697chr1531189 467 144 --1201 --
NM_170706chr163878 3861 1734 1472 1046 464 12991 --1643
NM_171825chr532667 1004 891 1195 ----
NM_171998chrX2369 208 --1934 --
NM_172071chr1----17236 --
NM_172206chr1741555 538 402 222 11307 21253 24 --
NM_172226chr1251206 541 503 304 85 ------
NM_172230chr113773 725 208 --1258 --
NM_172344chr221692 1518 ------
NM_172373chr1331019 994 902 ------
NM_173054chr71872 1371 ----
NM_173065chr1102744 2573 2510 2262 1038 669 382 370 308 41 12553 1483 --
NM_173074chr2172 ------
NM_173171chr21355 ------
NM_173172chr2--150 --1223
NM_173173chr21355 ------
NM_173198chr91786 ------
NM_173199chr9--1512 ----
NM_173200chr91786 ------
NM_173214chr1686370 3205 2260 2220 1880 1578 1215 943 ------
NM_173359chr311426 --11276 --
NM_173463chr444190 1684 1323 54 --13949 --
NM_173468chr426108 4965 12283 ----
NM_173469chr152310 249 ------
NM_173475chr16--11416 ----
NM_173511chr222757 1084 ------
NM_173515chr62904 21 ------
NM_173519chr81637 12083 1830 --
NM_173543chr33675 588 47 1195 ----
NM_173563chr61274 ------
NM_173587chr112499 51 --1195 --
NM_173595chr1265151 3486 3406 1476 1140 1122 14500 ----
NM_173618chr163306 277 117 ------
NM_173642chr168997 8185 6641 5789 1127 770 12454 ----
NM_173666chr51526 11150 ----
NM_173683chr811616 ------
NM_173814chr151159 ------
NM_173822chr2197 ------
NM_173825chr312085 12855 ----
NM_174890chr10--1755 ----
NM_174911chr832489 779 325 22901 941 --1641
NM_174926chr111113 ------
NM_174938chr9128 --183 --
NM_174963chr13908 669 217 122 ----
NM_174964chr13908 669 217 122 ----
NM_174965chr13927 688 236 141 ----
NM_174966chr13908 669 217 122 ----
NM_174967chr13927 688 236 141 ----
NM_174968chr13908 669 217 122 ----
NM_174969chr13908 669 217 122 ----
NM_174970chr13927 688 236 141 ----
NM_174971chr13908 669 217 122 ----
NM_175063chr194403 248 240 65 ------
NM_175610chr1511047 ------
NM_175624chr1246602 3129 2824 2613 26800 6440 ----
NM_175625chr1246602 3129 2824 2613 26800 6440 ----
NM_175630chr22661 93 ------
NM_175736chr12167316 7039 5318 3068 2687 2550 2121 1762 1242 1152 949 931 921 485 259 248 27069 5393 21626 239 --
NM_175748chr141466 11580 11383 --
NM_175852chr162973 2874 2805 2371 1051 152 12161 ----
NM_175856chr51622 ------
NM_175859chrX2640 341 ------
NM_175863chr61274 ----2947 47
NM_175866chr111057 ------
NM_175873chr51275 ------
NM_175907chr1832690 2620 2453 ------
NM_176792chr1051038 899 414 189 183 ----1262
NM_177398chr111677 --21653 64 --
NM_177399chr111677 --21653 64 --
NM_177402chr11852 ------
NM_177414chr11310 ------
NM_177424chr121280 438 ------
NM_177438chr1421499 363 ------
NM_177559chr201862 1966 ----
NM_177560chr201862 1966 ----
NM_177937chr92616 35 11171 ----
NM_177952chr141684 ------
NM_177972chr1133809 3784 892 2464 331 21480 1203 --
NM_177974chr1511822 --11596 --
NM_177976chr31172 ------
NM_177977chr1741533 628 534 411 ----31486 810 498
NM_177990chr201206 ------
NM_177999chr973695 3467 2598 2317 1140 445 51 2931 579 13056 --
NM_178010chr1211353 ----11498
NM_178140chr511942 ------
NM_178151chrX67691 7218 6748 2450 1595 87 13095 1185 --
NM_178152chrX67691 7218 6748 2450 1595 87 13095 1185 --
NM_178153chrX67691 7218 6748 2450 1595 87 13095 1185 --
NM_178175chrX2169 75 ------
NM_178424chr5155 ------
NM_178426chr111931 ------
NM_178450chr5166 ------
NM_178565chr8----11111 --
NM_178585chr421297 777 ------
NM_178835chr41222 ------
NM_180976chr62891 645 ----2710 28
NM_180977chr62891 645 ----2710 28
NM_181054chr14--1246 ----
NM_181332chrX12185 ------
NM_181349chr722726 38 1272 ----
NM_181353chr201541 ------
NM_181358chr153570 3518 3416 68 34 ----13276
NM_181443chr2021154 643 ------
NM_181459chr2----1453 --
NM_181492chr22----11221 --
NM_181504chr523537 2737 ------
NM_181507chr11--1393 1128 --
NM_181508chr11--1393 1128 --
NM_181523chr523537 2737 ------
NM_181524chr523537 2737 ------
NM_181655chr172551 500 ------
NM_181656chr173760 709 101 ----145
NM_181659chr2021107 364 11031 ----
NM_181659chr2021107 364 11031 ----
NM_181670chr122146 139 ------
NM_181702chr8150 ------
NM_181704chr21----11159 --
NM_181706chr1112124 --11482 --
NM_181712chr111709 183 --11284
NM_181714chr61480 1721 ----
NM_181746chr1----175 --
NM_181755chr1--1323 --1125
NM_181762chrX--131 ----
NM_181777chrX--131 ----
NM_181825chr222734 280 1148 --1105
NM_181886chr411247 ------
NM_181887chr411247 ------
NM_181888chr411247 ------
NM_181889chr411247 ------
NM_181890chr411247 ------
NM_181891chr411247 ------
NM_181892chr411294 ------
NM_181893chr411247 ------
NM_182484chr21----11159 --
NM_182485chr4----11430 --
NM_182487chr984432 4255 3640 3231 1097 486 133 100 22863 652 44137 1308 1293 461 --
NM_182527chr2251888 1689 1639 615 193 1790 199 1397
NM_182540chrX1299 --1348 --
NM_182548chr63837 354 106 --1691 --
NM_182557chr1152015 2000 1821 743 228 12088 31864 1625 1373 --
NM_182641chr172661 309 ------
NM_182643chr812291 --12195 --
NM_182645chr61976 ------
NM_182646chr4----11430 --
NM_182647chr2051355 705 258 147 77 11123 2637 211 --
NM_182666chr3171 ------
NM_182691chr7--11070 ----
NM_182692chr7--11070 ----
NM_182728chr1431610 434 21 1379 --1299
NM_182734chr2032859 2532 283 1967 13005 --
NM_182763chr122502 1997 ------
NM_182764chr201917 21119 954 1245 --
NM_182767chr1211701 ------
NM_182789chr5----1834 --
NM_182811chr2041149 799 407 291 ------
NM_182907chr62863 471 31845 877 194 ----
NM_182948chr122214 356 ------
NM_182961chr6153 ------
NM_182964chr1142160 1234 551 173 22755 512 11298 --
NM_182970chr2033829 2642 384 1213 --13310
NM_182978chr181141 ------
NM_183244chr201231 ------
NM_183246chr201231 ------
NM_183323chr5----1834 --
NM_183373chr61183 4762 232 219 81 ----
NM_183425chr2041340 1133 364 136 --11193 1195
NM_194278chr1481369 1158 1127 1080 1057 391 259 184 ------
NM_194285chr1122564 741 --1290 --
NM_194315chr151115 794 493 316 201 --21009 208 --
NM_194328chr922606 112 --1765 --
NM_194329chr922606 112 --1765 --
NM_194330chr922606 112 --1765 --
NM_194332chr922606 112 --1765 --
NM_194434chr182667 189 ------
NM_194449chr182917 779 ------
NM_194452chr111844 --1115 --
NM_194453chr111844 --1115 --
NM_194457chr151115 794 493 316 201 --21009 208 --
NM_194458chr151115 794 493 316 201 --21009 208 --
NM_194463chrX1912 ----1394
NM_197941chr5--12537 22591 2268 --
NM_197956chr942157 673 351 96 --1241 --
NM_198042chr85426 419 344 147 141 ------
NM_198043chr102419 320 ------
NM_198044chr102419 320 ------
NM_198045chr102419 320 ------
NM_198046chr102419 320 ------
NM_198066chr1432718 2689 31 147 ----
NM_198081chr622199 2005 ------
NM_198087chr162982 196 1268 ----
NM_198088chr162982 196 1268 ----
NM_198097chr7--157 ----
NM_198123chr811715 --1111 --
NM_198124chr811715 --1111 --
NM_198158chr322513 2267 ------
NM_198159chr322513 2267 ------
NM_198177chr322513 2267 ------
NM_198178chr322513 2267 ------
NM_198182chr211456 ------
NM_198225chr10--21365 413 ----
NM_198268chr153570 3518 3416 68 34 ----13276
NM_198269chr153570 3518 3416 68 34 ----13276
NM_198270chrX11000 ------
NM_198273chr511021 32622 1274 33 ----
NM_198391chr201404 ------
NM_198404chr131729 1799 ----
NM_198513chr81574 ------
NM_198595chr4113935 3596 3504 3413 1940 1898 934 817 475 436 306 23728 3637 23347 1618 --
NM_198793chr333998 2980 503 ------
NM_198794chr1421128 435 ------
NM_198830chr17----1604 --
NM_198834chr1732128 446 47 ------
NM_198836chr1732128 446 47 ------
NM_198837chr1732128 446 47 ------
NM_198838chr1732128 446 47 ------
NM_198839chr1732128 446 47 ------
NM_198859chr354690 4672 3871 1663 248 ------
NM_198896chr1122014 542 ------
NM_198900chr12167316 7039 5318 3068 2687 2550 2121 1762 1242 1152 949 931 921 485 259 248 27069 5393 21626 239 --
NM_198903chr51653 ------
NM_198904chr52653 390 ------
NM_198990chr722577 280 --1546 --
NM_199000chr722091 854 --11614 --
NM_199044chr122872 618 --11116 --
NM_199050chr2143396 3328 3287 1011 --1462 --
NM_199054chr1931936 329 31 11494 ----
NM_199078chr232734 1834 107 ------
NM_199141chr192784 774 1111 ----
NM_199160chr931941 834 705 --11813 --
NM_199188chr1223936 3556 ------
NM_199189chr511011 1844 ----
NM_199190chr1223936 3556 ------
NM_199229chr211452 ------
NM_199320chr43877 851 834 12410 ----
NM_199320chr43877 851 834 12410 ----
NM_199324chr4--13140 ----
NM_199355chr1621550 31 ------
NM_199436chr2--2222 79 12488 --
NM_199453chr51164 ------
NM_199454chr193405 3014 1362 1045 997 334 240 101 22 --22944 1141 1728
NM_201266chr231119 1051 672 ----32776 2524 280
NM_201279chr231119 1051 672 ----32776 2524 280
NM_201403chr1126 1668 ----
NM_201412chr161169 ------
NM_201432chr1785470 4876 2626 2114 2095 1819 1410 989 11147 3964 314 103 --
NM_201433chr1785470 4876 2626 2114 2095 1819 1410 989 11147 3964 314 103 --
NM_201434chr171620 --193 --
NM_201436chr7------1691
NM_201437chr821207 1061 ------
NM_201516chr7------1747
NM_201517chr7------1691
NM_201591chr4--1525 157 --
NM_201592chr4--1525 157 --
NM_201599chrX153 ------
NM_201630chr13418 130 72 --1204 --
NM_201995chr111231 ------
NM_203305chr952008 975 764 491 435 12036 ----
NM_203327chr2084001 2906 1199 711 692 582 244 238 129 ----
NM_203382chr511415 ------
NM_203394chr121289 ------
NM_203403chr91312 ------
NM_203417chr212215 74 --1387 --
NM_203418chr212215 74 --1387 --
NM_203446chr2122262 497 11904 ----
NM_203458chr123553 1550 --1169 --
NM_203459chr1------1995
NM_203464chr11198 11251 ----
NM_203506chr171314 --31581 471 120 --
NM_205848chr132354 2049 62 --12622 --
NM_205858chr15----146 --
NM_205861chr12711 240 1153 --1269
NM_206853chr634038 2982 762 13262 ----
NM_206854chr635299 4243 2023 14523 ----
NM_206855chr626264 5208 15488 ----
NM_206907chr513091 ------
NM_207043chr111733 12122 ----
NM_207044chr111733 12122 ----
NM_207047chr111733 12122 ----
NM_207111chr782454 2193 1748 987 698 500 401 259 22224 299 1154 --
NM_207116chr782454 2193 1748 987 698 500 401 259 22224 299 1154 --
NM_207303chr1033861 3504 3213 22962 193 ----
NM_207306chr154341 4327 4226 3763 239 14333 ----
NM_207325chr1911651 ------
NM_207343chr111348 ------
NM_207371chr1011258 --11509 --
NM_207380chr1563563 3405 2375 830 774 81 33522 547 304 --11133
NM_207412chr821248 960 21127 277 ----
NM_207445chr15----1217 --
NM_207481chr211318 ------
NM_207520chr2171 ------
NM_207521chr2171 ------
NM_212460chr721567 754 ------
NM_212467chr1552541 868 778 695 376 --11004 --
NM_212471chr17197 1404 ----
NM_212472chr17197 1404 ----
NM_212554chr1011255 ------
NM_213593chr1--2995 168 ----
NM_213594chr122274 113 ------
NM_213609chr321037 119 ------
NM_213651chr12156 139 1216 ----