TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-665
miRNA Sequence: ACCAGGAGGCUGAGGCCCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr83706 240 172 1467 1187 --
NM_000052chrX42828 1125 1069 831 13373 12363 --
NM_000084chrX126179 6152 5875 5229 4910 4556 4328 2507 2257 2187 2048 538 15167 11522 1953
NM_000127chr81216 ------
NM_000135chr16172 ------
NM_000180chr171205 ----1157
NM_000212chr1741969 979 292 277 ------
NM_000217chr1285325 4906 4687 4205 3799 3423 1266 716 --12053 --
NM_000264chr973333 2078 1161 1062 602 566 251 --12057 --
NM_000266chrX2937 401 1969 --127
NM_000267chr1732367 375 106 12639 ----
NM_000278chr1052217 1678 1450 868 787 --1754 --
NM_000321chr1331606 506 380 ------
NM_000330chrX------12059
NM_000335chr331772 853 97 --11900 --
NM_000393chr23746 365 95 ------
NM_000430chr1782897 2801 2472 1279 1185 511 470 342 1118 13309 --
NM_000461chr363675 1712 1667 1297 1223 887 11485 11098 1994
NM_000478chr11665 --3621 252 194 --
NM_000489chrX42911 706 523 174 --1801 --
NM_000555chrX237801 7687 7630 7057 6351 6328 6108 5804 5609 5502 5355 5021 4972 2765 2748 1910 699 616 553 516 345 165 66 --25146 3139 15267
NM_000610chr1152546 1941 1922 1000 319 1935 1520 --
NM_000615chr1132905 1864 1146 1956 32162 1968 630 --
NM_000618chr12106009 5517 5413 5400 4946 4855 4166 1479 1174 360 22287 204 15382 --
NM_000701chr1--184 ----
NM_000720chr32510 504 ------
NM_000723chr1741207 576 564 504 1408 ----
NM_000725chr122952 163 --1192 --
NM_000726chr231095 1028 373 ------
NM_000767chr193444 328 90 --11246 --
NM_000812chr41384 ------
NM_000814chr1583872 3769 3666 3401 3192 2928 1365 553 --13597 13720
NM_000826chr42461 131 11645 ----
NM_000828chrX41536 1406 556 464 --1808 --
NM_000829chr1111881 ------
NM_000833chr1611271 158 --11207
NM_000834chr122236 147 1140 1320 1911
NM_000841chr61852 1242 1726 --
NM_000845chr71359 ----182
NM_000859chr541433 1227 425 376 ----11414
NM_000868chrX32584 780 431 1887 ----
NM_000875chr1596935 5950 5539 5454 5224 4923 1779 766 98 --34802 4420 2254 --
NM_000883chr73586 450 442 ------
NM_000885chr221545 1397 ----1660
NM_000891chr1783521 3058 2659 2408 1279 1133 1061 995 ------
NM_000899chr1241594 795 610 415 ------
NM_000900chr12--136 1235 --
NM_000944chr452294 2200 1712 807 510 --11773 --
NM_000965chr31956 --11289 --
NM_000966chr123896 675 175 --11000 --
NM_001001323chr1232317 2287 767 22736 606 ----
NM_001001331chr342482 1845 1079 269 1916 --12062
NM_001001396chr193918 3674 3461 3256 3112 1459 1072 619 169 1628 23202 579 1111
NM_001001481chr873345 3198 2952 2403 896 394 155 11241 12742 --
NM_001001484chr102463 120 11956 ----
NM_001001548chr72114 56 ----1407
NM_001001557chr82782 744 12183 11450 --
NM_001001740chr1----1237 --
NM_001001995chrX51806 1666 1560 1516 578 11337 ----
NM_001002032chr171278 1718 177 --
NM_001002033chr17--1818 1177 187
NM_001002762chr1082848 2539 2309 2069 832 596 344 145 --22512 67 12522
NM_001002811chr171590 1529 1236 982 624 604 565 11568 21457 1159 --
NM_001002860chr1474279 4127 3794 3227 1175 753 689 13761 ----
NM_001002877chr22286 56 ------
NM_001002914chr1741182 992 428 109 --21054 827 1410
NM_001003406chr2263081 2560 2259 821 811 389 11060 12047 12520
NM_001003652chr18198580 7880 6890 6436 6420 6196 5510 5298 2711 2552 2540 2081 2029 1825 1374 1087 834 529 50 27193 6369 46862 5583 1541 574 13220
NM_001003800chr973559 3138 2526 2369 1404 1226 339 13351 12988 13266
NM_001003940chr1573425 3351 2983 2908 2462 611 600 13226 23121 691 13410
NM_001004127chr131187 ----1354
NM_001004304chr1272430 2169 2136 1138 1015 453 225 1839 22686 2183 1111
NM_001004360chr261747 1629 1599 1294 284 235 ------
NM_001004419chr1234552 4151 3454 --1850 11377
NM_001005266chr151495 --2213 192 --
NM_001005271chr1721127 918 1834 11105 --
NM_001005335chr191264 --1296 --
NM_001005404chr17144434 3596 3505 3013 1278 974 899 668 564 558 405 343 216 150 --1646 1459
NM_001005473chr5116656 6377 6310 5746 5038 4289 2047 1346 1107 864 377 26414 2651 ----
NM_001005474chr321238 1034 --1187 --
NM_001005743chr1461226 1147 1086 894 398 86 ------
NM_001005782chr221013 937 ----1370
NM_001005845chr82357 342 --127 --
NM_001005920chr1631099 388 260 ------
NM_001006115chr3102613 2444 1975 1901 1752 1727 1071 671 449 315 12641 1959 --
NM_001006638chr1731041 770 167 --11197 --
NM_001007067chr831004 200 61 ------
NM_001007246chr2141229 629 370 175 11719 ----
NM_001007277chr1121031 60 1850 ----
NM_001007278chr1394266 3892 3531 3495 3297 1299 604 484 429 14175 ----
NM_001007471chr91581 --2652 156 --
NM_001007553chr131002 960 446 --1395 --
NM_001008220chr553734 3660 2665 942 730 ------
NM_001008222chrX3453 345 320 --2503 239 --
NM_001008223chr123543 512 58 --1154 --
NM_001008567chr9------1327
NM_001008701chr19112879 2764 2732 2158 1199 1183 833 703 507 388 367 13129 21231 627 --
NM_001009899chr3156438 5549 5463 5225 4727 4587 4263 2522 2199 2177 2040 1553 1449 1436 132 --26269 2064 --
NM_001009960chr752699 2107 1763 1132 215 --1888 --
NM_001009993chr293983 3796 3279 3223 3093 3060 1305 884 586 1987 11198 --
NM_001010867chr1246318 6107 6098 5860 5801 5660 5477 5406 5375 5259 5246 5173 4520 4301 4164 2597 2456 2232 2089 1965 1654 1198 789 213 35727 5720 5689 45228 4767 2670 2103 11464
NM_001010888chrX44311 1582 1504 1299 14206 1637 --
NM_001010924chr1031200 343 135 ------
NM_001010935chr12959 115 ----1203
NM_001010971chr11884 ------
NM_001011513chr454018 1637 1225 255 211 13535 12933 --
NM_001011537chr341888 1607 1456 376 --12081 --
NM_001012264chr143958 758 88 1328 ----
NM_001012761chr571789 928 832 502 402 389 128 --12479 --
NM_001012979chrX160 ------
NM_001012989chrX2653 36 ------
NM_001012993chr951083 1003 969 479 421 2443 271 ----
NM_001013399chr62841 191 ------
NM_001013415chr411431 1481 ----
NM_001013438chr3----151 --
NM_001013635chr123455 433 112 --2834 806 --
NM_001013693chr182280 2164 865 851 829 676 260 173 --1406 12496
NM_001013843chr15148 ------
NM_001014797chr10128179 7430 7350 7208 6867 5647 3165 2959 2212 2102 2037 820 47158 6756 5481 2609 17874 --
NM_001015055chr22378 108 ------
NM_001015877chrX63028 2635 643 556 491 223 22536 303 22248 687 --
NM_001015887chr341554 1522 623 218 21472 734 11160 11172
NM_001017368chr1772495 874 677 483 437 340 236 31937 1029 251 2784 180 12720
NM_001017369chr431101 41 22 --1100 175
NM_001017395chr372952 2834 2748 2686 1354 1234 965 2562 212 ----
NM_001017415chr1----1218 --
NM_001017424chr121213 322 ------
NM_001017924chr10----11400 --
NM_001017926chr8----21821 1272 --
NM_001017930chrX1111 --11022 --
NM_001017998chr91119 ------
NM_001017999chr172131 2075 1893 1709 1445 684 583 ----1496
NM_001018050chr2283401 3377 3177 2871 2549 2354 1040 987 2579 255 32618 1174 769 --
NM_001018078chr9195 --1195 --
NM_001024218chr14----1594 --
NM_001024808chr1241985 1876 812 458 --2495 89 --
NM_001024847chr322522 672 197 22181 617 1693
NM_001024858chr1462713 2286 1167 1138 318 171 --12533 --
NM_001024912chr1911862 --1759 --
NM_001024948chr143147 2616 1290 1157 --1616 11277
NM_001024948chr143147 2616 1290 1157 --1616 11277
NM_001025077chr1097150 6560 5515 5277 5189 2151 1591 1328 968 --11228 16099
NM_001025079chr3103145 2714 1513 1310 1178 1110 1001 752 739 608 --1503 23733 2925
NM_001025201chr25677 509 208 193 72 ------
NM_001025233chr1242673 2636 1015 752 1795 22659 426 --
NM_001025266chr3164837 4314 4269 4036 3834 3821 3687 3657 3562 3257 1701 1688 1646 1612 882 386 21430 314 21670 549 --
NM_001025366chr641359 1309 330 322 ----1250
NM_001025579chr171114 --131 --
NM_001025580chrX53973 3167 540 346 70 23082 1470 --13032
NM_001025780chr931137 1034 1021 1375 11277 --
NM_001029863chr651130 1010 998 535 505 ------
NM_001029882chr14600 547 107 42 ------
NM_001030001chr14--1350 ----
NM_001030007chr1643707 3581 3157 2985 --1575 1213
NM_001030055chr1484615 4423 4246 3362 3143 439 388 280 --1839 13750
NM_001031690chr7112891 2806 2652 2392 2102 1999 1893 1014 813 593 427 22611 882 33072 2463 273 1138
NM_001031695chr2294559 4176 3805 1728 796 613 518 498 489 --11693 --
NM_001031804chr1654407 3546 3464 3440 639 13780 1804 --
NM_001031812chr53381 311 23 ------
NM_001032279chr111364 ------
NM_001032288chr2021507 1076 --21310 253 --
NM_001032393chrX----1137 --
NM_001032999chr20175100 4283 3254 3239 2134 1952 1929 1813 1699 1586 1470 1428 1169 1156 958 869 246 24443 4398 --21076 854
NM_001033025chr1----1294 --
NM_001033081chr131817 1546 494 21372 169 31914 1805 1200 21629 1597
NM_001033117chr3114577 4396 4113 3393 3380 1916 1689 1571 1484 1087 582 11513 11428 14792
NM_001033557chr2------1512
NM_001033667chr1----1213 --
NM_001033723chr842576 1781 302 43 42612 2321 2165 498 11999 --
NM_001034837chr5----1100 --
NM_001034915chr81456 2502 355 1560 --
NM_001034954chr1072206 2007 1989 876 861 336 282 --1244 --
NM_001035chr12293 122 3382 258 241 --176
NM_001037132chr742084 1921 899 624 --1618 --
NM_001037164chr721551 659 1549 --1102
NM_001037582chr461330 616 429 324 311 72 ----11480
NM_001038707chr1102225 1765 1718 1462 931 822 615 460 322 315 ----1193
NM_001039457chr1154 ------
NM_001039479chr1452191 1887 1559 1517 1500 32349 1867 644 32281 2081 48 --
NM_001039538chr233575 2640 866 --150 --
NM_001039570chr22163889 3828 3747 3668 3492 3438 3372 3284 2959 1731 1679 1439 1102 434 194 68 24677 450 34132 1313 487 1519
NM_001039574chr131064 820 248 ------
NM_001039590chrX22466 1033 --13209 --
NM_001039618chr1194593 3904 2245 1466 1408 1165 894 541 236 23679 2169 1484 --
NM_001039690chr1622368 1623 --52169 768 492 354 172 1887
NM_001039711chr1166 --2843 362 --
NM_001039840chrX76023 5812 5013 4017 2346 1039 23 --14557 --
NM_001040020chr72491 105 --11596 --
NM_001040057chr71991 1123 ----
NM_001040134chr192561 321 --41448 1221 1075 982 --
NM_001040142chr2----11865 --
NM_001040152chr764348 3400 3376 1868 1195 136 11451 1145 14342
NM_001040152chr764348 3400 3376 1868 1195 136 11451 1145 14342
NM_001040153chr13------1853
NM_001040181chr32980 902 ------
NM_001040217chr12468 228 --1445 --
NM_001040260chr421184 875 1203 1195 11006
NM_001040280chr6101410 1306 1123 1113 507 391 383 363 323 28 ----1268
NM_001040284chr1675761 5631 4706 4593 2315 1016 896 25467 5121 173 14525
NM_001040402chr432774 1047 99 ----2489 183
NM_001040429chr1353445 2261 1249 1196 44 --22312 69 --
NM_001040450chr1552631 2286 2072 382 336 12510 ----
NM_001040712chr923180 62 ------
NM_001042388chr185848 275 267 113 27 --2793 356 --
NM_001042406chr621081 390 ------
NM_001042478chr12371 141 --289 27 --
NM_001042510chr831616 1348 590 --1150 --
NM_001042537chrX52246 2173 1661 658 193 ----12161
NM_001042539chr1651117 1032 904 369 358 ------
NM_001042599chr257630 7065 6466 6371 5268 16478 27721 4995 --
NM_001042601chr373062 2982 2335 710 358 319 38 ----12472
NM_001042632chr201812 42419 2147 1006 514 2971 536 --
NM_001042632chr201812 42419 2147 1006 514 2971 536 --
NM_001042681chr172608 2063 2044 1759 279 185 44 21024 241 22093 1984 --
NM_001042762chr72882 357 11107 ----
NM_001044385chr273773 3421 3334 3074 2527 885 862 14063 ----
NM_001092chr1762192 1941 1726 1576 790 215 1739 3768 454 427 --
NM_001095chr1251738 1555 1431 1209 123 --31823 1500 521 --
NM_001106chr3148003 7993 7562 7401 7330 7046 6879 6735 6276 3619 2745 1080 387 310 37320 7188 2110 57501 3646 3416 1842 1725 11019
NM_001121chr10----11601 --
NM_001144chr164970 937 326 30 1533 2547 244 --
NM_001148chr451798 1697 1444 449 226 ------
NM_001167chrX115828 5574 5340 2466 2460 2078 1973 1796 1486 1461 1050 16466 11942 11524
NM_001174chrX12217 ----1273
NM_001219chr762206 1882 1826 1584 820 184 --153 --
NM_001222chr1031659 468 341 --11810 --
NM_001257chr1631412 291 214 1414 1263 --
NM_001259chr7125991 4711 4634 2543 2515 1939 1552 1137 1000 901 776 621 14000 --1128
NM_001261chr931054 44 28 31100 956 216 1432 --
NM_001265chr132773 755 ----1875
NM_001267chr174522 194 140 26 ------
NM_001273chr123183 104 57 ------
NM_001274chr112108 28 ------
NM_001284chr51386 ----1111
NM_001292chr152185 98 --1162 --
NM_001299chr19----153 --
NM_001304chr1763373 3077 3036 2466 566 92 13538 159 --
NM_001356chrX12546 1633 --11651
NM_001357chr12274 22 ------
NM_001365chr173762 634 197 ------
NM_001383chr171184 --1276 --
NM_001386chr842024 2015 1505 984 12264 ----
NM_001390chr1863203 1354 1186 603 284 171 --13570 --
NM_001396chr2152478 2412 1104 796 325 ------
NM_001406chr1761650 1478 557 187 66 42 --31673 509 478 --
NM_001408chr131511 1436 68 11056 1447 11389
NM_001417chr1251836 1450 1358 1349 107 1763 --1466
NM_001420chr1942417 1924 262 223 --12570 11211
NM_001423chr1251406 1322 733 452 391 --1331 1759
NM_001438chr13529 496 172 --12613 --
NM_001460chr1103256 3039 2990 2877 2791 2666 2573 2339 584 142 ------
NM_001478chr122350 166 ----1751
NM_001522chrX135 ------
NM_001527chr694119 3764 3440 3123 3019 3006 1827 1004 152 11907 181 --
NM_001543chr5134655 4530 4378 3776 2965 1864 1665 1504 963 734 601 587 267 24042 1629 23055 252 --
NM_001546chr611438 ----11221
NM_001552chr172880 44 1305 11039 --
NM_001616chr242965 2732 2234 1165 ----1112
NM_001624chr631590 1261 493 21414 511 11876 127
NM_001635chr72881 258 ------
NM_001642chr1151199 1171 1133 913 426 ----1123
NM_001650chr1811008 22917 1244 ----
NM_001654chrX------1163
NM_001659chr1272562 2391 2211 1729 1089 1063 167 1694 1345 --
NM_001660chr32266 80 --1529 --
NM_001662chr73138 132 38 ------
NM_001665chr112576 97 --1536 1400
NM_001677chr131111 713 297 1838 ----
NM_001678chr17101752 1561 1554 1457 1264 728 520 306 277 31 --1546 145
NM_001694chr162386 316 2468 404 ----
NM_001701chr921546 1357 ------
NM_001707chr75704 330 170 58 52 --126 --
NM_001731chr121947 --173 --
NM_001742chr731632 161 46 ------
NM_001753chr781520 1410 1327 665 557 168 115 54 ------
NM_001759chr1273461 3286 1159 1124 1064 607 61 34968 4537 3311 31890 1094 679 --
NM_001789chr331485 1219 194 ----1484
NM_001804chr52195 62 --1106 1783
NM_001806chr1972900 2530 1160 985 931 366 130 --22471 1995 --
NM_001810chr203718 536 524 ------
NM_001830chrX53207 1617 691 583 340 13198 ----
NM_001859chr973443 3130 2800 2572 1282 1274 71 21585 950 --23938 2892
NM_001873chr41286 --1654 --
NM_001938chr1199 ------
NM_001945chr551367 1246 1128 1050 248 11358 11140 1308
NM_001946chr12----157 --
NM_001949chr662815 2478 2058 1043 842 706 --1249 1621
NM_001968chr42262 169 ------
NM_001981chr14311 241 118 45 ----1320
NM_001982chr122995 327 ----1283
NM_001987chr12134189 3912 3549 1216 713 684 617 551 534 510 247 205 139 --12873 1704
NM_001995chr451152 547 464 315 53 ------
NM_002006chr434587 1743 665 13853 --15262
NM_002009chr1532613 2232 1753 11117 21820 434 --
NM_002010chr131453 ----1195
NM_002024chrX51549 882 563 386 309 --11672 --
NM_002025chrX148989 8886 8870 8754 7877 7026 6974 6891 6701 6244 6236 6086 646 351 38050 7243 6590 16070 18444
NM_002062chr611591 21450 628 21472 190 --
NM_002070chr31260 --1247 --
NM_002072chr92952 396 1116 ----
NM_002126chr1793765 3062 2664 1292 1046 455 336 220 51 1947 --12582
NM_002131chr651346 1062 935 909 469 --147 1274
NM_002135chr122387 366 1490 ----
NM_002141chr7159 --1588 --
NM_002146chr1731200 930 117 ----11372
NM_002147chr173639 248 156 1925 --1175
NM_002161chr92360 332 1406 ----
NM_002167chr1175 1147 1346 --
NM_002202chr51869 ------
NM_002211chr101218 1262 ----
NM_002221chr1132962 2871 2624 2469 2437 2365 1162 1088 918 493 465 105 50 12831 21031 1002 --
NM_002230chr176993 747 446 402 204 64 --3947 258 218 --
NM_002232chr13943 909 309 ------
NM_002247chr102909 232 ------
NM_002248chr19134 ----186
NM_002253chr41355 1168 --2878 30
NM_002264chr364577 4473 4466 3772 1238 59 13406 11298 --
NM_002268chr311903 1563 ----
NM_002270chr585452 5405 4845 3944 3797 3732 1627 883 2595 51 ----
NM_002271chr1342470 2389 2265 2156 22231 208 --1125
NM_002283chr123763 520 26 --3805 527 204 1106
NM_002293chr182229 2139 2080 1940 1095 1051 394 253 1894 ----
NM_002315chr112223 108 --1191 --
NM_002349chr231556 637 624 ------
NM_002359chr17114157 3765 3629 3515 3231 2891 2844 2781 1291 1144 1131 --53942 3895 3200 1376 1210 12708
NM_002372chr52568 52 --192 --
NM_002373chr153538 403 179 ----1993
NM_002382chr1431188 1111 840 11075 1401 1159
NM_002390chr1752069 1918 1877 1451 229 --1127 --
NM_002397chr521825 1707 ----11945
NM_002398chr221087 404 1183 ----
NM_002402chr741003 868 370 91 ------
NM_002430chr22142601 2570 2562 2157 2099 1971 1893 1753 1014 834 731 677 324 260 2520 504 ----
NM_002451chr983322 3302 3264 2562 1402 959 167 62 1408 --12828
NM_002469chr123481 342 58 ------
NM_002473chr223288 119 93 ------
NM_002499chr1572288 2245 2068 1537 987 917 527 21922 48 ----
NM_002501chr1994093 4001 2600 1566 1551 987 902 782 26 --1380 --
NM_002516chr192267 78 --1110 --
NM_002537chr152797 438 --2889 764 --
NM_002558chr1731113 781 743 --1234 --
NM_002570chr152950 260 --1294 --
NM_002572chr112343 295 1112 ----
NM_002577chr393787 3506 2966 2884 2711 2607 2575 1600 798 1434 ----
NM_002581chr984864 4505 1826 1299 1027 978 849 668 23490 390 25223 4663 15159
NM_002595chr1221721 1279 21476 472 ----
NM_002607chr741071 875 80 47 1507 ----
NM_002613chr1665255 3335 1704 1035 1028 520 24371 455 44527 2141 1872 1388 --
NM_002636chr62410 223 --191 --
NM_002657chr20113937 3631 2947 2483 2455 1447 1369 1292 982 870 532 11083 1402 33774 3421 340
NM_002660chr20----1922 1264
NM_002698chr1932902 2833 2315 --1180 --
NM_002699chr121386 442 11348 2974 589 --
NM_002709chr223101 879 ------
NM_002713chr11905 --1123 --
NM_002717chr82528 34 --1473 1482
NM_002736chr711722 ------
NM_002745chr22144217 4189 4181 3603 3379 2949 1827 1315 1258 891 328 296 145 98 14266 22956 201 --
NM_002755chr152327 150 --1633 --
NM_002773chr161393 --1159 1483
NM_002779chr102446 365 ------
NM_002822chr121136 11469 11810 --
NM_002833chr1531204 640 350 ------
NM_002854chr22175 ----1152
NM_002855chr1193486 3457 3049 2659 2589 2341 1309 1282 625 --33636 3203 137 --
NM_002858chr141331 1215 434 303 ------
NM_002868chr12112385 2257 2141 1819 1589 1558 875 376 361 354 130 --22333 2215 --
NM_002906chr1121735 711 1928 ----
NM_002911chr19157 --21406 1147 --
NM_002994chr451756 1367 771 526 496 2146 60 ----
NM_003010chr1732232 592 150 22335 376 --1470
NM_003029chr141423 1310 522 255 1483 31121 529 347 --
NM_003068chr82681 87 ------
NM_003081chr2011149 --1182 --
NM_003098chr202217 158 ----1508
NM_003108chr286574 5581 5414 2267 1889 1101 372 253 15055 34789 2871 2606 --
NM_003131chr691887 1758 1609 916 571 538 396 346 255 --1622 11771
NM_003137chr661897 1697 1679 737 525 260 1488 ----
NM_003139chr115864 795 721 662 54 ------
NM_003145chr11439 ----2417 133
NM_003150chr1792275 2184 1882 1681 1470 850 676 392 138 --2443 373 --
NM_003155chr852532 1777 1066 860 153 ----12040
NM_003156chr1141249 436 361 313 ------
NM_003161chr1731406 627 318 --1640 --
NM_003170chr172574 229 ------
NM_003178chr342249 2158 662 179 1874 1298 --
NM_003203chr21342 12490 2883 163 --
NM_003205chr1541477 639 579 274 --11602 --
NM_003216chr2262727 2716 2395 2263 1339 1247 42367 923 870 264 32350 1211 315 --
NM_003221chr654093 3264 1652 989 748 --33438 1632 549 12603
NM_003223chr16----130 --
NM_003239chr141700 31032 881 797 --11049
NM_003246chr15------2656 60
NM_003253chr2181810 1514 1493 564 224 104 66 43 --11613 --
NM_003255chr1741922 1860 1828 876 184 ----
NM_003262chr3135060 4633 4516 4496 3709 3569 3542 3484 3455 3392 2064 1643 1206 --33617 3536 564 --
NM_003275chr911057 --11141 --
NM_003290chr192315 64 ------
NM_003319chr2----1687 1750
NM_003320chr11104309 4176 3792 3536 2896 1556 1245 1062 811 736 --22780 1296 --
NM_003326chr142691 2334 917 136 12505 ----
NM_003334chrX1142 ------
NM_003342chr1782995 2869 2113 2100 1291 759 101 72 --22082 924 1717
NM_003344chr751345 1079 539 511 171 --11109 1398
NM_003348chr1261523 1442 1115 643 277 36 11589 ----
NM_003373chr1031242 603 109 ------
NM_003392chr363563 3278 3261 481 135 68 23398 803 ----
NM_003394chr125725 719 511 472 223 --194 1651
NM_003400chr21342 ------
NM_003404chr2021898 830 --11342 --
NM_003406chr861562 1497 1484 1334 1239 359 ------
NM_003407chr192232 55 ------
NM_003413chrX32009 796 258 ------
NM_003432chr51118 --1488 --
NM_003442chr111103 --149 --
NM_003468chr244139 3535 2997 1402 11251 13163 11136
NM_003478chr1133123 2799 935 --1460 --
NM_003482chr123982 776 512 ------
NM_003489chr2173445 3291 2849 895 870 794 227 13077 --1565
NM_003603chr42494 226 ------
NM_003617chr194484 4046 3919 3645 1994 1485 1194 1147 213 --14308 14969
NM_003633chr512029 12160 22444 2361 --
NM_003659chr21385 --1320 --
NM_003673chr17153 ------
NM_003711chr52111 86 ----1131
NM_003743chr232142 1938 1616 ------
NM_003771chr17--1197 1226 167
NM_003787chr1811311 --184 --
NM_003872chr232176 2091 539 --1849 --
NM_003913chr664177 3189 2667 1519 1381 1058 ------
NM_003939chr10113744 3647 3104 3060 2940 1504 1386 963 623 373 152 33830 3684 993 13159 --
NM_003958chr6113815 3602 3412 3300 2493 2434 1329 1122 668 521 286 43394 1436 1301 455 ----
NM_003988chr1052294 1755 1527 945 864 --1831 --
NM_003993chr1----1110 --
NM_004036chr26673 631 510 479 471 176 180 --1503
NM_004050chr1432676 2288 557 --22347 792 --
NM_004055chr1182006 1820 1618 1477 1411 788 476 465 --32036 1470 459 --
NM_004093chr1332184 398 357 --11979 --
NM_004094chr1442298 2280 411 50 ------
NM_004107chr19------168
NM_004112chr1741371 508 289 240 2477 363 21725 1657 --
NM_004136chr1511002 22264 336 ----
NM_004157chr36894 749 354 342 204 96 --148 --
NM_004171chr11149250 9018 8748 8388 8011 6788 3655 2606 2347 2285 2165 2049 1055 148 --26304 6074 26589 3595
NM_004187chrX41302 380 374 85 --1190 --
NM_004200chr1172877 2097 1239 852 763 246 226 1531 22278 523 12080
NM_004225chr811121 ----11405
NM_004227chr753121 2107 304 252 178 13004 --1626
NM_004240chr19----147 --
NM_004242chr6----141 --
NM_004302chr1252800 2542 2121 981 969 22729 1122 22248 30 11884
NM_004330chr15----1778 --
NM_004343chr19143 1371 1492 --
NM_004349chr821097 866 --11081 --
NM_004392chr135930 558 387 352 106 --12037 --
NM_004393chr311547 --1776 --
NM_004397chr1194299 3677 3598 3474 2670 1672 1559 1013 264 23516 1532 1765 --
NM_004411chr72707 73 ------
NM_004419chr103876 859 814 --2932 258 --
NM_004423chr342445 2170 2009 460 --32459 2068 971 --
NM_004425chr1------188
NM_004426chr1271969 1772 1396 1233 592 541 116 31636 1582 310 ----
NM_004427chr1271 24 --31000 895 828 --
NM_004429chrX61095 1077 1035 567 200 124 1254 11278 --
NM_004430chr841758 1740 924 586 12521 12197 --
NM_004432chr922092 923 1705 ----
NM_004433chr151590 633 316 160 60 21803 412 1671 1202
NM_004438chr2122826 2749 2531 2111 2016 1166 948 927 858 841 334 29 13150 ----
NM_004441chr341029 864 516 482 21068 1002 ----
NM_004454chr32249 230 --1613 --
NM_004459chr1731629 511 155 1673 --11477
NM_004475chr17101130 1057 961 860 840 745 439 363 165 156 --21197 877 1468
NM_004514chr1783072 2673 2313 2119 1950 1135 812 460 12127 ----
NM_004535chr2031607 628 410 ------
NM_004561chr1151674 1386 1334 1155 84 21632 518 --129
NM_004586chrX75419 4732 3663 1851 145 133 56 25398 197 ----
NM_004588chr1183907 3660 3648 3198 3008 511 406 129 12786 23127 82 12928
NM_004612chr944514 3404 3014 658 --34648 401 49 --
NM_004630chr1131211 894 824 1949 1216 --
NM_004654chrY31175 1137 997 1482 ----
NM_004655chr17259 46 --1246 --
NM_004660chrY62084 2043 1482 937 240 121 1629 --11595
NM_004663chr1511392 31282 607 501 ----
NM_004685chr1312221 1984 1561 11982
NM_004687chr1741705 762 700 436 --11974 1279
NM_004711chr22143506 3340 3011 2995 2988 2806 2683 2642 2459 2402 2284 1121 723 69 --23628 1364 --
NM_004719chr1242129 1897 1762 178 ------
NM_004725chr1031424 1077 522 1352 2560 481 --
NM_004730chr542160 1604 817 298 --1533 --
NM_004736chr11664 --1186 --
NM_004755chr1421024 263 ------
NM_004762chr1771681 1310 1277 595 297 252 45 --2331 272 --
NM_004774chr1792671 2521 2492 2446 2399 2377 986 223 197 ------
NM_004786chr18------152
NM_004801chr23593 420 169 1393 ----
NM_004834chr252703 2219 1329 679 153 ------
NM_004846chr2156 ------
NM_004850chr231081 624 106 ------
NM_004852chr182114339 14010 13593 13198 12716 12410 12296 12043 11623 9548 9131 3180 3016 2823 2423 2085 1701 1396 1219 806 131 2725 294 312052 4634 1841 313383 3351 706
NM_004884chr153478 207 97 --1133 --
NM_004926chr1421750 24 11667 1216 --
NM_004943chr19----41233 1200 976 295 --
NM_004947chr361949 1721 1692 1607 969 283 1293 ----
NM_004952chr11778 --2918 314 --
NM_004961chrX41366 1301 423 116 --11409 --
NM_004973chr621622 493 --1122 --
NM_004975chr201952 --1372 --
NM_004979chrX5927 831 299 209 104 --11063 --
NM_004981chr221157 ----1115
NM_004992chrX188066 7163 7009 6730 6377 5806 5768 5721 5672 5388 5320 5259 2841 2640 2559 1635 1380 1204 17663 27839 2666 22791 2372
NM_005032chrX11000 --2345 96 --
NM_005053chr191151 ------
NM_005076chr1154163 3463 3411 2920 2752 2655 2587 1601 1191 1052 1035 996 834 559 68 13397 --13741
NM_005077chr91408 ------
NM_005094chr92661 279 173 1217 --
NM_005105chr162063 1643 796 686 371 179 11958 1353 1749
NM_005116chr20144356 4102 3968 3695 3165 1798 1679 1650 1623 1472 1338 1321 1308 845 --33862 1490 688 24610 1771
NM_005126chr362210 1588 1536 736 692 505 --1605 --
NM_005157chr96778 756 748 671 622 247 --11791 11402
NM_005178chr191164 125 --171
NM_005198chr221138 ----133
NM_005202chr141943 1712 1551 275 1175 --181
NM_005229chrX41285 1013 931 497 --21130 31 --
NM_005252chr142496 98 ------
NM_005263chr12384 99 --21198 500 2921 167
NM_005378chr21760 ------
NM_005380chr131208 1175 262 --11232 11255
NM_005386chr20146 ----1837
NM_005400chr2102995 2895 2753 2629 2251 587 453 424 408 59 32977 2125 460 1303 12143
NM_005402chr74684 638 382 268 --11752 --
NM_005409chr41199 2871 27 ----
NM_005415chr26682 661 501 254 218 55 --1240 --
NM_005436chr10104035 4008 3751 3245 3119 2923 2668 2546 1638 974 13538 1326 --
NM_005440chr17123124 1330 1024 737 645 406 352 346 128 92 85 77 ------
NM_005465chr141913 1731 1478 634 161 ----
NM_005507chr112196 77 ------
NM_005517chr121327 557 --2254 34 --
NM_005520chr51667 --1147 --
NM_005522chr741372 1034 250 229 21064 167 1136 --
NM_005530chr1521179 485 --11507 --
NM_005539chr1021298 80 11212 ----
NM_005542chr71693 21490 1470 --1131
NM_005565chr52531 34 --1590 --
NM_005574chr111488 ------
NM_005578chr3104768 4111 3744 3435 2056 1148 489 364 276 268 25081 4377 13876 --
NM_005584chr132575 66 1519 ----
NM_005596chr985885 5747 4933 4736 4203 2065 1285 500 24779 4494 --12285
NM_005604chr652030 947 411 92 74 12389 1667 1264
NM_005607chr8------1718
NM_005626chr13532 364 183 --1168 --
NM_005667chr2----1376 --
NM_005668chr553441 1773 1690 882 765 ----1537
NM_005682chr1651272 1247 1168 914 903 11262 --11218
NM_005708chr13------177
NM_005724chr152548 303 ------
NM_005754chr531045 828 180 21252 81 1491 --
NM_005786chr1831074 922 232 --1975 --
NM_005797chr1121689 398 11608 ----
NM_005822chr62171 91 1650 1376 --
NM_005828chr17185037 4573 4552 4099 3915 3805 3780 3670 3530 2028 1913 1856 1178 1025 751 532 150 46 14240 21649 1484 --
NM_005851chr112105 97 ------
NM_005857chr131447 68 49 --11216 --
NM_005898chr1132992 2381 736 --12507 --
NM_005904chr1831219 475 76 ------
NM_005910chr1763984 3877 3426 3006 1566 1532 12501 43092 2708 1034 363 --
NM_005920chr183716 3708 3321 2523 1445 1184 1178 1165 12361 53697 2991 2975 1273 1205 --
NM_005933chr1142766 2250 2234 439 --2536 227 --
NM_005934chr1952396 2348 2079 1639 40 12581 --12523
NM_005941chr883939 3762 3595 3315 3097 1233 376 356 --11508 --
NM_005967chr121117 --2473 43 --
NM_006016chr632034 1958 1693 --1341 --
NM_006032chr14------189
NM_006037chr244826 1830 780 27 13361 13220 24701 106
NM_006039chr174997 851 732 225 --1811 --
NM_006091chr1551772 1293 657 578 167 11731 --1200
NM_006133chr11102080 1955 1690 1643 1552 754 718 560 444 306 --11002 --
NM_006135chr111442 --1405 --
NM_006141chr1642771 1089 855 398 22052 1884 ----
NM_006148chr17152905 2589 2268 2073 2044 1958 648 586 443 437 331 214 169 160 56 --22958 2035 --
NM_006156chr141259 ----1269
NM_006176chr112638 98 --1739 --
NM_006194chr143185 107 91 ----1817
NM_006224chr1761925 714 706 553 462 432 ------
NM_006237chr1362292 1895 655 398 320 165 ------
NM_006244chr115551 445 180 117 62 ------
NM_006246chr141520 ------
NM_006265chr831037 521 469 --1989 --
NM_006279chr11573 --1229 --
NM_006281chr83967 942 226 134 ----
NM_006283chr864467 4255 3372 1499 693 49 14100 13572 --
NM_006289chr9----167 --
NM_006293chr155888 356 242 176 109 1937 ----
NM_006313chr1231639 1573 37 ------
NM_006315chr474026 3254 3053 1500 1376 298 105 11310 23881 913 --
NM_006328chr112497 98 ------
NM_006338chr13618 266 167 ------
NM_006352chr132007 1498 438 197 1546 --
NM_006369chr11303 1152 ----
NM_006371chr395247 4766 4646 4605 4117 1907 1498 434 246 43713 3692 1336 1259 2301 30 --
NM_006372chr6----1169 --
NM_006380chr1764421 3585 3548 3506 3471 646 12695 23408 3316 --
NM_006382chr17143 1255 --184
NM_006393chr10104393 4138 4037 3833 3471 3050 2839 1602 925 792 11188 1278 13492
NM_006401chr91146 --1182 --
NM_006451chr5------1349
NM_006454chr472524 2266 2180 1166 874 814 744 1114 1481 11011
NM_006460chr1751751 1492 1364 1315 175 ------
NM_006465chr1572270 2181 1455 891 537 392 36 1234 --11429
NM_006472chr141119 1024 835 810 159 2333 161 --
NM_006496chr121310 1240 31920 1226 781 1521 --
NM_006517chrX21565 1526 ----1315
NM_006534chr2063283 2591 2218 899 785 208 2276 97 ----
NM_006547chr721809 153 --1719 --
NM_006614chr342923 2679 1348 1311 1709 ----
NM_006618chr121430 529 --11311 --
NM_006633chr51621 123 ----
NM_006690chr20112200 1995 1973 1957 1605 1571 759 510 427 229 223 1901 22083 353 --
NM_006698chr2051320 1148 305 247 113 --21258 428 --
NM_006708chr64829 481 284 177 --3876 869 373 --
NM_006732chr1962001 1965 1640 1546 714 197 --1810 --
NM_006734chr611232 --11322 --
NM_006736chr221310 433 --31215 676 515 1443
NM_006750chr16127808 6224 5731 5712 4891 3066 2488 2283 2068 1135 463 408 37179 2306 492 --17893
NM_006756chr82160 87 --1264 --
NM_006772chr641547 1533 1121 36 11730 ----
NM_006807chr17------1982
NM_006814chr2062381 2092 879 696 547 489 12501 1574 146
NM_006826chr22188 180 ------
NM_006827chr1493313 2708 2605 2592 2343 2267 2208 1224 302 --22574 503 --
NM_006838chr123686 557 225 2475 401 ----
NM_006841chr32622 224 ------
NM_006852chr1742467 1112 707 452 ----1936
NM_006891chr2163 ------
NM_006927chr1651646 1389 1371 587 188 12081 ----
NM_006931chr1231587 208 94 1196 12052 11674
NM_006943chr2073129 2591 2116 1056 634 443 239 --2990 553 1123
NM_006948chr21--2287 280 --11740
NM_006950chrX3643 273 251 3380 363 319 1172 --
NM_006981chr992975 2829 2634 755 458 352 149 119 90 ------
NM_006987chr1751208 1188 1181 301 43 --21247 179 11114
NM_006988chr2131037 1014 349 ------
NM_006990chr151611 1569 985 960 213 11798 2800 403 12238
NM_006999chr531395 1359 350 ------
NM_007005chr91346 --21037 37 --
NM_007011chr15116561 6477 5870 5828 5402 4243 2720 2306 1857 566 165 --15299 --
NM_007026chr17----197 1571
NM_007047chr642105 1938 575 253 1714 12392 12371
NM_007050chr20146770 5907 5100 4951 2887 2046 1618 1576 1468 1103 1013 287 176 164 26825 2026 55370 2323 1634 447 331 27659 6506
NM_007067chr1751362 1246 1100 140 85 ------
NM_007106chr131692 12586 ----
NM_007137chrX85273 4944 4854 4276 3869 3748 3630 897 13402 14912 --
NM_007144chr172492 59 --11299 --
NM_007146chr1732806 2112 2085 12542 12643 --
NM_007174chr1241946 1716 600 483 --21899 885 --
NM_007189chr74460 367 196 97 --1428 --
NM_007192chr143313 292 282 --11009 --
NM_007218chr8----1182 --
NM_007219chr201952 --2885 134 1293
NM_007232chr205761 641 362 236 167 --153 --
NM_007245chr164712 642 328 209 --1112 --
NM_007245chr164712 642 328 209 --1112 --
NM_007260chr13733 171 107 2775 71 ----
NM_007271chr6101873 1737 1271 1235 1157 641 489 375 127 72 ------
NM_012081chr543305 2298 1151 185 1516 12385 --
NM_012090chr121207 1046 --1198 --
NM_012104chr1163286 2690 2400 1487 1000 533 --23541 239 --
NM_012153chr1152174 2073 1632 927 847 22003 1642 --166
NM_012191chr32129 31 --1198 --
NM_012192chr1152240 2101 1980 487 180 1138 ----
NM_012199chr194612 4342 4040 3361 3229 2893 1822 1640 1617 --11140 --
NM_012215chr1041947 1884 1779 569 ------
NM_012231chr161855 1454 662 619 613 311 --1283 --
NM_012232chr1732200 1695 248 --11431 --
NM_012248chr163686 500 258 ------
NM_012249chr232892 2525 1245 --1715 --
NM_012259chr61345 21005 265 --1430
NM_012261chr203620 533 30 --1501 --
NM_012281chr731638 936 381 --21857 848 --
NM_012301chr741858 1837 650 617 ------
NM_012302chr131098 440 105 ------
NM_012304chr542479 2343 1884 1865 ------
NM_012309chr11134559 3751 3699 3596 3388 3353 648 610 499 379 345 200 34 14947 21343 123 --
NM_012343chr5------1109
NM_012347chr653035 2649 971 368 235 1486 12411 --
NM_012384chr2041500 925 851 233 --12073 --
NM_012402chr1141215 1149 208 121 ------
NM_012414chr1----1865 --
NM_012470chr72191 169 ------
NM_013231chr1483787 3775 2814 1542 1242 1028 369 44 --14267 --
NM_013242chr162424 333 ------
NM_013245chr161254 1699 --1235
NM_013247chr25555 545 481 54 28 --1136 --
NM_013286chr362963 2793 2400 1215 499 343 --2809 103 13687
NM_013309chr153954 900 24 ----1433
NM_013323chr173993 467 408 --1262 --
NM_013336chr321653 182 --2668 615 --
NM_013372chr1552921 2143 1093 755 531 12619 2345 123 --
NM_013374chr373054 2988 2761 2475 2038 825 537 ----1109
NM_013381chr1231502 957 229 ----12405
NM_013382chr1461819 1800 1689 781 665 403 12201 31490 876 230 --
NM_013390chr951561 1187 689 468 334 --1640 --
NM_013433chr1941674 1635 1409 567 --31434 242 184 --
NM_013438chr941725 1532 698 221 31145 514 184 --192
NM_013444chrX31141 836 219 1724 ----
NM_013449chr12102953 2846 2802 2604 2099 812 711 697 367 189 --1856 1228
NM_013960chr81520 ------
NM_014002chr15742 660 613 540 60 --1121 --
NM_014010chr93557 154 71 ----165
NM_014112chr8105440 4731 4592 4426 4014 3862 1604 858 781 258 ----14485
NM_014154chr321586 1570 ------
NM_014155chr11117131 6777 6327 5719 5631 1804 1368 1355 1098 783 462 156 21337 157 --
NM_014157chr16103770 3205 2902 2458 1384 1294 1220 1199 973 743 --21281 139 1446
NM_014159chr31494 ------
NM_014184chr1------1116
NM_014191chr12169 --1847 --
NM_014238chr1761709 1080 558 387 312 68 21435 284 ----
NM_014240chr3133015 2942 2795 2679 2641 1372 1066 1054 844 509 301 180 122 12530 13486 --
NM_014268chr181344 11340 --154
NM_014289chrX41413 1304 426 130 ------
NM_014299chr1991947 1631 1534 1454 1443 1432 437 408 266 11651 --2765 304
NM_014300chr15122 --1113 --
NM_014326chr1551472 1148 529 188 57 --1588 --
NM_014363chr13--2134 124 --21232 457
NM_014388chr1195903 5674 5281 5242 5204 5128 5030 4997 4980 4375 4266 4189 4123 3851 3840 3819 2139 1980 892 ------
NM_014405chr1792192 2026 1900 1452 937 816 479 451 284 ----2714 343
NM_014408chr1193 --1510 --
NM_014409chr13974 790 295 1749 1119 --
NM_014417chr19160 --1202 --
NM_014452chr62989 68 2841 24 1216 --
NM_014547chr152249 80 ------
NM_014554chr1242252 1846 804 347 1120 --11828
NM_014571chr1102664 2485 2426 2404 2280 2170 1995 295 258 212 1479 32005 933 517 22352 202
NM_014630chr15103822 2460 1108 919 753 423 401 256 242 214 11052 32928 853 346 --
NM_014636chr9114103 3756 3193 2782 1504 1435 1108 1056 781 652 76 11418 44126 3538 231 38 --
NM_014647chr1642083 1558 717 560 ------
NM_014661chr10133937 3734 3697 3006 2607 2577 2452 1514 1349 905 555 431 114 --23239 453 --
NM_014667chr321622 252 12403 12111 --
NM_014670chr231164 260 70 ------
NM_014705chr721919 437 ----11985
NM_014712chr164479 442 181 172 ------
NM_014717chr192860 710 ------
NM_014718chr124782 716 565 81 --2217 201 --
NM_014720chr102221 64 --11627 --
NM_014726chr172384 188 --1221 --
NM_014729chr821970 1567 21762 323 ----
NM_014730chr12134540 3953 3652 3431 3400 3234 1963 1749 1492 1354 456 277 246 1571 65195 4434 3388 2011 1736 1065 13449
NM_014742chr203300 136 92 21631 130 1115 --
NM_014751chr811475 1513 1678 --
NM_014767chr1072733 2335 1288 1185 1055 501 495 22834 2240 52388 2355 1355 994 264 --
NM_014770chr1211218 --1413 --
NM_014810chr193415 2930 2745 1485 1272 752 394 61 45 1505 11362 23396 100
NM_014828chr1421932 897 11790 186 --
NM_014835chr2042084 1546 1516 874 --12042 11582
NM_014839chr12745 317 --11774 --
NM_014859chr1731340 509 109 ------
NM_014871chr121544 1512 ----
NM_014872chr952298 1557 671 366 188 ----1607
NM_014877chr17117369 6953 6599 6128 6011 4965 2689 1688 1441 1330 1278 27025 5765 16622 --
NM_014901chr571815 1628 471 380 293 266 110 --11861 --
NM_014906chr1743922 3642 631 462 ------
NM_014909chr14143971 3929 3724 3645 3470 3453 3403 3142 2901 2833 2676 1014 975 527 22534 1185 32780 2527 37 --
NM_014920chr683817 3737 3598 3074 2952 1518 861 128 1515 --13124
NM_014938chr12102508 2489 2316 1995 1861 1638 802 404 377 86 --22324 2171 --
NM_014949chr11857 ------
NM_014952chr15101977 1818 1740 1523 834 671 375 236 158 127 ------
NM_014962chr2022583 1790 12439 1539 --
NM_014977chr142445 410 --2355 188 --
NM_014989chr6----11280 --
NM_015001chr1----1635 --
NM_015009chr32588 59 1200 ----
NM_015020chr1693095 2980 2843 2607 1474 1450 1059 331 213 --13510 --
NM_015032chr132900 697 1655 1548 --
NM_015039chr1114085 3516 3235 3140 1660 1533 1063 951 574 431 65 --21652 1561 --
NM_015042chr15114125 3796 3682 3673 3654 3447 3433 3284 3167 2844 1191 23919 1047 13245 13612
NM_015052chr73416 52 30 --11236 --
NM_015074chr1134666 4564 4494 3828 3541 3513 1882 1747 1024 876 752 486 90 11558 23229 788 --
NM_015075chrX42085 1961 1902 100 ------
NM_015076chr6114532 4451 3609 3524 3316 2844 2802 1799 1461 305 273 ------
NM_015090chr1135839 5793 5396 5086 4743 4339 4279 4082 3998 2368 1183 903 744 23877 660 26128 5166 --
NM_015093chr6----1506 --
NM_015107chrX52475 2274 580 532 125 --163 175
NM_015111chr583811 2708 1539 1450 1378 906 796 730 21011 238 32688 2611 198 --
NM_015112chr1------151
NM_015132chr721420 1219 --164 --
NM_015138chr1582548 2501 2149 1012 964 876 496 23 12094 32747 1808 239 --
NM_015194chr1762033 1405 1352 424 146 48 ------
NM_015206chr1542888 2735 2539 802 1607 23752 849 --
NM_015215chr172853 2728 1951 1945 960 445 257 22781 244 12086 --
NM_015227chr214989 737 726 669 --23091 2511 --
NM_015236chr421332 1172 ------
NM_015268chr32508 233 --197 --
NM_015270chr1291914 1882 1645 938 895 686 503 406 308 11785 ----
NM_015272chr1621986 1612 ----11695
NM_015288chr573479 3380 2788 2620 1084 709 589 --21283 284 --
NM_015299chr1473084 1586 1321 1118 987 920 586 11483 53597 3274 2888 532 428 1653
NM_015308chr112309 120 ------
NM_015313chr11114546 4411 4077 4052 3984 3901 3385 3088 878 463 70 13863 ----
NM_015317chr252748 2696 2467 2341 1943 12728 ----
NM_015326chr152557 2154 1911 908 775 --1544 --
NM_015335chr1232413 2131 1783 ------
NM_015344chr82281 37 11942 1107 --
NM_015347chr12------1357
NM_015349chr652706 2464 1962 104 77 ------
NM_015353chr1792831 2765 2258 2101 2038 1931 138 115 76 --32629 1009 197 1971
NM_015359chr82213 131 12072 --1314
NM_015443chr1731385 1053 264 --2952 467 --
NM_015457chr112435 357 ------
NM_015458chr864871 4460 3991 2108 1508 36 23630 3586 --14896
NM_015481chr121387 ------
NM_015483chr731123 395 325 1410 ----
NM_015497chr1541007 467 290 70 ------
NM_015503chr161458 --1588 --
NM_015508chr331293 580 498 --11245 --
NM_015526chr1931469 403 49 11284 ----
NM_015534chr13804 198 128 ------
NM_015548chr63901 364 183 ------
NM_015565chr2132266 1732 1646 --11653 --
NM_015576chr332139 1849 431 ------
NM_015678chr131546 ------
NM_015680chr2----2583 119 --
NM_015695chr661792 805 560 505 315 67 --1180 --
NM_015726chr181692 1610 1424 1395 747 529 346 66 ------
NM_015850chr891924 1883 1799 1780 1733 353 341 136 100 --1730 --
NM_015872chr161611 1394 1259 1185 472 452 --1280 --
NM_015888chr153403 3003 999 888 501 --11194 1686
NM_015895chr61246 ------
NM_015897chr19126 --1141 --
NM_015898chr1931636 869 752 12380 2741 654 --
NM_015902chr8----1219 --
NM_015906chr154669 3968 3041 1860 1805 ----13726
NM_015982chr171427 --1303 --
NM_015995chr15124411 4285 4186 4021 1713 1501 1384 1269 910 882 497 294 35383 3528 3510 23982 1352 --
NM_015999chr11596 ------
NM_016026chr1441286 567 283 205 11224 ----
NM_016037chr151009 887 335 322 172 --1304 --
NM_016039chr14----159 --
NM_016057chr1231152 815 199 --11089 --
NM_016083chr643841 3343 1219 1183 ----1775
NM_016131chr22727 555 --22272 1706 --
NM_016147chr112395 259 1830 ----
NM_016169chr10123182 3020 2901 2793 2673 2623 2559 2364 2141 1190 1182 285 --12442 --
NM_016173chr3154527 3858 3820 3648 3437 2995 2762 1772 1729 1650 1153 878 627 451 343 34055 3783 591 33791 1755 429 --
NM_016201chr362306 905 885 783 746 514 1564 ----
NM_016231chr1731682 1550 1081 171 --11127
NM_016250chr141795 ----1187
NM_016255chr643183 2287 1240 430 --12267 --
NM_016269chr41864 ----170
NM_016275chr331936 1816 124 ----1146
NM_016284chr167939 734 397 388 284 152 91 --1201 --
NM_016287chr172049 1929 1785 1385 1346 823 448 2399 227 31918 1854 805 --
NM_016320chr1111146 1329 --1194
NM_016333chr163211 196 166 1384 ----
NM_016337chr14----1178 --
NM_016339chr17151704 1626 1551 1521 1470 1316 1254 1230 575 409 341 311 286 222 109 --11207 --
NM_016352chr771441 1343 1217 580 547 293 164 21295 478 ----
NM_016374chr121305 545 ------
NM_016436chr2092703 2056 1002 934 570 520 420 238 37 --1223 --
NM_016441chr252405 2299 2276 2265 2088 ----11533
NM_016529chr134489 477 408 333 ------
NM_016580chr51335 ------
NM_016592chr20--1445 --1524
NM_016604chr54512 342 300 288 ------
NM_016605chr542540 2053 846 21 --21923 1756 --
NM_016652chr20159 --1151 170
NM_017413chrX102478 2343 1835 1776 973 683 649 425 396 230 --1174 12135
NM_017415chr564040 1647 1520 1032 910 491 ----1446
NM_017548chr352038 1829 1691 748 25 1594 --1385
NM_017551chr102553 317 22255 609 22230 449 --
NM_017575chr1751239 1050 646 631 41 --1214 --
NM_017582chr121794 1725 1112 ----
NM_017592chr1981142 1105 869 422 317 191 100 70 ------
NM_017596chr1114538 4251 4224 4204 3559 3215 3186 870 699 173 133 1539 44174 3391 1309 846 11262
NM_017610chr1541981 630 48 21 11584 ----
NM_017633chr632524 835 283 11568 1132 --
NM_017637chr9149430 9101 8827 8512 8464 8325 8057 7795 7717 7073 6533 3267 2120 363 13078 27355 6037 --
NM_017643chr1742931 2483 2129 542 1990 ----
NM_017650chr795874 5365 4338 4260 4078 3868 3737 947 57 11455 24060 935 14469
NM_017658chr1464446 3772 3692 1126 566 176 1449 ----
NM_017666chrX51903 1533 1409 1367 591 1886 11391 1478
NM_017668chr161551 1650 --185
NM_017734chr11469 ----170
NM_017742chr1821452 139 --1194 --
NM_017758chr173548 417 204 11182 121 2466 217
NM_017778chr83602 530 134 ------
NM_017780chr81168 --1284 --
NM_017789chr22699 620 ------
NM_017790chr9149 --130 --
NM_017848chrX124404 4384 3672 3540 3242 3165 3037 1728 705 442 204 165 1194 11301 11481
NM_017851chr1541140 956 888 844 --21087 354 1387
NM_017873chr9122975 2379 2314 2120 1201 1188 892 721 665 563 480 359 --12488 --
NM_017902chr10184795 4775 4743 4689 4491 3641 2180 1784 1557 1208 1196 778 635 527 418 209 121 24 12130 21414 380 1463
NM_017944chr1162975 2734 2561 2347 2079 2051 2610 525 --1485
NM_018013chr672862 2736 2531 2112 1089 231 134 32727 523 205 13067 12945
NM_018014chr241380 1131 489 290 --11321 --
NM_018026chr1141250 1141 375 231 --31383 266 31 --
NM_018027chr1053122 926 426 316 230 2279 29 ----
NM_018032chr164973 922 661 228 ------
NM_018045chr1112716 2698 2667 2646 2492 2443 2058 2023 2013 341 31 12281 12246 12654
NM_018061chr131178 1171 544 2535 446 ----
NM_018078chr41239 --1125 --
NM_018086chr261802 1717 1631 1393 1344 186 ----11431
NM_018133chr341482 1464 452 93 --129 --
NM_018179chr121555 2190 110 ----
NM_018201chr9112376 2118 1985 1881 998 852 402 336 274 256 165 22404 956 31725 354 343 12143
NM_018206chr162307 251 ------
NM_018216chr1126 ------
NM_018240chr15875 862 739 250 237 --1196 --
NM_018287chr1011313 --1415 --
NM_018362chr1133731 3394 3276 ------
NM_018364chr184107 3845 3117 2823 2661 2572 785 355 11315 ----
NM_018371chr821447 1308 --21129 1122 --
NM_018381chr195915 374 326 242 135 ------
NM_018383chr22311 115 --11447 1698
NM_018398chr31286 --143 --
NM_018403chr343463 3145 902 71 11555 12654 13543
NM_018416chr12122579 2525 2209 2148 2122 2051 1637 1044 598 279 203 178 1859 --1394
NM_018440chr898461 7706 7000 5620 3401 1296 659 464 57 27399 7349 15556 --
NM_018469chr1731364 124 59 ------
NM_018486chrX2162 123 ------
NM_018527chr13197 ------
NM_018557chr21119 ------
NM_018566chr153653 3295 792 471 364 ------
NM_018684chrX41127 1030 311 177 --1168 2997 981
NM_018712chr1131464 1114 574 1177 1139 --
NM_018715chr141638 1600 1492 325 22292 1758 32009 1785 600 --
NM_018896chr17176 --164 --
NM_018948chr131048 1015 491 ------
NM_018951chr73352 303 215 --1130 --
NM_018952chr171265 ----1148
NM_018977chrX----1318 1376
NM_018994chr11561 1399 ----
NM_018999chr10104929 4327 4255 1985 1195 1124 894 773 669 152 --14295 --
NM_019012chr122592 26 ----1156
NM_019046chr103825 613 351 ------
NM_019071chr71609 --1203 --
NM_019074chr152660 55 178 ----
NM_019094chr1243372 1343 1167 965 ----12405
NM_019096chr621001 859 1149 158 --
NM_019106chr2273202 2962 2873 2501 791 530 490 --22590 2161 --
NM_019106chr2273202 2962 2873 2501 791 530 490 --22590 2161 --
NM_019116chr16123642 3207 3200 2787 2777 2734 1258 1235 1074 770 706 637 23362 92 31307 1272 1221 --
NM_019600chr152142 108 1118 ----
NM_020066chr13861 709 115 ------
NM_020122chr2165717 5611 5587 5492 4860 4258 2025 1946 1441 1422 1333 1211 1075 231 110 71 --24266 1689 --
NM_020123chr1041272 1142 397 180 ------
NM_020144chr721677 196 --12084 --
NM_020184chr242363 2271 2075 1825 --2735 631 11673
NM_020205chr122294 360 --1283 --
NM_020309chr191316 --1846 --
NM_020338chr1092835 2394 2355 1361 1281 1034 737 698 414 --11441 23073 978
NM_020348chr1032438 1093 610 22813 374 ----
NM_020432chr72465 270 ------
NM_020443chr1207030 6342 6218 5958 5855 5842 5521 5343 4605 4383 2707 2610 2521 2498 2132 1862 661 321 272 156 12673 24984 312 --
NM_020466chr695009 4345 4205 4142 1632 1442 1149 1065 657 ----11385
NM_020474chr1842060 1443 407 183 1317 ----
NM_020546chr562588 2565 996 705 691 73 1347 1329 --
NM_020640chr351875 1778 777 661 538 1151 ----
NM_020647chr851840 1697 699 607 317 ----1598
NM_020673chr20157480 6190 6071 5775 5301 5260 5157 5144 2176 1906 1723 1446 1240 634 623 --15126 --
NM_020699chr1115025 4863 4286 3668 1873 1429 865 844 296 216 71 --14306 14613
NM_020713chr20102907 2743 2723 1959 1074 987 593 459 411 282 12285 1836 --
NM_020726chr5--2439 394 1423 --
NM_020734chr1222965 830 12595 13211 --
NM_020748chr17--21950 107 11404 --
NM_020760chr241844 1782 1480 437 ----1177
NM_020769chrX7833 820 692 684 622 280 22 164 ----
NM_020808chr11339 --1221 --
NM_020809chr1132007 831 290 11874 11593 --
NM_020810chr1423406 3126 11425 23103 2896 12279
NM_020818chr14----1403 --
NM_020825chr16173797 3692 3487 2979 2912 2884 2790 2773 2603 2494 2485 1333 1030 887 792 338 193 12653 32406 1139 843 --
NM_020850chr1693132 2724 2559 2052 1153 1067 993 317 119 --1519 --
NM_020854chr1831511 1355 1076 ------
NM_020856chr19188 --11242 --
NM_020858chr1561729 1557 1507 938 415 184 ------
NM_020860chr41784 21022 421 ----
NM_020870chr432038 1762 426 ------
NM_020873chr3----123 --
NM_020898chr125684 622 548 323 134 ------
NM_020899chr1772212 1860 1730 1724 931 846 106 1632 1180 --
NM_020920chr141334 ------
NM_020956chr1994729 4023 1550 1430 566 530 421 380 359 ----11410
NM_020958chr141382 ----1275
NM_020962chr1582027 944 920 882 805 747 715 458 --21551 1003 --
NM_020971chr192570 153 --1748 --
NM_020980chr1541429 690 682 246 ------
NM_020988chr1621338 372 --169 --
NM_021019chr12------1160
NM_021033chr1312691 21177 23 ----
NM_021038chr353309 2455 2387 2118 247 ------
NM_021072chr522408 80 1350 11019 --
NM_021116chr7178794 8188 7823 7561 6995 6842 6183 3344 2365 2312 2257 2115 2106 1879 1473 942 591 39078 3257 3167 48696 7810 7290 1309 1702
NM_021132chr1021344 125 21028 147 ----
NM_021155chr19133001 2896 2489 2357 2291 2219 2067 1964 677 635 601 362 169 --11078 12194
NM_021174chr82625 310 --2481 278 --
NM_021202chr2072282 2267 2125 956 861 587 437 12117 32044 247 204 12787
NM_021215chr2032075 1504 395 2899 447 1912 1330
NM_021627chr3199 ----1777
NM_021643chr23611 362 123 ----11592
NM_021648chr651716 1696 677 556 24 11058 1764 153
NM_021728chr142679 634 1985 ----
NM_021942chr41788 1872 1748 --
NM_021943chr642203 1974 185 142 ------
NM_021961chr11137380 6643 6434 6100 5314 4984 2457 2426 2111 2067 1336 704 210 --37096 6996 2278 --
NM_021964chr3115267 4943 4562 4134 4128 4059 2635 2315 2233 1841 1104 ------
NM_022048chr15106367 6307 6204 6195 5503 5463 4179 1219 596 63 --1350 --
NM_022058chr231976 1431 253 --11287 --
NM_022060chr1431285 1245 161 1497 21342 957 --
NM_022089chr11261 ------
NM_022117chrX1231 --1102 --
NM_022121chr631021 1011 964 ------
NM_022130chr541040 270 111 58 --169 --
NM_022143chr731432 280 221 ------
NM_022165chr19158 ------
NM_022343chr931288 1007 980 --1855 11019
NM_022462chr19133138 3039 2703 2641 2520 1419 1309 1243 1107 991 865 645 375 23047 1490 33540 310 261 13231
NM_022465chr1282906 2172 2144 2127 2116 1124 563 327 --32699 2220 1170 --
NM_022469chr142690 1233 453 196 --12319 --
NM_022552chr22916 200 ------
NM_022574chr7112169 2061 2033 1946 1833 1766 1744 1450 793 595 290 ------
NM_022648chr2104602 4545 4275 4199 3424 3256 2857 1026 441 78 14565 34133 1333 775 23690 3491
NM_022658chr1221327 291 1304 ----
NM_022659chr8----1202 --
NM_022719chr2243245 1492 1352 549 ------
NM_022730chr23994 907 738 --3965 840 726 --
NM_022733chr131185 1170 331 --1237 --
NM_022735chr131796 1759 136 11608 ----
NM_022739chr171448 ------
NM_022744chr1641113 1070 263 230 --1432 --
NM_022749chr86940 547 305 102 59 29 1234 21078 89 --
NM_022763chr333062 2703 2140 --12290 11986
NM_022780chr261318 1223 413 344 204 97 ------
NM_022821chr1----1422 --
NM_022832chr421955 441 --1176 --
NM_022893chr253091 2899 2580 2037 318 --1967 --
NM_022912chr252427 1006 863 482 305 22917 850 22715 900 --
NM_023079chr1721243 730 11564 11674 --
NM_024016chr171185 --1222 --
NM_024038chr19----1293 --
NM_024052chr1792649 2436 2391 2356 1993 1930 971 272 100 ------
NM_024076chr1932141 949 804 1206 ----
NM_024086chr17113446 3292 3239 2959 1475 1399 1252 1201 1142 831 593 --23285 3265 13697
NM_024320chr171641 1792 130 --
NM_024345chr995938 5643 4748 4295 2345 613 285 230 113 --2263 33 --
NM_024539chrX1977 ------
NM_024617chr91820 ----1842
NM_024639chr642340 913 733 654 12292 12781 --
NM_024674chr1123068 3048 2517 2392 2308 2208 2195 956 773 730 590 217 --12177 --
NM_024692chr241677 1492 752 248 ------
NM_024713chr1511431 11176 1623 --
NM_024721chr812099 12334 --12657
NM_024749chr141887 1532 567 352 1668 21806 638 --
NM_024766chr21437 ------
NM_024798chr1592404 2150 2015 1170 1156 774 683 568 492 22918 2083 32557 1790 1182 --
NM_024808chr13------1177
NM_024817chr15105957 4958 4853 4296 2016 1881 1847 1259 1250 528 11191 --25251 1858
NM_024854chr1211474 --1490 11522
NM_024855chr202223 199 --1135 1407
NM_024873chr42423 166 ------
NM_024887chr161877 1481 696 185 91 70 11616 11790 --
NM_024940chr831513 704 109 21629 465 ----
NM_024949chr4144897 4526 4148 4054 3825 3800 3568 3254 1971 1580 828 695 386 121 24252 3685 1677 14323
NM_024969chr2166 ------
NM_025083chr1571675 1317 1270 1258 575 120 45 --11622 --
NM_025104chr1731230 1162 34 --21301 1180 --
NM_025146chr332765 696 498 --11815 1934
NM_025160chr183408 3346 1535 1303 897 345 306 27 13903 --1797
NM_025182chr92314 157 --1960 --
NM_025187chr1621166 185 2263 91 --11304
NM_025222chr342602 2201 544 400 --2802 198 --
NM_025230chr144439 427 286 36 --1491 --
NM_025248chr1793083 2934 2746 2307 1985 1265 876 358 46 1470 43272 1303 1082 732 --
NM_025251chr87872 866 418 406 350 291 157 1300 ----
NM_030621chr1474019 3213 2871 2626 1679 934 243 ------
NM_030625chr1022508 551 --1402 --
NM_030629chr1651879 1271 131 82 53 ------
NM_030648chr4115348 4889 4715 4647 4640 4331 3721 2162 2156 2138 1446 14980 15203 --
NM_030780chr83614 601 151 ----11619
NM_030786chr141930 1734 676 273 11672 ----
NM_030806chr1199221 8857 8836 8548 8533 8074 6749 6313 6168 5828 5791 3387 2508 2280 2204 1555 819 418 260 38022 6563 5924 38881 7992 5752 27424 597
NM_030809chr1261531 775 631 509 255 214 --12241 --
NM_030816chr143401 3106 2928 2606 ----1376
NM_030885chr331585 884 191 21499 112 ----
NM_030914chr93943 864 661 ----1935
NM_030915chr292296 1960 1913 1813 1668 829 352 122 47 11556 --12165
NM_030927chr1071340 1325 1278 1207 1143 1033 287 --11027 11353
NM_030939chr6--1144 11188 --
NM_030949chr651105 972 963 308 47 --11147 --
NM_030978chr9--142 2461 421 --
NM_030981chr1151051 995 361 304 123 --2142 90 --
NM_031212chr102246 49 ----170
NM_031372chr441421 1081 644 77 --21446 523 1603
NM_031442chrX33085 2122 705 --12175 --
NM_031445chr283403 3173 2448 829 713 699 688 81 13266 13389 1579
NM_031449chr761979 1560 1448 693 391 138 12002 1523 1498
NM_031450chr112155 59 1405 1600 --
NM_031461chr842267 1702 775 763 ----11497
NM_031483chr2053256 2863 568 523 442 22317 550 2449 406 --
NM_031936chr13694 492 138 ------
NM_032102chr1141005 670 660 342 --1681 --
NM_032124chr1811089 11234 11118 --
NM_032174chr131194 503 240 ----11211
NM_032182chr103532 371 232 --31434 1140 1043 --
NM_032199chr1043582 3387 2516 1512 12654 23555 2980 --
NM_032207chr1941267 1035 215 138 --1790 3429 190 115
NM_032233chr142855 298 ------
NM_032239chr421180 499 2426 325 1451 1510
NM_032271chr1631547 1240 616 --1338 --
NM_032289chr531809 791 510 ------
NM_032352chr1421255 1117 ------
NM_032420chr52716 102 ----1564
NM_032434chr261576 323 277 222 199 133 21214 343 ----
NM_032452chr1441471 1419 83 24 1566 1983 2407 198
NM_032458chrX63358 2965 973 886 821 553 22866 633 22578 1017 --
NM_032492chr31180 1131 176 --
NM_032499chr1581639 1540 1508 624 617 114 81 65 ------
NM_032505chr361947 1783 1095 1029 836 226 ------
NM_032514chr202170 75 --169 --
NM_032534chr72416 385 1426 ----
NM_032538chr672622 1074 999 946 835 775 420 2704 668 41962 1737 546 344 --
NM_032552chr951578 1553 1336 708 695 ------
NM_032569chr1632026 1639 225 189 ----
NM_032575chr1661545 1384 424 268 236 74 --21956 216 --
NM_032622chr421563 1490 11236 11426 --
NM_032682chr343555 3488 3280 2278 ----1678
NM_032727chr10173 21345 196 11169 --
NM_032786chr121196 --1494 --
NM_032804chr1042102 1824 1783 207 ------
NM_032846chr14--134 11436 --
NM_032866chr1583053 3047 2902 2527 2304 739 624 37 23183 1206 1674 12214
NM_032905chr102459 245 1905 --1113
NM_032947chr551175 969 301 251 91 21135 62 ----
NM_032959chr771071 968 955 913 440 267 38 ----1823
NM_032983chr7112864 2791 2758 2747 2593 2230 2112 949 626 609 264 --22468 723 --
NM_032995chr251653 1373 1061 577 179 --1615 1342
NM_033058chr83728 279 90 ------
NM_033116chr14185 ------
NM_033127chr11638 --1548 --
NM_033132chr1332100 1786 531 11626 ----
NM_033133chr17113176 3075 3040 2794 2787 1278 1192 1099 614 311 163 13504 21059 596 --
NM_033211chr521405 1300 1123 ----
NM_033224chr7148008 7782 7478 7356 7178 6818 6701 6400 5837 5495 3222 2909 269 68 11383 ----
NM_033285chr843792 3125 3033 2886 23523 230 133 --
NM_033309chr163866 295 232 --1145 --
NM_033315chr1761869 1721 752 534 506 209 12059 ----
NM_033389chr17124763 4234 4189 3451 3244 1687 1380 961 800 696 522 122 24000 1142 ----
NM_033397chr1031713 727 89 --32219 2122 453 1260
NM_033420chr193804 450 335 1794 --1361
NM_033426chr1462104 1115 889 802 307 65 12435 11967 12207
NM_033512chr891203 1179 1051 787 546 496 285 169 29 --2685 44 --
NM_033540chr32321 138 ------
NM_033626chrX81767 1599 1483 555 450 416 170 155 --11474 --
NM_033631chr1103520 3276 2383 1512 1238 977 752 396 275 36 43263 2782 1427 358 22398 610 1627
NM_044472chr14698 692 474 37 ----1306
NM_052840chr1531414 1350 1340 ------
NM_052851chr1321843 1742 1190 ----
NM_052855chr171483 --1195 --
NM_052879chr1243985 3957 3473 1025 1770 23313 2582 --
NM_052898chr841664 1256 269 258 --11341 --
NM_052905chr241876 1186 583 342 --11173 --
NM_052934chr142225 1581 737 277 ----12095
NM_053023chr1152777 2599 2068 429 303 ------
NM_053025chr32396 369 11691 11712 --
NM_053064chr1442347 1900 1892 1876 2374 119 22909 38 --
NM_054027chr552213 1724 865 837 392 --11970 1326
NM_054108chr11------1113
NM_057161chr62458 28 ------
NM_058197chr92801 641 2669 198 ----
NM_078476chr641610 1533 253 171 2588 222 --1491
NM_079834chr1971300 1042 629 613 250 149 51 11703 ----
NM_080391chr1----154 --
NM_080415chr172868 96 ------
NM_080617chr203933 282 50 ------
NM_080654chr114324 119 83 55 --11200 --
NM_080669chr1773977 3944 1934 1150 1014 667 104 --23481 635 24540 3753
NM_080738chr141636 1538 747 399 ------
NM_080865chr32700 137 1660 ----
NM_080867chr1443785 3487 3241 730 45052 4458 3997 683 11371 --
NM_080872chr874040 3594 2827 1423 1394 659 393 13436 33553 1435 1086 --
NM_101395chr2173146 3080 2272 2212 993 66 36 --176 --
NM_133264chr1763507 2602 1137 859 368 282 --21437 294 --
NM_133265chrX22424 1013 33362 2694 1199 13472 1660
NM_133329chr21110 1448 ----
NM_133369chr51386 --1923 --
NM_133433chr52764 74 2335 253 ----
NM_133496chr1133990 3746 3378 3144 3125 3009 2933 1447 899 796 783 250 46 13119 --2400 200
NM_133510chr14----1354 --
NM_133638chr5--11194 21252 33 --
NM_138300chr151535 1388 633 615 435 1270 31105 132 79 --
NM_138316chr1021319 545 --1342 --
NM_138357chr1031558 1502 25 1241 1552 11845
NM_138385chr451092 486 475 450 202 1211 2923 308 --
NM_138426chr772506 2049 1819 1805 1596 427 145 1704 ----
NM_138468chr2125983 5738 5343 5016 5004 4993 4870 1444 1246 1018 898 846 1187 15858 --
NM_138473chr12105047 4585 3951 1384 1192 1017 910 789 589 296 --45098 3987 3545 1641 --
NM_138782chr542041 967 850 669 ------
NM_138819chrX283 71 --130 --
NM_138939chr3------1168
NM_139062chr17138 ------
NM_139207chr1241831 1710 723 95 21790 1379 --2274 252
NM_139244chr62737 316 1307 --1619
NM_139246chr931703 491 112 12254 12197 --
NM_139280chr1741372 975 577 510 --1291 1417
NM_144571chr456074 5672 1295 1103 848 25851 4935 ----
NM_144574chr141552 --1236 --
NM_144590chr1092919 2654 2487 2200 1992 1075 831 452 426 ----12629
NM_144633chr331149 424 379 21478 1443 ----
NM_144635chr32970 484 --1117 --
NM_144664chr111125 12270 ----
NM_144778chr1312350 --12567 1135
NM_144778chr1312350 --12567 1135
NM_144994chr251466 1304 640 565 87 ------
NM_145020chr18130 ------
NM_145165chr142595 185 12369 ----
NM_145176chr653105 2742 736 519 82 --12872 --
NM_145204chr151126 1645 ----
NM_145239chr164432 156 145 36 --2353 254 1277
NM_145253chr161483 ------
NM_145260chr22559 522 --1223 --
NM_145279chr131844 1717 1611 1693 21689 136 --
NM_145296chr193823 597 350 --1671 --
NM_145307chr1094595 4309 4268 3884 2947 1285 550 268 178 23634 473 ----
NM_145313chr1021324 443 ----21246 562
NM_145349chr1762156 1976 1858 510 209 55 11643 ----
NM_146388chr1931258 1093 356 1948 ----
NM_152237chr2271586 1560 1168 1117 647 236 216 11489 ----
NM_152253chr2273611 3458 3296 3108 1614 918 125 12746 11347 11509
NM_152265chr161578 1522 1387 1299 1184 251 1457 11126 --
NM_152267chr2282289 2228 1773 712 696 688 432 79 1391 32164 1492 65 21812 98
NM_152275chr241605 1481 598 197 1526 --11844
NM_152277chr531806 732 530 ----1692
NM_152284chr81892 --1777 --
NM_152344chr1761125 981 956 377 340 315 11234 11321 1255
NM_152345chr17----2436 357 --
NM_152399chr471225 1105 1069 444 263 89 60 --11093 --
NM_152424chrX114411 4163 3781 3084 1790 1711 1432 1387 1318 166 129 12882 14738 --
NM_152470chr18143970 3686 3478 3202 3089 2715 1602 1515 1330 1146 1048 995 814 84 --13257 --
NM_152493chr121239 443 31478 489 196 ----
NM_152545chr43177 73 40 ------
NM_152546chr521093 1062 --2258 129 --
NM_152588chr1221741 1182 ----2208 143
NM_152594chr1542187 733 236 147 --22219 2160 --
NM_152608chr162256 2125 587 255 83 70 ------
NM_152624chr5126938 5400 5311 5248 5162 4902 4504 2786 1921 1252 828 286 24895 2533 11763 21836 568
NM_152663chr1----1314 --
NM_152682chr441636 600 311 79 ------
NM_152688chr6----1267 --
NM_152721chr18--144 --179
NM_152749chr74374 306 294 34 178 ----
NM_152758chr862979 2454 2241 1906 980 844 1476 ----
NM_152780chrX5875 853 391 272 94 --1178 --
NM_152787chrX43956 3591 3196 287 13318 ----
NM_152793chr7105033 4748 4419 3397 3326 3150 1848 1250 1153 234 11242 169 --
NM_152857chr611021 ------
NM_152888chr841017 800 711 329 --1376 --
NM_153207chr1244068 3470 3130 2604 12906 22983 1484 --
NM_153350chr1661674 1431 1287 1186 1129 514 ------
NM_153367chr1073426 3303 1486 1385 1013 684 476 43948 2828 1043 866 12849 --
NM_153449chr12195 1197 ----
NM_153619chr1562967 2795 2745 1422 665 339 ----1872
NM_153634chr12--21223 135 1666 --
NM_153756chr151501 1275 445 300 173 1781 --21300 1219
NM_153757chr421190 165 ------
NM_153810chr10115076 5044 4399 4215 4175 3646 3232 1933 1009 948 29 34302 4160 1638 --1654
NM_153812chr152163 886 810 710 620 ------
NM_170606chr751720 1702 1673 1513 198 --1128 --
NM_170607chr1771424 1326 1237 1007 565 299 192 --21526 386 --
NM_170739chr11173 ------
NM_171998chrX22162 881 --12152 --
NM_172097chr152628 552 ------
NM_172127chr451456 1339 514 502 65 ------
NM_172212chr14655 627 608 455 131 ----
NM_172240chr12--1973 --11294
NM_173156chr142174 1442 811 565 11363 12056 --
NM_173199chr94491 474 454 181 ------
NM_173355chr21932 --1897 1250
NM_173468chr443926 3691 680 402 11783 11253 --
NM_173470chrX32797 1954 1025 ------
NM_173475chr1611676 ----1594
NM_173508chr141167 1160 918 48 ------
NM_173582chr1145425 1555 1156 746 ----13920
NM_173595chr12154974 4413 4135 3815 2119 1992 1429 1087 999 908 816 579 471 236 168 24367 3457 23702 298 11411
NM_173681chr792055 1921 1818 1797 755 622 418 290 138 11565 1455 --
NM_173829chr576119 5819 5306 4873 4552 2399 426 14478 1775 --
NM_173851chr893392 3373 2899 2592 2465 1046 946 938 247 23584 1005 ----
NM_174911chr8123684 3516 3044 2848 1505 1045 731 721 407 390 371 117 1539 12838 1697
NM_174916chr153811 667 342 11776 ----
NM_174921chr42323 175 --1868 --
NM_175733chr1132191 1966 190 11395 ----
NM_175767chr521701 557 ------
NM_175856chr51124 --2333 141 --
NM_175898chr1521279 1239 --1292 --
NM_176812chr201629 ----2591 287
NM_176880chr191143 --190 --
NM_177402chr15814 781 694 390 341 ----2961 359
NM_177424chr151919 1320 1309 394 241 ------
NM_177999chr9123538 2942 2877 2683 1455 1284 1228 1126 1043 922 266 128 1289 13051 1142
NM_178126chr1781788 1773 1530 1508 1401 661 540 498 --11912 --
NM_178496chr351463 1091 302 132 26 ------
NM_178500chr172549 289 2235 127 1616 --
NM_178502chr121516 1592 1208 --
NM_178523chr192325 75 ------
NM_178539chr1251622 1557 406 389 72 2522 396 ----
NM_178565chr851722 1367 1106 514 71 ------
NM_178582chr2041276 456 421 44 ------
NM_178812chr821090 270 ------
NM_178826chr121595 --155 --
NM_178835chr42819 549 ------
NM_181358chr183514 2963 2784 1304 1010 674 277 94 --144 --
NM_181670chr122956 151 ------
NM_181672chrX51867 701 641 443 157 21942 1547 151 21273 352
NM_181704chr213517 158 127 --11134 --
NM_181844chr1771591 1455 1390 553 276 168 33 1707 21636 1280 --
NM_182481chr2121032 302 --1919 --
NM_182485chr441414 826 164 101 ------
NM_182526chr1473037 2779 2583 2268 1232 876 326 --22805 604 --
NM_182527chr2221730 500 22251 1911 3756 472 286 --
NM_182553chr11------1527
NM_182565chr172572 168 --1491 --
NM_182664chr132035 1508 964 127 21709 155 --
NM_182691chr72462 174 --1443 1229
NM_182700chr731820 1785 151 --154 11517
NM_182854chr162333 314 ------
NM_182970chr20114241 3585 3452 3358 3115 1719 1681 1592 602 448 420 14116 23754 618 14201
NM_194286chr12186190 6153 6101 5524 5516 5373 5364 5131 4601 4359 4105 2441 1202 1192 1185 203 118 80 11601 21386 768 --
NM_194298chr102783 758 11683 --11710
NM_194314chr125178 185 --14174 --
NM_194318chr13102487 2468 1730 914 872 658 499 328 196 116 ----11586
NM_194320chr961228 507 358 315 155 62 --11004 --
NM_197939chr174401 244 225 199 1470 2832 449 21142 137
NM_198042chr8----126 --
NM_198066chr1462630 2524 2504 1060 943 295 --12216 --
NM_198098chr741184 593 206 190 ------
NM_198243chr152615 231 --1791 --
NM_198396chr17176 --2419 64 --
NM_198440chr22102288 2269 2232 2073 996 933 844 737 696 554 --32495 335 225 2919 112
NM_198511chrX----1674 --
NM_198560chr383781 3603 3551 3332 2722 965 893 55 --63270 2940 1503 1361 1132 396 --
NM_198859chr3154938 4572 4500 3697 3554 3439 3418 3386 3373 3230 3199 3128 968 307 178 1985 13689 --
NM_198993chr1771512 1221 1163 1070 466 324 175 11301 2552 56 --
NM_199129chr2031235 1095 916 --21252 114 --
NM_199245chr12102335 2235 1675 1643 908 382 375 344 334 212 2886 37 12203 --
NM_203434chr91930 1187 ----
NM_203446chr2172427 1975 1114 715 680 626 169 --1431 1330
NM_203459chr142596 2390 907 58 --2770 421 --
NM_203463chr264814 4642 3142 1152 853 369 64750 4553 3539 1585 1231 48 --14635
NM_206853chr674045 2965 1517 1448 1246 731 355 --13392 --
NM_206914chr12142064 2033 1896 1887 1636 1596 896 731 618 611 577 401 277 88 --21500 531 --
NM_207111chr762388 2280 2219 1059 854 276 --12710 1164
NM_207371chr1051209 1092 989 523 111 2516 181 ----
NM_207387chr1731509 1471 91 1144 ----
NM_207396chr141597 1259 1248 198 --1180 --
NM_207577chr1172813 2492 2350 2300 1789 940 203 --12797 --
NM_207647chr922574 370 1283 12005 --
NM_212467chr1522438 197 52113 1059 888 801 297 1532 --
NM_213589chr265486 5304 4136 3464 2032 467 1815 24118 93 --
NM_213609chr311020 ------