TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-671-3p
miRNA Sequence: UCCGGUUCUCAGGGCUCCACC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000217chr1251936 1907 1680 542 259 ----21927 808
NM_000408chr212215 1599 --13204
NM_000910chr41149 ----11489
NM_001001323chr1253027 1953 634 500 342 22398 30 ----
NM_001030007chr161120 11120 1641 13445
NM_001031732chr433309 1213 1041 --13479 1172
NM_001037131chr21379 ----11187
NM_001037132chr71237 ----1181
NM_001040152chr724803 4014 ----13141
NM_001042599chr257764 6642 5497 2254 423 ----11027
NM_001121chr10--1117 --1131
NM_001386chr812196 ----1540
NM_001858chr633434 1620 1282 14688 11596 --
NM_001945chr521383 525 --125 1407
NM_001981chr1--11918 --1945
NM_003108chr221585 760 36398 1630 1363 1569 --
NM_003342chr1742775 2014 359 226 --1134 --
NM_003566chr121477 ----13193
NM_003597chr2161 1497 --1558
NM_003948chr432298 1834 120 ----124
NM_004852chr18310683 9570 2118 112962 212154 2988 --
NM_005789chr1721970 91 --12013 1381
NM_006380chr1713701 ----1596
NM_006608chr11175 ----1422
NM_007137chrX64717 2223 2192 2147 2131 426 11286 11426 --
NM_007146chr1732914 2573 2105 ----12548
NM_012309chr1124866 4338 --13870 14347
NM_015059chr1522699 1329 --12570 22688 51
NM_015094chr2244075 3456 3212 180 24020 3800 --24439 954
NM_017658chr1421728 1516 11301 --14325
NM_017813chr843690 1590 1246 938 --14088 --
NM_018979chr1232378 1764 110 --12302 --
NM_020474chr181323 --1418 1461
NM_020699chr165280 4619 4566 4267 3299 1738 1587 12080 --
NM_032961chr431021 984 203 --11197 --
NM_144973chr1264422 4175 1767 836 563 57 11456 11633 25211 665
NM_173078chrX1352 ----1410
NM_178539chr121219 ----1728
NM_178815chr1012454 ----1148
NM_198859chr353663 3625 1046 1025 814 ----11236
NM_206854chr624154 432 25268 3460 --1243
NM_207396chr111660 ----11823
NM_212558chr911660 ----14171