TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-671-5p
miRNA Sequence: AGGAAGCCCUGGAGGGGCUGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX116523 6451 5880 5609 5555 4296 2536 2351 825 719 444 26682 1163 24628 950 1204
NM_000093chr922399 949 12533 1103 1628
NM_000109chrX21065 558 --11923 --
NM_000125chr622709 1572 13666 31717 696 123 --
NM_000127chr8----1215 --
NM_000135chr163993 747 373 ------
NM_000138chr1542412 1843 929 375 1329 21761 200 --
NM_000141chr1031058 1033 203 21240 587 --11119
NM_000214chr2031664 1581 1568 ------
NM_000217chr1275324 4737 4298 4051 1996 347 315 25175 187 24683 2029 1800
NM_000226chr172342 249 --2222 46 1234
NM_000248chr33880 267 38 --11187 --
NM_000264chr922875 433 --31243 574 242 --
NM_000289chr12----1104 --
NM_000314chr1032980 2253 1051 --1460 --
NM_000330chrX51836 609 413 399 160 1452 22111 1797 22270 651
NM_000332chr6106566 6150 5981 4690 2846 1882 1237 864 272 114 14761 36502 4883 4546 --
NM_000335chr321362 102 ----2787 319
NM_000345chr42241 181 ------
NM_000362chr2272881 2383 2267 881 720 367 49 --23395 3203 --
NM_000368chr964238 1904 1813 619 374 78 187 34201 1646 1404 --
NM_000378chr112859 146 159 --1442
NM_000408chr242742 2712 2337 2288 32634 1098 665 ----
NM_000448chr115997 857 189 100 43 23190 843 167 13104
NM_000461chr324336 1092 14010 24071 786 2747 448
NM_000476chr911493 31296 1096 199 2606 551 --
NM_000489chrX53153 3000 2916 1126 1090 13411 --11081
NM_000533chrX21901 1624 21706 1440 --1797
NM_000555chrX75866 5539 5484 5254 5113 4827 1907 199 17683 --
NM_000602chr7--1301 --11112
NM_000681chr103272 178 113 ------
NM_000721chr172676 2328 2239 1651 523 298 292 ------
NM_000723chr1731416 502 142 11251 ----
NM_000734chr11406 1794 ----
NM_000739chr7----1292 --
NM_000801chr2051126 989 982 184 169 ----1310
NM_000812chr42382 313 ------
NM_000826chr442587 2553 665 587 21939 605 ----
NM_000828chrX31404 815 755 21583 1454 1838 --
NM_000838chr632718 2006 850 --1965 --
NM_000839chr31490 1339 ----
NM_000842chr111229 ----1638
NM_000875chr15116619 5353 5113 4471 2381 2349 2252 2117 953 765 150 11690 1844 11010
NM_000880chr82356 92 ------
NM_000883chr71647 ------
NM_000891chr1742947 1066 320 141 --13536 --
NM_000901chr431697 672 37 ------
NM_000919chr51179 --1158 --
NM_000944chr41650 --21778 1652 --
NM_000960chr19----1321 --
NM_000961chr20113936 3332 3320 3118 1089 1062 951 593 528 240 73 --23406 704 --
NM_000964chr17146 --11374 --
NM_001001132chr2121442 537 1321 1274 --
NM_001001323chr1243031 2278 787 456 --12572 --
NM_001001433chr2022549 1291 13003 23029 2387 --
NM_001001438chr21----1261 --
NM_001001974chr1021900 46 11999 --162
NM_001001995chrX31333 679 202 --11804 --
NM_001002258chr21328 1374 ----
NM_001002265chr101803 --1129 --
NM_001002909chr1722071 767 32024 1538 170 ----
NM_001003676chr11----1257 --
NM_001003712chr1233422 1567 1043 ----14068
NM_001003792chr3------174
NM_001003800chr973347 1508 894 774 676 479 180 ------
NM_001003810chr4--2723 198 ----
NM_001003940chr1563802 2850 2713 2383 1092 484 11184 31427 1008 498 --
NM_001004065chr932714 1402 437 --13385 --
NM_001004106chr5----1241 --
NM_001004342chr1135466 5270 5230 4521 4455 3745 2224 1895 1637 1247 511 314 300 14873 45600 4838 1312 642 --
NM_001004360chr2----21740 233 --
NM_001005266chr15----1619 --
NM_001005386chr251621 910 512 203 38 2715 475 1285 --
NM_001005404chr1733345 828 557 34388 3838 1717 33238 1098 221 --
NM_001005463chr1052432 2289 1907 730 297 ------
NM_001005743chr142993 239 1546 ----
NM_001005845chr821834 1710 1610 ----
NM_001006115chr352585 2249 2123 1769 310 --1457 --
NM_001006618chr9------1234
NM_001006634chr16--199 1214 --
NM_001006946chr261299 611 524 276 216 178 ------
NM_001007277chr11----11117 --
NM_001007565chr32331 275 ------
NM_001007793chr10246 21 ------
NM_001008220chr533819 1085 940 1910 1139 12562
NM_001008405chr7--167 ----
NM_001008541chr1022094 1970 11716 ----
NM_001008564chr1311876 ------
NM_001008660chr11--11357 ----
NM_001008701chr1952816 2152 387 365 358 --42827 2737 1017 200 12575
NM_001008800chr11207 ----1193
NM_001008895chr13------11266
NM_001009880chr2264541 4248 3904 3263 3201 559 54470 3950 1754 1061 655 21302 895 14620
NM_001009899chr375098 4591 2435 2303 2167 1521 456 36192 6017 5191 1577 --
NM_001010852chr6----1144 --
NM_001010867chr161743 1581 891 626 440 336 36282 4866 468 34765 2580 806 1121
NM_001010888chrX43283 1207 1176 604 33783 1678 932 ----
NM_001010898chr183214 3177 3069 2945 2644 625 292 205 ----1887
NM_001010935chr11831 --1111 --
NM_001010942chr121446 --1819 --
NM_001010984chr121765 540 1187 ----
NM_001011545chr212532 150 ------
NM_001011546chr201827 131 ----
NM_001011666chr744408 4188 1171 296 22114 1241 12356 1124
NM_001012279chr61206 ------
NM_001012329chr11492 --3658 638 330 --
NM_001012393chr1194183 3647 3430 1732 1721 1703 1347 290 37 --21394 90 --
NM_001012423chr1522002 1124 12374 --1187
NM_001012732chr4--11029 11151 --
NM_001012980chrX2158 69 ----141
NM_001013031chr1041002 906 695 535 --1652 --
NM_001013415chr41234 1623 ----
NM_001013635chr1221180 1002 --146 --
NM_001013640chr192257 208 11319 ----
NM_001013690chr1262166 1961 1924 1649 508 175 ------
NM_001014435chr16----2149 85 153
NM_001014797chr10108219 7948 7602 7443 7317 5606 5136 2766 2479 982 31833 1791 300 17405 12043
NM_001017368chr1762746 2213 2181 1834 960 779 11065 32336 873 451 --
NM_001017395chr342407 1296 820 810 11160 33009 2545 529 --
NM_001017440chr7126874 6567 6560 5755 2328 1789 1625 1546 1514 905 662 603 17583 55362 826 679 506 488 26040 3300
NM_001017923chr1421409 62 1671 ----
NM_001017979chr41290 --1683 --
NM_001018064chr931982 1587 1545 11678 1328 --
NM_001018065chr942332 1581 1373 416 1140 1371 --
NM_001018108chr1541733 733 153 75 --21965 821 --
NM_001020818chr1951831 1733 1720 1668 209 11499 1503 --
NM_001023587chr32141 91 ------
NM_001024218chr142648 560 ------
NM_001024593chr103795 353 165 --1971 --
NM_001024649chr531832 910 726 22105 528 ----
NM_001024808chr1252359 1792 1099 860 410 --2890 382 --
NM_001024847chr331624 985 93 ------
NM_001024858chr1432057 1849 690 12970 32629 2500 637 --
NM_001024937chr174245 226 159 94 --162 --
NM_001024948chr153275 2232 1301 706 425 22153 459 1540 --
NM_001024948chr153275 2232 1301 706 425 22153 459 1540 --
NM_001024959chr32762 544 --1213 --
NM_001025068chr321552 274 ------
NM_001025076chr1096226 3918 2362 2236 1897 812 792 446 39 35208 4163 1513 14336 --
NM_001025081chr182452 37 ------
NM_001025105chr531377 1350 1003 --21226 510 --
NM_001025580chrX74190 3682 3256 1095 344 303 114 ----13074
NM_001029858chr633153 771 504 --1536 --
NM_001029875chr53726 525 115 12676 12657 --
NM_001030006chr1742616 639 285 177 --32345 2154 260 --
NM_001030007chr1663706 3585 3086 2833 1598 210 33836 3134 1228 ----
NM_001030055chr1433142 1149 385 12972 ----
NM_001031677chr5----1213 --
NM_001031716chr2----1109 --
NM_001031738chr21203 --1115 --
NM_001031740chr111367 1171 ----
NM_001031812chr5--1771 ----
NM_001032282chr84380 262 199 167 173 ----
NM_001032288chr2031233 523 461 11492 --11125
NM_001032293chr17290 76 1435 1222 --
NM_001032394chr632147 2078 269 --12634 11841
NM_001032999chr2054886 3781 1554 1266 1161 24187 744 35090 4450 243 14480
NM_001033049chr2142300 2152 1922 739 1278 1324 --
NM_001033049chr2142300 2152 1922 739 1278 1324 --
NM_001033059chr6290 61 11865 1373 11405
NM_001033081chr131543 1526 1198 11302 1242 --
NM_001033085chr22237 214 ------
NM_001033087chr2042916 2689 342 199 13208 13129 --
NM_001033112chr5----1791 --
NM_001033117chr3104683 4587 3715 3457 3391 1610 1588 1317 1140 81 --34693 3881 289 172
NM_001033602chr1342245 1029 652 505 12449 21781 34 --
NM_001034954chr1072626 2268 2204 1986 791 387 242 --11099 --
NM_001035511chr151652 1385 594 299 182 --1255 --
NM_001037132chr711475 --1641 --
NM_001037277chr111452 1321 ----
NM_001037332chr531823 333 192 32580 1904 732 1557 --
NM_001037535chrX11176 1489 --11061
NM_001037954chr1132417 2139 124 33371 3239 2357 13445 --
NM_001039366chr22291 55 ------
NM_001039547chr347220 6877 1698 586 --13157 --
NM_001039550chr2----1692 --
NM_001039577chr184499 4425 1464 1330 1182 1164 1146 163 21091 699 ----
NM_001039618chr1195985 5590 5108 4238 4034 3941 3899 2292 1089 --23890 1465 11657
NM_001039690chr1682008 1846 1832 1604 1514 869 647 238 1686 2884 287 --
NM_001039697chr911492 ----1445
NM_001039711chr12837 366 11145 1192 --
NM_001039960chr1231382 1121 301 ------
NM_001040056chr162700 594 1144 ----
NM_001040152chr773887 3795 3375 1930 1614 1205 143 --11695 11970
NM_001040158chr51136 --1425 1144
NM_001040284chr1695960 4705 4672 4036 3949 1621 1507 931 313 --11061 --
NM_001040429chr1342528 1201 195 121 ----22923 477
NM_001040439chr1621435 234 31013 258 124 11307 --
NM_001040446chr522183 315 ----11002
NM_001040455chr1141035 978 957 251 ----11028
NM_001040708chr8----11016 --
NM_001040709chr142454 2346 385 227 11921 1179 162
NM_001040712chr923334 2524 22785 2777 1391 11208
NM_001042601chr31818 12844 1660 --
NM_001042603chr12184767 3525 3517 3511 3467 3459 3453 3409 3401 3395 3351 3343 3337 1782 1058 923 740 342 34665 999 99 34785 803 143 --
NM_001042604chr374438 4399 4221 3751 3461 3018 913 33552 3155 1501 --14091
NM_001042681chr151978 1808 524 290 267 1944 22384 2091 --
NM_001042749chrX2624 259 ----11464
NM_001046chr521860 1025 --12807 --
NM_001050chr1711114 --175 1104
NM_001080418chr11406 --1577 --
NM_001095chr1221957 1838 --1465 --
NM_001106chr3188747 8427 7560 6945 6271 6220 3379 3238 2947 2517 2318 2247 1729 1716 1547 1012 477 338 16960 17499 11390
NM_001148chr42448 224 --11812 --
NM_001159chr2--1102 1230 1323
NM_001197chr22------1404
NM_001202chr141110 ------
NM_001204chr277069 4725 2613 1468 827 795 540 24739 177 ----
NM_001222chr1011708 --11416 11301
NM_001241chr21457 1385 12034 --
NM_001259chr776357 5913 5011 4282 3953 1736 142 25474 1215 ----
NM_001273chr122584 68 ------
NM_001300chr10------140
NM_001304chr1763208 3033 2459 1197 341 97 --2578 565 --
NM_001332chr531264 569 431 --1388 --
NM_001343chr541538 593 267 209 ------
NM_001351chr331809 1510 728 11152 11344 165
NM_001356chrX22334 516 ------
NM_001357chr1----1280 --
NM_001362chr142356 193 --1698 --
NM_001364chr1174466 4392 3773 1086 1039 218 79 --31784 1548 266 --
NM_001383chr173287 252 188 ------
NM_001385chr8----1140 --
NM_001396chr2112411 1551 ----
NM_001406chr1711514 21452 545 1483 --
NM_001407chr321627 1480 11218 ----
NM_001408chr141467 511 411 392 ------
NM_001419chr1933903 3744 1379 24720 3368 24580 3097 --
NM_001420chr1932969 2106 1923 ----12880
NM_001423chr1221563 503 --11988 --
NM_001431chr621217 851 --1441 --
NM_001438chr183466 3096 2957 2788 2464 963 785 284 33681 2341 152 --12266
NM_001454chr172388 377 ------
NM_001463chr23812 166 159 ------
NM_001494chr101229 --1672 --
NM_001616chr212702 ----1558
NM_001627chr322301 1604 ----12069
NM_001642chr1121132 430 1477 ----
NM_001655chr1131645 1578 544 ----11932
NM_001656chr521652 415 ------
NM_001659chr1272560 2553 2537 2043 2015 292 255 --11727 --
NM_001662chr71345 --1282 --
NM_001678chr1721305 660 1423 11368 --
NM_001686chr12------1126
NM_001690chr361693 1651 811 390 140 93 12034 ----
NM_001697chr21--163 ----
NM_001740chr163508 46 22 ------
NM_001755chr1632120 2061 873 198 11963 --
NM_001797chr16--1566 ----
NM_001806chr1962786 2723 2437 2148 1195 311 --11173 12907
NM_001810chr204660 545 535 124 ----1622
NM_001884chr5----1441 --
NM_001949chr6--42880 2133 1006 758 22476 1144 --
NM_001962chr5----1234 1577
NM_001969chr1452541 2449 1278 1037 954 ------
NM_001991chr1752188 2070 1580 711 378 --21548 52 --
NM_002009chr1562503 1959 1895 1058 854 498 1684 1432 --
NM_002010chr13154 --1186 --
NM_002017chr111170 ------
NM_002032chr11--2408 388 176 --
NM_002040chr211393 --1848 11953
NM_002074chr11418 --11515 --
NM_002077chr931899 1530 470 --21914 1792 --
NM_002094chr161156 ------
NM_002105chr111811 --1990 --
NM_002128chr13--1439 ----
NM_002131chr63829 358 41 --21306 406 --
NM_002147chr172943 920 1819 ----
NM_002158chr223607 3575 11494 13211 --
NM_002199chr43406 164 42 --135 --
NM_002204chr17----11371 11177
NM_002230chr176890 849 824 256 136 39 --1979 --
NM_002232chr121251 907 2979 890 11389 --
NM_002239chr2--1394 ----
NM_002264chr384736 1257 1215 962 762 644 516 253 23581 1344 14208 --
NM_002268chr31754 ------
NM_002270chr545403 2189 1407 1227 --14600 --
NM_002271chr1352160 1641 1577 573 66 2582 173 ----
NM_002283chr121525 194 124 --
NM_002293chr132227 2160 1732 32147 2086 1104 12378 --
NM_002336chr1263206 1926 1810 1662 538 360 14795 14043 --
NM_002359chr1783783 3395 2987 2912 1290 1208 1136 79 31716 1696 1514 12705 --
NM_002375chr321826 1453 --11513 --
NM_002382chr14----11307 --
NM_002390chr17--1275 --12077
NM_002473chr221149 --1180 --
NM_002481chr177548 5924 5779 5363 2386 1378 674 36582 1418 1021 25340 5195 27622 5672
NM_002499chr1572444 2312 2067 1698 767 550 214 ------
NM_002501chr1964092 3870 3195 2801 1195 614 --14127 --
NM_002519chr111160 ------
NM_002537chr153683 436 251 --2393 378 --
NM_002547chrX61642 1366 1337 1169 760 356 11205 13078 14085
NM_002569chr151128 --1446 --
NM_002572chr112399 36 ------
NM_002581chr954860 3950 3625 1255 1025 --14803 --
NM_002599chr112321 155 --11055 --
NM_002603chr81212 ------
NM_002607chr731070 879 243 ------
NM_002608chr2231537 141 93 --21578 589 --
NM_002628chr311028 21072 490 ----
NM_002645chr111637 ------
NM_002655chr855333 5250 4717 1889 1486 23957 455 ----
NM_002687chr14----1494 --
NM_002693chr15------175
NM_002699chr131364 1077 527 ------
NM_002719chr1472337 2119 1904 1551 807 512 104 --12349 1443
NM_002725chr1----1250 --
NM_002726chr63446 433 89 --2168 50 --
NM_002734chr1772212 2119 1920 1717 437 237 113 ------
NM_002740chr312051 1196 12625 --
NM_002753chr41295 1847 ----
NM_002779chr10----2516 411 --
NM_002834chr1262664 1571 1476 647 351 202 --1971 1522
NM_002836chr20------1126
NM_002840chr121014 292 ------
NM_002843chr1132543 700 640 1541 11134 --
NM_002848chr1211311 154 ----
NM_002849chr12181 1977 1711 169
NM_002855chr11113333 3062 3047 2708 2588 2557 1021 1004 826 236 175 1937 1569 --
NM_002867chr1156 --1468 --
NM_002868chr1252384 2213 2103 772 743 --22169 2061 1467
NM_002893chrX1360 --1116 --
NM_002897chr23765 726 550 ------
NM_002911chr1921304 1145 1653 31497 1451 1444 11366
NM_002918chr194779 391 73 65 ------
NM_002928chr111461 --11585 --
NM_002942chr3--11063 --11339
NM_002959chr182924 2884 2761 1023 791 677 497 277 23299 126 11109 13471
NM_003011chr921367 1088 --1584 --
NM_003017chr611211 11256 ----
NM_003024chr21------1250
NM_003026chr921264 285 21359 412 ----
NM_003030chr3174 --11372 --
NM_003043chr323903 1174 23212 261 132 --
NM_003070chr92856 771 --1696 --
NM_003074chr332099 855 88 1370 11462 11447
NM_003076chr1241321 608 389 201 ------
NM_003081chr201149 ------
NM_003091chr201210 ------
NM_003099chr1595073 4784 4314 4096 1186 774 546 528 207 1175 11135 --
NM_003101chr121095 116 171 11025 --
NM_003107chr662034 1000 653 488 383 138 --11890 --
NM_003108chr247200 5665 4408 2262 12108 12659 16125
NM_003112chr722360 2177 11996 1119 --
NM_003131chr632262 2197 2106 --31764 1608 502 11799
NM_003137chr652017 1999 1393 904 895 --11723 --
NM_003139chr113799 614 34 --1659 --
NM_003150chr1732182 940 507 --12043 --
NM_003155chr822849 2417 --1152 --
NM_003174chr102592 554 ------
NM_003183chr2------1219
NM_003185chr20----11104 --
NM_003202chr531760 1197 60 ------
NM_003221chr693761 3636 3491 3458 2893 2644 1450 1026 93 --22950 1047 --
NM_003244chr181124 ------
NM_003246chr151778 --3653 248 106 --
NM_003250chr172389 321 1337 ----
NM_003253chr2131641 1560 242 ----21723 1553
NM_003255chr1762504 1983 1826 864 240 53 22081 473 21054 279 --
NM_003272chr1------1127
NM_003275chr9----11481 --
NM_003295chr13----151 --
NM_003334chrX----179 --
NM_003342chr1752787 2653 1142 502 339 1473 22866 910 --
NM_003344chr71353 ----1367
NM_003370chr193763 61 27 --1160 --
NM_003385chr22722 144 ----1746
NM_003391chr7------1572
NM_003406chr821593 290 31380 629 317 ----
NM_003407chr191561 ------
NM_003412chr322454 333 3963 872 197 21939 340 --
NM_003420chr3----1259 --
NM_003432chr51116 --2493 486 --
NM_003453chr13----1694 --
NM_003455chr1141708 1669 1456 497 131 1232 11213
NM_003458chr333810 523 490 13792 31013 720 406 --
NM_003463chr643131 2958 2633 1016 2604 103 ----
NM_003466chr251659 1588 887 850 808 ------
NM_003470chr1621312 563 --21579 155 --
NM_003474chr102494 355 12056 2957 588 1519
NM_003482chr1242755 1994 571 528 ------
NM_003489chr211843 --1792 --
NM_003503chr11266 ------
NM_003507chr212009 1612 ----
NM_003564chr11426 --1560 --
NM_003590chr253252 2848 1426 630 188 21223 161 ----
NM_003603chr421847 1577 ----22021 104
NM_003624chr191912 --3982 362 287 --
NM_003632chr172726 224 ------
NM_003634chr221792 ----1436
NM_003635chr10140 --1188 --
NM_003655chr17--1754 ----
NM_003660chr192630 256 ------
NM_003670chr35944 541 406 296 31 --1437 --
NM_003685chr191948 --173 --
NM_003714chr532924 2649 394 22955 2324 11095 1776
NM_003716chr3----11030 --
NM_003722chr332686 2124 188 11672 ----
NM_003743chr251936 542 516 422 323 12131 1305 --
NM_003749chr1331601 1529 782 ------
NM_003768chr131284 526 243 --11572 --
NM_003779chr1----1336 --
NM_003783chr1----1189 --
NM_003822chr131972 852 226 128 ----
NM_003861chr142910 857 --12344 --
NM_003873chr103803 219 123 21949 1653 ----
NM_003884chr3121 21878 377 1291 --
NM_003888chr1541465 1302 1262 55 11607 11095 --
NM_003936chr21959 --1838 --
NM_003966chr557299 5234 2906 2152 82 --33067 1104 23 --
NM_004085chrX1301 ------
NM_004094chr14148 1951 1432 --
NM_004098chr1021179 517 ------
NM_004114chrX----1838 11045
NM_004117chr61144 --2657 57 --
NM_004124chr1463508 3042 1404 681 197 110 --1528 12429
NM_004162chr341028 801 383 39 ------
NM_004170chr921200 325 11503 1400 --
NM_004171chr11109539 9530 9267 6422 5843 3324 3082 2133 290 76 --29214 6786 --
NM_004183chr111808 1614 --1729
NM_004200chr1132828 1035 991 --42882 2584 2338 2095 --
NM_004210chr1042125 1671 331 44 11803 11845 --
NM_004225chr811327 1506 1298 --
NM_004230chr1952334 1768 865 641 538 ------
NM_004232chr1833472 2521 848 33887 3221 2691 ----
NM_004263chr241697 1144 341 220 --21517 240 --
NM_004274chr1433046 2065 703 31090 906 785 12263 --
NM_004294chr13----1185 --
NM_004311chr1043007 501 331 73 12129 2896 846 --
NM_004316chr12180 ----1222
NM_004326chr13833 797 396 --1354 --
NM_004331chr832382 917 478 --2955 262 --
NM_004349chr811006 --11112 --
NM_004364chr1921197 922 --2369 213 --
NM_004392chr1332606 1894 781 21626 675 --12334
NM_004395chr52671 146 --1226 --
NM_004423chr332033 377 217 12216 2969 914 22107 653
NM_004426chr1221401 1230 ------
NM_004427chr13777 457 222 --1253 --
NM_004430chr841015 809 379 135 ------
NM_004432chr942192 1838 885 354 --12162 --
NM_004440chr611774 11382 ----
NM_004441chr31464 --2861 99 --
NM_004464chr433213 1452 1148 ----24163 368
NM_004504chr212523 --12135 --
NM_004516chr194864 502 117 103 ------
NM_004537chr123486 436 54 1429 ----
NM_004550chr1141 --1138 --
NM_004555chr162415 47 ----1197
NM_004586chrX73871 3645 3497 2143 1240 498 150 33327 2049 1331 ----
NM_004588chr1183363 3069 974 927 916 735 372 91 23042 634 33007 2732 403 1965
NM_004598chr542558 1072 1045 420 --1554 --
NM_004612chr9104732 4546 4199 4081 3516 1592 1354 441 211 111 ------
NM_004614chr1651951 1894 1872 260 97 --1705 1912
NM_004615chrX1722 ------
NM_004647chr19----1245 --
NM_004654chrY2993 22 ------
NM_004730chr511730 --1816 --
NM_004734chr1322704 2155 22889 843 1263 --
NM_004736chr1--21958 1880 1373 --
NM_004737chr223936 359 323 ------
NM_004742chr341565 1266 420 42 --1326 --
NM_004744chr432695 1332 670 --1178 --
NM_004758chr1731126 754 158 1769 ----
NM_004772chr541517 1312 504 356 ------
NM_004774chr1721996 127 ------
NM_004798chr2083496 3443 3427 3378 2900 714 640 287 1568 ----
NM_004824chr62481 203 1544 11199 --
NM_004852chr181313208 12372 11524 10770 10657 8711 4648 3540 2516 1471 875 499 377 514029 5511 5035 4605 2245 212564 12397 1446
NM_004857chr1464768 3980 3424 3087 2907 1672 --33841 600 363 --
NM_004859chr1732965 528 243 --1608 --
NM_004866chr5----1639 --
NM_004887chr521123 431 ----1215
NM_004898chr411157 ------
NM_004922chr104869 790 661 256 140 ----
NM_004932chr51298 21314 178 189 --
NM_004947chr332050 1818 274 1937 1206 11029
NM_004963chr12----1346 --
NM_004965chr211708 1649 ----
NM_004972chr911037 --1742 --
NM_004978chr111115 --1475 --
NM_004985chr1224321 267 24154 1028 1463 --
NM_004992chrX117521 7459 6373 6352 5705 5393 3372 2813 1213 152 91 12142 35718 2788 2234 --
NM_005020chr7162 ------
NM_005065chr1465103 4538 4146 1576 599 243 11662 ----
NM_005067chr31149 --1853 1291
NM_005094chr9----1183 --
NM_005096chrX41103 1057 338 159 --1346 --
NM_005103chr11--1257 ----
NM_005121chr171373 12705 13256 --
NM_005157chr921886 1459 --11581 --
NM_005220chr1731463 322 296 1153 11267 --
NM_005225chr2031194 997 483 1139 --127
NM_005233chr361987 1032 770 586 353 22 ----12125
NM_005238chr1122839 411 --21395 1252 --
NM_005264chr104947 223 159 60 --2877 179 --
NM_005268chr1----1222 --
NM_005277chr441795 1600 612 98 --11691 --
NM_005281chr1----169 --
NM_005329chr1621716 1662 ------
NM_005380chr11115 --21252 491 1273
NM_005406chr1821330 112 --159 --
NM_005407chr1441531 272 247 133 11228 11504 --
NM_005413chr2----1360 --
NM_005436chr1083413 2973 2806 2650 1153 785 330 124 11644 2861 72 23011 490
NM_005443chr42464 104 --1581 --
NM_005461chr2021960 799 --21987 354 --
NM_005475chr1253025 2856 2408 2048 183 1504 1202 --
NM_005493chr62623 134 ------
NM_005502chr91978 --22177 454 --
NM_005517chr1--21446 958 ----
NM_005537chr131782 ------
NM_005539chr1021373 557 1987 1346 --
NM_005546chr51549 2874 295 12221 --
NM_005563chr1----1339 --
NM_005578chr364773 3890 3590 1918 1601 327 --13740 --
NM_005594chr12----196 --
NM_005596chr955809 5553 4798 4775 1827 24079 1332 --14311
NM_005604chr632172 799 409 ------
NM_005626chr13434 419 149 ------
NM_005647chrX52521 2172 951 820 762 --22609 1142 2296 234
NM_005652chr1621107 278 ------
NM_005668chr544294 2895 88 49 ------
NM_005678chr152289 70 --1805 --
NM_005683chr23928 885 118 2607 319 12157 --
NM_005730chr1253497 3456 2958 2948 1236 21299 563 12593 32844 2757 2465
NM_005746chr7--1831 ----
NM_005748chr1243379 3335 2912 1253 13081 33242 3092 998 --
NM_005766chr1341089 51 36 21 --1116 21384 1081
NM_005776chr14--1149 ----
NM_005789chr1722164 1538 --21829 518 --
NM_005851chr11160 --1103 --
NM_005909chr553904 3463 3282 1310 1184 34204 3699 43 13406 11219
NM_005911chr221030 994 11215 ----
NM_005920chr153790 2969 2865 2433 1161 23166 2395 23448 3155 12533
NM_005927chr53488 412 292 --1921 --
NM_005928chr152658 34 1686 160 --
NM_005941chr833963 2570 82 32694 1038 188 11506 --
NM_005955chr144561 2034 1377 1024 --44963 4679 3392 2197 1337
NM_005966chr262403 2043 1870 1708 1649 1577 ------
NM_006015chr11125 --1353 --
NM_006047chr2032944 1102 528 ----1125
NM_006089chrX31540 1423 1250 1641 ----
NM_006094chr831750 264 164 21659 26 --22400 1597
NM_006106chr1142713 1235 1002 419 --22843 994 --
NM_006129chr81445 1233 1530 --
NM_006135chr121299 325 ----1108
NM_006145chr192880 351 --1112 --
NM_006158chr811580 --31634 733 209 --
NM_006160chr1741391 393 254 189 11088 1325 --
NM_006166chr1231856 916 128 ------
NM_006191chr12----2852 202 --
NM_006192chr203398 268 117 21049 910 1194 --
NM_006202chr192468 347 ----12005
NM_006210chr1931066 758 188 ------
NM_006224chr1742375 922 498 430 22248 517 22120 703 --
NM_006238chr652031 1861 1352 278 179 --11683 --
NM_006251chr563348 2418 745 686 612 296 168 ----
NM_006255chr14--1707 1346 --
NM_006265chr811035 ------
NM_006267chr231613 600 104 ------
NM_006277chr2------1264
NM_006282chr2074684 4637 3227 1491 1465 601 41 32934 2883 329 22900 628 --
NM_006306chrX43963 3947 1056 907 12298 44987 4778 4609 737 --
NM_006310chr1721276 508 --2970 365 --
NM_006315chr483368 3172 2745 1505 946 481 376 323 --21445 842 1539
NM_006321chr321374 500 11388 ----
NM_006328chr11----1231 --
NM_006343chr2----2482 404 --
NM_006345chr421092 70 1241 ----
NM_006369chr11334 --1355 --
NM_006373chr173981 253 164 1337 1551 --
NM_006393chr1084540 4503 4036 3832 2930 1783 1387 791 13110 24392 252 --
NM_006451chr521103 1031 1408 1722 --
NM_006496chr121245 777 --11308 1644
NM_006526chr20------11879
NM_006546chr1796274 6033 5947 5330 5118 4422 1908 1192 800 15877 34663 1229 765 --
NM_006549chr1252968 2826 1973 1168 747 52715 1125 922 822 68 11984 --
NM_006558chr8------1339
NM_006559chr1----1175 --
NM_006562chr10------1258
NM_006565chr16192 --1339 --
NM_006577chr21952 ------
NM_006593chr2----1744 --
NM_006595chr1121954 577 ------
NM_006599chr1697847 6753 5728 1391 1247 918 678 637 420 38229 2294 249 22434 1834 28103 1491
NM_006618chr121109 575 --11316 --
NM_006621chr141660 1560 1343 504 11547 ----
NM_006624chr1031827 849 94 164 ----
NM_006626chr912149 12055 ----
NM_006628chr1533626 1631 1131 ----1317
NM_006644chr131235 --1448 --
NM_006662chr16----2323 27 --
NM_006670chr62263 140 ------
NM_006690chr2032282 733 509 --1538 12184
NM_006691chr112229 39 --1399 --
NM_006732chr1911639 11701 21552 500 --
NM_006749chr811033 ------
NM_006754chr741159 1127 888 100 ------
NM_006777chrX42934 352 271 52 22281 1969 22800 823 1628
NM_006788chr181204 32116 1788 1678 1299 --
NM_006814chr2022009 511 1435 42554 876 399 31 --
NM_006826chr211033 --1430 --
NM_006827chr1443196 2342 501 113 ----1373
NM_006851chr1242957 2758 924 53 1253 12827 --
NM_006852chr1772756 2490 2123 1107 722 688 588 ------
NM_006885chr1654240 3110 1695 1337 663 21423 97 ----
NM_006902chr122461 641 12367 1442 --
NM_006915chrX42507 990 721 494 --12280 --
NM_006927chr1641644 1369 332 187 --1585 --
NM_006930chr511779 11773 ----
NM_006950chrX2728 641 --1295 --
NM_006951chr10--1629 ----
NM_006981chr922198 456 1597 ----
NM_006990chr192346 2133 1964 1778 1559 982 310 160 126 11997 42235 1620 1610 329 11630
NM_006996chr11697 ------
NM_007005chr911054 --1310 --
NM_007008chr2--1805 ----
NM_007011chr1585879 5827 4528 4440 4353 1422 353 302 46524 6058 4694 1383 44578 1919 510 490 --
NM_007040chr1931067 745 389 --2159 42 --
NM_007085chr312139 2898 426 22335 2325 12596
NM_007106chr1322724 2649 ----1797
NM_007124chr631301 554 28 --1328 --
NM_007129chr131396 ------
NM_007146chr1722818 2666 --12185 --
NM_007159chr3----1290 --
NM_007170chr12886 783 1718 ----
NM_007174chr1292318 2166 2117 2029 1741 1479 827 779 627 11622 11982 --
NM_007207chr1----1668 --
NM_007212chr132098 2016 907 1273 ----
NM_007224chr121634 --1136 --
NM_007238chr2044836 4286 4243 4105 14661 14612 --
NM_007245chr162327 129 ------
NM_007260chr13803 566 216 ------
NM_007271chr611445 183 ----
NM_007275chr33803 391 325 11117 --175
NM_007276chr73778 217 204 --1693 --
NM_007286chr532114 254 232 11466 ----
NM_007365chr112085 12118 31914 654 552 1496
NM_007371chr91111 1149 --1682
NM_007375chr152360 2032 921 629 287 ----12636
NM_012081chr553693 3304 2939 693 159 ------
NM_012104chr1143223 2489 1210 431 --22415 1379 --
NM_012121chr171651 11648 ----
NM_012161chr4--11166 148 --
NM_012180chr41534 ------
NM_012193chr1184984 4964 4537 4117 3563 1965 1264 23 --14847 1230
NM_012199chr1104519 4051 3635 3321 3266 3226 2830 1616 128 41 --32950 1646 1145 14684
NM_012223chr21105 --11061 --
NM_012244chr1431503 1325 495 1735 ----
NM_012249chr273593 2627 1363 610 423 329 253 23010 1001 22227 713 11097
NM_012281chr762196 1871 1761 1637 514 267 21966 139 ----
NM_012290chr21571 21648 42 ----
NM_012300chr552512 1775 242 219 211 11591 --1456
NM_012304chr522473 1935 1668 ----
NM_012307chr181818 --1809 --
NM_012308chr1122164 1989 --2870 641 --
NM_012325chr202568 101 1424 ----
NM_012330chr102729 304 ------
NM_012384chr2072071 2030 1782 1591 917 508 216 --1785 1728
NM_012395chr732364 2125 1163 1350 ----
NM_012431chr752855 2625 2289 763 222 12374 ----
NM_012461chr14----1250 --
NM_012470chr71456 ------
NM_012471chrX61909 1620 1361 656 562 316 --11386 --
NM_013230chrY1598 1429 ----
NM_013231chr1444271 4265 1527 699 --1664 11375
NM_013261chr442815 1351 844 675 13400 12430 --
NM_013281chr2011197 ------
NM_013305chr18----1855 1812
NM_013397chr631045 937 225 ------
NM_013399chr1621793 1535 1318 11278 --
NM_013449chr1252929 2373 1100 539 335 2764 516 1810 --
NM_013995chrX--22618 1619 ----
NM_014016chr3175 ------
NM_014023chr1031917 865 62 1511 ----
NM_014038chr71422 --2125 88 --
NM_014117chr1642261 2143 1781 482 1950 32362 843 189 1447
NM_014157chr1663467 3404 2560 1218 1004 659 --21286 971 --
NM_014181chr252504 2293 1158 778 521 12387 1856 --
NM_014190chr441610 1202 1150 573 11604 3739 646 104 --
NM_014231chr1262027 1835 1603 733 529 471 2717 690 1116 12072
NM_014232chr17----1497 --
NM_014243chr411537 22024 163 12067 --
NM_014289chrX21303 481 --1268 --
NM_014319chr1261375 1278 654 571 462 60 11781 1345 --
NM_014325chr121794 22263 1495 ----
NM_014345chr61343 ----144
NM_014363chr1321229 1047 ------
NM_014382chr321081 215 --1389 --
NM_014388chr1126029 5860 5713 5673 4601 4258 3845 3680 2443 2317 1475 1216 ----12279
NM_014417chr191950 ------
NM_014423chr534055 1872 809 14631 1242 12179
NM_014469chr111849 --1291 --
NM_014491chr71286 11085 ----
NM_014494chr1642315 2071 1547 859 --1710 --
NM_014504chr71275 1757 --12026
NM_014515chr12----11045 --
NM_014517chr341639 727 694 391 1734 ----
NM_014520chr171353 --2493 431 --
NM_014577chr22----1760 1909
NM_014591chr103891 346 27 --1427 --
NM_014603chr1751443 1149 648 498 356 173 41257 479 329 289 --
NM_014635chr231709 1301 370 ----11332
NM_014647chr165711 683 631 426 67 1353 --1567
NM_014661chr1093935 3294 2484 1536 1513 1328 550 474 112 13366 13750 --
NM_014665chr842617 390 160 132 --1111 1922
NM_014667chr341524 845 382 322 1413 --11719
NM_014670chr211070 ----1120
NM_014682chr8----1895 --
NM_014686chr1922587 639 12526 1182 --
NM_014705chr731902 780 764 ------
NM_014709chr21254 ------
NM_014730chr12165140 5049 4671 4281 4060 3877 3731 3468 3399 3285 1473 1280 1021 783 550 69 35038 4309 1933 35188 3945 2009 --
NM_014731chr2011223 ------
NM_014747chr1105470 5402 5298 5119 4046 3957 3757 1325 1300 1233 --35785 5018 1225 --
NM_014755chr264096 2609 1450 1435 1297 1281 12862 ----
NM_014757chr532026 1976 1756 22159 585 1540 --
NM_014761chr1651100 1072 987 258 175 --1281 1823
NM_014766chr783711 3534 3490 3475 3193 2735 412 345 21043 676 ----
NM_014770chr12--1235 11191 11083
NM_014772chr1883599 2889 2731 2551 2403 1455 1302 1277 --13534 1939
NM_014774chr142583 2558 1290 1138 11006 11174 13216
NM_014784chr12785 189 --2456 365 --
NM_014795chr2124 1105 ----
NM_014803chr1032707 1039 917 --22575 2561 --
NM_014810chr162732 2479 1285 1197 608 97 11102 11395 --
NM_014819chr541927 1663 407 313 1864 ----
NM_014827chr141502 663 597 341 --11075 --
NM_014828chr14--11640 184 11740
NM_014841chr61362 --11334 --
NM_014847chr1----299 45 --
NM_014868chr121186 ----1133
NM_014871chr121533 --171 --
NM_014877chr1767055 6620 6096 5997 1739 408 45342 2883 2667 2490 1900 12163
NM_014893chrY2767 455 2717 315 ----
NM_014897chr1732654 2053 940 1843 1364 --
NM_014899chr522904 2692 12700 1636 1212
NM_014903chr1272071 1680 765 754 461 374 323 ------
NM_014904chr1053090 1052 704 373 101 13795 ----
NM_014906chr1733913 3396 3368 1327 12928 --
NM_014910chr191517 ------
NM_014926chr311150 --1450 --
NM_014932chr31708 ----172
NM_014936chr62459 283 ----1856
NM_014949chr11996 --11020 --
NM_014952chr1521559 446 --41982 711 582 470 1534
NM_014961chr442171 1933 1763 779 11377 ----
NM_014962chr203537 273 225 ------
NM_014989chr62664 166 2675 240 --1812
NM_014990chr14--1834 ----
NM_014997chr752975 2580 604 201 189 ----1990
NM_015011chr1321044 843 --194 --
NM_015023chr161714 1645 1520 1422 1284 1147 1270 1173 --
NM_015033chr933056 2511 1148 13287 12565 --
NM_015050chr6----181 11175
NM_015052chr7----1194 1399
NM_015057chr131182 ------
NM_015060chr72206 29 --1192 --
NM_015064chr1273371 3255 3039 2773 2333 818 164 12931 11319 --
NM_015071chr5106395 5721 5202 4092 2284 2250 2184 1962 1770 1582 --36475 4663 1068 --
NM_015072chr142529 393 ------
NM_015074chr184287 3385 1655 1554 1548 786 721 666 21504 1429 21770 355 --
NM_015075chrX31629 1569 193 ------
NM_015076chr653313 2928 975 801 199 --34449 3274 956 --
NM_015080chr11----1116 --
NM_015086chr1241586 1456 386 87 ------
NM_015092chr1634583 4501 3193 1880 11374 --
NM_015097chr31109 --11472 --
NM_015100chr14681 649 361 102 --21713 1336 11493
NM_015161chr1631137 213 158 1411 1580 --
NM_015176chr141424 1415 1164 163 1102 --1110
NM_015202chr161555 11398 11153 --
NM_015215chr112776 --1306 --
NM_015236chr4----11171 --
NM_015245chr632098 1114 1105 --32244 656 610 12719
NM_015260chr1911234 21497 1204 11051 --
NM_015263chr15174 --1853 --
NM_015265chr242118 1041 562 115 21714 54 1665 --
NM_015288chr552999 2658 2619 964 939 --1976 23819 3024
NM_015293chr63630 495 158 ------
NM_015299chr1473553 3285 3278 2712 1269 579 245 --1530 --
NM_015326chr163009 2117 1986 1909 1136 200 2613 385 22706 725 11967
NM_015336chr1211035 12481 ----
NM_015338chr2031936 1572 1330 11529 1191 --
NM_015347chr1232839 1052 101 ----11839
NM_015349chr642856 2064 1113 682 --1648 --
NM_015358chr21--157 1997 --
NM_015382chr142287 129 ------
NM_015396chr321170 1079 ------
NM_015460chr322081 1609 --11868 1255
NM_015481chr122439 173 --1953 --
NM_015483chr72394 323 1191 ----
NM_015508chr311118 ----11370
NM_015511chr2021133 814 11124 1832 --
NM_015514chr142147 133 --2427 228 --
NM_015534chr13312 126 94 --1214 --
NM_015542chr1011042 1196 ----
NM_015565chr2112265 --11651 --
NM_015568chr2043915 3604 3183 191 24286 992 22754 308 --
NM_015576chr332741 2594 430 ------
NM_015584chr1751408 1309 450 398 281 11150 ----
NM_015635chr921891 1695 --1619 --
NM_015651chr951954 1922 1911 1743 73 11387 ----
NM_015686chrX32471 2278 745 --12359 --
NM_015691chrX52815 2552 2309 775 739 12626 --12785
NM_015719chr192736 66 1305 ----
NM_015850chr831695 348 339 11641 11785 --
NM_015855chr112342 127 1770 ----
NM_015878chr811769 1160 --12229
NM_015906chr123982 3357 24487 732 31866 1802 1470 --
NM_015915chr14--188 ----
NM_015982chr17----1424 --
NM_015995chr1595240 5174 4729 4504 3980 1910 1274 1241 813 24173 1750 25118 1711 --
NM_016009chr154394 3260 1804 612 237 41052 487 255 192 --14919
NM_016019chr7135 ------
NM_016037chr12977 866 ------
NM_016048chr51380 --1198 --
NM_016076chr122494 2488 1648 23006 2787 --
NM_016131chr252350 2248 1974 1453 792 11659 ----
NM_016154chr191150 ------
NM_016173chr374448 3795 3271 2826 741 682 587 --43779 1734 1482 338 --
NM_016206chr3109049 8108 7207 6959 6462 6200 3136 2419 1234 578 78699 7187 7158 6676 6124 3201 1520 13022 --
NM_016230chr6----1168 --
NM_016235chr1621090 972 ----11192
NM_016240chr81647 --1519 --
NM_016269chr4----1763 --
NM_016272chr2232201 1906 1859 --31791 765 309 --
NM_016289chr231836 765 617 11950 1202 --
NM_016308chr151843 1768 1644 1537 366 1610 ----
NM_016320chr112359 160 --1191 --
NM_016337chr14------1314
NM_016339chr172625 404 1300 21612 1228 --
NM_016395chr1521522 1369 --123 --
NM_016396chr1532982 2972 2487 --12169 --
NM_016406chr14357 326 223 92 ------
NM_016422chr1142793 1252 759 728 ----1307
NM_016436chr2062014 812 782 637 533 414 --11712 --
NM_016577chr384262 3729 3549 3284 1116 491 69 54 13901 123 --
NM_016598chr31262 11482 ----
NM_016604chr51814 1996 1285 --
NM_016605chr542324 2170 1855 1673 11974 12058 --
NM_017409chr122783 577 1179 ----
NM_017412chr811429 1103 --1970
NM_017420chr1411401 1792 --13524
NM_017437chr1432372 2182 286 ----1197
NM_017544chrX1985 1756 ----
NM_017583chr1121600 189 11757 173 --
NM_017590chr2242679 2105 1993 538 --12259 --
NM_017602chrX1794 1779 179 --
NM_017622chr171507 --1686 --
NM_017629chr141519 1258 758 301 ------
NM_017632chr4------183
NM_017633chr632973 2509 532 --13617 --
NM_017637chr9159209 8625 8461 7504 7095 6796 6459 6086 3685 3015 2705 2156 1681 1572 862 33273 2015 1011 38734 7715 6179 18683
NM_017643chr1732748 2163 461 12174 ----
NM_017650chr745721 4463 4089 1557 --1927 --
NM_017660chr1911306 11137 2407 246 --
NM_017715chr75743 687 660 270 183 ------
NM_017742chr1821357 400 21322 1226 ----
NM_017754chr6134736 4440 4247 4075 1339 1044 918 823 641 435 350 329 151 23943 1924 ----
NM_017766chr1----1550 --
NM_017776chrX11144 133 ----
NM_017793chr15--1661 1858 --
NM_017799chr1441494 1328 453 422 141 ----
NM_017811chr912799 12000 12815 --
NM_017813chr895425 3856 3625 3543 2134 2027 1382 1270 815 15773 ----
NM_017824chr1011708 12152 --1614
NM_017847chr131448 887 779 --11969 --
NM_017848chrX54543 4161 1811 1503 1166 11144 11243 11454
NM_017902chr1065641 5448 4472 3828 3640 1206 --1822 15127
NM_017934chr6179 ------
NM_017964chr22780 202 --1214 147
NM_018013chr692609 2175 1960 1084 791 682 286 251 132 --12734 --
NM_018018chr121693 --11886 --
NM_018028chr191521 --171 --
NM_018030chr1821118 80 1799 ----
NM_018036chr1484343 4147 3942 3174 2956 2906 1443 747 23094 1027 13851 --
NM_018061chr111182 ------
NM_018064chr61120 --1258 --
NM_018084chr21404 12549 --11296
NM_018094chrX1150 ------
NM_018110chr161482 --1521 --
NM_018115chr42823 663 --2759 523 --
NM_018121chr1021161 548 42696 2672 875 860 ----
NM_018133chr341991 1730 1704 1540 ------
NM_018157chr1233248 2361 2151 12210 11149 --
NM_018164chr12----1276 --
NM_018193chr151577 --137 --
NM_018206chr16----2110 67 --
NM_018240chr12867 696 ----151
NM_018243chr453452 3173 1393 1097 224 --23444 802 --
NM_018275chr7--1551 ----
NM_018287chr101477 --1910 --
NM_018293chr342856 2565 2332 812 ----1581
NM_018354chr20----1246 --
NM_018362chr1123362 2503 13954 --12766
NM_018364chr143852 820 783 556 1529 ----
NM_018371chr851446 1376 1307 1048 155 --11127 11135
NM_018403chr3103798 3619 1571 1564 1551 1530 426 398 175 55 2483 328 ----
NM_018448chr12----1147 --
NM_018482chr821731 310 --1938 --
NM_018486chrX----1160 125
NM_018490chr1121223 24 --11447 --
NM_018566chr143278 1283 1267 790 13842 ----
NM_018584chr1----11145 --
NM_018650chr121897 1558 --12239 11511
NM_018715chr131736 1637 189 11714 12032 --
NM_018717chr432093 943 534 --1727 --
NM_018847chr91131 ----11619
NM_018898chr542286 760 632 254 --1284 --
NM_018953chr121578 --1700 --
NM_018959chr195718 707 490 274 132 1532 ----
NM_018999chr1044299 4055 3416 1261 33513 864 591 24325 1879 --
NM_019004chr7----32084 578 380 --
NM_019012chr12------1718
NM_019045chrX2691 216 ------
NM_019050chr421797 559 22159 1817 ----
NM_019058chr101150 ----1252
NM_019094chr1253570 2960 2907 1426 63 1151 154 --
NM_019592chr91204 --1603 --
NM_019593chr2033093 3077 2711 --198 --
NM_019854chr121222 ------
NM_019885chr21204 ----12968
NM_020122chr285785 5034 4270 4217 1585 1332 473 229 --11687 --
NM_020144chr71681 --21591 1431 --
NM_020148chr1872996 2541 2346 1130 1083 342 259 22321 2245 23119 3008 --
NM_020150chr10161 ----1655
NM_020177chr541268 744 398 377 --1162 --
NM_020180chr1821354 389 1965 ----
NM_020205chr143425 2802 2485 1349 --11142 --
NM_020362chr12833 808 1748 ----
NM_020382chr1231257 554 275 1456 --1179
NM_020418chr3--1430 1396 --
NM_020423chr1176 --1453 1214
NM_020438chr941310 1215 1179 467 ----11303
NM_020443chr1116537 5299 5141 5064 4819 4335 4251 2769 2131 968 883 11895 1318 --
NM_020463chr231316 261 84 --1170 --
NM_020640chr331908 1873 1627 11768 ----
NM_020653chr17--1444 1421 --
NM_020708chr2022479 2022 1863 1775 --
NM_020713chr2052903 2231 732 592 342 --12865 --
NM_020724chr462315 2030 1794 996 555 462 2722 599 21903 934 --
NM_020742chrX42605 2279 828 808 1333 ----
NM_020752chr1032713 2705 697 ------
NM_020760chr2196 1530 1523 --
NM_020771chr611502 1119 ----
NM_020781chr763086 2066 1993 1282 1063 596 --23123 923 --
NM_020804chr621646 425 --42529 2077 485 394 1601
NM_020824chr101117 --1691 --
NM_020839chr341560 1443 449 296 ------
NM_020845chr1232547 2026 841 1695 ----
NM_020858chr1532131 1512 30 --21555 183 --
NM_020860chr4----1117 1719
NM_020873chr3121 ----1202
NM_020897chr11425 11350 ----
NM_020899chr1781799 1567 939 563 526 519 437 413 32195 593 255 ----
NM_020918chr1063330 3181 2593 750 437 64 12254 1978 12313
NM_020927chr1612329 11599 12271 --
NM_020956chr1964442 4219 3685 1003 418 302 11564 22894 1401 41915 1837 1759 1681
NM_020981chr22786 122 ------
NM_021003chr141754 1629 ----
NM_021025chr52381 353 ------
NM_021033chr1333291 2321 672 32373 1032 463 13348 1719
NM_021044chr12------1422
NM_021077chr151205 ------
NM_021117chr1142130 915 490 242 1655 31768 1613 613 --
NM_021132chr1021255 124 --1981 --
NM_021155chr1942550 2202 1915 762 ----1527
NM_021183chrX42260 2215 1960 263 ------
NM_021189chr12887 411 --1234 --
NM_021252chr1021773 751 1574 --11870
NM_021648chr651715 404 94 35 23 --11692 1252
NM_021649chr541786 1344 1245 727 1743 11459 --
NM_021784chr201575 ------
NM_021807chr71153 ------
NM_021813chr644082 2185 1750 1620 1393 11390 --
NM_021818chr14197 ------
NM_021914chr14--140 --21855 1793
NM_021945chr663189 1126 1088 575 509 464 13330 21421 1298 --
NM_021947chr172468 61 ------
NM_021964chr354327 4133 2019 1898 303 --11839 15793
NM_021965chr921344 1191 11326 11095 --
NM_021977chr643676 3530 2785 1085 --33815 3289 563 --
NM_021998chrX21290 86 ------
NM_022058chr221367 376 ------
NM_022085chr61554 --1286 --
NM_022112chr113298 99 63 21445 831 --1694
NM_022117chrX----1230 --
NM_022130chr541261 549 267 135 --1110 11342
NM_022140chr541650 1436 337 142 22347 2288 22205 1959 --
NM_022153chr1053542 3355 2314 2253 1110 --12323 1609
NM_022169chr1121389 240 --11361 --
NM_022170chr791505 1497 1424 1221 427 406 368 236 182 11588 --1469
NM_022373chr7----1133 --
NM_022451chr101106 ------
NM_022465chr1252707 2578 2111 840 429 --22842 1900 --
NM_022467chr19------1441
NM_022552chr22929 168 2904 872 ----
NM_022644chr17------1402
NM_022720chr2251409 598 516 289 149 --11351 1326
NM_022737chr19----11288 --
NM_022749chr831113 1070 157 11136 2203 101 --
NM_022756chr1146 21489 26 ----
NM_022771chr122728 345 --1376 --
NM_022776chr3193 ----11224
NM_022781chr932686 1277 1259 1860 --188
NM_022826chr2--1485 ----
NM_022841chr1542561 1846 534 133 ------
NM_022898chr1464823 4136 3943 3930 3539 3470 --34227 2967 1049 21418 743
NM_022912chr262719 2377 2091 862 529 522 1648 ----
NM_022918chr1131581 520 195 ------
NM_023009chr12576 225 ------
NM_023079chr1721161 209 11621 1484 --
NM_023931chr1631091 233 221 ----1526
NM_024016chr171184 --2583 571 --
NM_024046chr321125 242 --166 --
NM_024090chr411895 ----11626
NM_024503chr1--156 --133
NM_024525chr1147 --1187 --
NM_024541chr104747 642 624 436 --21487 389 --
NM_024551chr121122 --1298 --
NM_024557chr1121442 691 ------
NM_024565chr52626 608 ------
NM_024624chr2----11227 --
NM_024645chr821573 168 11144 186 --
NM_024704chr201262 1151 1405 --
NM_024798chr1532664 651 547 12208 21910 713 --
NM_024874chr11414 --1197 --
NM_024953chr1272686 2035 2000 1134 1004 769 657 12092 1494 --
NM_025054chr821060 969 31425 1077 302 --13365
NM_025083chr1571818 1657 1415 1316 1305 420 403 ------
NM_025090chr1771410 1383 1296 1250 1209 1005 958 ----11367
NM_025134chr1642485 2176 949 555 3859 515 142 ----
NM_025160chr11756 --11326 --
NM_025179chr194217 4076 3866 3723 3384 3240 1872 1230 908 ----11980
NM_025182chr92422 156 --1220 --
NM_025191chr153238 1384 1082 548 101 --187 12914
NM_025212chr4----1131 --
NM_025248chr1743242 2958 1251 874 --23082 1984 --
NM_025251chr81451 --1871 --
NM_030567chr5158 ------
NM_030647chr765735 5457 4455 4401 868 68 11428 ----
NM_030648chr475197 4801 4329 3720 1754 1529 511 25289 1831 34516 4309 1709 --
NM_030661chr731644 1582 143 --1151 --
NM_030753chr17----1245 --
NM_030796chr722211 201 12038 1153 --
NM_030885chr341899 1666 940 186 ------
NM_030912chr101161 --1355 --
NM_030913chr1--1680 1578 --
NM_030915chr232405 1700 795 1569 21803 121 --
NM_031216chr182787 397 11857 1237 --
NM_031372chr441189 580 463 270 ------
NM_031412chr123989 235 187 ------
NM_031431chr1331892 1142 526 ------
NM_031445chr232784 930 126 ------
NM_031475chr1----1520 --
NM_031478chr161296 --1683 --
NM_031483chr2021068 447 23389 175 22208 1328 --
NM_031886chr192611 327 --22608 2360 --
NM_031911chr421053 1007 12284 1978 --
NM_031936chr11136 ------
NM_032017chr131450 1359 431 --1798 --
NM_032042chr562696 2525 2055 976 383 206 ------
NM_032102chr1121158 658 ------
NM_032109chr521324 1122 ------
NM_032174chr121287 463 1511 2487 313 --
NM_032182chr1021138 93 ----1569
NM_032192chr17----1117 1474
NM_032193chr1121856 1717 ------
NM_032199chr1083835 3690 2726 2440 1516 1322 1266 545 ----12884
NM_032207chr19158 --1187 --
NM_032233chr142168 74 --1852 --
NM_032246chr1511013 1338 ----
NM_032283chr1----1142 11279
NM_032289chr521807 748 ------
NM_032327chr10----1381 --
NM_032353chr172338 150 ----151
NM_032449chr142258 2128 843 368 --11147 --
NM_032538chr631912 872 126 ------
NM_032558chr931475 937 911 --1311 --
NM_032578chr10--1500 --177
NM_032595chr1711117 --11285 --
NM_032646chr1721659 1451 11366 ----
NM_032664chr811259 ----1461
NM_032682chr352983 2910 2438 2336 765 22586 516 11266 --
NM_032689chr1931661 480 99 ------
NM_032727chr102232 116 11078 ----
NM_032737chr1942443 1720 1045 619 --2407 72 1585
NM_032765chr51148 ------
NM_032801chr11--11980 1454 --
NM_032804chr103232 205 116 2909 274 ----
NM_032833chr142449 2077 1789 449 ----12595
NM_032840chr1231156 153 82 --1287 --
NM_032842chr721530 572 11207 ----
NM_032869chr811369 --1210 --
NM_032875chr171221 --1597 --
NM_032880chr1----1117 --
NM_032946chrX1325 --1130 --
NM_032968chrX43830 3545 2695 1237 23688 330 1469 --
NM_032973chrY33822 2690 1237 23680 330 1469 --
NM_033102chr12933 240 --41372 1147 950 401 --
NM_033103chr1931050 1027 485 1362 ----
NM_033119chr161877 ------
NM_033121chr1231857 1387 511 ------
NM_033133chr1793644 3499 3039 2300 1325 1196 1070 1057 487 12750 --11417
NM_033224chr787354 6946 6848 6786 2069 1889 1424 268 17184 17248 --
NM_033274chr53417 407 281 --41077 697 549 173 --
NM_033315chr1731635 846 514 --22125 207 1653
NM_033377chr19--151 1150 --
NM_033378chr19--151 1150 --
NM_033394chr21281 --11517 --
NM_033426chr1462043 1985 1895 1122 815 70 ------
NM_033495chrX1387 1786 ----
NM_033505chr276577 5715 4130 2093 534 512 341 16338 25800 1929 16356
NM_033512chr872731 2483 2237 869 683 550 395 1438 1785 --
NM_033540chr341123 841 384 319 ------
NM_033626chrX21567 723 --11376 --
NM_033631chr183927 3528 2673 1439 1383 786 400 41 1828 --1499
NM_033656chr2195926 5628 5234 5078 2276 2215 2073 1505 581 25174 1068 1949 1806
NM_044472chr13697 289 35 ------
NM_052832chr8--1572 --12739
NM_052840chr1521349 1338 11228 1285 --
NM_052851chr1321899 1595 ----1302
NM_052855chr171636 --1546 --
NM_052876chr19--2790 459 --1743
NM_052879chr1263622 3600 3575 3482 3101 2586 13015 13956 --
NM_052880chr2231373 1238 1129 --11289 1281
NM_052896chr11379 1466 12527 --
NM_052898chr841787 1384 1339 1192 ----1736
NM_052904chr6185 ------
NM_052905chr221828 1171 1561 1340 --
NM_052936chrX2729 259 ------
NM_052978chr1421236 678 158 1185 --
NM_053002chr3------1924
NM_053064chr1412278 22898 739 12344 --
NM_053281chrX1290 --1357 --
NM_057175chr41444 1618 ----
NM_058191chr211827 --183 --
NM_058197chr91640 --2797 194 --
NM_078470chr1052689 2280 796 278 74 11722 2987 858 1110
NM_078487chr932456 2217 838 13240 1163 --
NM_080546chr972227 1659 1549 932 926 660 232 1483 ----
NM_080552chr20130 ------
NM_080617chr201103 --1932 --
NM_080625chr20----2950 87 --
NM_080678chr21460 --1219 --
NM_080867chr1444695 3535 3485 1152 34818 1462 903 --13283
NM_130386chr181655 --1604 --
NM_130459chr92228 183 11595 ----
NM_130469chr14------1672
NM_133171chr2061267 904 849 479 295 165 --1974 --
NM_133328chr192771 196 ------
NM_133334chr465321 4397 4066 1433 340 306 22356 693 35989 1862 989 --
NM_133433chr5--1626 1361 --
NM_133446chr10----1248 --
NM_133468chr722212 936 ----1475
NM_133507chr12----167 --
NM_138370chr2--1682 1716 --
NM_138473chr1254757 4570 4492 4198 693 --21191 594 21296 1068
NM_138479chr111289 --21735 1678 11939
NM_138724chr122277 236 ------
NM_138795chr121016 295 1581 ----
NM_138962chr17----1279 --
NM_139015chr1231733 436 66 ------
NM_139057chr1542331 819 407 157 --3955 473 195 --
NM_139062chr171148 ----153
NM_139072chr21858 1235 1354 --
NM_139167chr8197 --174 --
NM_139279chr242998 2579 1068 1009 11041 13467 21398 1325
NM_139280chr173554 543 147 --1414 --
NM_144571chr4106969 5958 5924 5523 5517 2747 1026 350 111 102 36355 5222 1000 22638 1995 --
NM_144582chr242133 1795 1635 847 32100 900 475 31716 1704 112 --
NM_144599chr1533848 1898 51 45376 5059 1454 272 13775 --
NM_144660chr10----1338 --
NM_144723chr54773 719 288 205 --2622 149 --
NM_144963chr872509 2279 2245 2082 1941 713 275 --1434 --
NM_144967chrX1368 --1279 --
NM_145025chr63308 275 218 1195 11051 --
NM_145052chrX2798 399 --1987 --
NM_145056chr191676 2216 109 ----
NM_145117chr1141215 634 391 193 43153 2991 2633 613 1444 --
NM_145166chr332184 886 463 --11849 11996
NM_145175chr231190 1023 274 ----11331
NM_145176chr643273 3241 2502 1073 ----23013 877
NM_145206chr1042795 2553 1253 366 1528 1189 --
NM_145207chr495365 5299 4821 4155 1974 1488 1328 888 135 11553 --14997
NM_145251chr1431603 1569 657 1121 ----
NM_145285chr101131 --1673 --
NM_145296chr191828 --1109 --
NM_145349chr1721944 593 ----21522 70
NM_145349chr1721944 593 ----21522 70
NM_145799chrX93037 2937 2813 2048 2001 1158 708 537 395 --152 --
NM_145800chrX1705 ----1965
NM_147189chr892295 2221 2202 2090 1790 1458 360 240 88 ----1163
NM_147202chr972628 2473 879 781 630 288 143 ----12417
NM_152253chr2273804 3771 2891 2670 1113 186 124 23289 3124 ----
NM_152261chr1232182 1912 185 11666 --1141
NM_152267chr2232242 754 431 --3743 694 77 11949
NM_152280chr122667 417 12264 2747 732 13020
NM_152380chr12581 572 1496 1658 --
NM_152398chr4144 ------
NM_152409chr533098 1375 60 --1102 --
NM_152450chr1531858 1847 262 22120 851 ----
NM_152493chr131246 1237 485 --11462 --
NM_152520chr24865 814 218 175 ------
NM_152594chr151945 141 11968 --
NM_152641chr12--11883 12469 --
NM_152652chr16------2284 224
NM_152660chr1192 ------
NM_152680chr411600 --1406 --
NM_152695chrX12118 --11959 --
NM_152721chr181160 ------
NM_152727chr16176 1194 1210 --
NM_152734chr684911 1886 1754 1590 663 495 350 89 131 35101 4589 735 --
NM_152745chr7------1319
NM_152749chr711015 2300 121 2387 74 --
NM_152758chr823061 1963 ------
NM_152860chr123427 396 358 --31190 263 207 --
NM_152890chr12384 231 1368 ----
NM_152994chr2----1249 --
NM_153020chr611372 ------
NM_153207chr1232599 298 288 --1712 --
NM_153252chrX2330 102 ------
NM_153266chr112855 219 1285 --1940
NM_153350chr1621119 367 11327 1512 --
NM_153365chr4------1324
NM_153607chr522917 2041 11141 ----
NM_153756chr11498 2523 456 21865 371 --
NM_153810chr1084853 4398 3710 3593 921 405 320 22 --11296 --
NM_170662chr31143 --1189 --
NM_170707chr11353 1269 2308 39 --
NM_170711chr196894 883 666 308 125 29 1708 2616 42 --
NM_172070chr21365 ------
NM_172097chr152551 544 ------
NM_172196chr2176 ------
NM_173083chr11152 --11204 172
NM_173359chr351606 1568 1303 186 119 --2366 247 --
NM_173462chr1451538 735 512 281 176 11633 177 --
NM_173468chr445119 5001 3924 323 --34787 824 734 --
NM_173470chrX--12901 22773 2007 --
NM_173475chr1621658 1484 11758 ----
NM_173491chr51959 ------
NM_173495chrX21976 1589 ----1444
NM_173510chr2242838 2493 2072 633 --1666 --
NM_173562chr633002 687 104 --22760 2284 22189 876
NM_173576chr101264 1148 ----
NM_173595chr1265298 5228 4353 1868 1580 771 24301 3324 11157 21905 1792
NM_173602chr1253786 2951 2527 453 76 --11330 1823
NM_173642chr1148177 7273 6334 5983 3371 3045 2676 2301 2046 1810 712 547 295 44 48829 8401 3447 2239 48864 8571 8092 5958 --
NM_174921chr43877 246 173 1141 ----
NM_174934chr1162431 2418 1435 1195 1116 929 --42830 1105 433 351 12674
NM_175630chr22735 715 --1217 1260
NM_175709chr2272857 2811 2786 2125 1002 931 439 12071 12184 2865 553
NM_175733chr1142219 2091 2040 1964 --11677 11609
NM_175736chr12117616 7514 6563 6455 5781 2966 2854 2833 2267 2102 1922 22397 189 12111 --
NM_175898chr1551362 1051 281 260 251 ------
NM_176792chr102432 34 ----1102
NM_176871chr853351 2429 2293 158 108 12922 32914 801 488 --
NM_177424chr11236 ------
NM_177999chr91135 --23537 2522 1199
NM_178013chr1422684 514 22706 1071 23032 363 --
NM_178026chr20------1572
NM_178126chr1731772 1567 629 --32037 503 240 --
NM_178313chr221471 118 --1670 166
NM_178423chr711284 1253 ----
NM_178496chr32525 130 1432 ----
NM_178539chr1241955 1840 1775 446 --11733 11534
NM_178580chr203379 312 30 ------
NM_181358chr183998 3973 3804 3715 3307 3189 3079 1104 ----12628
NM_181504chr583247 1687 1384 989 870 771 350 138 13056 ----
NM_181571chr10----184 --
NM_181645chr112111 26 ------
NM_181670chr121550 1403 162 --
NM_181672chrX31918 404 155 ------
NM_181782chr62828 115 ------
NM_181784chr262582 2005 1040 957 818 328 11687 11802 --
NM_181825chr222650 526 --1309 --
NM_182503chr665051 4488 4203 2196 1924 1544 11488 11535 13982
NM_182509chr1431396 198 135 ------
NM_182557chr1131978 1782 450 ----1859
NM_182565chr17----1103 --
NM_182765chr1011682 ------
NM_182975chr1--1885 ----
NM_183376chr1542537 1843 658 346 ------
NM_183416chr1--21556 1501 ----
NM_194247chr243023 2788 1159 458 14086 11272 --
NM_194272chr152313 152 ----1887
NM_194286chr1246187 4954 1209 157 --31952 1415 1201 --
NM_197939chr171400 --1197 --
NM_198066chr1422578 452 --1287 --
NM_198270chrX53327 2495 2450 2403 1163 1190 ----
NM_198511chrX1120 1241 1102 --
NM_198513chr821669 357 1260 ----
NM_198571chr73555 316 54 --1379 --
NM_198844chr17--11052 1906 --
NM_198988chr191103 ------
NM_199000chr711709 --11925 --
NM_199044chr152766 1217 986 846 669 --21210 811 1197
NM_199054chr1911390 2815 187 1657 11307
NM_199168chr1011107 --11031 --
NM_199286chr12------1377
NM_199320chr412339 12188 --2967 861
NM_199328chr211897 ------
NM_199423chr162306 290 1460 161 1356
NM_199459chr10----1381 --
NM_199464chr13------179
NM_201520chr17----1253 --
NM_201628chr153361 2746 2394 834 150 --11098 --
NM_203301chr1411208 ----1206
NM_203390chr811550 ----1577
NM_203394chr1292533 2143 2112 1815 833 767 438 429 399 ------
NM_203459chr112471 12267 1816 --
NM_203463chr264872 4064 3677 1190 468 355 21300 1027 24812 299 11200
NM_206853chr623397 316 11281 13743 --
NM_206854chr624658 1577 --25004 1246 --
NM_206933chr1--12365 12163 12824
NM_207303chr1063823 1307 819 573 447 124 13035 150 --
NM_207380chr1523181 2326 --1990 1417
NM_207422chrX41413 500 414 401 --1148 --
NM_207497chr61923 ------
NM_207577chr1182690 2601 2590 2253 799 625 611 462 12510 42642 2193 154 106 --
NM_207645chr113968 511 465 31314 494 36 21304 117 --
NM_212464chr153758 394 78 ----11679
NM_212467chr15187 ----12256