TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-675-3p
miRNA Sequence: CUGUAUGCCCUCACCGCUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541736 1684 1563 158 --11688 --
NM_000052chrX103198 2732 2726 2714 2706 2694 2276 2118 943 39 1959 13212 --
NM_000084chrX76956 4820 2440 1800 1040 1027 995 ------
NM_000096chr33861 791 243 ----1129
NM_000125chr654148 3494 3286 3062 60 --2104 92 --
NM_000138chr1542255 2083 2062 595 --1709 --
NM_000170chr91415 ------
NM_000216chrX82787 2772 1608 1321 1307 1295 1215 70 13443 23041 1325 --
NM_000217chr1254432 1383 1053 902 547 ------
NM_000222chr432150 2026 703 1793 --1744
NM_000248chr342729 2298 1932 866 ----12713
NM_000259chr1576175 4781 4739 4327 2513 987 249 24703 1649 ----
NM_000264chr963351 2871 1345 1028 460 346 12616 21287 1043 --
NM_000266chrX3803 321 127 --1766 1808
NM_000284chrX21634 224 11666 1152 --
NM_000291chrX1880 --2253 190 --
NM_000297chr452000 1907 1797 1254 813 1199 11419 --
NM_000314chr1093045 2937 2416 2179 675 597 558 328 156 21284 821 12941 --
NM_000328chrX147 ------
NM_000329chr12703 317 ------
NM_000332chr6107186 7159 6898 5393 4857 4827 2433 2331 1426 171 16068 26842 1102 16012
NM_000337chr566226 5380 4976 4953 1955 404 22481 2418 15200 12550
NM_000338chr1561153 1042 1010 924 813 133 ------
NM_000340chr331514 571 406 --11169 --
NM_000362chr222916 522 --21018 1006 --
NM_000368chr943786 3522 1226 33 --1943 --
NM_000390chrX73402 2962 2841 2139 1236 826 454 12557 22977 2328 --
NM_000393chr262052 1638 1495 1363 849 529 ----11500
NM_000408chr252978 2847 2684 2135 380 1553 23143 384 12385
NM_000428chr1452514 2398 2329 2320 1923 --12284 1326
NM_000430chr1773762 2812 1158 542 199 183 162 ------
NM_000480chr1131595 1471 1231 ------
NM_000486chr123867 459 446 13141 12491 23241 1122
NM_000533chrX21862 1848 --11852 11694
NM_000544chr6_cox_hap142487 1212 307 262 11051 23215 299 --
NM_000555chrX64792 1485 1265 772 365 333 16391 --16635
NM_000598chr731094 472 403 ----11131
NM_000599chr264556 4289 977 969 762 380 --12844 1988
NM_000612chr1181474 1440 1370 1314 1235 1178 1066 1022 1790 11391 --
NM_000618chr12136549 6413 5269 5036 4430 2583 2548 2501 1943 858 848 824 721 12264 ----
NM_000618chr12136549 6413 5269 5036 4430 2583 2548 2501 1943 858 848 824 721 12264 ----
NM_000633chr1874761 4643 1867 1820 807 606 588 2765 127 ----
NM_000719chr1296054 5382 5350 5261 4887 2668 1886 1210 1149 16268 14794 --
NM_000793chr1485012 4018 3597 3163 1185 1173 804 315 45118 4405 1198 863 ----
NM_000806chr531504 768 637 --11240 --
NM_000809chr498643 7730 7718 7676 3436 2868 2059 818 294 38346 7993 7488 38227 7432 2916 --
NM_000811chr52618 593 --1580 --
NM_000813chr564586 3456 907 836 672 387 33449 1017 436 ----
NM_000814chr1592608 1276 1079 746 479 294 249 204 114 --31026 591 157 --
NM_000824chr44956 817 661 247 1268 ----
NM_000826chr442618 2482 375 110 11991 --12276
NM_000831chr1136106 5216 5129 4473 4126 2439 2226 2192 2140 2069 1883 1868 1610 12013 45680 2211 2207 2203 24606 2032
NM_000838chr642650 2406 2350 1698 ------
NM_000845chr7--2480 195 --1468
NM_000855chr113248 242 236 1327 ----
NM_000868chrX82051 1925 1762 1709 561 449 316 124 1484 11901 --
NM_000875chr1526383 1757 --26202 1192 --
NM_000891chr1733148 732 73 ------
NM_000899chr1244385 4354 2761 34 23213 645 --14204
NM_000901chr431939 1592 486 32464 1627 780 32141 915 580 --
NM_000902chr342066 863 548 499 ------
NM_000912chr872933 1239 1060 683 501 207 25 23253 1307 ----
NM_000926chr11129252 9060 9037 7811 7503 7170 2887 1901 1854 1350 1077 800 77243 6975 5713 1882 1769 1249 1019 23160 2291 17441
NM_000944chr432122 1961 77 1684 11474 --
NM_000945chr241875 745 317 234 ------
NM_000950chrX2254 116 --1286 --
NM_000966chr1211064 ------
NM_001001323chr1212252 ------
NM_001001396chr154210 4019 3088 2826 1151 --11163 --
NM_001001419chr535214 5013 832 13540 2767 365 --
NM_001001420chr535214 5013 832 13540 2767 365 --
NM_001001481chr852795 2185 1229 596 212 12243 ----
NM_001001484chr1082273 2173 2141 2110 2003 1876 1629 646 --12079 --
NM_001001549chr72666 610 1470 ----
NM_001001550chr72666 610 1470 ----
NM_001001555chr72666 610 1470 ----
NM_001001664chr273867 3499 3465 3444 2707 881 132 23656 243 32581 1549 1359 11156
NM_001001995chrX31386 1351 407 11236 ----
NM_001002243chr23898 807 69 1948 2263 147 --
NM_001002257chr263574 2570 2378 2325 746 37 13124 1809 --
NM_001002295chr101742 ----1284
NM_001002926chr732605 1995 1735 32227 214 47 11072 11788
NM_001003406chr221279 --3257 227 199 --
NM_001003652chr1897126 6663 6537 6480 5495 5472 3085 2104 356 47057 7012 6715 2119 ----
NM_001003674chr18117097 6890 6679 6397 4769 2719 2131 1527 1095 959 937 11611 15165 1166
NM_001003675chr18117097 6890 6679 6397 4769 2719 2131 1527 1095 959 937 11611 15165 1166
NM_001003712chr1253781 3771 3227 3197 3063 --1280 --
NM_001003937chr211445 ------
NM_001004065chr963563 3551 3545 3488 1596 850 23517 145 13971 --
NM_001004317chr633643 1251 299 44537 3128 361 56 34394 1788 1002 --
NM_001004360chr22659 560 --1673 1357
NM_001004419chr1294512 3986 3706 3670 3206 3051 913 112 66 23222 450 34558 4441 1716 --
NM_001005473chr5126051 5304 5294 4780 4761 4300 2073 1950 1800 1716 568 59 32030 2023 1687 32008 1989 1963 25021 2060
NM_001005739chr22592 331 1847 ----
NM_001005849chr172403 189 ------
NM_001006117chrY290 32 ------
NM_001006600chr552164 816 739 492 305 1210 ----
NM_001007023chr1485012 4018 3597 3163 1185 1173 804 315 45118 4405 1198 863 ----
NM_001007067chr82390 101 ------
NM_001007068chr82390 101 ------
NM_001007069chr82390 101 ------
NM_001007070chr82390 101 ------
NM_001007099chr12185 60 ----1210
NM_001007100chr12185 60 ----1210
NM_001007246chr2111941 11516 1643 --
NM_001007277chr11----1983 --
NM_001008220chr541216 1154 380 297 12948 11158 12968
NM_001008225chr71697 --197 --
NM_001008392chr373258 2952 2921 2633 847 623 213 ------
NM_001008408chr785048 4655 4637 3871 2307 1251 1001 537 ------
NM_001008539chr874984 4538 4374 4352 2058 1711 82 31638 1397 1150 43692 362 109 39 --
NM_001008541chr1072178 1861 1760 1743 1475 747 624 12066 ----
NM_001008541chr1072178 1861 1760 1743 1475 747 624 12066 ----
NM_001008564chr1352050 1958 462 356 339 --21861 1766 1493
NM_001008566chr222139 85 ------
NM_001008707chr14------11460
NM_001008777chr174641 603 492 156 1629 1559 --
NM_001008801chr1931889 294 253 ----1287
NM_001008938chr11------194
NM_001009552chr82542 40 ------
NM_001009554chr433704 3178 26 24689 1020 ----
NM_001009554chr433704 3178 26 24689 1020 ----
NM_001009894chr121356 1614 11699 11277
NM_001009909chr1173060 2717 1334 1314 1217 1169 890 1245 --197
NM_001010000chr1893352 3181 3000 2926 2791 2212 1274 680 410 1515 12579 --
NM_001010861chr152732 2135 1009 613 406 ------
NM_001010862chrX63278 3272 3213 3080 2192 147 ------
NM_001010888chrX54287 4253 3841 864 303 33115 1738 29 ----
NM_001010891chr576662 5863 5045 2476 2159 971 952 45845 1830 1403 622 --26123 260
NM_001010895chr931657 597 187 21802 843 22086 480 --
NM_001010927chr62512 403 --1121 --
NM_001011666chr736390 372 43 --23998 2592 --
NM_001011708chr242536 2526 1995 602 42266 1988 1939 30 ----
NM_001012420chr1522159 208 --22307 257 11051
NM_001012423chr1532238 2159 208 --32307 1050 257 --
NM_001012643chr191456 ------
NM_001012756chr1953220 2480 853 373 229 --12792 --
NM_001012968chrX52681 1919 1035 755 409 12698 ----
NM_001013398chr731094 472 403 ----11131
NM_001013399chr63815 240 115 ------
NM_001013406chr721073 423 --1399 --
NM_001013620chr12128120 7721 7570 7563 6114 5818 5606 5128 1884 1442 952 585 47121 5861 5837 5543 26133 5897 --
NM_001014380chr1344036 3870 3864 1131 --11285 --
NM_001014797chr1057984 6314 1443 1308 1211 --25034 607 15121
NM_001015048chr1432893 2181 93 13106 --12998
NM_001015049chr1432893 2181 93 13106 --12998
NM_001015877chrX12419 1676 23098 2928 --
NM_001015880chr1041569 230 173 161 1180 ----
NM_001017371chr241256 1238 129 41 ------
NM_001017440chr757552 6281 5731 1950 50 ----18103
NM_001017923chr142223 76 ----11485
NM_001017969chr93442 98 92 ------
NM_001018009chr331009 43 30 11137 ----
NM_001018037chr941351 1048 244 82 1905 ----
NM_001018067chr194564 4319 1807 1739 1534 1146 620 449 62 ------
NM_001018068chr194564 4319 1807 1739 1534 1146 620 449 62 ------
NM_001018069chr194564 4319 1807 1739 1534 1146 620 449 62 ------
NM_001024226chr111125 ------
NM_001024227chr111125 ------
NM_001024228chr111125 ------
NM_001025068chr321818 367 21396 1227 11530 --
NM_001025069chr321818 367 21396 1227 11530 --
NM_001025076chr1085630 4719 4313 4174 2379 2223 1837 376 1269 ----
NM_001025077chr1056988 6077 5671 5532 1734 21627 870 1326 --
NM_001025108chr263686 3677 3244 1092 870 326 --23900 3707 --
NM_001025201chr22682 280 ----1111
NM_001025389chr1131595 1471 1231 ------
NM_001025390chr1131595 1471 1231 ------
NM_001025580chrX43342 3308 1647 1436 33726 2722 2664 1236 11401
NM_001025616chr41263 21685 1220 --11864
NM_001025780chr93570 556 317 21356 469 ----
NM_001029863chr683234 3087 2945 2669 2221 1290 425 134 42421 2199 1244 492 23238 944 --
NM_001029875chr552348 877 680 505 330 42091 774 672 353 22791 2471 --
NM_001030055chr1462996 911 742 94 79 56 33860 3044 890 --1252
NM_001031679chr121591 --11005 13553
NM_001031685chr1----1262 --
NM_001031711chr531365 496 338 --11669 --
NM_001031732chr453546 3245 2553 1003 849 13124 2674 155 --
NM_001033045chr264082 3945 3603 1367 907 706 --13607 1684
NM_001033057chr332063 1986 221 12129 22137 1939 --
NM_001033087chr2033241 2328 1318 --12614 --
NM_001033117chr35468 442 385 340 298 --1372 --
NM_001033576chr1711701 22571 1048 12674 1387
NM_001033910chr141713 1674 816 804 11482 12124 1843
NM_001034954chr1052591 2553 2346 2142 948 ------
NM_001034955chr1052591 2553 2346 2142 948 ------
NM_001034956chr1052591 2553 2346 2142 948 ------
NM_001034957chr1052591 2553 2346 2142 948 ------
NM_001035003chr41110 --1268 --
NM_001035004chr41110 --1268 --
NM_001037317chr152732 2135 1009 613 406 ------
NM_001037535chrX21065 433 2509 281 --1583
NM_001037536chrX21065 433 2509 281 --1583
NM_001037540chrX21065 433 2509 281 --1583
NM_001037553chr2163960 3284 2017 1862 739 680 --35092 4416 3417 --
NM_001037637chr5----1261 --
NM_001037954chr1133318 3169 171 ------
NM_001039538chr263509 2656 2335 1107 823 170 12383 ----
NM_001039570chr2224422 2904 31090 744 504 --14584
NM_001039571chr2224422 2904 31090 744 504 --14584
NM_001039573chr171423 ------
NM_001039590chrX53959 3701 2903 1579 1553 24033 2541 --13253
NM_001039591chrX53959 3701 2903 1579 1553 24033 2541 --13253
NM_001039618chr1195981 5874 5050 4258 4045 3657 1832 1673 881 --1733 --
NM_001039693chr222680 463 --23791 1396 23671 2688
NM_001039840chrX95969 5878 5411 5397 4994 4668 3682 1820 314 25702 476 24179 238 --
NM_001040020chr731428 971 562 --2284 95 --
NM_001040110chr74366 347 335 278 11660 ----
NM_001040142chr25852 836 814 563 123 --22143 828 --
NM_001040143chr25852 836 814 563 123 --22143 828 --
NM_001040152chr764737 4166 3432 3191 956 900 13232 ----
NM_001040153chr132717 399 ----1942
NM_001040157chr462374 2273 2222 2175 409 44 21793 74 1830 --
NM_001040159chr441433 430 337 112 --11012 11387
NM_001040202chr441926 975 147 61 1779 ----
NM_001040214chr691909 1840 1770 1659 1649 1607 551 430 108 1145 ----
NM_001040284chr1675516 5288 4630 1642 1053 651 519 11606 24806 480 --
NM_001040402chr492837 2708 2293 2028 989 595 544 523 88 1632 ----
NM_001040429chr1343579 3308 1049 951 63407 3340 3094 665 579 420 ----
NM_001040441chr144932 1783 675 137 11408 13500 11607
NM_001040446chr552674 2165 2050 1831 277 ------
NM_001040450chr1542423 2218 2183 1995 ----12894
NM_001040453chr1542423 2218 2183 1995 ----12894
NM_001040665chr794128 4020 3787 3280 3159 1576 794 441 378 33190 1569 30 15018 --
NM_001040712chr942603 1297 892 71 ------
NM_001040876chr421350 744 31918 251 68 --11490
NM_001042355chr1645390 1954 1444 832 --1860 1304
NM_001042412chr1645390 1954 1444 832 --1860 1304
NM_001042473chr102151 141 1755 31611 1360 241 --
NM_001042481chr1452479 984 897 613 480 11698 ----
NM_001042486chr20----11033 1139
NM_001042494chr1543564 1510 640 521 2846 828 11135 --
NM_001042495chr1543564 1510 640 521 2846 828 11135 --
NM_001042496chr1543564 1510 640 521 2846 828 11135 --
NM_001042497chr1543564 1510 640 521 2846 828 11135 --
NM_001042510chr821659 1387 21686 161 --1494
NM_001042511chr821659 1387 21686 161 --1494
NM_001042533chr322654 418 --142 --
NM_001042550chr941487 1287 1264 222 3458 307 85 2474 160 11499
NM_001042555chr1294698 4563 4348 4293 4189 3699 3484 3268 307 24313 1167 14008 13064
NM_001042599chr2117567 7556 7520 6924 6772 5829 4905 2687 1592 1336 435 56226 5876 4853 2136 1531 17007 1803
NM_001042603chr1262046 1414 1259 1213 1185 877 13813 1330 --
NM_001042604chr374610 4536 4192 4157 3705 1237 997 --11822 --
NM_001042669chr41263 21685 1220 --11864
NM_001042728chr1211064 ------
NM_001043318chr1423985 328 --12521 13868
NM_001044305chr631135 1111 87 1426 --1317
NM_001083620chr442616 2480 374 110 11989 --12274
NM_001099678chr3125479 5299 4887 2276 1574 1549 1451 763 453 435 419 413 ----32343 2260 594
NM_001106chr3159476 9334 9184 8764 8690 7780 7430 7424 6075 5934 3848 3329 3210 1365 208 ------
NM_001113490chrX63256 2359 1060 678 670 284 --13175 --
NM_001117chr1822317 1637 1295 130 --
NM_001121chr1021520 753 --1492 11467
NM_001126chr11175 ------
NM_001160chr1232711 2605 1975 --12803 --
NM_001173chr1462996 911 742 94 79 56 33860 3044 890 --1252
NM_001177chr1252119 2091 1679 615 296 --1113 --
NM_001179chr42233 195 ------
NM_001186chr2143059 2568 2532 321 --12509 --
NM_001198chr61196 1377 1222 --
NM_001204chr297458 6632 6069 5622 2795 2138 1413 1230 53 25852 2549 25899 2960 --
NM_001207chr5----1261 --
NM_001237chr42763 462 1772 11164 --
NM_001237chr42763 462 1772 11164 --
NM_001241chr25807 654 586 545 36 ------
NM_001241chr25807 654 586 545 36 ------
NM_001244chr92125 46 ----11051
NM_001256chr1752440 2347 608 570 70 --1156 --
NM_001257chr1691514 1475 1459 1353 1312 1006 974 952 385 --1946 --
NM_001259chr756045 5128 1480 1194 667 22068 1771 1718 11755
NM_001310chr1242905 912 634 585 --1811 --
NM_001356chrX52452 981 806 701 563 --1705 --
NM_001364chr1174680 4095 4055 3410 3346 1650 960 31156 1118 711 ----
NM_001378chr24373 343 169 72 --1438 --
NM_001415chrX61945 1857 643 591 278 271 ------
NM_001432chr463225 3138 2941 2726 1551 470 1227 --13729
NM_001438chr132751 1273 1136 32743 921 706 ----
NM_001453chr631159 1153 264 11138 ----
NM_001460chr142676 1146 899 357 ------
NM_001494chr10------161
NM_001546chr631028 965 215 --1907 --
NM_001616chr22879 591 ------
NM_001621chr762999 2992 2609 689 197 117 1284 --13055
NM_001621chr762999 2992 2609 689 197 117 1284 --13055
NM_001655chr1121466 782 ----12171
NM_001656chr542044 1893 236 76 --1107 11701
NM_001658chr111125 ------
NM_001682chr1211966 --11115 --
NM_001684chr153927 3736 2805 2543 868 --1880 --
NM_001703chr1------130
NM_001730chr1331175 515 458 ------
NM_001730chr1331175 515 458 ------
NM_001753chr751842 1639 1476 1369 26 11769 ----
NM_001755chr162470 87 ----11556
NM_001759chr1284676 4451 3812 2066 1898 1584 1399 378 ------
NM_001762chr71280 --1198 --
NM_001797chr161687 ----1253
NM_001819chr201200 ------
NM_001822chr22682 280 ----1111
NM_001860chr911128 ------
NM_001918chr199237 8930 8885 8321 5980 3144 2693 2252 621 39331 8735 705 27046 2740 18497
NM_001920chr12----1727 1545
NM_001942chr181338 21701 472 11870 --
NM_001969chr1453900 1271 1140 271 184 ------
NM_001977chr441441 1324 1080 463 11360 ----
NM_001981chr142287 1955 1610 967 12363 1247 --
NM_002006chr464453 3859 3584 715 568 332 21644 423 13744 15409
NM_002009chr1542629 2465 2084 1920 22754 2118 1202 --
NM_002015chr1342620 1157 1018 934 22848 288 ----
NM_002024chrX1678 ----21454 1442
NM_002025chrX128952 8072 7114 5987 3398 2684 2278 1664 1512 1040 822 379 43438 2998 2342 2049 ----
NM_002040chr2173225 2590 2200 1982 1144 1087 804 --43043 1202 1097 179 --
NM_002048chr91437 ------
NM_002051chr101742 ----1284
NM_002069chr71516 --1285 --
NM_002094chr161342 ------
NM_002128chr1342412 2405 615 575 11787 ----
NM_002147chr171680 ------
NM_002158chr273501 3392 3224 1449 1033 968 427 32602 2511 1105 11435 --
NM_002210chr243602 823 546 183 --1918 13084
NM_002214chr765186 4729 4313 4016 1984 1788 15562 ----
NM_002222chr331277 967 864 1976 11244 --
NM_002233chr112444 131 --1105 --
NM_002239chr26771 470 464 450 285 120 --1442 1233
NM_002247chr1072110 1600 1485 779 449 256 129 --11904 11510
NM_002253chr431298 1171 162 ------
NM_002264chr363952 3653 1659 1562 458 291 13877 15044 --
NM_002267chr131193 --1395 --
NM_002268chr321288 83 1418 --1613
NM_002270chr595604 5103 4695 4497 4277 4231 1871 929 742 24482 360 54716 3676 3595 2277 877 --
NM_002285chr263686 3677 3244 1092 870 326 --23900 3707 --
NM_002336chr1243631 1299 985 282 11880 11064 11984
NM_002351chrX1488 ------
NM_002372chr51653 ------
NM_002374chr263509 2656 2335 1107 823 170 12383 ----
NM_002382chr1411213 ------
NM_002397chr541992 1368 522 410 1708 ----
NM_002398chr221077 167 11059 21307 171 11312
NM_002430chr2222575 163 11655 1330 --
NM_002449chr531195 346 299 ------
NM_002473chr2211207 ------
NM_002480chr1221503 1270 11381 --1300
NM_002500chr251032 1003 834 526 506 1897 ----
NM_002527chr12121 ----164
NM_002556chr11------131
NM_002581chr985500 4970 4940 1801 1652 866 549 346 1365 3354 350 237 --
NM_002594chr2061915 1909 1885 1859 1842 100 ----12225
NM_002595chr122761 743 ------
NM_002607chr721265 843 ------
NM_002645chr1142959 2366 2355 353 --32994 56 52 --
NM_002655chr875197 3455 1926 1348 1327 1109 258 24650 4212 ----
NM_002657chr2033849 2817 1013 --1134 --
NM_002709chr283596 2590 1139 868 786 692 642 193 13313 13320 12431
NM_002710chr1231042 843 419 1833 1724 --
NM_002718chr342562 1818 513 78 ------
NM_002721chr91468 ------
NM_002740chr342677 2474 1904 1044 ------
NM_002745chr2253320 3183 747 631 363 --1930 11032
NM_002755chr151662 ------
NM_002760chrY83788 3636 2279 2034 1621 1343 1084 583 --35224 4483 679 --
NM_002767chr171444 ------
NM_002839chr942603 1297 892 71 ------
NM_002843chr1143350 2143 1222 151 13285 12791 --
NM_002858chr131349 978 513 ------
NM_002869chr111230 ------
NM_002880chr3------1782
NM_002892chr141118 --11348 --
NM_002902chr151570 ------
NM_002906chr1142272 1700 881 481 ----1942
NM_002924chr1----1394 --
NM_002940chr421350 744 31918 251 68 --11490
NM_002942chr321049 395 11182 ----
NM_002977chr213106 13480 1369 31249 1073 239
NM_002979chr12185 60 ----1210
NM_003003chr171221 ------
NM_003016chr17----11808 11793
NM_003030chr32640 524 ------
NM_003034chr12117386 7050 6500 5160 2951 2868 2256 1754 1143 1090 960 17700 21127 992 12181
NM_003042chr362098 2081 2002 1503 1410 435 12281 11648 --
NM_003043chr343308 506 357 339 1328 11143 14167
NM_003046chr874984 4538 4374 4352 2058 1711 82 31638 1397 1150 43692 362 109 39 --
NM_003060chr521239 320 ------
NM_003069chrX3616 275 42 ------
NM_003071chr331629 441 113 1451 ----
NM_003099chr1544597 1550 179 49 ----12374
NM_003107chr612271 ------
NM_003108chr266905 6165 5018 1464 1320 307 16415 17048 11077
NM_003111chr241256 1238 129 41 ------
NM_003112chr732863 2615 266 1792 --12539
NM_003128chr232437 2143 486 ----2625 59
NM_003155chr832643 2376 2364 --1821 12700
NM_003178chr332074 1716 1705 ----1254
NM_003199chr1824627 1419 14716 --14805
NM_003221chr611611 1126 --21514 180
NM_003246chr1531730 1427 477 11513 11451 1230
NM_003262chr344882 4010 3957 1177 --11626 --
NM_003272chr11292 --1677 --
NM_003298chr336002 4443 652 25501 58 14126 14769
NM_003372chrX1919 1927 ----
NM_003373chr1021619 581 ------
NM_003375chr10----1456 --
NM_003385chr21667 1873 1205 --
NM_003387chr262852 2679 2195 1885 390 65 1553 --1965
NM_003390chr1111130 ------
NM_003400chr22551 305 1333 ----
NM_003409chr1811296 ------
NM_003410chrX72954 2613 918 875 869 405 155 21168 85 ----
NM_003418chr31744 ------
NM_003439chr733052 1059 794 ----1179
NM_003463chr663105 1272 1153 392 270 60 --12723 1224
NM_003474chr1042295 2197 1887 1836 --11760 --
NM_003478chr1131144 396 211 --12384 12184
NM_003483chr1242543 1125 982 427 ----1386
NM_003489chr2142512 2489 1221 158 --22913 2461 --
NM_003574chr1874138 3786 1721 1643 1631 1530 127 11304 ----
NM_003590chr253948 3037 2623 917 541 23927 514 1835 24052 530
NM_003595chr222139 85 ------
NM_003607chr163266 3169 2987 828 512 241 --1614 --
NM_003615chr3238 24 33452 1528 722 11548 --
NM_003618chr241229 274 230 181 11068 ----
NM_003622chr1242631 810 613 519 177 1944 --
NM_003626chr1121142 523 ------
NM_003630chr62306 218 --1210 --
NM_003663chr322335 2300 ------
NM_003664chr51568 --1213 --
NM_003676chr11265 ------
NM_003677chr1210367 214 192 182 150 134 116 110 96 90 11654 5242 222 200 166 128 --
NM_003702chr81770 ------
NM_003711chr5----1242 --
NM_003718chr7------1140
NM_003722chr342627 1770 852 354 12738 12054 --
NM_003749chr1362045 1946 1904 1701 929 377 11726 ----
NM_003759chr454308 3341 3315 3303 1017 21627 1528 ----
NM_003783chr12987 309 1243 1256 11202
NM_003794chr3--31105 703 102 189 --
NM_003822chr152586 2578 2356 2045 394 23053 250 1905 --
NM_003825chr1561188 1081 955 545 271 220 ------
NM_003850chr13----1651 --
NM_003895chr2131875 765 475 1487 1508 12118
NM_003902chr13676 640 308 ------
NM_003913chr653905 3049 1232 810 427 --24006 2827 --
NM_003916chrX31108 421 303 11254 1326 --
NM_003919chr71102 ------
NM_003921chr131539 162 126 11761 ----
NM_003930chr731719 634 309 2671 654 --12268
NM_003968chr31700 ----1271
NM_003972chr1041209 925 912 902 --11138 --
NM_003980chr611317 ------
NM_003983chr1653336 1720 1655 541 116 --23040 755 --
NM_003994chr1244385 4354 2761 34 23213 645 --14204
NM_003998chr41470 ------
NM_004035chr1735037 4720 3157 24680 1118 ----
NM_004080chr731165 538 236 1101 1250 11170
NM_004093chr1333037 2259 428 12395 12247 --
NM_004114chrX21235 999 ------
NM_004117chr622156 2136 ------
NM_004124chr1443264 2858 1214 1011 23321 2450 ----
NM_004136chr1553090 2285 2027 916 101 32578 2212 532 12807 --
NM_004156chr82542 40 ------
NM_004161chr21410 --11236 1524
NM_004171chr11139456 8863 8559 7456 7291 3745 3320 3045 3021 2960 2879 2844 2426 33331 2700 1736 28019 1379 --
NM_004187chrX21454 1270 ----11477
NM_004225chr821229 492 1327 --11421
NM_004232chr1831240 731 479 ------
NM_004235chr92851 550 ------
NM_004241chr102689 161 ------
NM_004242chr63314 298 275 ----1117
NM_004301chr33112 101 61 ------
NM_004304chr21281 ------
NM_004338chr18117097 6890 6679 6397 4769 2719 2131 1527 1095 959 937 11611 15165 1166
NM_004342chr722252 1520 1714 1705 --
NM_004370chr6----11872 --
NM_004385chr51287 ------
NM_004388chr11104 ------
NM_004392chr1342271 1966 858 638 --2944 281 --
NM_004397chr1143005 1038 1022 980 --14246 --
NM_004432chr921963 72 21583 43 --12240
NM_004434chr14------11460
NM_004438chr243070 2864 2189 53 1698 --13337
NM_004458chrX32446 2173 2059 1635 ----
NM_004464chr463935 3198 3074 1651 455 342 11609 21708 963 --
NM_004484chrX1111 ------
NM_004500chr1452023 1653 1508 800 346 ------
NM_004501chr173767 3731 3308 2669 2659 1380 1207 11434 ----
NM_004525chr241417 1332 1309 49 ------
NM_004529chr92538 373 --1421 11348
NM_004582chr13388 305 143 ------
NM_004586chrX95167 4962 4405 3340 1796 913 818 475 312 24807 4471 35013 1402 511 --
NM_004600chr121113 61 1437 1992 --
NM_004602chr2021010 41 11074 11161 --
NM_004612chr974378 4359 3227 1723 952 579 539 24131 564 21369 1011 --
NM_004619chr141713 1674 816 804 11482 12124 1843
NM_004630chr1111091 ------
NM_004657chr241252 1224 448 132 1472 ----
NM_004670chr1041569 230 173 161 1180 ----
NM_004686chr82453 400 --2578 323 --
NM_004687chr1731627 1376 349 22079 1402 --1422
NM_004703chr1742328 2159 842 730 11606 ----
NM_004718chr21163 ------
NM_004719chr1242416 2258 1976 81 ------
NM_004726chrX65743 5295 4733 3761 1608 1290 ------
NM_004730chr531337 337 62 32088 2078 853 ----
NM_004738chr2051725 709 400 281 150 --12641 --
NM_004742chr31644 ----1448
NM_004748chr1574122 3966 3928 3606 1369 1300 383 ----23541 1615
NM_004755chr1441167 1114 1034 52 --1477 --
NM_004774chr1783056 2874 2802 2765 2103 626 327 159 13166 ----
NM_004776chr2022820 2240 --22901 2340 --
NM_004787chr4141 ------
NM_004798chr2093235 3025 2475 2379 878 833 826 782 572 ------
NM_004801chr221188 1134 21036 99 11296 --
NM_004815chr144739 4286 1371 455 --24929 1919 --
NM_004844chr331009 43 30 11137 ----
NM_004849chr62668 630 11300 --11475
NM_004850chr251201 538 470 131 123 11633 ----
NM_004859chr1742284 2053 510 455 21101 465 22121 622 --
NM_004866chr584657 3840 3823 3511 3485 3441 1633 842 14694 23691 1817 --
NM_004873chr1432893 2181 93 13106 --12998
NM_004879chr11----1861 --
NM_004898chr432316 2222 955 --11984 --
NM_004902chr20------2715 201
NM_004904chr736390 372 43 --23998 2592 --
NM_004906chr64636 545 73 25 ------
NM_004912chr721073 423 --1399 --
NM_004929chr821158 175 1581 1111 --
NM_004938chr921170 396 ------
NM_004967chr4198 ----1389
NM_004984chr125539 444 416 71 24 1585 1456 --
NM_004992chrX38481 8019 2024 --12441 --
NM_004992chrX38481 8019 2024 --12441 --
NM_004996chr16----11651 --
NM_004999chr61255 1375 24216 3518 --
NM_005011chr74366 347 335 278 11660 ----
NM_005012chr1----130 --
NM_005037chr31140 ------
NM_005056chr1251658 1503 1457 1429 1121 14057 1574 --
NM_005063chr1073724 2969 1088 857 740 666 622 ----11499
NM_005066chr11519 --1550 --
NM_005119chr121139 462 ------
NM_005121chr1773306 3203 2396 2358 1440 1225 1058 33172 846 217 ----
NM_005123chr12----1321 --
NM_005126chr362137 1867 883 594 75 61 1142 ----
NM_005135chr1543564 1510 640 521 2846 828 11135 --
NM_005156chr975378 4422 4343 3635 3626 1336 516 2492 345 ----
NM_005164chr1232435 1017 879 ----1629
NM_005168chr22416 103 ------
NM_005180chr1041596 1528 1069 507 ------
NM_005188chr1178285 7457 7338 5918 3150 2974 2246 ------
NM_005190chr63815 240 115 ------
NM_005197chr1434839 4687 2134 45554 5327 4315 1382 15703 --
NM_005203chr102136 61 ------
NM_005233chr382401 2155 2060 2043 1613 838 803 401 --32148 531 284 --
NM_005235chr2117567 7556 7520 6924 6772 5829 4905 2687 1592 1336 435 56226 5876 4853 2136 1531 17007 1803
NM_005249chr141554 ------
NM_005254chr151945 ------
NM_005259chr251315 1067 509 465 383 1196 --1965
NM_005269chr121143 ------
NM_005296chrX1134 ------
NM_005311chr72666 610 1470 ----
NM_005328chr81550 ------
NM_005339chr433251 3035 450 11710 14342 --
NM_005359chr1836477 2062 738 11313 ----
NM_005378chr21594 ------
NM_005385chr332194 801 582 --22693 367 --
NM_005399chr164452 4404 3974 2974 2871 212 11591 ----
NM_005400chr232064 616 513 31229 1143 1035 1250 --
NM_005413chr22337 141 2465 150 ----
NM_005426chr1----1262 --
NM_005433chr1822268 1909 22074 1766 12026 1834
NM_005436chr1073946 3929 3498 2821 1528 1277 85 12752 ----
NM_005465chr141278 734 492 170 --1530 --
NM_005497chr1755906 4623 4151 2275 2106 12149 14532 --
NM_005504chr1254881 2058 1439 710 570 24638 253 24764 4104 11165
NM_005517chr11173 ------
NM_005578chr354980 4528 4162 3903 3252 ----11051
NM_005596chr956114 5867 4771 2049 1699 ----1821
NM_005604chr631942 569 498 1805 ----
NM_005613chr172143 1866 1684 1651 486 471 365 --2545 519 11755
NM_005625chr82390 101 ------
NM_005644chr1----1112 --
NM_005665chr164831 1731 1101 980 463 94 --13348 --
NM_005668chr574230 3661 3587 3179 3020 591 344 --34071 4047 4013 13721
NM_005717chr1------1890
NM_005725chr192328 2318 2292 2278 2146 1860 1679 541 204 22203 777 ----
NM_005748chr1222796 100 42877 2607 765 46 --1418
NM_005754chr52343 21 130 21205 285 --
NM_005756chrX41271 1048 970 386 1341 11386 --
NM_005759chr234539 3446 342 24339 3808 11845 --
NM_005779chr543609 2821 2795 2755 1674 12264 --
NM_005795chr252350 2109 1887 654 367 22024 974 ----
NM_005807chr1198 ----1677
NM_005808chr373258 2952 2921 2633 847 623 213 ------
NM_005828chr1764477 4268 1779 1735 1427 906 ------
NM_005840chrX87674 7198 7015 5802 2669 2247 1822 962 26987 5085 ----
NM_005843chr221400 567 --11913 1654
NM_005845chr1311297 21656 110 21321 1281 --
NM_005898chr1122454 516 32928 2527 549 ----
NM_005901chr1897126 6663 6537 6480 5495 5472 3085 2104 356 47057 7012 6715 2119 ----
NM_005902chr1563990 2953 1631 754 435 50 --23360 925 --
NM_005903chr535214 5013 832 13540 2767 365 --
NM_005906chr621522 1300 11514 ----
NM_005907chr641679 1340 1137 46 --11391 --
NM_005909chr553278 2870 1023 810 270 1745 24023 864 --
NM_005935chr424603 3440 13421 14626 --
NM_005941chr874169 3672 2774 2758 1332 721 618 22589 1156 --13174
NM_005955chr155215 4529 3641 1987 1078 --11068 --
NM_005962chr1072178 1861 1760 1743 1475 747 624 12066 ----
NM_005962chr1072178 1861 1760 1743 1475 747 624 12066 ----
NM_006007chr994316 4187 3529 3416 1128 821 798 546 328 ------
NM_006015chr111203 ------
NM_006022chr1331010 984 248 ----11093
NM_006037chr254539 4500 3607 1479 187 11010 23708 1741 --
NM_006047chr2042193 2171 1151 236 --2499 113 --
NM_006080chr731076 834 76 ------
NM_006100chr31104 ------
NM_006139chr242853 2658 2018 1979 11990 ----
NM_006141chr1622645 21 ------
NM_006154chr151757 32792 2025 129 --12664
NM_006190chr23870 856 686 ----1112
NM_006194chr14------1971
NM_006197chr831743 1537 345 --21848 51 12286
NM_006241chr382081 2053 2041 1819 1811 1491 841 107 --12437 --
NM_006246chr1411159 ------
NM_006251chr552888 2072 328 229 87 23256 3011 52788 1333 1323 991 42 --
NM_006252chr167189 7064 5899 5107 4730 2631 --15908 --
NM_006255chr1431098 778 232 --11062 --
NM_006256chr112601 --1953 1520
NM_006265chr811237 ------
NM_006281chr82369 243 ------
NM_006281chr82369 243 ------
NM_006283chr854447 3496 1477 1206 522 21401 1351 14170 --
NM_006287chr212436 1425 12584 12106
NM_006298chr653152 2500 2183 959 817 1590 12308 --
NM_006313chr12------11264
NM_006323chr42674 595 ------
NM_006330chr861456 1307 468 437 389 187 ------
NM_006352chr12700 36 ------
NM_006364chr14----1474 --
NM_006379chr722088 444 11432 1154 1212
NM_006380chr1743222 1526 898 791 --1177 --
NM_006415chr9------11057
NM_006420chr2083293 3203 2848 2724 1292 282 198 49 ------
NM_006434chr1052591 2553 2346 2142 948 ------
NM_006460chr1731590 568 68 --11670 --
NM_006520chrX41615 1327 1304 191 11054 --11163
NM_006521chrX31360 1190 1144 ------
NM_006526chr2031992 321 240 12037 ----
NM_006529chr41122 31601 503 373 --193
NM_006540chr8----11304 --
NM_006544chr1445578 1510 896 534 14564 33769 1865 866 --
NM_006547chr762062 1897 1611 1551 172 99 21771 1441 ----
NM_006558chr8150 ------
NM_006561chr1085630 4719 4313 4174 2379 2223 1837 376 1269 ----
NM_006572chr1742774 2678 422 282 --21132 553 --
NM_006577chr21813 1925 11050 --
NM_006589chr11113 ------
NM_006595chr1141820 776 721 655 --1739 --
NM_006599chr16108246 7675 7257 6532 6424 5334 2048 1987 1352 303 27049 3077 ----
NM_006601chr1211048 ------
NM_006614chr373658 3084 2351 1247 616 505 81 23058 1135 31420 878 381 --
NM_006624chr101558 11560 --1832
NM_006626chr91576 42624 1022 358 219 1626 --
NM_006629chr1852304 2188 2132 843 619 12331 ----
NM_006650chr541216 1154 380 297 12948 11158 12968
NM_006654chr1294698 4563 4348 4293 4189 3699 3484 3268 307 24313 1167 14008 13064
NM_006710chr23158 135 44 ------
NM_006717chr942851 2645 1288 437 13281 33322 2403 422 --
NM_006722chr342729 2298 1932 866 ----12713
NM_006727chr5----1463 --
NM_006729chrX85220 5100 4091 1956 1736 1718 1372 432 1770 ----
NM_006746chrX21065 433 2509 281 --1583
NM_006750chr1678082 8022 7966 7263 6715 6628 6451 35610 1818 1407 16507 --
NM_006813chr61177 3283 136 103 ----
NM_006827chr1493347 3335 3214 2412 1329 1273 1210 1028 876 11342 11032 --
NM_006852chr1752664 2164 2158 925 582 12171 ----
NM_006874chr42405 376 --1115 --
NM_006884chr32640 524 ------
NM_006885chr1643742 3136 2666 161 --1389 11274
NM_006902chr173314 2946 2661 2356 2245 1144 1055 ------
NM_006914chr931213 530 520 2315 222 11490 --
NM_006922chr212554 1137 32431 2115 1933 1468
NM_006924chr1723535 569 --141 --
NM_006937chr172403 189 ------
NM_006956chr7102368 2317 2064 2033 1974 903 686 630 273 242 ------
NM_006981chr932729 2248 1019 32326 1830 997 12384 --
NM_006996chr12304 87 ----11725
NM_007013chr83659 279 261 1865 ----
NM_007034chr12832 397 ----1991
NM_007038chr2195555 5452 4846 4593 4424 2202 1006 696 448 1956 --14355
NM_007050chr2037390 7195 1051 28089 5741 15773 17734
NM_007054chr533290 3159 168 --33964 3711 599 --
NM_007107chr32933 626 --12235 --
NM_007114chr332403 1254 319 2337 286 13137 --
NM_007144chr1721321 171 --1441 --
NM_007146chr1741071 677 598 484 22876 387 22092 1020 --
NM_007173chr1162192 2178 2006 708 229 204 11619 --1372
NM_007203chr963563 3551 3545 3488 1596 850 23517 145 13971 --
NM_007249chr1366973 6818 6711 3067 2251 1556 25982 3643 ----
NM_007275chr3----1279 1424
NM_007287chr342066 863 548 499 ------
NM_007288chr342066 863 548 499 ------
NM_007289chr342066 863 548 499 ------
NM_007292chr1735037 4720 3157 24680 1118 ----
NM_007331chr452663 2106 476 377 198 12745 ----
NM_007345chr1852347 1715 1485 848 768 ------
NM_012081chr563206 3094 2445 721 573 559 ------
NM_012092chr231597 1460 110 --1730 --
NM_012096chr333565 1466 448 23588 1345 13650 --
NM_012156chr2043419 2439 2265 184 1955 1150 --
NM_012164chr977139 4967 4943 2801 2773 1818 203 1193 --17234
NM_012197chr921627 376 ------
NM_012223chr231158 982 289 ------
NM_012243chr1----2943 934 --
NM_012249chr263563 3417 1407 1399 1060 338 --22810 493 --
NM_012250chr1141367 942 872 245 ------
NM_012252chr784626 3913 3626 1423 1307 778 772 676 55323 5151 4923 3293 365 25373 4291 25067 1557
NM_012257chr72383 242 --2323 39 --
NM_012262chr153994 1430 971 415 254 ----24610 2050
NM_012287chr353507 3083 511 349 141 --21809 52 --
NM_012297chr432118 2093 1054 --11889 --
NM_012302chr12201 191 2387 175 1811 --
NM_012330chr1041528 1450 1329 453 1172 ----
NM_012345chr131752 --21311 22 --
NM_012347chr622337 278 12048 1649 --
NM_012395chr753344 3133 3061 2962 2238 13150 ----
NM_012399chr2251652 476 277 203 162 ------
NM_012416chr91318 ------
NM_012425chr1032736 2337 594 --22077 1790 --
NM_012446chr51204 ------
NM_012454chr62512 403 --1121 --
NM_012464chr432962 1871 242 32279 471 97 22689 1810 --
NM_012471chrX31306 1221 212 ------
NM_013229chr1232711 2605 1975 --12803 --
NM_013231chr1474382 4071 1744 1670 1273 1159 817 ------
NM_013233chr21557 ----11379
NM_013243chr1531037 942 373 --1216 --
NM_013255chr7118161 8152 7938 7382 7211 7205 7191 5984 2331 992 225 15927 17174 11068
NM_013262chr611261 ----11372
NM_013269chr1284439 3913 3633 3597 3133 2978 840 39 23149 377 34485 4368 1643 --
NM_013281chr202948 587 1136 ----
NM_013309chr1542653 2482 2381 1038 --11884 12452
NM_013341chr242536 2526 1995 602 42266 1988 1939 30 ----
NM_013372chr1512331 ----13040
NM_013374chr332665 1267 1173 1764 --11057
NM_013381chr122676 383 22229 1692 2660 644 --
NM_013436chr24592 255 171 121 ------
NM_013437chr8------131
NM_013438chr9----31203 419 212 1479
NM_013943chr142661 2434 166 108 ----12780
NM_013989chr1485012 4018 3597 3163 1185 1173 804 315 45118 4405 1198 863 ----
NM_013995chrX51868 1853 1833 1687 507 162 ----
NM_014000chr1021619 581 ------
NM_014048chr1655196 5162 3654 3354 709 24316 3877 13634 --
NM_014059chr13------1369
NM_014089chr1352050 1958 462 356 339 --21861 1766 1493
NM_014106chr1542722 2677 2539 250 12506 12480 --
NM_014112chr854785 1894 1588 658 652 --11120 --
NM_014155chr1197143 6688 4638 2863 2387 1846 1391 796 535 11123 22302 1104 17063
NM_014190chr4----11807 --
NM_014191chr127961 839 695 682 663 319 27 1409 ----
NM_014243chr441408 740 306 69 11724 11978 --
NM_014300chr15----1416 --
NM_014319chr122749 731 --1394 --
NM_014331chr4116755 5741 5397 5245 2847 2827 2778 1707 1048 145 134 27301 964 34991 1116 440 --
NM_014333chr1112764 --12483 --
NM_014415chr341525 1366 357 322 --11442 --
NM_014418chr14------11930
NM_014421chr421762 1495 2440 368 ----
NM_014423chr543966 3515 1498 1091 11564 11353 11041
NM_014456chr1031583 1184 737 1366 ----
NM_014496chrX------1222
NM_014522chrX1655 ------
NM_014554chr123929 921 445 42084 1482 585 357 21806 433 --
NM_014562chr26851 845 833 821 812 249 ------
NM_014572chr1331631 1299 580 --11337 --
NM_014574chr1411469 ----11504
NM_014588chr203556 87 41 ------
NM_014606chr431501 447 61 --21539 1057 --
NM_014612chr931329 1249 622 1611 ----
NM_014616chr353176 2392 1189 835 796 3985 690 665 ----
NM_014629chr811116 --11287 --
NM_014630chr1553642 3583 3379 2689 907 ----23681 3416
NM_014660chr711097 1908 1964 --
NM_014666chr531332 963 444 --1518 --
NM_014671chr741492 1381 610 595 ------
NM_014682chr822262 1891 1921 --11912
NM_014701chr1573269 2784 2603 2319 2204 1227 878 --11161 --
NM_014702chr663279 3165 2548 958 465 400 1619 23085 1193 --
NM_014709chr22433 190 ------
NM_014717chr19----2154 108 --
NM_014719chr7192 --11119 --
NM_014720chr1021694 1659 ----11724
NM_014721chr685856 5489 5095 2671 1853 725 703 656 --27090 6886 --
NM_014733chr582231 2152 2020 2008 1781 1574 625 315 --11396 --
NM_014739chr664024 3677 3104 998 491 265 33175 3048 383 21276 438 --
NM_014743chr462849 2334 895 803 775 720 --12913 --
NM_014746chr264137 4128 3938 2677 1239 1071 ----1536
NM_014755chr243767 792 613 341 14288 181 --
NM_014756chr11------194
NM_014803chr1042243 2138 1864 1067 1568 ----
NM_014826chr163266 3169 2987 828 512 241 --1614 --
NM_014827chr11125 ------
NM_014829chr521820 794 21652 573 31634 1605 1588 --
NM_014832chr1362052 1626 1472 680 645 165 1223 ----
NM_014841chr621288 1188 2486 375 ----
NM_014850chr35468 442 385 340 298 --1372 --
NM_014859chr1731151 1091 36 ----11096
NM_014873chr144610 1916 699 652 ------
NM_014877chr17117428 7280 6745 6047 5746 4982 4951 4764 2083 690 644 --12800 --
NM_014887chr131604 1885 1623 --
NM_014888chr731428 971 562 --2284 95 --
NM_014897chr1753023 2934 2861 2606 2263 1763 --1727
NM_014901chr542313 2172 1959 676 11749 ----
NM_014902chr20----11033 1139
NM_014903chr1211603 --22419 2230 --
NM_014904chr1073629 3437 3001 2637 918 527 460 --33941 3849 518 --
NM_014912chr1032164 1410 1033 --1393 1893
NM_014918chr1521021 1013 ----190
NM_014920chr623092 292 12709 --13145
NM_014923chr1362221 2012 1934 904 870 840 12109 1834 1854
NM_014926chr3----11067 --
NM_014932chr331925 1661 122 21649 170 ----
NM_014934chr1343847 1348 774 500 --13549 --
NM_014946chr232903 1996 1058 2733 175 11067 --
NM_014947chr11263 ------
NM_014962chr2022635 1090 1983 --1840
NM_014982chr1464246 3432 2088 1742 1268 1036 55101 4579 4449 3997 1916 ----
NM_014988chr422631 2091 --1219 --
NM_014989chr62297 285 --21433 279 --
NM_015000chr1242896 1153 734 720 ------
NM_015009chr33797 572 308 1539 ----
NM_015025chr232188 665 515 ------
NM_015026chr1224088 673 --22985 254 --
NM_015032chr1362853 1913 1883 955 178 151 22096 627 ----
NM_015035chr2076412 4907 2347 2021 2009 1186 322 --22243 1113 --
NM_015042chr1544201 3093 3057 1105 23510 630 ----
NM_015049chr242387 2231 1013 316 33131 712 30 13111 --
NM_015057chr131708 ----1499
NM_015071chr576193 5123 4174 2599 2464 626 187 11002 25817 520 --
NM_015076chr643441 1607 1547 112 33755 3711 3452 11642 --
NM_015087chr1342460 2344 1730 1691 --12703 --
NM_015110chr932099 1833 863 ------
NM_015115chr492837 2708 2293 2028 989 595 544 523 88 1632 ----
NM_015130chr421279 959 --1322 --
NM_015132chr741876 1648 1622 217 --21930 1638 1657
NM_015143chr4----2437 419 --
NM_015155chr1053095 2714 1206 743 409 ------
NM_015163chr1411277 --1470 11965
NM_015172chr121427 237 ----1293
NM_015176chr13620 311 63 --2676 301 --
NM_015180chr141611 ------
NM_015187chr43882 332 305 2988 212 ----
NM_015199chr322808 2425 --11938 --
NM_015200chr422473 773 ------
NM_015205chr13153817 3807 3750 3744 3670 3617 3595 3498 3478 3380 3307 3273 3264 3235 407 --34865 4846 3215 --
NM_015206chr1553502 2764 877 358 24 --1158 --
NM_015208chr1832811 776 528 1897 1711 22905 1464
NM_015236chr421093 586 11413 ----
NM_015247chr1645390 1954 1444 832 --1860 1304
NM_015265chr232016 1887 438 22438 1741 12409 --
NM_015267chr1222131 1731 --21768 437 --
NM_015271chr4104312 4210 3185 3150 2816 2638 1182 1170 738 320 13488 11126 --
NM_015272chr162693 157 11515 21439 581 --
NM_015275chr1242170 1827 1475 397 --1388 --
NM_015285chr1851914 1717 1655 945 150 --12315 --
NM_015308chr11----1567 1141
NM_015310chr866327 6208 2970 2917 2371 2192 16355 ----
NM_015313chr1154726 4395 1332 904 564 24206 3670 ----
NM_015323chr66648 402 392 380 117 26 2701 85 ----
NM_015328chr732958 1200 922 167 ----
NM_015335chr1232622 2361 886 11034 --1365
NM_015336chr1252281 1783 764 103 25 ------
NM_015344chr852060 1537 527 497 150 --1512 --
NM_015347chr1262775 2522 2269 1131 610 335 ------
NM_015349chr63711 628 339 1952 22914 890 --
NM_015360chr53165 155 147 --1199 --
NM_015365chrX43342 3308 1647 1436 33726 2722 2664 1236 11401
NM_015375chr174997 4012 3521 1876 1061 843 187 --11003 --
NM_015381chr2222005 469 ----11310
NM_015385chr1052591 2553 2346 2142 948 ------
NM_015387chr232124 1468 645 134 1514 --
NM_015407chr31162 ------
NM_015409chr1212751 ----1387
NM_015446chr141637 1156 258 207 ------
NM_015455chr543701 3614 3408 3231 1690 1981 --
NM_015458chr815042 34928 778 702 1771 11879
NM_015484chr14729 702 644 630 --2825 246 --
NM_015520chr342761 2684 919 191 12827 22835 2637 --
NM_015535chr233056 1366 456 197 ----
NM_015554chr1542840 1827 1809 268 12888 22229 1167 --
NM_015564chr553574 2540 1405 733 307 1272 ----
NM_015569chr164647 4180 3670 3407 656 388 --33293 3124 287 13419
NM_015575chr253597 3520 1126 1080 718 13543 23528 3261 --
NM_015577chr511735 ------
NM_015602chr121661 1568 1143 ----
NM_015640chr194564 4319 1807 1739 1534 1146 620 449 62 ------
NM_015696chr1------1433
NM_015852chr7103520 3206 3190 3182 2448 1028 876 708 608 524 33370 779 389 ----
NM_015869chr31140 ------
NM_015879chr1846005 1507 921 447 32578 2530 1242 17138 --
NM_015886chr875678 4769 3613 3530 1704 922 91 45115 3807 728 397 35493 5136 350 --
NM_015888chr172613 2579 2461 1153 628 235 139 32292 909 488 13122 --
NM_015906chr184375 3860 3758 3446 1696 783 446 344 11734 ----
NM_015912chr822379 1720 ------
NM_015976chr1----1284 --
NM_015994chr141295 ------
NM_016009chr11874 151 --1838
NM_016018chr892850 2399 2377 2318 2211 1062 872 837 264 ------
NM_016023chr811979 ------
NM_016073chr1541183 1152 281 23 ------
NM_016075chr1372942 2907 2771 2359 538 433 174 ------
NM_016076chr122398 379 22948 256 ----
NM_016083chr653235 2824 2472 1527 825 12569 --13771
NM_016096chr821659 1387 21686 161 --1494
NM_016100chr20----2395 343 --
NM_016132chr1552849 2589 2582 898 609 ------
NM_016156chr1172294 2053 1806 691 534 413 34 ------
NM_016192chr2----1183 --
NM_016195chr103886 286 127 1674 1110 1566
NM_016206chr368841 8178 5902 5828 2839 1671 33576 1340 920 ----
NM_016216chr31551 ----1700
NM_016255chr642592 955 949 860 --13231 --
NM_016258chr1144 ------
NM_016260chr297357 6738 5255 5141 4830 2700 2098 607 280 36709 4816 2121 12540 27563 5246
NM_016271chr1851631 1615 1429 921 897 ------
NM_016287chr132080 1556 252 ------
NM_016289chr2----12256 --
NM_016300chr33428 179 155 ------
NM_016319chr12----1775 --
NM_016322chr912788 ----12235
NM_016351chr7----2490 475 1606
NM_016396chr1551997 868 689 586 189 1785 22712 2118 --
NM_016410chr9121 ------
NM_016507chr1721135 1121 --12982 --
NM_016513chr623092 292 12709 --13145
NM_016516chr22592 331 1847 ----
NM_016522chr1141109 1038 1025 1018 199 ----
NM_016531chr4113729 3720 3562 3308 3200 3172 1511 1320 1106 869 835 1890 13553 11577
NM_016559chr341204 471 293 121 --1465 --
NM_016603chr541750 1689 1371 469 32167 1863 1414 ----
NM_016626chr1851666 1509 1349 412 326 ------
NM_016654chr151945 ------
NM_016824chr1021520 753 --1492 11467
NM_016830chr121539 ------
NM_016950chr441433 430 337 112 --11012 11387
NM_016953chr275643 5404 4744 4227 1417 1010 128 11327 ----
NM_017420chr1443866 3631 3479 1230 --4478 474 340 166 1122
NM_017437chr1421799 924 196 42136 734 683 477 --
NM_017447chr2144189 3826 2883 1375 21640 55 12738 --
NM_017452chr2021010 41 11074 11161 --
NM_017453chr2021010 41 11074 11161 --
NM_017454chr2021010 41 11074 11161 --
NM_017546chr2------1103
NM_017548chr331990 863 173 ------
NM_017563chr355533 5133 4519 1390 572 21743 106 14328 --
NM_017594chr922668 767 --12821 33325 3187 2826
NM_017610chr1541763 1337 1314 686 1576 1166 --
NM_017628chr454616 3716 546 460 109 24607 3597 --24536 947
NM_017633chr683512 2829 2738 1184 1083 1064 1051 813 ------
NM_017634chr811799 ------
NM_017635chr1151481 604 404 145 121 ------
NM_017637chr996322 3701 3484 831 817 756 300 294 144 36313 3237 2524 18106 --
NM_017640chr62786 644 ------
NM_017644chr344800 3559 375 298 ------
NM_017645chr962696 2641 2497 2452 2436 2430 22183 432 ----
NM_017650chr745391 5110 4760 1195 --14936 --
NM_017657chr23898 807 69 1948 2263 147 --
NM_017658chr1434203 849 757 ------
NM_017694chr21112 ----1630
NM_017704chr113725 365 246 --2878 183 --
NM_017719chr31170 --12245 12052
NM_017736chr1632738 655 645 1773 --12671
NM_017742chr1831888 625 97 ----1527
NM_017744chr15939 853 600 129 109 ------
NM_017745chrX153 ------
NM_017752chrX21687 337 --11827 11751
NM_017762chr1521901 731 11621 ----
NM_017769chr1462379 1037 500 473 357 190 12560 ----
NM_017770chr662575 2082 874 773 509 27 --1301 --
NM_017813chr895617 5481 5264 4758 4269 1490 351 241 230 --22085 254 --
NM_017830chr4172 --21050 243 1321
NM_017831chr1823986 901 23505 3262 21316 932 --
NM_017848chrX63680 1070 1058 1050 989 629 --1948 --
NM_017890chr831881 1712 365 ------
NM_017902chr1075557 5488 4396 4301 1734 751 687 --22046 345 --
NM_017915chr1231115 271 211 --21133 402 --
NM_017926chr142352 81 --1688 --
NM_017938chrX11628 21931 1595 ----
NM_017972chr142352 81 --1688 --
NM_017988chr12----1856 --
NM_018008chr33381 338 134 161 ----
NM_018018chr1241784 1764 1567 1276 ----11658
NM_018027chr1083040 2856 2395 2269 2056 1017 566 522 ------
NM_018032chr16----1369 --
NM_018084chr252977 2780 2657 2483 2292 12619 --12628
NM_018107chr144946 934 737 348 ------
NM_018119chr161302 ------
NM_018120chr831206 1168 126 ------
NM_018157chr12102401 1199 1193 1181 1173 1095 902 889 189 143 --23188 2096 --
NM_018159chrX31531 1046 312 ------
NM_018179chr12----1126 --
NM_018181chr1821905 1609 ------
NM_018184chr341843 1624 314 280 ------
NM_018200chr1542093 1665 476 297 ------
NM_018211chr142238 1752 511 308 1541 11693 --
NM_018243chr433953 3888 1299 13482 14050 --
NM_018254chr172141 2054 1852 1645 683 544 522 ----1775
NM_018299chr852795 2185 1229 596 212 12243 ----
NM_018313chr352243 1872 1073 491 223 ------
NM_018317chr4------1100
NM_018330chr101530 ----1703
NM_018351chr1254695 4018 3147 1818 297 34751 1598 1163 24286 3449 --
NM_018364chr133669 1517 147 13541 13879 --
NM_018367chr1152440 1870 1864 1845 1002 ------
NM_018373chr14116229 5728 5136 4975 4260 2020 1617 1608 517 507 337 12302 ----
NM_018374chr734570 1762 757 13956 ----
NM_018416chr1232628 2065 107 22095 1979 1725 --
NM_018424chr921314 553 11901 1360 11421
NM_018439chr1852631 1937 1684 942 47 11902 ----
NM_018440chr868445 7295 6902 6873 1340 923 18229 --16592
NM_018490chr111668 --1504 11390
NM_018557chr211599 11297 21503 673 --
NM_018566chr164464 4434 4156 1562 1532 213 33900 3763 1631 --2749 384
NM_018569chr41987 --11503 --
NM_018638chr1211447 33510 694 529 ----
NM_018652chr151327 ------
NM_018657chr3----166 1598
NM_018664chr1----184 --
NM_018685chr721132 742 ------
NM_018695chr552164 816 739 492 305 1210 ----
NM_018698chrX31572 704 209 --1519 11810
NM_018847chr931483 617 601 11646 2631 609 --
NM_018983chr41271 ------
NM_018994chr11421 ------
NM_018999chr1074476 3719 1740 1436 642 225 21 11374 23893 1424 --
NM_019001chr374610 4536 4192 4157 3705 1237 997 --11822 --
NM_019006chr15----1495 1673
NM_019027chr43204 191 146 31675 448 95 ----
NM_019041chr632576 189 124 1183 --22525 255
NM_019050chr442090 598 250 220 --2244 82 --
NM_019067chrX94752 4466 4437 3379 3328 3247 773 749 98 13553 13631 --
NM_019084chr1022233 906 ------
NM_019087chr531296 1263 495 ----11630
NM_019091chr21713 1917 ----
NM_019094chr1263159 3026 774 393 353 285 1113 12803 --
NM_019096chr631090 1062 738 --21050 719 --
NM_019116chr1652453 1082 975 967 399 12565 13493 --
NM_019117chrX32195 718 209 31157 732 649 23436 2746 12803
NM_019558chr2------1332
NM_019590chr1041158 1112 1031 985 1413 --1313
NM_019593chr2072913 1048 994 975 756 712 515 1738 1438 --
NM_019862chr16----11651 --
NM_019898chr16----11651 --
NM_019899chr16----11651 --
NM_019900chr16----11651 --
NM_019903chr1021520 753 --1492 11467
NM_020116chr43690 514 167 21723 1495 21766 645 --
NM_020122chr225945 5193 1246 24316 1479 --
NM_020132chr2163960 3284 2017 1862 739 680 --35092 4416 3417 --
NM_020133chr644385 1613 822 57 35362 4684 1375 ----
NM_020150chr1031970 1820 1637 --22186 1700 --
NM_020157chr201370 ----21022 306
NM_020189chr8----1129 --
NM_020199chr5----1912 --
NM_020336chr2063616 2937 2780 2773 2412 229 --23470 1226 --
NM_020346chr1131141 1131 98 1362 11188 --
NM_020357chr331137 286 184 --21257 1040 --
NM_020390chr354199 3759 3381 1759 1064 1534 14146 13386
NM_020403chr1311315 21128 188 --11457
NM_020432chr762033 1960 1808 773 704 416 ------
NM_020456chr133836 277 144 1436 1675 --
NM_020466chr674995 4889 4419 3898 3675 1171 691 1921 ----
NM_020474chr18----21478 58 --
NM_020673chr2076521 6331 5876 5593 876 581 444 21734 263 11912 --
NM_020718chr1666408 6308 4281 4245 1541 1458 25945 4231 36571 4419 1597 --
NM_020728chr752526 2042 2015 335 113 --1799 --
NM_020734chr1262485 2299 2261 2191 2108 454 12856 11114 1678
NM_020739chr1574122 3966 3928 3606 1369 1300 383 ----23541 1615
NM_020742chrX21099 771 ----22003 970
NM_020747chr53749 218 58 --1202 --
NM_020748chr17160 --140 --
NM_020752chr101384 1834 --12722
NM_020766chrX33166 3005 734 --23515 738 --
NM_020771chr621004 978 21490 594 11008 --
NM_020772chr1777998 5744 5317 2385 1788 1316 149 68428 6818 2177 1129 827 134 ----
NM_020774chr1884839 4085 4062 1935 1328 1115 792 419 15509 26137 5556 --
NM_020782chr1284427 1870 1550 1414 1218 712 488 118 14045 ----
NM_020791chr1771035 474 287 281 271 265 116 ------
NM_020792chr342047 1747 1066 67 12138 1680 --
NM_020794chr1164 1299 21387 456 --
NM_020801chr531709 962 747 21830 1005 ----
NM_020802chr1173317 2144 2096 620 604 441 59 --33303 1135 805 --
NM_020810chr1423570 964 1202 ----
NM_020824chr102761 175 --1259 1219
NM_020841chr1253781 3771 3227 3197 3063 --1280 --
NM_020844chr8117015 6162 5721 5701 5329 5321 4748 2707 1953 1900 813 1226 --12780
NM_020866chr131191 ----1265
NM_020868chr22659 560 --1673 1357
NM_020899chr1721947 1906 --11633 --
NM_020935chr263957 3345 3337 800 685 37 11331 2289 29 13759
NM_020951chr19121777 844 806 771 751 704 693 687 659 653 638 581 --12450 --
NM_021005chr1511089 ------
NM_021007chr25852 836 814 563 123 --22143 828 --
NM_021033chr1322388 1399 22832 2724 --12540
NM_021038chr352873 953 740 308 204 --1502 --
NM_021072chr552621 2351 1727 1013 158 12265 ----
NM_021083chrX63084 2497 1462 1175 583 31 23640 65 ----
NM_021090chr2243744 3331 1560 498 31929 1058 427 ----
NM_021096chr221279 --3257 227 199 --
NM_021097chr253021 2374 130 46 36 ------
NM_021116chr748299 7438 5682 470 --28356 5515 18195
NM_021163chr7103379 3214 3130 3076 3070 2651 2644 1352 868 816 2297 201 23822 1381 --
NM_021180chr11781 --1617 --
NM_021183chrX4967 872 221 143 1291 ----
NM_021222chr11114 ------
NM_021229chr1241256 1174 1109 110 11136 1903 --
NM_021249chr14----1436 11088
NM_021252chr1041804 1462 792 28 21489 1396 1182 11296
NM_021253chr611243 ----1897
NM_021626chr173416 384 344 ------
NM_021629chr374656 3151 1021 834 673 581 567 14994 2909 360 1719
NM_021637chrX1245 ------
NM_021639chr11253 ----162
NM_021647chr433704 3178 26 24689 1020 ----
NM_021722chr7----2449 434 1565
NM_021723chr7----2490 475 1606
NM_021783chrX92215 2199 2100 1962 1866 890 466 456 134 ------
NM_021813chr664983 4415 2146 924 496 397 ------
NM_021814chr61359 --1163 1255
NM_021911chr564586 3456 907 836 672 387 33449 1017 436 ----
NM_021912chr1592608 1276 1079 746 479 294 249 204 114 --31026 591 157 --
NM_021914chr1462331 1942 1591 850 615 439 ------
NM_021940chr631135 1111 87 1426 --1317
NM_021961chr1187477 6236 5858 2735 1232 1168 753 37 1391 21212 1026 --
NM_021964chr3125809 5721 5033 4794 1846 1409 1166 902 722 657 538 416 --16288 --
NM_021970chr4----1144 --
NM_021979chr141411 ------
NM_021998chrX41196 1115 979 259 ----11511
NM_022048chr1556117 4313 3929 2553 799 ------
NM_022091chr632189 1976 374 12373 --1196
NM_022118chr13125 ------
NM_022130chr531445 476 310 11164 ----
NM_022133chr841408 1216 604 97 ------
NM_022351chr893239 3124 2940 2684 1428 1337 1017 400 291 21554 1116 ----
NM_022353chr22501 190 --1165 --
NM_022374chr2----2124 101 --
NM_022454chr8------1134
NM_022459chr13105838 5517 5182 3877 1529 1372 1360 1296 268 212 --11523 --
NM_022469chr162434 2062 1193 1174 984 750 ------
NM_022473chr1533034 1697 127 23682 3444 23406 252 --
NM_022484chr711373 --1987 1351
NM_022550chr51122 ----1168
NM_022658chr1211351 ------
NM_022716chr173158 2790 2505 2200 2089 988 899 ------
NM_022726chr6--21632 56 21598 461 --
NM_022763chr373090 3015 2834 2225 1270 482 233 ------
NM_022781chr953151 2871 2136 2076 883 12066 --12217
NM_022818chr1621405 1296 --11490 --
NM_022824chr54705 430 151 144 ------
NM_022826chr221026 127 ------
NM_022841chr1522456 1982 12574 --12499
NM_022845chr162424 41 ----11510
NM_022893chr243165 2818 2135 1211 12496 1489 1831
NM_022912chr232989 1129 423 ------
NM_022977chrX32446 2173 2059 1635 ----
NM_023000chr141118 --11348 --
NM_023001chr141118 --11348 --
NM_023016chr212156 --22776 2070 --
NM_023037chr133759 296 259 --1863 --
NM_023074chr1931139 938 26 --2917 356 --
NM_023929chr832629 274 186 --12221 --
NM_024007chr532319 761 548 1341 ----
NM_024019chr41303 ------
NM_024057chr121108 ------
NM_024063chr151180 ------
NM_024345chr974741 4645 2462 2451 504 462 172 --14925 --
NM_024411chr2041031 493 434 423 --1445 --
NM_024524chr362848 2312 2284 1140 408 244 --13154 12853
NM_024546chr1331250 441 329 191 ----
NM_024561chr1331286 1068 123 ----1268
NM_024563chr51643 --174 11716
NM_024624chr231466 1387 300 21295 147 ----
NM_024665chr353685 1502 312 292 136 33311 1486 1152 24113 637 11172
NM_024686chr14451 159 116 31 172 ----
NM_024692chr241817 1810 1791 1596 1725 ----
NM_024721chr821860 1058 ------
NM_024725chr112827 801 1735 ----
NM_024744chr221910 641 12248 ----
NM_024761chr945194 4222 3330 2065 24510 3465 13357 15372
NM_024770chr266159 5682 5178 5172 2436 1118 22473 631 --11326
NM_024824chr1451269 683 550 299 31 ------
NM_024852chr13478 438 103 154 1499 --
NM_024854chr121974 21338 28 11395 --
NM_024920chr441259 1028 358 32 21066 1012 ----
NM_024921chrX51513 1446 704 641 485 1745 ----
NM_024947chr3119497 7783 6701 3855 3088 2494 1582 1315 959 385 174 48383 7205 1772 1079 28195 6987 --
NM_024953chr1291896 906 900 886 880 782 561 243 228 1162 ----
NM_024969chr21247 ------
NM_024989chr297912 5575 5488 5353 2673 2476 2015 1847 1221 27602 5273 12689 1275
NM_024991chr1052591 2553 2346 2142 948 ------
NM_024993chr2--1300 21401 272 1500
NM_025054chr842986 2667 410 245 23514 478 ----
NM_025073chr184779 4761 4337 4309 4016 3762 3091 1578 24738 856 ----
NM_025106chr131471 1341 229 ----1242
NM_025160chr133401 3268 1196 --33074 723 435 --
NM_025191chr131230 979 163 1706 --23433 2765
NM_025195chr851861 1548 1520 1499 183 ------
NM_025208chr1152421 2136 719 613 523 12273 ----
NM_025221chr41110 --1268 --
NM_025222chr332402 596 538 12994 41926 1148 1128 1116 --
NM_025246chr3146 1125 ----
NM_030621chr1454155 4077 3426 3035 837 --21386 1147 --
NM_030625chr103891 692 500 11895 --1702
NM_030627chr533891 3219 1365 2402 374 --14120
NM_030648chr453646 1926 1729 411 144 25622 4026 13991 --
NM_030664chr1082273 2173 2141 2110 2003 1876 1629 646 --12079 --
NM_030665chr17----11270 --
NM_030674chr1264603 3928 1550 1347 563 354 2334 236 14886 15047
NM_030762chr12----1598 --
NM_030791chr144664 533 522 429 11422 ----
NM_030799chr572206 2195 2143 1372 226 174 100 ------
NM_030806chr189399 9389 7997 7453 6371 5994 5988 579 --38783 8734 6004 --
NM_030816chr163675 3510 3081 2673 2465 212 23695 3208 11070 1336
NM_030885chr322266 2025 12036 ----
NM_030918chr185249 4862 4480 3995 1237 1214 1185 686 ------
NM_030949chr611446 ------
NM_030958chr81329 --1138 --
NM_031267chr7------1140
NM_031291chr4--150 2134 75 --
NM_031305chr41263 21685 1220 --11864
NM_031314chr1452023 1653 1508 800 346 ------
NM_031418chr1131755 386 92 --32584 1992 956 --
NM_031435chr1273483 3468 2261 1061 865 742 352 ------
NM_031442chrX52653 2635 2627 2038 869 22821 981 ----
NM_031458chr3------1289
NM_031461chr832214 1596 296 21536 1427 1522 1132
NM_031468chr757552 6281 5731 1950 50 ----18103
NM_031469chr643899 3822 3108 854 33906 3876 2895 ----
NM_031844chr173767 3731 3308 2669 2659 1380 1207 11434 ----
NM_031845chr263509 2656 2335 1107 823 170 12383 ----
NM_031847chr263509 2656 2335 1107 823 170 12383 ----
NM_031942chr221111 313 11207 ----
NM_032012chr964112 3992 3986 1067 268 140 --11929 --
NM_032116chr1344036 3870 3864 1131 --11285 --
NM_032144chr2180 ------
NM_032145chr63530 278 26 3489 415 362 ----
NM_032153chr332505 2469 584 ----1254
NM_032189chr13133619 3609 3552 3546 3472 3419 3397 3300 3280 3182 3109 3075 209 --24667 4648 --
NM_032199chr1033601 928 588 12973 13149 --
NM_032221chr2041526 681 562 472 ------
NM_032228chr1163198 1311 697 592 354 33 --13462 --
NM_032239chr411474 --11403 --
NM_032246chr153948 922 267 ------
NM_032256chr1231083 956 196 ----1397
NM_032289chr561936 1893 663 642 628 271 ------
NM_032290chr52393 377 1385 ----
NM_032291chr131971 1905 607 136 ----
NM_032299chr11------151
NM_032312chr21686 ------
NM_032352chr141465 ----11412
NM_032373chr1055005 4236 1471 1170 410 11580 1925 1116
NM_032410chr82875 477 2488 346 ----
NM_032433chr1931572 1241 1191 --2277 237 --
NM_032440chr1052806 1858 1151 302 169 1453 ----
NM_032445chr1522402 1789 --1996 --
NM_032446chr563544 2858 1150 1019 778 379 1640 ----
NM_032457chr433118 2591 701 --33111 1175 725 --
NM_032458chrX22749 59 11006 23428 3258 --
NM_032471chr61261 1746 31134 1090 953 --
NM_032485chr201668 --1684 --
NM_032521chr2022339 328 --173 --
NM_032532chr6----1603 --
NM_032547chr421060 1053 1316 1234 --
NM_032558chr91206 11351 2599 29 --
NM_032560chr142450 183 166 --1891
NM_032582chr1711614 1196 1638 --
NM_032622chr421438 289 ------
NM_032632chr14------1695
NM_032682chr353511 3014 2796 2713 1319 1734 23111 2284 --
NM_032689chr1951350 532 452 169 22 ------
NM_032731chr1731416 1129 63 ------
NM_032778chr322654 418 --142 --
NM_032859chr1373677 3566 3485 1375 770 513 193 22753 1435 ----
NM_032866chr1562991 2970 2889 2694 497 125 12583 ----
NM_032873chr1134279 551 117 14100 13309 --
NM_032968chrX64103 3504 1297 1062 631 443 --13065 --
NM_032969chrX64103 3504 1297 1062 631 443 --13065 --
NM_032973chrY74138 4095 3500 1297 631 443 264 --13060 --
NM_032983chr713128 --132 11125
NM_032993chr41271 ------
NM_033020chr184375 3860 3758 3446 1696 783 446 344 11734 ----
NM_033023chr721241 819 ------
NM_033030chr231417 466 450 ----11427
NM_033132chr1352223 1925 1661 683 357 12129 ----
NM_033135chr1152421 2136 719 613 523 12273 ----
NM_033138chr722252 1520 1714 1705 --
NM_033139chr722252 1520 1714 1705 --
NM_033140chr722252 1520 1714 1705 --
NM_033143chr464266 3529 3405 786 673 156 --11294 --
NM_033157chr722252 1520 1714 1705 --
NM_033181chr653235 2824 2472 1527 825 12569 --13771
NM_033222chr931371 267 201 2903 485 11340 --
NM_033224chr775226 4932 2663 2121 1748 1708 1108 21825 1789 12635 --
NM_033225chr852353 2193 2173 720 75 12362 ----
NM_033227chr52574 423 ----1231
NM_033285chr863734 3602 3003 1640 587 287 13023 1635 --
NM_033305chr941351 1048 244 82 1905 ----
NM_033360chr1274421 3729 2815 1204 236 152 28 --1399 --
NM_033364chr331634 1547 389 31889 1297 617 ----
NM_033389chr1794522 4405 4055 3789 3745 3699 2983 627 75 --23034 130 --
NM_033394chr231111 632 471 ------
NM_033425chr1133318 3169 171 ------
NM_033480chr622337 278 12048 1649 --
NM_033481chr622337 278 12048 1649 --
NM_033495chrX5976 958 840 698 690 --2826 676 --
NM_033515chr61351 ----11308
NM_033642chrX21235 999 ------
NM_052832chr842768 2450 1090 586 11111 ----
NM_052834chr1851914 1717 1655 945 150 --12315 --
NM_052860chr52995 277 --1256 --
NM_052864chr421995 706 1246 ----
NM_052879chr1284032 3615 3584 1375 1078 353 240 230 1979 ----
NM_052885chr1264868 4612 4383 3289 3106 952 11834 1714 --
NM_052900chr811275 21547 1202 21737 286 --
NM_052905chr221892 1738 11448 ----
NM_052907chr1273886 3489 2935 786 636 483 419 42846 1263 1148 957 12613 14013
NM_052923chr6------149
NM_052927chr511978 ------
NM_052932chr1131724 1544 117 2474 219 --2354 122
NM_052937chr822461 2075 --12628 --
NM_052966chr163158 3129 837 407 331 241 --1142 176
NM_053016chr987687 7521 6091 5883 3142 2655 2400 1844 27283 5745 22646 2105 --
NM_053023chr1143289 2709 377 146 ------
NM_053043chr785048 4655 4637 3871 2307 1251 1001 537 ------
NM_057749chr821215 380 ------
NM_058237chr1421016 850 ----1937
NM_080546chr961735 596 476 223 127 51 1558 11739 11502
NM_080617chr201420 ------
NM_080645chr6----11872 --
NM_080676chr2033241 2328 1318 --12614 --
NM_080677chr171130 ------
NM_080743chr621752 121 --185 --
NM_080759chr1342271 1966 858 638 --2944 281 --
NM_080760chr1342271 1966 858 638 --2944 281 --
NM_080798chr102136 61 ------
NM_080799chr102136 61 ------
NM_080800chr102136 61 ------
NM_080801chr102136 61 ------
NM_080802chr102136 61 ------
NM_080803chr102136 61 ------
NM_080804chr102136 61 ------
NM_080805chr102136 61 ------
NM_080806chr102136 61 ------
NM_080807chr102136 61 ------
NM_080808chr102136 61 ------
NM_080809chr102136 61 ------
NM_080810chr102136 61 ------
NM_080811chr102136 61 ------
NM_080812chr102136 61 ------
NM_080813chr102136 61 ------
NM_080814chr102136 61 ------
NM_080815chr102136 61 ------
NM_080867chr1474934 4495 1196 299 274 245 179 ----13392
NM_080874chr421515 201 21249 73 ----
NM_080927chr352802 2362 2130 1043 1029 ------
NM_130387chr341153 811 783 215 1805 ----
NM_130391chr942603 1297 892 71 ------
NM_130392chr942603 1297 892 71 ------
NM_130393chr942603 1297 892 71 ------
NM_130434chr153487 359 145 --131 --
NM_130439chr1072178 1861 1760 1743 1475 747 624 12066 ----
NM_130439chr1072178 1861 1760 1743 1475 747 624 12066 ----
NM_130446chr354162 3858 3850 109 44 14396 12731 --
NM_130798chr1561188 1081 955 545 271 220 ------
NM_130809chr543030 2865 1227 598 21159 242 ----
NM_133170chr2037390 7195 1051 28089 5741 15773 17734
NM_133265chrX63256 2359 1060 678 670 284 --13175 --
NM_133334chr485958 5541 4574 4393 2438 2063 1113 49 22412 131 14592 14548
NM_133370chr453546 3245 2553 1003 849 13124 2674 155 --
NM_133445chr952955 1226 1062 719 639 ------
NM_133477chr452984 2797 2521 473 180 --23256 2293 --
NM_133503chr12----1727 1545
NM_133504chr12----1727 1545
NM_133505chr12----1727 1545
NM_133506chr12----1727 1545
NM_133507chr12----1905 1723
NM_133638chr521066 363 1102 --1953
NM_133646chr235539 4872 1103 33533 970 265 --24718 4230
NM_133647chr1543564 1510 640 521 2846 828 11135 --
NM_134424chr1221008 845 --1933 --
NM_138288chr1412200 --1400 --
NM_138333chr932393 806 460 1684 22246 237 --
NM_138364chr41134 ------
NM_138444chr1373579 1986 1924 1694 1457 1125 680 24414 3812 13210 --
NM_138459chr642877 2633 2566 1381 ------
NM_138468chr295927 5806 5556 3961 1221 1028 970 961 807 45058 4376 4041 628 14944 --
NM_138554chr932701 2680 2088 11716 22195 1709 --
NM_138638chr1462331 1942 1591 850 615 439 ------
NM_138694chr643639 3533 3383 190 23002 160 12962 --
NM_138711chr31140 ------
NM_138712chr31140 ------
NM_138713chr16108246 7675 7257 6532 6424 5334 2048 1987 1352 303 27049 3077 ----
NM_138714chr16108246 7675 7257 6532 6424 5334 2048 1987 1352 303 27049 3077 ----
NM_138727chr15939 853 600 129 109 ------
NM_138728chr15939 853 600 129 109 ------
NM_138730chr63339 323 300 ----1142
NM_138731chr1463545 3529 1584 1302 790 435 22700 2595 23925 3826 14082
NM_138735chr221188 1134 21036 99 11278 --
NM_139035chrX3616 275 42 ------
NM_139135chr111203 ------
NM_139168chr551885 1836 642 462 424 ------
NM_139318chr14370 61 45 --1220 --
NM_144571chr4135814 4686 4235 2775 2211 1988 1776 1593 1436 981 592 549 157 25166 2035 36223 4908 4775 --
NM_144578chr1484700 4382 4286 3736 1056 768 636 516 --168 1182
NM_144595chr132717 399 ----1942
NM_144599chr1534245 1412 1393 24116 888 25387 501 --
NM_144632chr261990 1775 689 644 462 277 11907 ----
NM_144664chr113781 733 148 1303 1865 --
NM_144684chr1973008 2706 2569 2457 2295 2278 821 11914 21127 791 --
NM_144967chrX3913 857 789 ------
NM_144979chr4197 ------
NM_145054chr171166 ------
NM_145112chr1411213 ------
NM_145113chr1411485 ------
NM_145176chr663508 3477 3401 2938 2905 491 11385 13492 --
NM_145259chr266028 5823 5415 1057 844 417 36212 5170 405 37117 4447 2282 11488
NM_145284chrX32374 1640 308 --12560 --
NM_145307chr1044660 4105 3824 3628 14088 ----
NM_145341chr1031583 1184 737 1366 ----
NM_145698chr102151 141 1755 31611 1360 241 --
NM_145735chr1342789 2769 2134 1917 12424 1171 --
NM_145753chr311377 --11370 --
NM_145759chr141713 1674 816 804 11482 12124 1843
NM_145808chr762836 2390 1159 760 736 256 22826 2225 --12909
NM_145810chr221111 313 11207 ----
NM_145913chr122908 718 ----1376
NM_147150chr963563 3551 3545 3488 1596 850 23517 145 13971 --
NM_147181chr41110 --1268 --
NM_147182chr41110 --1268 --
NM_147183chr41110 --1268 --
NM_147189chr822106 133 ----1279
NM_148955chr1544597 1550 179 49 ----12374
NM_148957chr1342626 1848 787 400 22201 326 ----
NM_152233chr14----1436 11088
NM_152238chr1----1284 --
NM_152263chr154458 1968 878 854 833 16066 ----
NM_152291chr411004 --1884 --
NM_152330chr1452479 984 897 613 480 11698 ----
NM_152347chr17159 --2473 469 --
NM_152349chr173658 558 191 ------
NM_152352chr1853028 2507 2389 2127 569 ------
NM_152375chr112026 128 --12630
NM_152380chr18436 422 411 401 381 363 351 143 1429 11079 --
NM_152400chr471991 1896 801 256 202 139 42 --1532 --
NM_152409chr573067 2919 2476 2444 863 790 80 1799 32579 1409 684 --
NM_152415chr8----1131 --
NM_152424chrX84708 1593 1442 1152 436 426 398 366 --1445 --
NM_152512chr22----1437 --
NM_152520chr2------1848
NM_152529chr264082 3945 3603 1367 907 706 --13607 1684
NM_152564chr831881 1712 365 ------
NM_152608chr162476 2360 2160 2095 1574 961 ------
NM_152613chr2221220 474 --11072 --
NM_152624chr596388 5882 5716 4620 2833 1904 1086 683 195 --26930 6453 --
NM_152641chr1262809 2797 2354 1095 895 328 ------
NM_152647chr15------142
NM_152665chr1----1409 1445
NM_152666chr1147 1675 --1256
NM_152678chr342256 2037 644 50 ------
NM_152680chr422349 1943 --12091 11684
NM_152682chr431795 515 231 ------
NM_152699chr321206 1098 --4729 277 264 260 --
NM_152716chr1141667 1348 483 448 ------
NM_152724chr1032736 2337 594 --22077 1790 --
NM_152726chr131458 ------
NM_152748chr71388 ------
NM_152756chr553838 3559 3057 2951 1231 --23761 784 --
NM_152758chr832842 938 701 12204 11093 --
NM_152774chr752679 2629 2549 1908 287 22027 296 62657 1006 777 765 758 732 --
NM_152787chrX52755 2741 1087 634 577 --13912 --
NM_152826chr1544597 1550 179 49 ----12374
NM_152836chr841408 1216 604 97 ------
NM_152837chr841408 1216 604 97 ------
NM_152838chr2042193 2171 1151 236 --2499 113 --
NM_152896chr91847 ------
NM_152999chr794128 4020 3787 3280 3159 1576 794 441 378 33190 1569 30 15018 --
NM_153050chr2243744 3331 1560 498 31929 1058 427 ----
NM_153051chr2243744 3331 1560 498 31929 1058 427 ----
NM_153182chr322654 418 --142 --
NM_153184chr361997 1948 315 260 245 141 ------
NM_153188chr595604 5103 4695 4497 4277 4231 1871 929 742 24482 360 54716 3676 3595 2277 877 --
NM_153235chr67572 524 488 457 440 250 44 --11746 --
NM_153252chrX----1139 --
NM_153262chr193170 2895 2626 2528 2428 1223 620 220 41 12443 12420 --
NM_153267chr91185 --1734 --
NM_153331chr3------1543
NM_153332chr831230 874 174 --1530 --
NM_153354chr5124 ------
NM_153365chr41802 ------
NM_153371chr1321879 1534 22093 1853 1112 --
NM_153456chr1345374 4775 2539 238 12171 --11046
NM_153607chr543086 1964 592 547 11108 13095 --
NM_153810chr1053851 3553 1530 1404 783 --25090 3194 --
NM_170587chr81770 ------
NM_170606chr7----11829 --
NM_170711chr191584 ------
NM_172016chr611243 ----1897
NM_172037chr831368 1195 986 --11015 --
NM_172069chr251579 1530 865 622 479 ------
NM_172070chr281998 1865 1799 1534 834 807 700 120 ------
NM_172071chr166516 2670 1926 1777 1707 332 14565 ----
NM_172127chr461747 1726 212 198 175 128 --11862 --
NM_172128chr461703 1682 168 154 131 84 --11818 --
NM_172193chr1451238 951 392 295 55 11117 ----
NM_172373chr1311122 11388 --11110
NM_172375chr1451004 995 979 944 809 --11154 --
NM_173167chr1711701 22571 1048 12674 1387
NM_173198chr932729 2248 1019 32326 1830 997 12384 --
NM_173200chr932729 2248 1019 32326 1830 997 12384 --
NM_173214chr16108246 7675 7257 6532 6424 5334 2048 1987 1352 303 27049 3077 ----
NM_173468chr485485 4445 4370 4304 2063 1928 1539 200 --25996 4937 --
NM_173470chrX42707 2371 566 212 11967 ----
NM_173475chr1641371 1365 1316 440 ------
NM_173495chrX62500 2099 2001 1759 997 174 ------
NM_173531chr1922933 1509 12620 13709 12703
NM_173554chr10------1235
NM_173576chr101556 2779 162 ----
NM_173582chr1145789 4314 1547 37 22007 1912 22280 65 --
NM_173595chr1211682 ------
NM_173644chr2041617 1463 1365 380 42035 694 389 321 1602 --
NM_173645chr21176 1524 2369 126 --
NM_173670chr521010 268 ------
NM_173683chr811227 21462 517 --1212
NM_173694chrX42399 2322 2127 47 --1985 --
NM_173797chr52374 148 1137 ----
NM_173808chr144444 1694 1139 722 24258 623 ----
NM_173829chr575849 5767 5385 5028 1449 240 115 16180 1952 --
NM_173848chr82626 362 2900 306 1759 --
NM_175607chr341691 456 271 152 31593 379 322 ----
NM_175612chr341691 456 271 152 31593 379 322 ----
NM_175854chr1322297 347 ----12224
NM_175876chr141802 685 572 83 ------
NM_175895chr123820 806 394 ------
NM_175910chr1922295 936 2871 456 12378 --
NM_175921chr524331 1468 12931 44305 3838 2761 2618 --
NM_176801chr4----11807 --
NM_176895chr5----1242 --
NM_177422chr13478 438 103 154 1499 --
NM_177438chr1454155 4077 3426 3035 837 --21386 1147 --
NM_177925chr1242922 2721 2672 2280 --11917 --
NM_177968chr221786 229 11665 ----
NM_177989chr33112 101 61 ------
NM_177996chr2043419 2439 2265 184 1955 1150 --
NM_178013chr1442798 2755 2418 311 12748 ----
NM_178042chr33112 101 61 ------
NM_178151chrX64792 1485 1265 772 365 333 16391 --16635
NM_178152chrX64792 1485 1265 772 365 333 16391 --16635
NM_178153chrX64792 1485 1265 772 365 333 16391 --16635
NM_178313chr252182 1654 1385 580 190 ------
NM_178439chr21203 ------
NM_178505chr1043287 3005 1308 612 23585 1438 13099 --
NM_178509chr1753719 1296 1273 427 279 2571 246 2174 100 --
NM_178539chr1252024 1945 1754 1551 1524 22010 641 --12029
NM_178566chr921567 1353 --11906 --
NM_178815chr1011950 ----1789
NM_180989chr1332078 1804 83 --21589 852 --
NM_181332chrX21099 771 ----22003 970
NM_181354chr821209 662 --11724 --
NM_181443chr2022635 1090 1983 --1840
NM_181481chr18117097 6890 6679 6397 4769 2719 2131 1527 1095 959 937 11611 15165 1166
NM_181482chr18106890 6679 6397 4769 2719 2131 1527 1095 959 937 11611 15165 1166
NM_181483chr18117097 6890 6679 6397 4769 2719 2131 1527 1095 959 937 11611 15165 1166
NM_181527chr20----2395 343 --
NM_181528chr20----2450 398 --
NM_181670chr1211468 ------
NM_181705chr545729 3966 2228 100 25194 3595 15224 --
NM_181712chr121480 135 11320 --21945 425
NM_181723chr842162 1543 888 690 11622 22198 1743 --
NM_181782chr652207 2009 747 345 255 11917 42157 851 685 582 --
NM_181784chr232469 2173 218 12538 ----
NM_181787chr883590 3211 1498 1429 1408 923 748 553 13492 1951 1818
NM_181789chr1511173 12231 --12597
NM_181794chr61261 1746 31134 1090 953 --
NM_181795chr61261 1746 31134 1090 953 --
NM_181836chr571918 1768 1003 932 665 140 112 12307 ----
NM_181861chr1232711 2605 1975 --12803 --
NM_181868chr1232711 2605 1975 --12803 --
NM_181869chr1232796 2690 2060 --12888 --
NM_181897chr342562 1818 513 78 ------
NM_182481chr211315 ------
NM_182482chr211315 ------
NM_182485chr453178 3017 1312 129 78 --4883 770 757 475 --
NM_182524chr42258 176 174 ----
NM_182540chrX1694 1757 1839 --
NM_182543chr101271 ------
NM_182551chr263574 2570 2378 2325 746 37 13124 1809 --
NM_182646chr453178 3017 1312 129 78 --4883 770 757 475 --
NM_182758chr15103757 3406 3167 2697 2665 2659 2653 2645 734 696 --12617 --
NM_182762chr755018 4402 4373 4331 1070 11078 42336 1465 1359 837 --
NM_182765chr1032370 2147 444 --1746 1455
NM_182767chr12--21639 801 22067 360 --
NM_182802chr201668 --1684 --
NM_182896chr341575 343 131 112 1418 ----
NM_182898chr736390 372 43 --23998 2592 --
NM_182899chr736390 372 43 --23998 2592 --
NM_182907chr61196 1377 1222 --
NM_182910chr141611 ------
NM_182913chr141611 ------
NM_182914chr141611 ------
NM_182972chr172587 1873 1116 741 502 229 74 ------
NM_183004chr1453900 1271 1140 271 184 ------
NM_183006chr20----11033 1139
NM_183422chr1331010 984 248 ----11093
NM_184234chr20------2715 201
NM_194247chr244277 1432 1177 1155 --11779 22973 1680
NM_194278chr1423985 328 --12521 13868
NM_194282chr432355 1951 1088 3917 614 315 ----
NM_194285chr111126 --13396 13427
NM_194292chr121537 1489 --21603 1531 --
NM_194314chr1105530 4757 3824 2067 2043 1956 1252 1061 846 547 65033 1983 1671 1074 729 470 13518 --
NM_194328chr953151 2871 2136 2076 883 12066 --12217
NM_194329chr953151 2871 2136 2076 883 12066 --12217
NM_194330chr953151 2871 2136 2076 883 12066 --12217
NM_194332chr953151 2871 2136 2076 883 12066 --12217
NM_194434chr1874138 3786 1721 1643 1631 1530 127 11304 ----
NM_194454chr721073 423 --1399 --
NM_194455chr721073 423 --1399 --
NM_194456chr721073 423 --1399 --
NM_197970chr231417 466 450 ----11427
NM_198047chr2------1559
NM_198123chr811275 21547 1202 21737 286 --
NM_198124chr811275 21547 1202 21737 286 --
NM_198128chr1851631 1615 1429 921 897 ------
NM_198150chr521228 1122 21500 39 ----
NM_198158chr342729 2298 1932 866 ----12713
NM_198159chr342729 2298 1932 866 ----12713
NM_198173chr11781 --1617 --
NM_198174chr11781 --1617 --
NM_198177chr342729 2298 1932 866 ----12713
NM_198178chr342729 2298 1932 866 ----12713
NM_198181chr1532802 2624 1903 --32068 1067 343 --
NM_198189chr23158 135 44 ------
NM_198195chr31700 ----1271
NM_198243chr15----1122 1264
NM_198264chr11113 ------
NM_198270chrX42545 1107 830 696 22970 1316 ----
NM_198273chr542979 2066 859 800 23067 2152 1516 --
NM_198391chr202948 587 1136 ----
NM_198395chr52343 21 130 21205 285 --
NM_198399chr321818 367 21396 1227 11530 --
NM_198400chr151757 32792 2025 129 --12664
NM_198465chrX72847 2712 2342 1841 1129 772 513 11116 ----
NM_198484chr385875 4937 4387 1800 1381 967 809 443 1657 ----
NM_198503chr151928 1761 896 845 720 11841 11789 --
NM_198506chr411122 ------
NM_198581chr2127531 7495 7388 6917 6725 5609 1773 1452 1432 1392 1185 610 22300 1924 ----
NM_198715chr1106164 4494 3832 2448 2432 2223 1383 1313 355 85 --16267 16077
NM_198719chr1156 --1831 --
NM_198859chr364184 3549 3487 3211 3135 1931 1587 1509 --
NM_198896chr111230 ------
NM_198947chr1141038 744 731 323 --1200 --
NM_198968chr1343847 1348 774 500 --13549 --
NM_198992chr1251088 912 367 283 195 ------
NM_199000chr732068 1660 688 21939 657 ----
NM_199040chr1263159 3026 774 393 353 285 1113 12803 --
NM_199072chr763210 2296 2271 2110 1223 990 12123 ----
NM_199132chr1931889 294 253 ----1287
NM_199188chr1284032 3615 3584 1375 1078 353 240 230 1979 ----
NM_199190chr1284032 3615 3584 1375 1078 353 240 230 1979 ----
NM_199229chr231344 467 318 --11636 --
NM_199320chr431920 1131 946 --1507 --
NM_199320chr431920 1131 946 --1507 --
NM_199324chr453557 3131 2561 1404 1305 --13762 --
NM_199414chr1551120 1060 419 296 258 11088 ----
NM_199421chr1474934 4495 1196 299 274 245 179 ----13392
NM_199436chr232903 1996 1058 2733 175 11067 --
NM_199461chr1043028 2798 820 306 12759 ----
NM_199462chr174997 4012 3521 1876 1061 843 187 --11003 --
NM_199478chrX21862 1848 --11852 11694
NM_199482chr232124 1468 645 134 1514 --
NM_199511chr32783 88 ----1298
NM_199512chr32783 88 ----1298
NM_201263chr152047 1815 1726 498 205 --1408 --
NM_201278chr1172294 2053 1806 691 534 413 34 ------
NM_201281chr1172294 2053 1806 691 534 413 34 ------
NM_201995chr111662 ------
NM_201998chr111727 ------
NM_201999chr42405 376 --1115 --
NM_203406chr542889 940 783 38 21094 460 1560 --
NM_203437chr23898 807 69 1948 2263 147 --
NM_203446chr2122685 208 1820 --12928
NM_203458chr113094 3897 741 592 ----
NM_203459chr112196 1954 11660 --
NM_203463chr254611 1945 1832 505 198 ----12994
NM_203487chr1311315 21128 188 --11457
NM_203504chr432118 2093 1054 --11889 --
NM_203505chr432118 2093 1054 --11889 --
NM_205768chr12700 36 ------
NM_205836chr5--2223 179 189 1154
NM_205842chr24592 255 171 121 ------
NM_205860chr152586 2578 2356 2045 394 23053 250 1905 --
NM_206594chr132751 1273 1136 32743 921 706 ----
NM_206595chr132751 1273 1136 32743 921 706 ----
NM_206853chr622560 216 23958 2744 1582 --
NM_206854chr653821 3708 1477 1079 555 25219 4005 31843 328 149 --
NM_206855chr664786 4673 2442 2044 1520 481 26184 4970 21293 1114 --
NM_206866chr2143059 2568 2532 321 --12509 --
NM_206876chr283596 2590 1139 868 786 692 642 193 13313 13320 12431
NM_206907chr552888 2072 328 229 87 23256 3011 52788 1333 1323 991 42 --
NM_206909chr866327 6208 2970 2917 2371 2192 16355 ----
NM_207170chr14729 702 644 630 --2825 246 --
NM_207292chr352873 953 740 308 204 --1502 --
NM_207293chr352873 953 740 308 204 --1502 --
NM_207294chr352873 953 740 308 204 --1502 --
NM_207295chr352873 953 740 308 204 --1502 --
NM_207296chr352873 953 740 308 204 --1502 --
NM_207297chr352898 978 765 333 229 --1527 --
NM_207303chr1074094 3680 3528 2834 1609 1576 1505 33485 1629 309 --1813
NM_207322chr1541783 1518 364 242 11841 ----
NM_207337chr1231070 863 163 ------
NM_207361chr13116149 5589 5579 5569 5553 3991 2476 2222 2057 995 656 12111 1733 --
NM_207404chr31239 ----1841
NM_207406chr476516 6012 5965 5518 4322 2168 501 25510 1482 1907 --
NM_207506chr851352 1020 402 387 113 11285 ----
NM_207660chr1451269 683 550 299 31 ------
NM_207661chr1451269 683 550 299 31 ------
NM_207662chr1451269 683 550 299 31 ------
NM_212551chr121100 922 ------
NM_212558chr974104 3541 3081 2685 1376 1154 857 13481 23493 1430 --
NM_213589chr295535 5164 4345 3923 3841 3713 1726 1022 574 --21957 189 --