TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-676-3p
miRNA Sequence: CUGUCCUAAGGUUGUUGAGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX116295 6102 5945 5543 5173 4691 4670 4237 1372 1191 35 16789 11874 --
NM_000314chr1043163 1304 260 241 13196 190 --
NM_000538chr1321705 668 --11134 21761 1718
NM_000633chr1875123 4354 4323 4004 1275 1066 677 13557 --13998
NM_000809chr457707 2355 1377 867 845 57580 7359 6280 2002 1062 ----
NM_001005473chr5126506 6005 5614 5248 4550 4173 2387 2256 994 982 479 114 15570 156 25712 1673
NM_001005609chrX82869 2862 2641 1442 1159 879 338 200 11147 11164 --
NM_001008220chr5103620 3423 3385 2644 1225 1049 1040 935 424 224 22931 1025 ----
NM_001011666chr776105 5743 5225 4117 2450 1462 67 ----26172 5263
NM_001013620chr1288251 6019 5591 2560 2139 1214 1067 1048 --25499 5167 11225
NM_001014797chr10167649 7614 7013 6518 6103 5776 5211 3277 2922 2311 2304 2086 1134 1123 869 646 17960 36871 6672 2473 1235
NM_001017440chr7137782 7304 5776 5536 2868 2691 2298 2118 2001 1720 1570 949 192 17891 ----
NM_001018111chr7133819 3560 3516 3414 2468 1495 1343 1331 1152 1116 839 811 493 13741 ----
NM_001029858chr633222 2971 1325 1747 12467 22751 811
NM_001031695chr22124806 3507 3458 3445 2004 1654 1350 1170 1160 917 908 473 1439 25115 29 --
NM_001033087chr2051994 1112 860 483 112 23314 425 --13160
NM_001039840chrX95990 5786 5730 5415 4658 4536 1437 471 456 14623 25820 4099 1760
NM_001039937chr1333449 3361 872 43671 3537 3521 1118 13712 13379
NM_001040284chr1634743 4304 54 ----11991
NM_001042555chr1254265 3893 2927 1411 675 24374 3714 13101 11688
NM_001042603chr1284885 4084 3296 1444 660 334 326 34 11636 124 --
NM_001049chr1442431 1922 942 927 --1144 11529
NM_001099678chr355722 5272 4005 2031 707 15655 --26392 555
NM_001106chr3119191 8963 6837 6406 3845 3824 3649 3531 2753 881 645 28788 7730 48041 6340 6199 3047 11068
NM_001117chr1862475 2222 1995 888 538 417 1987 --1868
NM_001167chrX55609 2373 1400 998 499 15983 14814 24951 1422
NM_001204chr246709 4773 871 566 12226 12148 36645 5258 2173
NM_001399chrX82869 2862 2641 1442 1159 879 338 200 11147 11164 --
NM_001616chr252676 1090 195 102 35 --21414 1068 11230
NM_001939chrX113775 3161 3019 2987 2911 2852 2683 2542 2415 853 552 13768 11537 --
NM_001981chr132103 2031 141 --12399 11753
NM_002025chrX78793 8062 7735 3022 2873 2802 181 --18136 15603
NM_002254chr252206 2110 1972 588 447 1478 11652 12149
NM_002886chr394652 4404 4143 3537 3497 1841 1176 698 290 21170 603 ----
NM_003043chr3104027 3374 3252 2654 1579 1339 1126 480 98 65 --23626 1362 --
NM_003108chr2126724 6675 6295 6014 5247 4792 2514 2404 2306 2098 1303 428 26393 5341 ----
NM_003161chr1743094 2690 1311 308 2990 410 ----
NM_003281chr1125227 4837 4697 3792 3780 3595 3440 1743 1511 1090 817 781 --15307 --
NM_003615chr343400 2558 1487 1378 ----12908
NM_003783chr121187 903 1453 --184
NM_004171chr11129237 9044 7541 7429 7287 5877 3387 3317 2311 2074 1508 338 26814 3354 11141 --
NM_004571chr2132387 1361 1216 1651 --22679 1138
NM_004719chr123260 34 23 --1133 1310
NM_004748chr1522959 1158 11014 11070 22913 1475
NM_004904chr776105 5743 5225 4117 2450 1462 67 ----26172 5263
NM_004985chr1241793 1664 1564 1548 --24333 1115 12894
NM_004992chrX118226 7609 2681 2629 1773 1731 963 619 607 387 76 17804 1470 38294 5607 799
NM_004992chrX118226 7609 2681 2629 1773 1731 963 619 607 387 76 17804 1470 38294 5607 799
NM_004999chr653828 3468 3287 3265 1557 13259 23410 1640 --
NM_005056chr1285129 4328 3540 1688 904 578 570 278 11880 1268 --
NM_005076chr194089 3897 3631 2557 1103 1060 481 348 177 33081 1068 471 23508 155 --
NM_005397chr7133819 3560 3516 3414 2468 1495 1343 1331 1152 1116 839 811 493 13741 ----
NM_005596chr976148 5938 5576 4571 4546 4432 1011 26254 5136 44223 2554 1269 31 --
NM_005779chr552516 2339 810 505 486 21152 288 1308 13158
NM_005840chrX97592 7384 5759 5182 1877 1357 1344 1061 109 16801 26477 973 --
NM_005902chr1574101 3806 3513 1771 654 374 27 23112 234 22840 1745 --
NM_005910chr17104037 3823 1611 1450 1379 1339 998 990 764 745 23179 1598 13262 --
NM_005935chr484364 3975 3900 852 322 247 129 89 24426 2036 ----
NM_005941chr853541 2810 2613 1050 623 23957 3248 22887 639 --
NM_006095chr444201 1231 758 430 --11641 11159
NM_006212chr164374 3720 1896 1665 1027 700 1412 24794 245 1174
NM_006306chrX104863 4834 4308 1137 1076 951 819 779 448 390 15076 23638 1921 14207
NM_006625chr131174 287 27 1823 1993 1179
NM_006625chr131174 287 27 1823 1993 1179
NM_006625chr131174 287 27 1823 1993 1179
NM_006628chr1534075 3377 198 13349 24127 1323 11713
NM_006650chr5103620 3423 3385 2644 1225 1049 1040 935 424 224 22931 1025 ----
NM_006654chr1254265 3893 2927 1411 675 24374 3714 13101 11688
NM_006750chr1677928 6965 6935 5295 5247 639 380 15267 22832 1292 --
NM_007030chr5203928 3902 3875 3840 3805 3770 3735 3727 3700 3692 3665 3657 3630 3343 1741 1388 1124 1106 1027 533 1645 --14037
NM_007249chr1397865 7799 6750 6132 2971 2570 1876 544 99 68849 6259 6117 2296 1941 1374 38192 3409 2848 --
NM_007350chr1294198 3869 3008 1378 1310 766 739 694 52 24247 3175 13279 13160
NM_012141chr1333449 3361 872 43671 3537 3521 1118 13712 13379
NM_012296chr11103543 3536 3517 3386 1353 1314 1263 1053 778 662 33951 1338 699 43853 1575 1320 1025 --
NM_012309chr1144929 4903 1515 469 44804 1941 994 855 --1225
NM_013231chr1454197 3037 2667 1320 388 23452 1494 1325 13168
NM_013943chr152831 2684 1152 134 126 12331 12405 --
NM_014309chr22124796 3497 3448 3435 1994 1644 1340 1160 1150 907 898 463 1429 15105 --
NM_014423chr565336 4639 3772 1483 591 502 32029 821 773 11268 --
NM_014721chr657020 6567 5260 4943 1107 1801 --11816
NM_014730chr1284904 4275 3922 3297 1616 1365 993 252 24689 1941 14438 11522
NM_014730chr1284904 4275 3922 3297 1616 1365 993 252 24689 1941 14438 11522
NM_014912chr1031415 582 61 1530 21118 743 1431
NM_015051chr972482 2448 2240 2170 2105 1096 206 13307 22177 728 --
NM_015090chr195448 5313 5068 4997 4153 2041 1994 1434 1023 --55337 4924 4117 2295 1171 --
NM_015310chr8107198 6881 6293 6172 5335 3249 2793 2012 1900 616 --17649 --
NM_015879chr1858478 7638 6400 236 177 --36830 2822 980 27693 6546
NM_016009chr144583 4339 1225 1193 13033 24019 445 1701
NM_016248chr1321561 357 11214 --21431 73
NM_016260chr297322 6360 5018 1770 1672 1630 1299 1235 394 22617 2607 14778 --
NM_016308chr12595 348 ----21374 1318
NM_016834chr17104037 3823 1611 1450 1379 1339 998 990 764 745 23179 1598 13262 --
NM_016835chr17104037 3823 1611 1450 1379 1339 998 990 764 745 23179 1598 13262 --
NM_016841chr17104037 3823 1611 1450 1379 1339 998 990 764 745 23179 1598 13262 --
NM_016953chr2105411 5202 4457 4375 4033 3942 816 655 616 378 1183 15079 --
NM_017423chr43815 595 140 ----12170
NM_017637chr998579 7711 7542 7076 6066 3726 3209 2126 1242 23379 1230 39165 5817 952 --
NM_017754chr654331 1733 341 310 73 31389 188 182 166 --
NM_017902chr1094849 4630 4596 4032 3941 3600 1274 161 69 11363 35523 1028 705 --
NM_018085chr197826 7670 6961 5854 2845 1941 1545 412 198 27336 5541 1885 --
NM_018155chr332785 2740 1183 12135 11000 1667
NM_018364chr123680 2867 ----24080 3406
NM_018373chr1474716 4495 4135 2037 1721 689 248 35341 2186 1132 12090 --
NM_018440chr867362 7173 5775 5640 3046 530 18284 36926 6688 893 18097
NM_020673chr2056096 5527 1807 509 281 1473 2575 452 --
NM_020727chr2133949 2545 957 --11333 1890
NM_020739chr1522959 1158 11014 11070 22913 1475
NM_020772chr1788044 7419 6027 2275 2015 1479 683 61 35877 5362 125 17579 12802
NM_020774chr1821207 274 ----25817 235
NM_021116chr7108366 8036 6723 5790 3498 2422 2044 1550 460 212 22387 1028 33198 2203 2163 --
NM_021961chr1157226 2562 2360 2311 1188 25741 2335 1373 15547
NM_022048chr1596280 5649 5152 2391 1471 1341 1288 892 252 14407 26083 616 1705
NM_022336chr232250 896 128 21951 33 --1646
NM_022841chr1532280 1025 521 11052 --12029
NM_024345chr976069 5133 4135 3888 2296 2036 1431 34531 3745 2072 ----
NM_024947chr378986 7796 2749 1891 1269 820 698 11071 ----
NM_024989chr276281 5621 5581 5057 2310 1871 44 27732 7440 11237 --
NM_030648chr474608 4466 3397 2088 1887 1550 708 --14871 25008 77
NM_030806chr1109195 8251 7313 7255 6828 2646 1656 1385 942 872 23063 2598 --13487
NM_031468chr7137782 7304 5776 5536 2868 2691 2298 2118 2001 1720 1570 949 192 17891 ----
NM_032859chr1353636 3169 1545 1258 666 --12662 1385
NM_033360chr1231785 1685 1669 --24454 1236 13015
NM_080491chr11103543 3536 3517 3386 1353 1314 1263 1053 778 662 33951 1338 699 43853 1575 1320 1025 --
NM_080669chr17104094 3854 3493 3235 1540 1459 1368 228 192 114 33324 94 28 1253 --
NM_080676chr2051994 1112 860 483 112 23314 425 --13160
NM_080872chr872592 2580 856 780 520 278 44 21470 267 --23515 2465
NM_133334chr4116057 5952 5941 4865 4805 4214 4004 1767 1714 1293 1239 --24834 4406 14816
NM_138492chr571239 420 359 349 207 163 119 1365 ----
NM_144571chr476950 6773 5161 5048 1746 806 179 11938 --16127
NM_145912chr22144007 3610 3505 3130 1612 1128 1072 731 723 626 607 599 561 103 21846 1836 1387 --
NM_152624chr566567 6000 2764 1424 741 247 47118 6167 1186 614 36864 6449 6092 --
NM_152673chr374388 4168 4081 1659 1262 502 130 34018 3256 978 13500 14110
NM_152733chr6146284 5846 5460 4739 4707 4646 4634 4118 2434 1895 1250 994 612 165 54372 4349 2600 2572 1868 ----
NM_153207chr1261435 1201 708 647 425 39 --14119 1141
NM_153810chr1024069 40 34835 4764 3526 15086 1223
NM_173825chr362962 2757 2516 2298 968 790 ----12560
NM_173851chr853297 2766 2700 2681 1320 23743 381 22950 1132 --
NM_175624chr1297623 7159 5787 2749 2546 1669 1545 795 110 27204 1841 ----
NM_175625chr1297623 7159 5787 2749 2546 1669 1545 795 110 27204 1841 ----
NM_175733chr1141777 791 407 342 134 --144
NM_175736chr12126790 6780 6604 6361 5817 2917 2464 2361 1797 1247 429 295 45895 3128 1420 722 --12380
NM_175861chr1255069 4784 4563 1986 1596 2422 209 1140 131
NM_178554chr3123129 2962 2846 2797 2748 2720 2303 1319 1196 828 754 412 23239 2761 ----
NM_182503chr664374 3438 2093 1854 1020 456 25121 789 --31756 1610 689
NM_182898chr776105 5743 5225 4117 2450 1462 67 ----26172 5263
NM_182899chr776105 5743 5225 4117 2450 1462 67 ----26172 5263
NM_194071chr773865 3627 2075 967 837 661 148 14475 25404 3847 1273
NM_194286chr1286104 5425 4889 4160 1983 1466 825 707 11869 11844 13861
NM_198859chr384874 4116 3379 1802 1252 1091 489 345 13845 14601 --
NM_198900chr12126790 6780 6604 6361 5817 2917 2464 2361 1797 1247 429 295 45895 3128 1420 722 --12380
NM_201613chr123767 684 93 ----178
NM_205846chr571239 420 359 349 207 163 119 1365 ----
NM_206909chr8107198 6881 6293 6172 5335 3249 2793 2012 1900 616 --17649 --