TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-676-5p
miRNA Sequence: UCUUCAACCUCAGGACUUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000809chr478813 8470 8304 8007 5751 3056 2022 46461 2391 1999 1227 19230 --
NM_000926chr11118586 7578 7024 6393 6309 6179 5807 3322 2680 1751 1283 26825 222 18839 27614 6788
NM_001001664chr293718 3093 3045 2808 2504 1647 898 686 21 33472 2896 452 ----
NM_001003652chr18118676 8477 7377 6774 5662 5354 2874 2697 2168 1573 122 12134 13062 --
NM_001010853chr632434 2045 496 22811 2617 --23165 2067
NM_001014797chr1097901 6084 6057 5454 5140 5065 3291 2791 742 58105 8011 7424 3203 524 --46976 6960 3134 120
NM_001024956chr11125100 4436 4419 4018 3851 3683 1985 1749 1186 1135 874 319 24836 4158 ----
NM_001039547chr396493 6114 6002 4998 2958 2372 2122 660 434 47329 5183 1427 908 ----
NM_001039618chr11135249 4899 4134 3937 3879 3699 1867 1738 1050 985 869 643 489 3941 913 621 12214 --
NM_001042603chr1275108 5064 4988 4623 2055 1043 447 --13801 1437
NM_001100108chr1148080 8017 6942 6677 6117 3034 2637 2163 1890 1325 1168 651 483 237 46522 2455 2251 1787 26894 2686 17222
NM_001106chr3138495 8476 7376 7051 6290 2733 2111 2011 1853 1020 998 748 634 33122 799 436 1254 13492
NM_001204chr266400 5889 2240 2214 620 479 27714 2223 16581 --
NM_002025chrX108613 7180 6193 3507 3492 3473 3310 2638 1903 752 21373 802 58628 7312 3466 3460 2253 --
NM_002519chr112400 294 ----21291 1138
NM_002581chr985603 5189 5138 4356 3471 1642 775 768 14544 21162 1061 --
NM_003034chr1297651 7211 6369 6030 5019 1854 1426 568 168 48120 7784 7175 1987 15508 11238
NM_003199chr1875567 5307 4844 3723 3461 2169 218 24890 1473 25479 4685 --
NM_004171chr1176225 3772 3314 1149 1093 682 263 48924 6725 6683 271 29505 2357 --
NM_004458chrX4487 324 309 79 32512 1706 348 1330 --
NM_004719chr1222427 969 22223 738 22836 2249 1729
NM_004985chr1254183 4014 1248 441 408 33966 1562 914 24088 3394 1982
NM_004992chrX77527 6772 5472 2427 1089 500 381 --48074 7105 3221 171 21617 216
NM_004992chrX77527 6772 5472 2427 1089 500 381 --48074 7105 3221 171 21617 216
NM_005044chrX64241 4203 3760 3389 725 163 33304 1129 1118 34120 1532 734 1871
NM_005197chr1485365 4305 1776 1721 1666 1559 667 213 46233 4294 1267 493 25579 4103 13918
NM_005238chr1163094 2930 913 519 263 62 22972 1404 1995 11299
NM_005339chr444299 4183 3494 335 52861 2734 542 136 46 23051 1281 --
NM_005504chr1296528 5641 5494 5010 4975 4599 4434 1770 507 35902 1039 959 ----
NM_005596chr995710 5582 5281 2420 2397 1109 1008 949 283 181 26249 2490 15144
NM_005840chrX67493 6640 2772 2731 2045 1874 37520 5549 75 37363 1477 906 27185 6650
NM_005901chr18118676 8477 7377 6774 5662 5354 2874 2697 2168 1573 122 12134 13062 --
NM_006252chr197282 7239 5780 4762 4589 2724 2006 1120 489 15841 ----
NM_006599chr1696986 6383 5370 3229 2697 2330 1627 1500 1208 1524 11573 17706
NM_006918chr11125100 4436 4419 4018 3851 3683 1985 1749 1186 1135 874 319 24836 4158 ----
NM_006924chr1794460 3464 3135 2993 2986 1640 1445 1185 116 33550 1418 457 ----
NM_006948chr2192253 2125 2035 2023 2015 1972 472 437 238 2780 197 11658 --
NM_007007chr1283958 3941 3930 3613 1722 1646 1066 214 1909 13027 --
NM_007249chr13148885 8716 8048 7776 7651 7581 7572 3431 3184 3019 1952 1931 1173 774 21363 998 25839 718 --
NM_007350chr1254062 3592 3060 2950 533 51167 564 431 44 36 --11285
NM_012081chr593609 3220 2887 2839 2506 2354 1383 517 103 32851 2602 1086 ----
NM_014423chr545100 4753 1939 383 45534 4045 1961 1915 1803 15623
NM_015206chr1573860 3699 3419 2516 628 132 92 1917 12570 1888
NM_015310chr8136970 6804 6555 6161 5745 2360 2241 1335 1132 977 711 651 568 22666 781 11557 --
NM_015569chr1114874 4805 4175 3913 3794 1578 1260 1176 1029 909 819 34775 4636 4030 14341 --
NM_016206chr3128641 7761 5894 3477 3039 3009 2302 2227 1059 802 483 448 21373 184 ----
NM_016260chr2106690 6504 6261 6155 6117 5947 5825 2517 2501 1376 77279 6666 5690 5016 2843 2674 2614 ----
NM_017637chr998985 8148 7737 7598 7016 5705 3623 2791 542 38997 7674 6859 ----
NM_017813chr875582 4745 4525 4518 3695 3547 2300 23663 3649 21149 365 --
NM_017919chr985616 3846 2187 987 393 194 131 63 2365 239 --14003
NM_018247chr672984 2202 1961 1152 748 686 100 --21190 521 11904
NM_018440chr8108351 7035 6700 6655 6202 3382 2816 2691 1290 719 38129 7437 3277 33373 1982 1700 27200 125
NM_018638chr12105700 5144 4724 4077 4028 1571 1348 1329 591 347 25654 2106 11096 --
NM_020336chr2063300 3238 3125 1175 870 26 1290 13498 23292 364
NM_020466chr6104596 4308 3759 1625 1602 1543 1352 1314 1152 362 11488 14743 --
NM_020727chr2154034 3230 821 315 247 12786 1137 1111
NM_021964chr3106663 5829 4915 4678 4542 4213 2123 1939 798 582 --1693 --
NM_022977chrX4487 324 309 79 32512 1706 348 1330 --
NM_024949chr484651 4464 3787 1560 1137 464 339 327 31644 1443 125 14385 --
NM_024989chr2118224 7186 6640 6504 6427 5886 5805 3124 890 780 158 42776 1061 260 101 21581 171 --
NM_030627chr584151 3329 3289 1451 1411 1339 1225 636 13323 14055 --
NM_030806chr195720 3716 3662 2384 1483 1469 833 495 62 47244 2953 1152 504 ----
NM_033360chr1254304 4135 1369 562 529 34087 1683 1035 24209 3515 11103
NM_033430chr463799 3780 2764 1025 895 753 22987 1292 126 13563
NM_033437chr463799 3780 2764 1025 895 753 22987 1292 126 13563
NM_052879chr1283860 3661 3350 1011 553 315 139 77 33000 460 401 12723 11328
NM_138468chr296210 6004 5414 4187 2250 1279 668 597 328 --15136 16059
NM_138473chr1294043 3767 3602 3534 1899 860 841 195 121 23663 1005 --13292
NM_138713chr1696986 6383 5370 3229 2697 2330 1627 1500 1208 1524 11573 17706
NM_138714chr1696986 6383 5370 3229 2697 2330 1627 1500 1208 1524 11573 17706
NM_144571chr4105906 4989 4960 4663 1252 1220 1168 1083 651 295 46919 5853 4380 663 12565 --
NM_152624chr5147184 7078 6223 4946 2877 2864 2256 2177 2008 1938 1241 382 244 47 46880 5220 2805 2395 ----
NM_172071chr1107033 6923 5695 2553 1406 1119 887 878 718 643 27006 2211 ----
NM_173214chr1696986 6383 5370 3229 2697 2330 1627 1500 1208 1524 11573 17706
NM_173468chr475454 4824 3943 2429 1532 1238 713 54739 877 706 553 257 15617 --
NM_173470chrX22234 52 1820 12720 2770 759
NM_181521chr16157152 6189 5972 5700 5446 4597 4428 2595 2530 1969 1791 737 439 244 98 12670 ----
NM_182762chr775847 4710 4388 3850 1729 1370 1021 1952 13781 15542
NM_194314chr144681 2130 1823 199 31321 1215 386 --25103 1161
NM_199188chr1283860 3661 3350 1011 553 315 139 77 33000 460 401 12723 11328
NM_199190chr1283860 3661 3350 1011 553 315 139 77 33000 460 401 12723 11328
NM_199320chr442899 2179 1958 673 1600 1755 22878 199
NM_199320chr442899 2179 1958 673 1600 1755 22878 199
NM_199324chr493628 3569 3399 2907 2528 1338 695 360 95 22572 1221 ----
NM_206853chr673535 3201 2853 2654 1520 1396 358 33269 2685 1260 ----
NM_206854chr694796 4462 4114 3915 3655 3482 1619 838 470 34530 3946 1020 --13290
NM_206855chr6105761 5427 5079 4880 4620 4447 1803 1435 728 367 45495 4911 3901 1985 --14255
NM_206909chr8136970 6804 6555 6161 5745 2360 2241 1335 1132 977 711 651 568 22666 781 11557 --