TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-7-1-3p
miRNA Sequence: CAACAAAUCACAGUCUGCCAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX46978 6007 2354 887 1567 --2796 762
NM_000092chr263642 3490 3395 1649 1613 1563 --34553 1456 192 --
NM_000176chr5113874 3013 2878 2817 1469 1265 1018 991 125 89 72 ------
NM_000264chr9113283 3141 2992 2579 2437 2344 2253 875 677 530 293 1160 ----
NM_000267chr1783060 2921 2915 2908 2895 2869 2578 823 11042 ----
NM_000332chr6147007 6589 6178 5600 5314 5291 5228 4372 4351 2531 2481 2469 1991 45 15387 14769 --
NM_000346chr1791941 1902 1888 1394 1385 1349 117 104 93 ------
NM_000408chr253444 3399 1362 298 184 --13410 12579
NM_000461chr384546 4436 4064 3525 2947 1652 558 77 ----11848
NM_000610chr1171218 891 884 877 178 155 141 --12852 --
NM_000618chr1276033 5096 4869 4406 4393 601 452 31962 1722 923 ----
NM_000618chr1276033 5096 4869 4406 4393 601 452 31962 1722 923 ----
NM_000633chr18105187 4964 4939 4897 4185 3628 3438 2011 1875 1838 15016 14010 --
NM_000793chr1444760 939 878 589 11389 25124 3692 1780
NM_000809chr4108918 8585 6387 6262 3236 3137 2123 2065 1644 628 --1941 18673
NM_000875chr15116660 6534 5765 5697 5476 4876 4597 2369 1679 1286 1118 16288 --16817
NM_000944chr462057 2024 1957 1940 1721 789 ----21840 596
NM_001001323chr12103180 3167 3159 2525 2173 1264 1132 964 763 747 11202 13010 --
NM_001001389chr1171218 891 884 877 178 155 141 --12852 --
NM_001001390chr1171218 891 884 877 178 155 141 --12852 --
NM_001001391chr1171218 891 884 877 178 155 141 --12852 --
NM_001001392chr116937 930 923 224 201 187 --12898 --
NM_001001419chr595205 5066 4973 4537 3520 2035 1013 983 142 14286 25073 167 --
NM_001001420chr595205 5066 4973 4537 3520 2035 1013 983 142 14286 25073 167 --
NM_001001664chr293845 3328 2960 2767 1591 1401 973 617 401 --11601 --
NM_001001890chr21113930 3797 3747 3655 3424 3411 3368 3258 2969 865 685 --23390 3315 --
NM_001003652chr18158601 7092 6935 6667 6257 5538 5317 2871 2804 2728 2291 1769 1689 672 662 --16341 15447
NM_001003674chr18116807 6349 5577 5520 5109 4982 4922 1983 1837 473 136 27013 2695 --16541
NM_001003675chr18116807 6349 5577 5520 5109 4982 4922 1983 1837 473 136 27013 2695 --16541
NM_001005473chr586627 6392 4588 4459 4367 4328 2636 259 24637 606 14792 --
NM_001007023chr1444760 939 878 589 11389 25124 3692 1780
NM_001007257chr181400 1191 1100 1013 986 949 535 388 11051 21464 1001 --
NM_001007278chr1385145 5056 4751 4477 1566 1319 935 199 25117 33 ----
NM_001007466chr6125110 4929 4500 4446 4063 3531 1584 1578 1572 1559 1546 888 11439 24714 3493 --
NM_001007559chr1882093 2047 1621 1614 1607 1601 1570 260 ------
NM_001008239chr18113711 3470 3459 3315 2829 1351 1345 1330 1314 112 103 13124 13070 --
NM_001008738chr532946 2739 2341 --2977 785 1443
NM_001009899chr3106500 6208 5694 5417 4817 4000 2372 1765 951 52 --16298 11115
NM_001009909chr1163959 3671 2951 1138 459 220 11548 12759 --
NM_001010888chrX104668 4585 4416 4354 4316 4004 3509 2851 1660 88 ------
NM_001010891chr596592 6240 5927 5613 5088 4716 4480 2667 1558 --34359 2265 1377 --
NM_001010923chr631560 1534 1377 --21125 401 21498 1076
NM_001011666chr786560 6445 6342 6330 6324 6306 2554 447 ------
NM_001012393chr1195210 4568 4393 4110 3582 2069 138 132 97 --31592 146 121 --
NM_001012751chr1051801 1615 623 513 448 21531 417 11378 --
NM_001012968chrX41765 1046 1009 911 22550 2448 22545 2245 --
NM_001014380chr13145865 5745 5734 5332 5002 4446 4428 3933 1844 1382 1168 756 418 36 15385 25220 4674 --
NM_001014797chr10178258 8198 7050 7031 6810 5903 5285 5234 2728 2419 2064 1863 1475 1160 1089 852 794 12637 --12240
NM_001015877chrX93062 3024 2936 2631 2471 428 341 153 93 12484 --11933
NM_001017999chr16694 431 360 354 347 331 ------
NM_001017999chr16694 431 360 354 347 331 ------
NM_001018000chr16694 431 360 354 347 331 ------
NM_001018000chr16694 431 360 354 347 331 ------
NM_001018001chr16694 431 360 354 347 331 ------
NM_001018074chr5113874 3013 2878 2817 1469 1265 1018 991 125 89 72 ------
NM_001018075chr5113874 3013 2878 2817 1469 1265 1018 991 125 89 72 ------
NM_001018076chr5113874 3013 2878 2817 1469 1265 1018 991 125 89 72 ------
NM_001018077chr5113874 3013 2878 2817 1469 1265 1018 991 125 89 72 ------
NM_001018089chr1583921 3903 3739 3513 3347 1565 607 433 --22689 2631 --
NM_001018090chr1572283 2124 2107 1913 647 640 145 1919 11920 --
NM_001018091chr1572393 2234 2217 2023 757 750 255 11029 12030 --
NM_001018102chr1572283 2124 2107 1913 647 640 145 1919 11920 --
NM_001024094chr5113874 3013 2878 2817 1469 1265 1018 991 125 89 72 ------
NM_001024649chr592930 2911 2568 2237 2000 520 500 357 286 1656 22824 2635 --
NM_001024948chr1103347 3250 3141 2793 2726 2645 2504 649 445 262 1959 ----
NM_001024956chr11115892 5842 5773 4897 4625 3680 1959 1746 1651 1066 271 15148 ----
NM_001025076chr1096170 5465 2403 1888 1571 1498 1028 837 667 21281 1234 14480 --
NM_001025077chr10177528 6823 4732 4707 4614 4594 2929 2856 2386 2195 2025 1350 1081 1061 844 252 203 32639 2592 649 25838 1144 --
NM_001025079chr3103996 3769 3605 3525 2842 1540 1518 1273 1259 243 13361 ----
NM_001025580chrX53338 1710 1203 1056 528 --12842 21083 186
NM_001030055chr1483567 3552 3079 3071 3019 2881 1590 1100 21238 400 33699 982 928 --
NM_001031695chr22104648 3824 3780 2090 2068 1716 1705 792 561 217 14487 ----
NM_001031700chr462221 2130 729 653 308 55 1836 2904 214 --
NM_001033087chr2043219 3022 1311 151 13178 33303 2253 575 13278
NM_001037165chr7108921 8857 8334 7650 7327 7319 7312 6592 1162 582 --18940 --
NM_001039395chr9102336 1663 983 868 590 471 462 243 227 90 --11996 --
NM_001039618chr11145345 5211 4965 4882 4765 4131 3792 3665 2050 1893 1613 1127 1001 362 11561 ----
NM_001039693chr273384 3310 3277 2794 2638 1205 125 23779 70 ----
NM_001039840chrX85556 5282 3893 2433 2199 1403 1390 875 14826 ----
NM_001040284chr1674512 3995 2144 2134 1949 1933 535 15366 25560 685 1551
NM_001040450chr1532119 635 114 --12314 22296 1880
NM_001040453chr1532119 635 114 --12314 22296 1880
NM_001040712chr963231 3103 2905 2357 1187 838 11196 --13593
NM_001042404chr11581 21976 1950 21411 727 1423
NM_001042492chr1783060 2921 2915 2908 2895 2869 2578 823 11042 ----
NM_001042493chr672006 1583 1577 1416 1361 782 769 1267 ----
NM_001042599chr2117328 7250 7012 6214 5102 4793 2966 2433 1902 658 339 17829 21324 1107 --
NM_001042604chr3104509 4071 3651 3561 3362 1646 1428 989 536 206 --1581 --
NM_001044385chr282754 1174 553 444 187 92 52 40 --13061 --
NM_001100108chr1117684 7163 6991 6527 5225 5080 3028 2401 2394 1254 470 --18187 --
NM_001106chr3209582 9180 8896 8885 8721 8665 8095 7820 7212 6830 6321 3773 3246 2647 1707 1623 1009 531 346 70 11502 ----
NM_001167chrX66638 4771 2684 1751 1307 850 11251 21454 417 --
NM_001173chr1483567 3552 3079 3071 3019 2881 1590 1100 21238 400 33699 982 928 --
NM_001204chr2127418 6661 6416 6039 5172 2293 2166 1820 502 240 216 194 ----14710
NM_001259chr785652 1363 984 971 965 950 932 231 26165 1333 2546 212 --
NM_001364chr1184611 4386 3166 1362 1219 1137 862 91 ----13956
NM_001412chrX113454 2809 2369 2333 1149 1143 1136 1130 636 483 203 --1126 1109
NM_001419chr1994252 4237 3384 1217 1201 1158 1058 974 107 --14186 --
NM_001609chr1033735 3516 3033 ----2909 707
NM_001650chr1842763 1017 930 108 23552 1287 11097 184
NM_001682chr12122894 2881 2873 2239 1887 1146 1130 978 846 678 477 461 1916 12724 --
NM_001695chr8103739 3394 2859 2664 1598 1125 903 651 378 40 1628 1836 1318
NM_001709chr1172578 887 666 579 554 246 53 12538 22258 2172 --
NM_001742chr751603 1320 1279 130 107 ----11437
NM_001746chr592930 2911 2568 2237 2000 520 500 357 286 1656 22824 2635 --
NM_001754chr21113930 3797 3747 3655 3424 3411 3368 3258 2969 865 685 --23390 3315 --
NM_001759chr12104464 4293 3513 3401 3357 2042 1880 1662 1334 72 ----11517
NM_001777chr3103996 3769 3605 3525 2842 1540 1518 1273 1259 243 13361 ----
NM_001858chr6105000 4717 4581 4281 4069 3889 3610 3394 1990 1570 33549 3536 664 33543 3423 1933 --
NM_001918chr1109200 9185 8985 8448 8400 5868 953 926 140 105 22233 1260 13169 --
NM_001949chr692829 2805 2790 2784 2726 2377 2227 768 749 ----13180
NM_001987chr1254172 1369 331 325 319 --12962 --
NM_002006chr4115824 5521 4511 4336 3555 1813 1589 1554 1350 1188 746 --14870 22255 63
NM_002015chr1372601 1218 950 708 685 466 362 2836 695 12242 --
NM_002024chrX52148 1399 751 745 511 2291 72 11729 --
NM_002025chrX139195 9149 9138 7189 6566 6330 6105 3307 2932 2692 1790 1161 113 35755 662 132 15764 --
NM_002040chr2183177 2621 2541 2494 2420 1276 910 828 21013 840 22553 2323 --
NM_002092chr4114964 4936 4841 4156 4150 1886 1880 1616 291 270 230 1772 14144 --
NM_002158chr253841 2633 1275 785 510 --1492 13594
NM_002210chr283506 3257 3044 2784 2726 2288 596 149 13270 1352 --
NM_002270chr595647 4932 4748 3855 2137 1925 1418 1040 983 23514 2113 11587 --
NM_002480chr1271523 489 201 193 180 157 147 ------
NM_002545chr1195210 4568 4393 4110 3582 2069 138 132 97 --31592 146 121 --
NM_002577chr374050 4037 3253 1609 1347 960 309 --21428 844 1693
NM_002595chr1281891 1819 1651 1533 1398 757 443 105 --21920 170 --
NM_002641chrX91940 1468 1408 1400 812 761 636 88 35 --11800 12002
NM_002655chr885063 4581 4067 3398 1851 1391 417 179 1524 13368 --
NM_002709chr282643 2337 1450 1384 960 717 400 394 ----137
NM_002737chr1786612 6463 6397 6197 5430 4281 4275 1361 26650 1200 14312 15393
NM_002821chr64794 788 782 765 ------
NM_002839chr963231 3103 2905 2357 1187 838 11196 --13593
NM_002886chr3114662 3849 3751 3189 1587 1499 1274 940 934 776 755 13623 11249 --
NM_002998chr872186 1743 860 475 333 90 83 1380 --1805
NM_003030chr381736 1730 1724 1713 1631 1607 1588 1468 --11816 --
NM_003034chr1278128 7271 6366 6050 3169 1451 1223 143 35279 833 565 --
NM_003108chr266876 6482 5556 5136 4605 1215 1613 47302 6612 4844 1205 --
NM_003112chr783057 2985 2882 2554 2380 2207 2198 2002 1372 ----
NM_003199chr18184432 4234 4228 4222 4211 4200 3921 3681 2003 1884 1685 1319 1032 1009 691 465 370 329 45043 4125 3909 819 22220 699 --
NM_003463chr633149 957 242 1877 11099 156
NM_003468chr294326 4238 4124 4013 1754 651 278 269 55 --14199 --
NM_003566chr1253266 2605 1387 619 419 --32538 1021 683 23034 2684
NM_003574chr18115084 4987 4046 3810 3539 1930 1917 1515 1228 815 625 15625 162 --
NM_003590chr283859 2751 1268 1258 931 686 598 257 13485 ----
NM_003615chr373663 3606 2938 2801 482 345 139 1405 23965 2952 --
NM_003630chr62705 501 189 1267 1251
NM_003759chr4102787 1687 1292 1284 960 827 352 207 196 151 --2190 174 --
NM_003913chr694081 3771 3725 3574 1372 1296 1015 945 697 1818 2996 321 --
NM_003930chr782518 2262 2133 1865 1694 722 358 273 --12419 --
NM_003955chr1751404 1299 1293 1287 1281 ------
NM_003966chr5117815 7728 7080 6409 2686 2660 2431 2293 2065 1651 277 --14766 --
NM_004028chr1842763 1017 930 108 23552 1287 11097 184
NM_004124chr1452569 2518 922 137 106 13557 23224 3052 2807 290
NM_004338chr18116807 6349 5577 5520 5109 4982 4922 1983 1837 473 136 27013 2695 --16541
NM_004380chr1672594 2503 642 364 278 257 251 2964 164 ----
NM_004392chr1392516 2290 1890 1848 1801 1038 961 318 216 12058 ----
NM_004397chr1144216 4049 449 192 14308 13196 13579
NM_004464chr453173 689 543 421 411 1402 21261 133 --
NM_004480chr143523 517 511 ------
NM_004504chr283032 2853 2216 1166 1108 883 330 314 11207 11099 --
NM_004612chr994844 4233 4062 4014 3921 3737 3636 1003 771 --13715 24639 1238
NM_004660chrY32105 1519 293 22094 299 --11446
NM_004685chr1373001 2763 2217 2102 577 546 87 --1728 --
NM_004726chrX85240 4596 4454 3882 1837 1698 1082 231 14390 34065 3537 917 --
NM_004760chr762392 1957 1853 299 283 141 1401 1441 --
NM_004815chr1113723 3631 3497 3176 866 771 496 444 192 130 28 --14419 --
NM_004904chr786560 6445 6342 6330 6324 6306 2554 447 ------
NM_004985chr1274484 3773 3663 3444 1675 1189 502 --23309 81 --
NM_004999chr664336 2780 1632 1350 1190 766 14150 23806 149 --
NM_005156chr9105312 5145 5011 4367 1882 1659 1394 1139 794 364 11450 14450 --
NM_005160chr22116434 5979 5650 5605 5353 4304 2158 1383 1263 1143 172 15661 11395 --
NM_005188chr11118360 8010 6502 5384 2778 2630 2548 2409 2089 1493 739 --11030 --
NM_005197chr14115754 4017 1545 1524 1518 1511 1505 1499 174 150 73 15289 ----
NM_005235chr2117328 7250 7012 6214 5102 4793 2966 2433 1902 658 339 17829 21324 1107 --
NM_005359chr1855357 2549 1848 1437 93 1707 14796 12450
NM_005399chr184358 3574 3057 3013 1373 1312 814 744 13813 --11226
NM_005497chr17126074 4724 4711 4666 3769 2280 1568 1389 1224 440 352 235 1987 ----
NM_005504chr1296650 6520 5878 4850 4127 2237 816 783 117 16483 12459 --
NM_005596chr975853 5168 4499 4282 4033 3980 1945 34752 3999 358 12394 --
NM_005637chr1882093 2047 1621 1614 1607 1601 1570 260 ------
NM_005665chr154225 1445 1039 954 807 21652 1625 2423 79 --
NM_005748chr1253139 2430 1164 629 537 ----2151 141
NM_005754chr521032 118 21178 928 1859 1940
NM_005795chr272646 2575 2284 2231 1945 206 197 --11216 --
NM_005798chr1385145 5056 4751 4477 1566 1319 935 199 25117 33 ----
NM_005828chr1744614 1805 1642 436 13685 1286 1489
NM_005839chr17912 895 688 679 364 334 40 --2758 99 --
NM_005841chr46765 279 79 73 67 61 ------
NM_005901chr18158601 7092 6935 6667 6257 5538 5317 2871 2804 2728 2291 1769 1689 672 662 --16341 15447
NM_005903chr595205 5066 4973 4537 3520 2035 1013 983 142 14286 25073 167 --
NM_005935chr4105213 4566 3957 3650 3643 3592 3514 1675 949 134 --2497 78 --
NM_005966chr281933 1901 1729 1591 1509 588 401 316 12241 ----
NM_006007chr974527 4156 4143 3800 3629 2982 32 22842 163 1756 13277
NM_006016chr651724 1630 1613 1517 40 11592 32219 2167 703 --
NM_006047chr20113518 2839 2633 2603 2295 661 621 599 579 307 255 32215 1024 436 ----
NM_006095chr464366 3911 1667 736 730 501 11256 13129 1751
NM_006106chr1193444 3364 2821 1387 736 727 715 705 395 --12910 --
NM_006241chr382409 2293 1718 700 690 672 486 273 133 ----
NM_006251chr583296 2610 2305 1342 503 414 194 73 1971 11278 --
NM_006252chr1127428 7382 6490 2907 2721 2350 1802 1367 1319 1229 1012 545 17387 --11383
NM_006283chr864917 3043 735 339 299 281 ----1908
NM_006306chrX75341 4136 2136 1572 1549 589 536 --23628 1658 --
NM_006420chr2063000 2918 2823 2580 777 377 33048 2865 563 --12552
NM_006544chr1475585 5082 4467 3887 1887 1835 1744 ----1427
NM_006561chr1096170 5465 2403 1888 1571 1498 1028 837 667 21281 1234 14480 --
NM_006599chr16148242 8147 6848 5259 3248 3124 2484 2104 2096 2002 1707 1686 1656 374 25626 2161 ----
NM_006609chr262955 2242 2032 892 449 410 --1152 1615
NM_006628chr1594635 4573 4565 4417 2944 1212 1182 655 490 14596 --1941
NM_006729chrX95568 5184 4857 2239 2206 2193 2048 249 148 ----14620
NM_006731chr9105804 5758 5624 4452 3565 1602 1171 1162 609 78 15598 ----
NM_006734chr681577 1443 496 313 295 241 55 49 1135 ----
NM_006738chr15104499 4438 3429 1637 1631 1623 1592 1315 658 213 --11606 13220
NM_006777chrX32006 137 29 --11886 22527 1070
NM_006815chr125953 539 428 327 305 ----11195
NM_006884chr381736 1730 1724 1713 1631 1607 1588 1468 --11816 --
NM_006885chr16164169 4154 3852 3800 3313 3239 2902 2896 2890 2686 2592 1501 1428 601 582 525 34063 2970 607 21618 1419 --
NM_006915chrX52566 2499 2255 2063 245 ----1425
NM_006918chr11115892 5842 5773 4897 4625 3680 1959 1746 1651 1066 271 15148 ----
NM_006922chr262110 2047 2041 1856 1793 624 22398 1582 1373 --
NM_007107chr332107 1858 477 --22133 148 11914
NM_007200chr15104499 4438 3429 1637 1631 1623 1592 1315 658 213 --11606 13220
NM_007249chr13129345 8358 8175 8012 7773 2380 1946 1680 1156 689 668 286 29466 323 48110 7199 3415 648 --
NM_012081chr573559 1497 1461 955 918 887 879 2307 224 ----
NM_012120chr652957 2367 1928 559 173 12943 12533 1787
NM_012214chr295704 5274 5051 4977 4641 4439 3886 2569 693 15413 1171 34451 2255 41
NM_012234chr353523 3346 2320 335 329 13413 32893 1203 1111 --
NM_012262chr185034 3459 3200 1515 788 462 109 59 11652 1770 --
NM_012290chr261517 1287 297 168 139 79 --11215 11299
NM_012309chr11114649 4548 4365 3930 3747 3264 3229 3096 1594 537 116 ------
NM_012395chr743393 3365 2608 301 22904 2178 --13350
NM_013231chr1444118 3993 1192 114 24355 1083 11422 14236
NM_013255chr7108870 8187 7819 7611 7047 5529 2581 2102 2056 1048 26291 5721 ----
NM_013989chr1444760 939 878 589 11389 25124 3692 1780
NM_014021chr183300 2819 2622 2452 2319 2217 1362 118 --23203 2388 --
NM_014112chr875398 5313 4888 3679 2068 2057 715 1140 2956 410 --
NM_014155chr11107544 7040 6517 6280 5328 5169 2027 1897 1822 298 --12078 --
NM_014181chr2102728 2190 1976 482 476 470 464 457 253 243 ----12705
NM_014309chr22104638 3814 3770 2080 2058 1706 1695 782 551 207 14477 ----
NM_014423chr5115558 5206 5182 4758 4171 3858 3721 3562 1711 1649 867 --15288 --
NM_014667chr371970 1926 1838 619 600 592 148 22038 767 --11868
NM_014670chr241609 1407 558 439 ----21518 376
NM_014682chr852254 2102 2060 817 809 11973 12156 1688
NM_014721chr677152 6967 6832 6276 5809 2718 719 26658 6331 ----
NM_014733chr521533 507 11805 21970 1694 142
NM_014739chr6163935 3012 2725 2719 2713 2707 2701 2695 2679 960 790 772 343 223 134 67 1259 13215 11302
NM_014810chr153595 3018 2762 2600 972 --12895 13658
NM_014812chr11581 21976 1950 21411 727 1423
NM_014819chr552348 1656 1637 521 235 --1824 12371
NM_014820chr341769 1615 1485 114 --1300 1131
NM_014877chr17127731 6565 5905 5530 3076 1729 1081 888 329 244 101 46 --46270 5712 4810 2997 --
NM_014904chr1083805 3340 1625 1601 1277 904 861 389 22535 657 13711 --
NM_014912chr10112973 2964 2734 2678 2613 2324 2145 1136 629 349 279 --12943 --
NM_014936chr6112613 2442 2261 2123 987 786 491 428 395 157 141 12371 1911 --
NM_014946chr272917 2847 1139 787 311 195 125 --21169 376 --
NM_014962chr2052699 2057 1039 911 104 11104 2635 531 --
NM_014989chr65477 451 440 433 416 11599 ----
NM_014991chr493208 3041 2856 2635 2407 2106 1190 1084 523 --22664 1241 --
NM_014999chr1261553 1159 239 229 218 177 11164 11417 --
NM_015026chr1293479 3320 3286 3175 2990 1040 969 951 305 22970 474 ----
NM_015032chr134682 419 413 156 12211 42839 2626 494 454 1378
NM_015097chr391898 1543 1461 798 785 526 443 280 127 --12221 --
NM_015100chr172033 1587 728 402 358 334 165 ----11551
NM_015156chr1473974 2977 2738 1585 1432 1107 461 11317 --13950
NM_015208chr1863396 3075 2915 2599 2547 658 13435 12565 --
NM_015209chr16694 431 360 354 347 331 ------
NM_015265chr281012 858 632 172 143 96 90 82 22620 76 ----
NM_015310chr8118297 8047 8014 7670 7515 5757 5635 5239 2955 1175 745 1145 22018 1553 --
NM_015313chr1194714 4699 4163 3993 3977 3364 3116 400 198 ----1871
NM_015315chr583445 2904 2464 2458 2452 2446 882 530 ------
NM_015349chr692880 2601 2241 1926 983 966 511 288 167 12985 1296 12668
NM_015355chr1771840 1428 1299 779 538 143 79 --21970 702 --
NM_015365chrX53338 1710 1203 1056 528 --12842 21083 186
NM_015458chr8145181 5110 4664 4628 4621 4486 3686 3230 1813 1207 1041 952 572 281 11722 --1721
NM_015532chr1572283 2124 2107 1913 647 640 145 1919 11920 --
NM_015554chr1562906 2879 2427 2420 2183 1820 --3557 548 539 11788
NM_015569chr194630 4570 4536 4287 4203 3506 1468 940 241 24488 688 ----
NM_015575chr2103311 3305 2581 2439 2272 914 868 843 378 178 --22593 2409 --
NM_015691chrX82922 2886 2040 2006 502 415 90 75 ------
NM_015866chr181400 1191 1100 1013 986 949 535 388 11051 21464 1001 --
NM_015879chr1888513 7959 6729 2543 2261 1919 1420 593 12772 18222 11513
NM_015886chr885343 3752 3705 2144 1250 537 161 148 11349 14418 14816
NM_015888chr193170 2639 1010 975 731 660 411 404 257 --1389 --
NM_015906chr194400 4121 3750 1583 1478 1425 1079 977 812 ------
NM_016018chr842687 975 349 120 --12219 12256
NM_016023chr831872 696 382 11828 12112 2748 204
NM_016076chr182688 2420 2037 1103 1036 486 480 146 1493 12056 --
NM_016078chr1751122 1030 991 887 107 126 21063 230 --
NM_016090chr1131069 904 75 --11032 1310
NM_016132chr15103373 3365 3359 3270 3151 3136 3067 1324 1026 974 1168 21126 291 --
NM_016206chr3138383 7878 7380 7372 7362 6459 6399 6003 2442 1217 601 378 287 23413 252 66722 6366 5930 5558 1038 202 --
NM_016260chr2117568 7504 7338 6881 5756 5459 5092 2806 2634 1709 473 26823 5603 2919 863 --
NM_016289chr242071 816 357 139 ----22263 683
NM_016315chr281617 1561 1536 1412 1202 317 246 42 --21164 666 --
NM_016396chr1542797 1964 702 390 12414 33004 2993 636 12442
NM_016422chr1173098 2782 2578 612 241 179 140 --22814 2667 --
NM_016436chr2062552 1962 1086 1065 1007 601 1975 --1848
NM_016441chr2102359 2352 2136 2069 1698 1608 902 869 857 75 ----12016
NM_016485chr662082 1555 913 739 451 107 12069 --1859
NM_016531chr453701 2738 2568 1234 1156 22775 794 --14081
NM_016613chr492724 2690 2677 2221 2130 729 653 308 55 1836 2904 214 --
NM_016831chr192325 2311 2083 1847 1620 953 775 360 186 --12344 12097
NM_016953chr2126134 5853 5709 5494 4751 4502 1547 1539 1293 1233 471 78 1392 ----
NM_017447chr21134365 4297 4116 3531 3438 3245 3160 3130 2787 1558 1439 767 704 24441 3819 ----
NM_017563chr3116407 6312 6203 5589 5408 5088 4678 4127 2160 1846 1442 ------
NM_017628chr4114847 4836 3629 3284 1732 1649 1636 1629 1125 1063 24 ------
NM_017633chr633908 3452 2617 13603 32970 1351 985 1799
NM_017637chr9179438 9272 9250 9066 7570 7547 3780 3455 2576 2545 2511 2427 2196 1820 1668 1585 591 12937 42310 1383 1060 387 --
NM_017644chr395224 5124 4811 4684 4347 2056 1556 474 259 1203 44559 4476 4441 4093 --
NM_017650chr775983 5810 4767 4302 4293 1343 1173 11921 --26027 651
NM_017658chr1474620 4437 2894 1748 1667 1041 138 --1477 11694
NM_017709chr174149 3764 3332 1054 1048 896 521 --12760 --
NM_017736chr16102964 2772 2744 1176 1167 1150 880 510 393 100 --13207 --
NM_017737chr192056 1959 1850 1502 1435 1354 595 538 528 ------
NM_017758chr1781487 149 114 107 100 82 76 62 ------
NM_017813chr8105650 4775 4678 4552 1501 996 965 689 666 263 25657 2121 ----
NM_017824chr1061762 1712 1066 738 265 202 --1190 --
NM_017994chr782783 1000 588 581 573 562 482 152 ------
NM_017998chr971183 1086 1004 998 361 250 184 11027 ----
NM_018011chr135586 102 90 84 78 ------
NM_018155chr3112961 2722 2596 2550 2400 2268 2154 1246 399 291 134 ------
NM_018227chr473160 2917 2456 1059 954 612 394 21285 579 ----
NM_018312chr1162209 2101 1997 827 815 809 --11349 --
NM_018361chr873620 2891 2716 1230 1178 818 139 --23181 1250 --
NM_018362chr11164065 3968 3910 3772 3669 3563 3169 3163 3156 2676 2664 2649 1447 1297 1181 1141 13005 --13092
NM_018374chr7105277 5245 4375 4276 4222 3701 3416 1786 1604 188 13774 1527 --
NM_018424chr931820 1567 536 1303 21363 750 1521
NM_018440chr8158698 8434 7993 7893 7801 7497 7015 5797 5549 3165 3053 2910 2786 2314 667 22440 1060 18522 --
NM_018566chr144765 3781 3243 1695 21482 981 13490 11435
NM_018638chr1265561 4866 1716 1650 1228 1209 --25444 4540 15340
NM_018717chr472846 2380 2293 2210 2162 2151 90 ------
NM_018999chr1084071 4058 3873 3267 1911 1898 1533 1460 13645 1752 11468
NM_019001chr3104509 4071 3651 3561 3362 1646 1428 989 536 206 --1581 --
NM_019022chr1873214 2840 2641 2191 2150 2102 191 1543 12261 127
NM_019027chr491757 1699 926 914 895 886 291 276 258 ------
NM_019050chr492056 1925 1825 1727 1709 1662 683 385 352 --1570 --
NM_019072chr533171 1244 294 --2348 61 14286
NM_020245chr6125016 4835 4406 4352 3969 3437 1490 1484 1478 1465 1452 794 11345 24620 3399 --
NM_020346chr1171714 1679 1586 1308 1062 221 35 1557 --1383
NM_020357chr341675 1401 1170 1152 21555 1145 1512 --
NM_020403chr1361701 661 649 529 407 195 21418 1279 11588 --
NM_020425chr672006 1583 1577 1416 1361 782 769 1267 ----
NM_020473chrX91940 1468 1408 1400 812 761 636 88 35 --11800 12002
NM_020474chr1851938 1495 766 758 646 ----1567
NM_020673chr20117753 7620 7606 7599 7310 7132 7067 5850 5805 1773 327 17779 11442 17148
NM_020718chr1696469 5723 5706 4554 4345 2140 1433 1180 88 --14799 --
NM_020727chr2194047 3981 3164 3146 2883 2791 1527 1457 1309 12659 11146 13722
NM_020734chr12103359 2341 1337 1322 1138 946 554 502 403 331 1888 33353 3324 3129 1746
NM_020772chr17168644 8390 7659 7238 7210 6661 6647 6098 6069 5968 5553 2377 2210 1983 1621 289 16926 46415 6045 3244 2842 --
NM_020774chr18156200 6118 5377 5150 4944 4411 4364 3885 2248 2157 802 555 313 195 189 45427 3819 1088 25 34570 2175 322 --
NM_020794chr141524 258 252 240 11421 ----
NM_020801chr582658 2527 2107 1626 906 886 878 432 1810 1774 --
NM_020809chr1162151 1497 1447 672 664 652 12033 ----
NM_020935chr2104616 4610 4481 3571 3420 3408 759 662 630 576 --23060 2832 23891 43
NM_020940chr1072504 2438 2336 2033 1971 992 980 --22393 2063 12156
NM_021030chr194772 264 257 250 ------
NM_021033chr13103156 3129 3107 2920 2820 2481 2299 1256 594 200 --12531 1683
NM_021038chr362328 2155 1267 734 516 229 12538 13322 --
NM_021097chr263073 2795 2510 354 300 86 1347 1283 --
NM_021148chr762524 2118 826 395 325 313 ----11962
NM_021183chrX72562 2491 991 624 611 525 477 ----11025
NM_021252chr1071885 1877 1788 1717 1572 1283 837 21971 1348 21545 559 --
NM_021813chr6154559 4284 4278 4272 2245 2232 2135 1972 1961 815 809 803 793 775 767 12343 15296 --
NM_021961chr11147230 7154 6827 6738 6261 6188 6131 5964 5954 5245 5057 4974 4772 655 12714 --17121
NM_021964chr355609 5478 2142 1663 1288 11499 26330 4180 --
NM_022048chr15116259 6230 5980 5913 4911 4639 4611 4588 4580 1902 746 ------
NM_022080chr20102192 2142 2115 2104 1960 1855 667 329 283 99 1482 ----
NM_022459chr13146129 6033 5692 5488 5387 4930 4855 4787 4503 3915 2489 2430 852 670 --34875 1876 931 --
NM_022841chr1552678 765 661 373 56 --11998 1824
NM_022898chr14134814 4790 4607 4543 4484 4246 3039 1863 1394 667 606 337 315 ------
NM_023929chr872559 2417 2271 1778 1091 436 419 12210 1969 --
NM_024408chr1123646 3623 3161 3087 2928 2887 2747 2721 1247 1067 854 223 ----13699
NM_024496chr149777 703 659 636 626 580 562 554 229 ------
NM_024539chrX61286 1233 1164 1114 1101 1082 ------
NM_024611chr1583921 3903 3739 3513 3347 1565 607 433 --22689 2631 --
NM_024613chr8101863 1698 1674 1640 1422 715 548 285 234 92 ------
NM_024665chr3154603 4335 4253 3830 3821 3340 1334 1020 1005 999 794 763 755 462 416 13455 23049 2875 --
NM_024721chr842680 1825 842 664 12517 --2988 447
NM_024930chr592820 2792 2441 806 278 264 226 220 214 --42526 730 637 208 --
NM_024947chr3149403 8706 8054 7672 6982 6670 6309 5803 3820 3372 2945 1525 1459 1215 29479 8872 39360 5887 2335 --
NM_024989chr2125911 5830 5695 5551 5257 2172 2149 2102 1744 1618 904 183 --37772 6501 5167 --
NM_025191chr172452 1354 1342 1282 1142 1136 986 12872 23107 1423 --
NM_030621chr1443086 2791 315 250 13145 --23250 3109
NM_030647chr796277 6109 6088 5905 4821 1598 999 278 95 --11104 --
NM_030755chr1473078 2387 2381 2371 2229 757 63 --1262 --
NM_030806chr169413 8159 8094 2485 1426 220 43415 2964 1369 996 12447 --
NM_030816chr153077 2289 914 531 475 1723 2704 292 11046
NM_031296chr482725 2339 2328 1827 564 431 160 120 1588 12350 --
NM_031435chr1273207 2266 1407 836 517 258 124 12845 32997 2436 807 --
NM_032116chr13145865 5745 5734 5332 5002 4446 4428 3933 1844 1382 1168 756 418 36 15385 25220 4674 --
NM_032121chrX52522 2464 2272 642 299 12347 --12751
NM_032145chr631695 1321 1228 31853 1826 651 31880 1424 335 1434
NM_032199chr10103653 2729 2500 1103 894 736 692 686 670 282 13164 22628 2409 --
NM_032228chr1183430 3069 2682 2620 2390 2206 485 451 ------
NM_032373chr1055316 1916 1756 1737 222 35924 1743 1223 146 --
NM_032410chr85914 397 225 163 97 --1934 21145 1093
NM_032440chr1052272 2169 1101 321 311 12152 22626 351 --
NM_032458chrX93392 3354 3266 2961 2801 758 671 483 423 12814 --12263
NM_032505chr382558 2481 2438 2131 1932 1796 1790 957 --12230 12185
NM_032859chr1363525 3034 2635 790 568 39 23829 702 13929 --
NM_032884chr14339 299 293 287 ------
NM_032968chrX114068 3467 2877 869 624 565 506 484 421 291 92 11093 2326 179 1752
NM_032969chrX114068 3467 2877 869 624 565 506 484 421 291 92 11093 2326 179 1752
NM_032973chrY114060 3463 2872 869 624 565 506 484 421 291 92 11093 2326 179 1752
NM_033020chr194400 4121 3750 1583 1478 1425 1079 977 812 ------
NM_033143chr453504 1020 874 752 742 1733 21592 464 --
NM_033224chr7128084 7592 7491 7172 6483 6389 6210 4981 3138 2901 2503 1845 13083 11180 --
NM_033285chr884299 4072 3438 3150 2784 2777 1119 38 --13917 1792
NM_033360chr1284605 3894 3784 3565 1796 1310 623 132 --23430 202 --
NM_033389chr1794572 4007 3929 3919 3655 3643 1168 1150 41 ------
NM_033430chr443869 3157 2559 262 --21338 196 21400 508
NM_033437chr443869 3157 2559 262 --21338 196 21400 508
NM_033505chr2106663 5669 5416 4369 1837 1801 1273 911 538 312 11671 24163 2290 --
NM_033551chr583445 2904 2464 2458 2452 2446 882 530 ------
NM_052811chr1385145 5056 4751 4477 1566 1319 935 199 25117 33 ----
NM_052879chr1294066 3427 3098 3030 2545 1516 1091 946 268 --24073 3981 1876
NM_052937chr842238 1077 462 304 11985 --164
NM_053042chr493158 3125 2645 2236 1230 439 424 401 290 23191 2690 ----
NM_058237chr1461006 804 699 325 117 90 --1964 --
NM_078487chr933316 2993 2492 13003 --23176 2180
NM_080676chr2043219 3022 1311 151 13178 33303 2253 575 13278
NM_080759chr1392516 2290 1890 1848 1801 1038 961 318 216 12058 ----
NM_080760chr1392516 2290 1890 1848 1801 1038 961 318 216 12058 ----
NM_130391chr963231 3103 2905 2357 1187 838 11196 --13593
NM_130392chr963231 3103 2905 2357 1187 838 11196 --13593
NM_130393chr963231 3103 2905 2357 1187 838 11196 --13593
NM_133334chr485280 5100 4503 4349 2054 1155 922 352 16339 15442 --
NM_133372chr532946 2739 2341 --2977 785 1443
NM_133496chr1144100 3835 3367 2904 2895 2887 2811 1441 672 556 317 307 301 278 1546 ----
NM_133646chr285578 5417 5094 1330 1228 1064 327 251 ----14598
NM_138448chr2------2412 396
NM_138576chr14134814 4790 4607 4543 4484 4246 3039 1863 1394 667 606 337 315 ------
NM_138713chr16148242 8147 6848 5259 3248 3124 2484 2104 2096 2002 1707 1686 1656 374 25626 2161 ----
NM_138714chr16148242 8147 6848 5259 3248 3124 2484 2104 2096 2002 1707 1686 1656 374 25626 2161 ----
NM_138731chr1433748 3627 629 1527 23242 577 13791
NM_138771chr741558 1552 1546 1035 1477 2410 182 --
NM_138959chr196732 6426 6396 5675 1826 598 520 513 438 --25313 2682 --
NM_139207chr1231809 802 787 1423 31472 781 154 --
NM_139281chr573507 3435 2817 2682 1186 1032 331 ----22705 2643
NM_139283chr1262292 2045 1691 930 665 158 41999 596 509 478 ----
NM_144571chr4126415 5927 5465 5053 4449 2682 2282 2149 1851 1601 1532 1146 15272 2631 316 --
NM_144578chr1464772 4711 4586 1164 813 676 --35003 1202 288 24280 1740
NM_144599chr1585161 5030 4847 4081 3420 2009 1251 1017 14370 14310 --
NM_144664chr1161928 1895 767 740 364 353 --2891 542 --
NM_144767chr15104499 4438 3429 1637 1631 1623 1592 1315 658 213 --11606 13220
NM_144778chr1362703 2455 2407 2072 1866 1800 11954 11791 --
NM_144963chr862583 2443 2085 1776 1689 809 22176 378 ----
NM_144973chr1235349 2127 1356 1929 44961 3637 1972 1041 --
NM_144979chr43592 41 31 1564 --1571
NM_145055chr18113711 3470 3459 3315 2829 1351 1345 1330 1314 112 103 13124 13070 --
NM_145259chr255299 5145 4875 828 89 12829 --25093 944
NM_152265chr13269 262 138 ----21342 404
NM_152388chr282754 1174 553 444 187 92 52 40 --13061 --
NM_152557chr751365 1126 264 257 250 ------
NM_152622chr543433 2952 2671 973 11067 13474 22834 2538
NM_152624chr597435 7175 6849 6763 5992 5053 4625 2617 809 12737 26589 5339 --
NM_152638chr1241038 918 907 333 1926 11197 --
NM_152678chr362561 2275 2262 1977 1919 1887 ----12588
NM_152688chr65849 697 674 384 96 ----2607 345
NM_152756chr5144266 4230 4106 3779 1369 1242 1185 1173 1141 1077 664 539 195 50 23413 414 ----
NM_152758chr852970 2519 737 719 401 12851 --1330
NM_152838chr20113518 2839 2633 2603 2295 661 621 599 579 307 255 32215 1024 436 ----
NM_153188chr595647 4932 4748 3855 2137 1925 1418 1040 983 23514 2113 11587 --
NM_153207chr1294082 3918 3282 2873 2807 1107 586 545 430 --13533 --
NM_153262chr143152 2472 1049 432 --23079 2632 12213
NM_153810chr1074735 3294 1516 508 377 370 151 14699 ----
NM_170606chr791854 1768 1751 1410 1397 1211 289 278 95 --11697 --
NM_170731chr1172578 887 666 579 554 246 53 12538 22258 2172 --
NM_170732chr1172578 887 666 579 554 246 53 12538 22258 2172 --
NM_170733chr1172578 887 666 579 554 246 53 12538 22258 2172 --
NM_170734chr1172578 887 666 579 554 246 53 12538 22258 2172 --
NM_170735chr1172578 887 666 579 554 246 53 12538 22258 2172 --
NM_172071chr1187260 6748 6479 6469 6340 5946 5722 4644 2995 2508 2491 2022 1931 1024 652 411 255 45 27294 5643 45716 5032 2988 249 --
NM_173214chr16148242 8147 6848 5259 3248 3124 2484 2104 2096 2002 1707 1686 1656 374 25626 2161 ----
NM_173468chr4105928 5333 5293 4617 4081 2395 2126 1901 565 76 167 11631 --
NM_173511chr253745 2490 736 716 276 13847 23319 1190 --
NM_173582chr1196271 4680 4499 4018 2233 2201 2156 1970 685 35489 4234 4116 12056 --
NM_173829chr595883 5366 4964 4166 1688 978 669 265 234 25866 5806 35748 1751 40 14229
NM_174911chr893782 3679 3671 3622 3547 2944 1151 824 430 11308 13600 --
NM_175624chr12127408 6910 6274 6240 4929 4838 4832 4757 4741 1821 1408 954 ----27816 6035
NM_175625chr12127408 6910 6274 6240 4929 4838 4832 4757 4741 1821 1408 954 ----27816 6035
NM_175861chr1295622 5122 4908 4620 4524 3697 1081 1016 262 25870 4460 42353 2122 1824 1665 --
NM_177438chr1443086 2791 315 250 13145 --23250 3109
NM_177538chr272541 2382 2249 1671 353 244 117 28793 3064 ----
NM_178154chr143523 517 511 ------
NM_178155chr143523 517 511 ------
NM_178156chr143523 517 511 ------
NM_178157chr143523 517 511 ------
NM_178585chr493208 3041 2856 2635 2407 2106 1190 1084 523 --22664 1241 --
NM_178815chr1062591 2484 1814 1689 967 288 --31970 682 453 --
NM_181358chr1114187 4055 3776 3658 3617 2880 2749 1325 578 541 478 1683 22914 1026 --
NM_181443chr2052699 2057 1039 911 104 11104 2635 531 --
NM_181481chr18116807 6349 5577 5520 5109 4982 4922 1983 1837 473 136 27013 2695 --16541
NM_181482chr18116807 6349 5577 5520 5109 4982 4922 1983 1837 473 136 27013 2695 --16541
NM_181483chr18116807 6349 5577 5520 5109 4982 4922 1983 1837 473 136 27013 2695 --16541
NM_181504chr593213 3185 2709 1548 1515 1094 887 779 751 2936 920 ----
NM_181523chr593213 3185 2709 1548 1515 1094 887 779 751 2936 920 ----
NM_181524chr593213 3185 2709 1548 1515 1094 887 779 751 2936 920 ----
NM_182485chr483731 3193 2961 2809 2533 2502 2453 1020 12778 1861 --
NM_182515chr1984898 2660 2510 2043 1712 1496 1227 649 --14326 --
NM_182646chr483731 3193 2961 2809 2533 2502 2453 1020 12778 1861 --
NM_182898chr786560 6445 6342 6330 6324 6306 2554 447 ------
NM_182899chr786560 6445 6342 6330 6324 6306 2554 447 ------
NM_182972chr192801 2351 2018 1914 981 970 886 667 336 1214 ----
NM_194071chr7104946 4567 4175 3371 1672 1463 1299 1201 895 881 14573 ----
NM_194247chr294406 4071 3511 2752 1562 1167 687 631 393 14060 22785 1387 24161 1768
NM_194291chr872940 2501 2441 2431 2352 2183 1187 ----22676 322
NM_194314chr195432 4869 4663 1705 1416 1363 1009 632 72 --14105 --
NM_194434chr18115084 4987 4046 3810 3539 1930 1917 1515 1228 815 625 15625 162 --
NM_194463chrX61286 1233 1164 1114 1101 1082 ------
NM_198066chr1442793 2129 411 74 12865 --1694
NM_198181chr156755 250 220 190 132 102 --32104 706 163 --
NM_198268chr1114187 4055 3776 3658 3617 2880 2749 1325 578 541 478 1683 22914 1026 --
NM_198269chr1114187 4055 3776 3658 3617 2880 2749 1325 578 541 478 1683 22914 1026 --
NM_198395chr521032 118 21178 928 1859 1940
NM_198401chr861254 704 592 408 396 57 11138 21627 627 --
NM_198581chr2107148 6913 4849 3003 2520 1721 1605 1178 559 418 17034 24837 1623 --
NM_198715chr1115613 5517 5326 4961 4358 4234 2441 1076 649 383 219 16067 25830 632 --
NM_198793chr3103992 3765 3601 3521 2838 1536 1514 1269 1255 239 13357 ----
NM_198859chr375154 4312 3657 2010 1997 1869 1397 --1369 25034 595
NM_199188chr1294066 3427 3098 3030 2545 1516 1091 946 268 --24073 3981 1876
NM_199190chr1294066 3427 3098 3030 2545 1516 1091 946 268 --24073 3981 1876
NM_199320chr452896 2682 2031 492 177 --12471 12595
NM_199320chr452896 2682 2031 492 177 --12471 12595
NM_199327chr46765 279 79 73 67 61 ------
NM_199436chr272917 2847 1139 787 311 195 125 --21169 376 --
NM_203487chr1361701 661 649 529 407 195 21418 1279 11588 --
NM_206855chr6106353 6070 5292 4082 3849 1796 1310 1052 355 111 15933 24227 4021 --
NM_206876chr282643 2337 1450 1384 960 717 400 394 ----137
NM_206907chr583296 2610 2305 1342 503 414 194 73 1971 11278 --
NM_206909chr8118297 8047 8014 7670 7515 5757 5635 5239 2955 1175 745 1145 22018 1553 --
NM_207171chr172033 1587 728 402 358 334 165 ----11551
NM_207292chr362328 2155 1267 734 516 229 12538 13322 --
NM_207293chr362328 2155 1267 734 516 229 12538 13322 --
NM_207294chr362328 2155 1267 734 516 229 12538 13322 --
NM_207295chr362328 2155 1267 734 516 229 12538 13322 --
NM_207296chr362328 2155 1267 734 516 229 12538 13322 --
NM_207297chr362353 2180 1292 759 541 254 12563 13347 --
NM_207304chr1362590 2342 2294 1959 1753 1687 11841 11678 --
NM_207406chr4125788 5644 5634 5459 4670 2548 2281 1655 1516 1467 1007 775 --25422 1131 16459
NM_212558chr921015 973 --21024 827 13719
NM_213590chr1385145 5056 4751 4477 1566 1319 935 199 25117 33 ----
NM_213606chr1042678 2232 349 209 1129 --1778