TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-708-3p
miRNA Sequence: CAACUAGACUGUGAGCUUCUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX23042 1377 13345 1483 13338
NM_000055chr31325 ------
NM_000081chr12753 194 ------
NM_000084chrX65225 4282 2258 2209 2188 562 21567 1525 14678 --
NM_000088chr171170 ------
NM_000108chr72768 185 1717 11602 11798
NM_000138chr152536 174 --1915 --
NM_000141chr1011009 ------
NM_000161chr1461833 1826 1383 1305 649 438 ------
NM_000163chr542321 957 654 244 --12130 --
NM_000165chr641722 1206 1187 1066 ------
NM_000168chr792999 1208 1179 1127 959 920 873 538 290 --186 --
NM_000176chr543853 2872 621 543 1236 33315 3140 519 11535
NM_000189chr252357 2321 1913 1895 1751 --32008 812 736 --
NM_000212chr17----21840 1703 11996
NM_000216chrX54095 3768 3131 1045 128 --13244 --
NM_000237chr8--1151 ----
NM_000248chr332207 2017 522 --12754 1606
NM_000259chr1552262 2142 1686 498 467 15806 25592 1705 11613
NM_000264chr933213 1234 87 12851 --11149
NM_000267chr1763151 2829 2689 2465 754 227 ------
NM_000291chrX2300 220 ------
NM_000297chr421922 789 ------
NM_000317chr111324 ------
NM_000321chr1341805 1579 1435 1165 ------
NM_000332chr665937 2381 2190 2164 1001 862 --36375 6175 5745 16437
NM_000338chr15------1932
NM_000345chr41788 ----11007
NM_000346chr172551 450 ------
NM_000368chr974290 4204 3318 1892 1818 1350 483 --34548 1810 445 14650
NM_000388chr31132 11297 ----
NM_000390chrX43107 2936 1172 596 --12876 12834
NM_000408chr22765 250 11305 --21051 627
NM_000411chr21--22914 697 1215 --
NM_000448chr1132353 2078 193 1748 12688 --
NM_000461chr314324 11101 21757 1626 1435
NM_000462chr1521663 675 ------
NM_000489chrX52876 2588 908 699 132 --11170 12752
NM_000493chr6------2755 210
NM_000495chrX1706 ------
NM_000536chr111538 ----1120
NM_000545chr1211294 ------
NM_000555chrX85937 5375 5099 4778 2956 2194 1911 1905 --15536 --
NM_000609chr10----1193 --
NM_000617chr1212276 ------
NM_000618chr12126639 6602 6402 5194 4815 4204 2422 2213 1762 1529 1176 896 12115 ----
NM_000618chr12126639 6602 6402 5194 4815 4204 2422 2213 1762 1529 1176 896 12115 ----
NM_000633chr1814453 --24344 3354 25241 1856
NM_000663chr1622752 61 ------
NM_000702chr142211 2066 2022 499 ------
NM_000724chr1021322 754 ------
NM_000745chr152254 97 ----134
NM_000767chr1931210 593 398 --21323 966 --
NM_000780chr82209 90 ------
NM_000806chr551665 1561 1328 1235 673 ------
NM_000810chr151404 ------
NM_000813chr55849 829 513 271 119 --25324 4120 --
NM_000814chr1574038 3525 3474 610 563 536 494 1460 1433 --
NM_000816chr51576 ------
NM_000818chr10--1344 ----
NM_000844chr311023 ------
NM_000859chr531642 1223 202 --11727 --
NM_000875chr15107044 7020 5894 5540 5143 4720 2387 2306 889 669 --35970 5631 1501 --
NM_000877chr242964 2861 2679 2422 1624 ----
NM_000899chr1253429 2783 1573 985 665 ----21120 1074
NM_000901chr452487 2205 654 338 272 --12194 --
NM_000922chr111781 ----1835
NM_000944chr432295 2047 656 ------
NM_000945chr221414 731 --32022 1971 707 --
NM_000949chr5--2785 224 ----
NM_000950chrX33197 2543 1127 --23047 146 1951
NM_000965chr331138 946 89 3800 313 238 ----
NM_001001132chr2141473 1168 934 183 1281 ----
NM_001001323chr1252282 2276 1284 1143 1048 --22064 591 --
NM_001001394chr21642 ------
NM_001001395chr1242180 568 464 385 ------
NM_001001396chr134099 3857 3389 --1978 --
NM_001001419chr534243 1948 1896 13856 22090 1007 --
NM_001001420chr534243 1948 1896 13856 22090 1007 --
NM_001001521chr22211 39 ------
NM_001001664chr243972 3578 1407 599 ------
NM_001001668chr1933343 1451 1120 13893 11274 --
NM_001001715chr13----2456 405 --
NM_001001971chr102341 110 ------
NM_001002257chr243526 2173 1382 758 13150 21102 683 --
NM_001002838chrX11394 --11375 --
NM_001003652chr18158581 8516 8457 7734 7310 6421 6245 5969 5642 5584 2714 2314 1439 1376 1115 --26198 365 --
NM_001003674chr18116607 6310 5928 5922 5380 4371 2775 1977 1569 1160 199 27017 5407 26735 6689 15751
NM_001003675chr18116607 6310 5928 5922 5380 4371 2775 1977 1569 1160 199 27017 5407 26735 6689 15751
NM_001003712chr1253504 3452 3172 2546 821 ------
NM_001003792chr341139 984 465 133 ------
NM_001003793chr341139 984 465 133 ------
NM_001004065chr922526 808 --23889 247 13730
NM_001004125chr921063 252 11251 3813 807 423 --
NM_001004317chr644245 3570 3358 1174 --23580 2863 12819
NM_001004329chr1251399 1144 451 342 148 ----11010
NM_001005375chrY31603 281 127 --2229 108 --
NM_001005404chr1743919 3478 639 151 14091 43672 3545 619 236 --
NM_001005473chr566167 5039 4219 2249 470 224 15206 14047 16513
NM_001005474chr3--11559 1128 --
NM_001005845chr841858 1770 1608 28 1766 ----
NM_001006600chr522013 774 --11846 12308
NM_001006605chr12935 810 ----11194
NM_001006605chr12935 810 ----11194
NM_001007067chr841113 764 745 202 --1379 --
NM_001007068chr841113 764 745 202 --1379 --
NM_001007069chr841113 764 745 202 --1379 --
NM_001007070chr841113 764 745 202 --1379 --
NM_001007237chr142560 444 299 249 --1365 --
NM_001007246chr2151946 1852 1591 773 757 --21665 787 --
NM_001007257chr1--11241 ----
NM_001007267chr22840 653 ----1638
NM_001007466chr644958 1950 932 877 ----11771
NM_001007559chr1821796 179 --1103 1165
NM_001008225chr7----1521 --
NM_001008239chr1833721 3338 653 11183 43665 3188 3050 808 --
NM_001008392chr31468 ------
NM_001008401chr1921423 355 ------
NM_001008495chr851866 1757 1441 247 119 1521 21777 1750 --
NM_001008738chr552809 2217 1978 446 389 ----1476
NM_001008744chr141192 ------
NM_001008777chr171242 ------
NM_001008801chr1932103 1639 719 ------
NM_001008897chr61179 ------
NM_001008925chr443363 3111 2526 418 --1530 12424
NM_001009552chr81198 ------
NM_001009555chr43534 268 236 ----1373
NM_001009955chr1----1170 --
NM_001009955chr1----1170 --
NM_001009959chr252397 2010 1007 423 372 1942 12041 --
NM_001009960chr71384 ------
NM_001009993chr283742 3667 3654 3224 2928 2781 1640 647 13421 2550 285 --
NM_001010854chr141263 ------
NM_001010861chr122527 2443 1387 1301 --
NM_001010867chr176653 6513 6278 6108 2158 922 117 12673 35876 2468 889 --
NM_001010888chrX64313 4306 4175 4109 3779 590 23150 1136 ----
NM_001010891chr5126667 5465 5259 4471 2678 2395 2367 2232 1155 907 586 387 24367 802 36724 4477 704 --
NM_001010922chr173927 3325 3292 2871 1579 1166 663 11386 12812 --
NM_001010927chr62382 218 ------
NM_001010971chr1----155 --
NM_001010984chr162548 2409 1047 934 905 75 --11863 11833
NM_001010986chrX42309 1815 1799 1546 ----1229
NM_001011513chr463809 3639 3516 3030 2934 856 11546 12526 --
NM_001011515chr44990 716 325 179 ------
NM_001011516chr44990 716 325 179 ------
NM_001011537chr341773 1668 629 583 1810 ----
NM_001011553chr73620 303 33 ------
NM_001011663chr101312 ------
NM_001011666chr732042 1019 245 1167 25859 2511 1894
NM_001011708chr221847 838 12598 22715 2495 --
NM_001011713chr1431443 410 93 11248 1612 --
NM_001011724chr13----1207 --
NM_001011725chr13----1207 --
NM_001011885chr152541 250 --1135 11597
NM_001012410chr3138 ------
NM_001012755chrX44922 4342 1360 50 --44889 4368 3867 1815 --
NM_001012756chr1932647 2513 250 --1874 --
NM_001012979chrX1170 ------
NM_001013438chr31173 ----1811
NM_001013439chr3------1657
NM_001013703chr151449 ------
NM_001013843chr151630 ------
NM_001014380chr1385167 3613 1429 1318 1111 1017 662 27 11941 ----
NM_001014797chr1067269 1905 1653 1038 951 618 27461 1692 21227 766 --
NM_001014831chr191798 ------
NM_001014832chr191798 ------
NM_001014834chr191798 ------
NM_001014835chr191798 ------
NM_001015877chrX23072 346 --11198 --
NM_001015882chr91249 ----1278
NM_001017369chr41945 ------
NM_001017371chr21316 ------
NM_001017923chr1471586 1181 1131 519 511 475 111 --11406 --
NM_001017967chr161930 ------
NM_001017969chr91594 ------
NM_001018037chr9----2972 383 11194
NM_001018038chr93444 170 48 --1148 --
NM_001018074chr543853 2872 621 543 1236 33315 3140 519 11535
NM_001018075chr543853 2872 621 543 1236 33315 3140 519 11535
NM_001018076chr543853 2872 621 543 1236 33315 3140 519 11535
NM_001018077chr543853 2872 621 543 1236 33315 3140 519 11535
NM_001018090chr1542231 786 376 256 ------
NM_001018091chr1542341 896 486 366 ------
NM_001018102chr1542231 786 376 256 ------
NM_001018113chrX----1126 --
NM_001020658chr131225 458 84 11180 ----
NM_001020658chr131225 458 84 11180 ----
NM_001024071chr145855 848 405 327 123 ------
NM_001024094chr543853 2872 621 543 1236 33315 3140 519 11535
NM_001024647chr1246041 2645 1800 1345 --2914 185 --
NM_001024688chr851584 1367 751 613 559 --1662 --
NM_001024948chr173084 2524 1062 1009 774 489 362 1980 ----
NM_001024956chr1185652 5360 4200 4088 3921 2211 1446 944 14008 15715 1843
NM_001025076chr1045518 5070 1806 65 13775 1187 --
NM_001025077chr1066876 6428 4873 1423 1319 636 15133 31545 1102 665 --
NM_001025079chr363034 2636 2627 1366 798 124 21181 158 --1190
NM_001025108chr253131 2693 1376 1240 33 1420 33015 1305 238 --
NM_001025266chr354162 3892 1759 237 60 --13352 11021
NM_001025580chrX53916 1707 1681 1161 867 1719 33900 640 458 --
NM_001025595chr411652 --21328 1231 --
NM_001025596chr111483 ------
NM_001025780chr911091 ------
NM_001029858chr623176 2261 --23088 2774 --
NM_001029875chr532488 1890 547 --12074 1940
NM_001030007chr1653224 2991 2463 2444 541 --12741 --
NM_001030055chr1474719 4573 4527 4458 3658 3615 853 --34431 4248 2987 34449 4190 3518
NM_001031695chr2274388 4289 1617 1035 499 483 419 13388 24046 520 22114 1696
NM_001031723chr41390 ----1197
NM_001031732chr433491 1148 1072 ------
NM_001031804chr1654413 3532 1469 853 76 --22939 1488 --
NM_001032393chrX184 ------
NM_001032394chr622353 868 22072 766 22404 1053 --
NM_001032395chr622220 735 21939 633 22271 920 --
NM_001032730chr11679 ------
NM_001032999chr2054905 3345 3255 1540 249 --35345 5233 691 --
NM_001033025chr111158 --11356 --
NM_001033030chr3190 ------
NM_001033031chr3190 ------
NM_001033032chr3190 ------
NM_001033045chr253405 2908 483 264 56 ----13575
NM_001033047chr432014 977 489 --1707 --
NM_001033057chr3--1340 21762 76 --
NM_001033085chr21267 --1125 --
NM_001033117chr354881 4752 3211 1357 1090 13120 13388 --
NM_001033557chr21374 2530 203 11153 --
NM_001033566chr17----1739 --
NM_001033568chr17----1739 --
NM_001033576chr1712558 1717 ----
NM_001033602chr1342641 1973 1884 434 1294 ----
NM_001033659chr1711472 ------
NM_001033925chr1011844 12185 1168 --
NM_001034841chr1644980 4577 1959 137 --15152 --
NM_001034954chr1012514 --171 --
NM_001034955chr1012514 --171 --
NM_001034956chr1012514 --171 --
NM_001034957chr1012514 --171 --
NM_001035003chr431308 1088 561 ------
NM_001035004chr431308 1088 561 ------
NM_001035507chr2156 ------
NM_001037164chr731721 653 44 ------
NM_001037172chr31955 --168 --
NM_001037174chr232063 339 191 ------
NM_001037317chr122527 2443 1387 1301 --
NM_001037339chr11459 ------
NM_001037340chr11459 ------
NM_001037341chr11459 ------
NM_001037341chr11459 ------
NM_001037954chr114713 662 627 176 --22623 101 --
NM_001038493chr2----11493 --
NM_001039199chr20105018 4974 4692 4154 3413 3077 1663 1193 707 651 --1305 1921
NM_001039538chr233635 3625 1013 ------
NM_001039569chr21312 --1423 12829
NM_001039580chr454941 4438 4432 4097 3850 33705 749 504 23513 992 --
NM_001039585chr123261 186 1329 ----
NM_001039590chrX32520 1225 21 --33577 3030 2874 --
NM_001039591chrX32520 1225 21 --33577 3030 2874 --
NM_001039618chr1185857 5718 4559 4010 3991 3961 3612 1805 25576 4403 34522 799 486 22064 905
NM_001039693chr243642 1597 940 37 11073 12772 --
NM_001039709chr2054905 3345 3255 1540 249 --35345 5233 691 --
NM_001039762chr10----11586 --
NM_001039771chr141854 ------
NM_001039840chrX95771 5591 4455 4260 2304 2290 1728 1476 491 --34559 1231 1079 --
NM_001039937chr1353479 3469 2891 1474 1238 ----13086
NM_001040100chr31493 --2270 173 --
NM_001040108chr1472492 2351 2335 2171 2123 2035 175 12572 12040 1578
NM_001040135chr7----1704 --
NM_001040157chr432653 2214 667 ----12523
NM_001040202chr442342 1017 228 89 --1582 --
NM_001040284chr16115911 5566 5506 3852 3806 3698 1946 1006 846 668 613 --25212 4641 25684 4315
NM_001040402chr453184 2857 2548 658 358 --22776 921 --
NM_001040424chr2122148 1195 --1797 --
NM_001040429chr1363448 2911 2786 2509 778 125 13299 ----
NM_001040450chr1542626 605 533 368 1147 ----
NM_001040453chr1542626 605 533 368 1147 ----
NM_001040458chr51157 ------
NM_001040624chr842062 846 806 636 ------
NM_001040625chr842062 846 806 636 ------
NM_001040626chr842062 846 806 636 ------
NM_001040627chr842062 846 806 636 ------
NM_001040628chr842062 846 806 636 ------
NM_001040629chr842062 846 806 636 ------
NM_001040630chr842062 846 806 636 ------
NM_001040665chr765053 4004 3301 1810 799 199 14790 ----
NM_001040708chr82357 215 ------
NM_001040712chr921237 510 12865 32354 999 503 12417
NM_001041chr3----121 --
NM_001042355chr1633962 3450 337 --35037 3641 620 --
NM_001042403chr121755 --1860 --
NM_001042406chr631144 953 282 ------
NM_001042412chr1633962 3450 337 --35037 3641 620 --
NM_001042413chr973605 3047 1417 937 915 866 772 1635 1205 --
NM_001042453chrX21346 232 --21216 317 --
NM_001042459chr31225 ------
NM_001042473chr1041606 1392 800 88 --1129 --
NM_001042481chr141860 --1322 --
NM_001042492chr1763151 2829 2689 2465 754 227 ------
NM_001042494chr1553626 2948 2460 1081 517 13075 13587 --
NM_001042495chr1553626 2948 2460 1081 517 13075 13587 --
NM_001042496chr1553626 2948 2460 1081 517 13075 13587 --
NM_001042497chr1553626 2948 2460 1081 517 13075 13587 --
NM_001042550chr921337 495 11551 ----
NM_001042555chr1251776 1764 1645 1272 274 --34508 4280 964 --
NM_001042599chr2127695 7563 7242 6806 6177 5529 4876 3056 2792 2448 1390 71 --16392 16422
NM_001042604chr344236 3966 3448 741 --24458 1193 --
NM_001042616chr4----184 --
NM_001042683chr631873 112 31 11285 1356 1139
NM_001042749chrX41473 1242 365 253 ------
NM_001042750chrX41473 1242 365 253 ------
NM_001042751chrX41473 1242 365 253 ------
NM_001044305chr61464 --21092 64 --
NM_001046chr582887 1965 1209 1023 924 480 423 184 --12632 --
NM_001099678chr345757 5492 5400 4550 14448 --14463
NM_001106chr3157653 7275 7113 6880 6614 6450 6318 3487 3390 2746 2065 1505 1262 713 536 --79155 7099 7048 3007 2658 1727 1137 15944
NM_001113490chrX43612 2603 1014 881 11468 ----
NM_001117chr1872274 2258 2149 2110 2061 953 612 ----12230
NM_001121chr102641 218 --1702 --
NM_001123chr101308 ------
NM_001126chr141091 826 658 266 ------
NM_001128chr1653224 2991 2463 2444 541 --12741 --
NM_001143chrY----143 --
NM_001148chr421688 1514 12175 1315 --
NM_001159chr2----1714 --
NM_001167chrX76472 5794 5783 2261 2215 2032 1212 --44572 2410 974 144 --
NM_001173chr1474719 4573 4527 4458 3658 3615 853 --34431 4248 2987 34449 4190 3518
NM_001177chr1232448 1663 1552 1871 31994 626 162 --
NM_001186chr214738 602 268 111 --1422 --
NM_001198chr622385 1784 ----1521
NM_001200chr20----1247 --
NM_001204chr296776 5682 3082 2769 2109 1421 440 408 220 25604 4696 21655 831 --
NM_001206chr922910 2141 ----11055
NM_001237chr41944 ------
NM_001237chr41944 ------
NM_001253chr61223 --1251 --
NM_001259chr7105881 5434 4105 1684 1667 1534 904 729 695 161 15371 12331 --
NM_001263chr41479 ------
NM_001284chr51462 ------
NM_001293chr111460 ------
NM_001298chr22502 376 11295 ----
NM_001310chr1232553 1889 1055 --32925 2063 1121 1680
NM_001316chr201167 ------
NM_001331chr1122651 281 ------
NM_001332chr521171 1114 --194 --
NM_001346chr332745 1763 761 --1439 --
NM_001356chrX42421 2401 1783 577 --12176 --
NM_001364chr1123829 3269 11145 24697 1333 11095
NM_001390chr1823198 787 1337 1858 --
NM_001400chr121245 179 --1392 --
NM_001412chrX11204 11244 11198 --
NM_001419chr1954549 4452 3009 1488 963 --2389 383 11580
NM_001427chr711611 --11962 --
NM_001432chr453535 3334 2793 2403 382 146 12871 --
NM_001438chr131173 867 297 --22860 412 189
NM_001439chr111158 --11356 --
NM_001448chrX2261 133 --1516 --
NM_001482chr153931 746 139 ------
NM_001498chr611310 11118 1894 1902
NM_001530chr142172 123 ------
NM_001541chr11----1164 --
NM_001542chr142560 444 299 249 --1365 --
NM_001584chr111978 ------
NM_001609chr1042974 985 444 426 14377 31369 811 579 --
NM_001616chr243075 3054 2395 500 ------
NM_001620chr112718 544 ------
NM_001621chr782879 2824 2562 2293 434 401 43 26 --1772 --
NM_001621chr782879 2824 2562 2293 434 401 43 26 --1772 --
NM_001649chrX32287 2230 717 --22260 183 12208
NM_001650chr1833574 1393 999 ----1257
NM_001655chr1131754 707 530 11984 ----
NM_001656chr531298 1269 454 21841 1613 ----
NM_001663chr1452068 2023 1973 1100 482 --12352 --
NM_001682chr1251996 1990 998 857 762 --21778 305 --
NM_001684chr133816 3574 3106 --1695 --
NM_001690chr342418 2346 797 189 ----1254
NM_001695chr863800 2720 969 828 391 89 --23246 1500 --
NM_001701chr941572 1360 535 428 ------
NM_001706chr31322 --1793 --
NM_001709chr1122763 875 --1597 --
NM_001714chr12----1539 --
NM_001717chr151455 ----11451
NM_001730chr13------11096
NM_001730chr13------11096
NM_001742chr71301 --11410 --
NM_001759chr1255269 1891 1125 1095 45 --44827 4195 929 63 --
NM_001769chr121116 ------
NM_001777chr363034 2636 2627 1366 798 124 21181 158 --1190
NM_001788chr73620 303 33 ------
NM_001792chr181274 ------
NM_001795chr16----11472 --
NM_001797chr161683 ------
NM_001798chr1241154 750 740 127 1249 11125 --
NM_001810chr201115 ------
NM_001839chr12186 29 ------
NM_001855chr91608 ------
NM_001895chr201845 --1292 1880
NM_001920chr121298 ------
NM_001938chr121684 1507 ------
NM_001942chr1841469 1324 731 720 --11457 --
NM_001946chr121753 ------
NM_001951chr8----1105 --
NM_001994chr1----1184 --
NM_002006chr425821 5397 15610 ----
NM_002009chr1562216 1943 502 252 219 98 ----12345
NM_002015chr1363157 2469 2435 2085 1039 947 --42982 2976 2598 101 --
NM_002024chrX1479 --1253 11539
NM_002025chrX69059 6892 2983 2376 1764 1388 28393 524 39045 7308 2311 25772 5731
NM_002026chr21949 --1985 --
NM_002032chr111298 ------
NM_002039chr41575 --1598 1584
NM_002054chr21140 ------
NM_002069chr721665 237 --1304 --
NM_002076chr1253294 3138 3017 2777 216 ------
NM_002078chr3--126 ----
NM_002092chr434328 3817 698 --55065 3782 3427 3171 1204 --
NM_002094chr161347 ------
NM_002128chr1332379 1975 1737 22476 291 ----
NM_002135chr12162 ------
NM_002136chr12----1207 --
NM_002137chr72787 287 --22065 1671 --
NM_002140chr93993 802 491 11006 1201 --
NM_002146chr1731294 1167 1044 ----11226
NM_002158chr243743 2934 1191 78 --23264 3216 --
NM_002166chr2----1594 --
NM_002193chr2----11473 --
NM_002214chr755700 1476 1340 781 118 ------
NM_002239chr2140 --1258 --
NM_002247chr101743 --1752 1628
NM_002264chr394857 4662 3434 3338 1960 1847 1667 1450 700 --21990 649 --
NM_002267chr13----12056 11492
NM_002270chr565310 5198 4580 4467 3892 1320 24688 3844 11922 15327
NM_002285chr253131 2693 1376 1240 33 1420 33015 1305 238 --
NM_002296chr131502 1217 623 --11175 --
NM_002310chr544536 4499 1034 562 --16434 --
NM_002317chr51394 ------
NM_002356chr631936 752 76 12384 --12280
NM_002359chr1741464 1211 1021 626 1897 21276 977 --
NM_002374chr233635 3625 1013 ------
NM_002376chr141508 ------
NM_002381chr23646 278 223 --1364 --
NM_002384chr18----1948 --
NM_002387chr563806 1842 1826 1684 1656 307 24008 3704 45063 4791 4606 3304 --
NM_002399chr15----1903 --
NM_002480chr121354 ------
NM_002481chr1127885 7680 7640 7016 4895 3197 2996 1778 1638 1447 826 613 --36926 5505 5438 --
NM_002485chr851584 1367 751 613 559 --1662 --
NM_002489chr71304 ------
NM_002500chr21918 ------
NM_002515chr1432061 340 250 --11805 --
NM_002519chr1121224 165 --1968 --
NM_002527chr121295 ------
NM_002572chr111126 --1251 --
NM_002577chr343394 3160 2665 56 --31342 1337 583 --
NM_002583chr12----1570 --
NM_002600chr11459 ------
NM_002611chr171838 ------
NM_002628chr331061 786 380 ------
NM_002641chrX41904 1727 1373 107 ------
NM_002645chr1112846 1790 ----
NM_002655chr864037 4006 3543 3333 830 71 ------
NM_002667chr6----1311 --
NM_002717chr82628 41 ------
NM_002721chr9----1387 --
NM_002732chr91460 ------
NM_002734chr1732104 623 520 ----11906
NM_002737chr1775739 4856 2473 1648 1622 1505 661 --11127 --
NM_002748chr151108 ------
NM_002753chr4----2749 348 --
NM_002763chr1----1211 --
NM_002822chr1231811 53 31 --11733 --
NM_002834chr1254037 3865 3533 839 341 ------
NM_002837chr1243221 1115 888 595 --13749 14410
NM_002839chr921237 510 12865 32354 999 503 12417
NM_002844chr61185 ------
NM_002869chr111808 11540 ----
NM_002874chr922426 304 --12362 --
NM_002886chr365054 4007 3652 3417 1188 208 14814 34832 4078 463 --
NM_002890chr5----1943 --
NM_002894chr18--151 ----
NM_002897chr23651 232 202 ------
NM_002906chr111609 21848 864 11479 --
NM_002930chr18145 --1222 --
NM_002956chr1231317 195 161 ------
NM_002959chr153192 2887 1555 1483 1344 --13295 --
NM_002971chr3----1312 --
NM_002998chr82676 506 ------
NM_003010chr1722081 895 ----12221
NM_003017chr631172 1138 532 ----1269
NM_003022chrX1117 ------
NM_003030chr321862 1330 ------
NM_003032chr342497 1935 1918 569 --22430 2360 --
NM_003034chr12107719 7228 6911 6533 5288 2609 1994 1300 1054 799 16087 22489 1726 --
NM_003042chr322131 1964 ------
NM_003069chrX176 ------
NM_003081chr2031194 1052 78 ------
NM_003101chr131609 592 501 ------
NM_003107chr622248 421 11822 ----
NM_003108chr255823 5759 1774 1269 1103 --14734 --
NM_003110chr17----21113 997 --
NM_003111chr21316 ------
NM_003114chr81182 ------
NM_003128chr252819 1121 723 417 312 ----12026
NM_003133chr11789 --1345 --
NM_003136chr141293 ------
NM_003140chrY----186 --
NM_003156chr111268 ------
NM_003161chr17----13568 --
NM_003185chr20----1348 --
NM_003199chr1875475 5467 3929 3750 3573 814 671 11676 25126 4241 --
NM_003201chr1021035 118 ------
NM_003234chr322207 477 --51571 1565 773 712 45 --
NM_003262chr365230 4587 4086 3998 1800 1150 11186 25006 566 --
NM_003272chr11179 ------
NM_003286chr2021071 1053 ------
NM_003292chr14845 709 170 52 ----1321
NM_003298chr325750 2133 1811 1122 15312
NM_003304chr321511 177 ------
NM_003317chr142661 655 ------
NM_003319chr2--1961 ----
NM_003337chr561469 1219 1198 1071 642 612 ------
NM_003338chr1011849 ------
NM_003341chr31214 ------
NM_003342chr1723083 2388 --33174 701 606 --
NM_003359chr43959 479 279 ------
NM_003360chr42283 65 ------
NM_003369chr1152632 2047 980 630 366 --32404 2208 246 --
NM_003372chrX2894 154 --128 --
NM_003374chr5164 ------
NM_003392chr354108 3926 3032 2881 462 12757 23589 70 --
NM_003400chr2--1598 1206 --
NM_003403chr141697 ------
NM_003407chr191638 ------
NM_003410chrX33042 2758 2175 22748 229 22181 135 --
NM_003411chrY31753 1591 129 --11738 --
NM_003412chr342489 868 696 563 12642 21951 959 --
NM_003413chrX21299 563 ------
NM_003418chr3----1195 --
NM_003432chr5----1500 --
NM_003453chr13------1529
NM_003462chr131579 1288 106 --1391 --
NM_003463chr653195 2838 1143 842 384 --12570 --
NM_003468chr211264 14289 ----
NM_003471chr341575 1489 782 116 12283 ----
NM_003474chr1031475 303 295 ------
NM_003478chr1133032 2995 1241 1166 43172 2547 2226 665 --
NM_003483chr1262880 2473 2157 1946 365 226 ------
NM_003487chr17----1187 --
NM_003503chr131124 1093 121 --1313 --
NM_003558chr91673 --1635 --
NM_003567chr12277 119 --1312 --
NM_003583chr12123882 3806 3477 3444 3229 2883 2455 1442 684 638 549 253 --22484 841 12938
NM_003590chr243981 3142 830 720 1884 13238 --
NM_003615chr353643 2578 1608 1322 1279 --21344 851 --
NM_003618chr231106 483 391 ----11055
NM_003630chr61778 ------
NM_003642chr21267 --1125 --
NM_003659chr231089 457 247 --11051 --
NM_003663chr363296 3242 3194 997 702 184 12212 ----
NM_003672chr11717 21242 175 21673 464 1606
NM_003692chr92166 108 ------
NM_003701chr1311010 ------
NM_003705chr22784 202 ------
NM_003716chr3--168 ----
NM_003722chr332667 1878 699 --21037 771 --
NM_003749chr1322396 419 --22071 1803 --
NM_003769chr122345 87 ------
NM_003774chr1283169 3015 2997 2951 2515 2062 1182 543 ------
NM_003787chr1841491 235 206 85 --11242 --
NM_003816chr831472 1384 1222 1380 ----
NM_003825chr152251 198 --21364 473 11234
NM_003842chr852144 1720 1630 755 37 ----12321
NM_003850chr13191 ------
NM_003861chr1452726 1919 447 246 64 --1374 12281
NM_003864chr41141 ------
NM_003885chr1762489 2367 698 620 555 537 --21987 380 --
NM_003887chr22939 759 11932 ----
NM_003902chr12226 219 ------
NM_003913chr664220 3996 3178 2907 2724 558 21411 167 --13935
NM_003916chrX21232 384 1973 --1171
NM_003922chr15----1289 1138
NM_003941chr752480 2334 1758 436 396 --1978 --
NM_003948chr452434 2322 1994 800 778 --11970 --
NM_003957chr111831 ------
NM_003972chr103349 313 34 ------
NM_003980chr611327 ------
NM_003981chr151182 --175 --
NM_003994chr1253429 2783 1573 985 665 ----21120 1074
NM_004004chr131248 ------
NM_004028chr1833574 1393 999 ----1257
NM_004056chr84957 822 801 309 ------
NM_004060chr511306 --11211 --
NM_004080chr731478 1326 1116 ------
NM_004081chrY31603 281 127 --2229 108 --
NM_004085chrX--1778 --1598
NM_004087chr351619 1600 1513 596 388 --11343 --
NM_004124chr14103578 3522 3433 2523 2419 2337 2242 1023 822 477 --12603 --
NM_004136chr1542965 2726 2342 522 11313 1347 --
NM_004156chr81198 ------
NM_004161chr24454 421 343 226 ------
NM_004162chr3----11307 --
NM_004171chr11118390 7221 7056 6641 6484 3754 3705 2607 2348 2120 490 --38598 6076 2034 --
NM_004193chr101418 ------
NM_004229chrX12222 --31648 1432 891 --
NM_004232chr18----42592 2363 1144 679 11364
NM_004244chr12----1436 --
NM_004272chr571953 1648 1319 641 631 619 192 ------
NM_004274chr1431175 923 212 --32311 1060 102 12364
NM_004282chr62101 76 ------
NM_004301chr32280 57 ------
NM_004316chr1221163 74 ------
NM_004331chr811672 --1445 12628
NM_004338chr18116607 6310 5928 5922 5380 4371 2775 1977 1569 1160 199 27017 5407 26735 6689 15751
NM_004342chr742117 1503 764 647 ------
NM_004346chr4----2382 31 --
NM_004349chr831269 1204 1188 ------
NM_004354chr45802 726 649 91 76 ------
NM_004362chr42504 141 --1265 --
NM_004365chr52298 92 ------
NM_004370chr612039 22074 362 --11631
NM_004385chr5----1247 --
NM_004392chr1342604 2113 1878 1003 12591 22369 932 12267
NM_004395chr51726 ------
NM_004397chr1143668 1260 245 229 ------
NM_004417chr5----1539 --
NM_004437chr132947 1227 870 --1923 --
NM_004438chr233263 2750 38 --13082 --
NM_004440chr61487 ------
NM_004442chr111380 ----11752
NM_004458chrX3653 191 176 ------
NM_004464chr423275 1455 --1630 --
NM_004480chr141677 --1824 --
NM_004496chr141915 --1335 --
NM_004498chr151290 ------
NM_004500chr1431754 1396 685 --1394 --
NM_004501chr123708 70 13933 ----
NM_004504chr232965 2916 2653 --33000 2555 2276 11194
NM_004506chr63714 665 656 ------
NM_004521chr101299 ------
NM_004535chr2011087 11315 ----
NM_004538chrX1261 ------
NM_004540chr212899 658 ------
NM_004571chr2132255 381 349 --12399 13341
NM_004586chrX85158 5148 4974 4698 4308 4274 3879 690 1365 14379 1568
NM_004660chrY62291 2132 1715 938 928 247 --1217 --
NM_004663chr1541479 1200 1091 217 11489 11234 11566
NM_004685chr1341141 732 562 441 ----23014 2756
NM_004686chr811387 --1383 1499
NM_004694chr17------1790
NM_004697chr9----183 --
NM_004709chrX2175 39 --11745 --
NM_004717chr71560 ------
NM_004718chr23589 537 22 ------
NM_004726chrX55380 4965 2007 980 571 --34292 4206 3843 44897 4617 4376 3730
NM_004733chr3--1481 145 1540
NM_004734chr1342339 2139 2037 1094 13037 ----
NM_004736chr142079 1620 396 75 --22034 188 --
NM_004745chr836532 4654 1819 --17068 --
NM_004748chr154882 704 685 676 23439 441 ----
NM_004760chr722436 458 ----1846
NM_004768chr11245 21075 150 ----
NM_004774chr1742894 1973 969 380 ----1200
NM_004775chr1842310 2013 830 561 ------
NM_004788chr1152278 2217 2190 1708 881 11822 177 --
NM_004789chr9----154 --
NM_004796chr1432400 1741 133 --31687 1523 555 --
NM_004801chr221422 1097 --1595 --
NM_004805chr23970 448 297 ------
NM_004815chr154350 4150 1812 1486 796 11695 13412 --
NM_004827chr43716 565 247 1210 11621 --
NM_004834chr243224 3017 2613 2115 --11000 12205
NM_004841chr11223 ------
NM_004849chr621715 1538 ------
NM_004850chr211224 ------
NM_004855chr15----1209 --
NM_004859chr1742841 2477 2159 366 ------
NM_004863chr1475320 5199 3607 3585 1991 1132 632 --23765 710 --
NM_004872chr11354 1336 ----
NM_004874chr81169 ------
NM_004904chr732042 1019 245 1167 25859 2511 1894
NM_004915chr211570 ------
NM_004932chr531706 202 159 ----11777
NM_004956chr723531 728 14466 23011 2885 1959
NM_004965chr213299 195 99 ------
NM_004966chr101695 --3994 953 400 --
NM_004985chr1253856 3038 1617 1335 374 11351 14001 --
NM_004992chrX52836 2305 1903 1294 1058 --25422 5410 --
NM_004992chrX52836 2305 1903 1294 1058 --25422 5410 --
NM_005006chr21363 1159 ----
NM_005023chr521483 1231 ------
NM_005054chr2----21519 1372 --
NM_005056chr1252071 1924 1726 1352 261 1540 ----
NM_005065chr1424896 2145 15372 1860 24042 1246
NM_005066chr1179 ------
NM_005067chr32989 810 ------
NM_005087chr3------1657
NM_005093chr2054905 3345 3255 1540 249 --35345 5233 691 --
NM_005099chr141095 950 311 167 ------
NM_005113chr141354 ------
NM_005121chr1741290 1010 964 413 12688 23515 3272 --
NM_005124chr61759 ------
NM_005126chr31431 11742 --12122
NM_005135chr1553626 2948 2460 1081 517 13075 13587 --
NM_005153chr163783 517 79 ------
NM_005154chr151231 125 ----
NM_005155chr63642 144 127 ------
NM_005156chr964926 4372 4324 4022 3981 2097 --34136 3410 321 --
NM_005160chr2266789 5784 5386 1545 1286 382 11758 35452 2265 876 --
NM_005171chr1231104 512 147 ----1389
NM_005188chr1167747 7554 6995 5952 5426 5027 28295 7444 --23234 2988
NM_005197chr1454412 4043 3751 1648 726 15007 --14733
NM_005229chrX1476 ------
NM_005230chr123482 430 64 ------
NM_005233chr342416 1736 1009 979 1234 ----
NM_005235chr2127695 7563 7242 6806 6177 5529 4876 3056 2792 2448 1390 71 --16392 16422
NM_005243chr221130 ------
NM_005245chr4133 ------
NM_005254chr151311 ------
NM_005256chr112843 700 --171 1818
NM_005277chr471805 1631 770 725 543 414 257 --1395 --
NM_005327chr41208 ------
NM_005338chr754057 4022 3819 2691 2483 1224 ----
NM_005339chr463430 3259 1237 908 878 284 --13366 --
NM_005349chr41406 ------
NM_005358chr1311317 --21561 306 1320
NM_005359chr1865850 5658 5247 2588 2562 2257 16490 35181 4267 2530 --
NM_005375chr6----1149 --
NM_005378chr22845 600 ------
NM_005386chr201805 ------
NM_005388chr931675 1483 1283 --11654 --
NM_005399chr153846 3834 3392 3107 1088 --23755 820 --
NM_005437chr103961 593 111 ------
NM_005455chr131785 1173 491 --31201 1189 79 --
NM_005465chr1----2446 350 11788
NM_005493chr63741 210 139 ------
NM_005497chr1766045 5758 3833 896 563 329 ----2957 96
NM_005504chr12106500 5917 5814 5767 4354 4295 4083 2099 909 280 12533 ----
NM_005565chr53520 429 240 ------
NM_005578chr344475 4351 2020 1948 --45106 1667 1655 317 13669
NM_005587chr15----1969 --
NM_005591chr1142191 735 347 176 --21083 129 --
NM_005593chr12------1453
NM_005596chr975964 4934 4291 2234 1139 465 452 25236 504 --1633
NM_005602chr3----1894 --
NM_005604chr612053 ------
NM_005614chr71855 ------
NM_005625chr841113 764 745 202 --1379 --
NM_005627chr6------157
NM_005637chr1821796 179 --1103 1165
NM_005665chr131923 1196 674 11332 24448 1439 14719
NM_005667chr2----192 --
NM_005668chr554253 3820 1691 1587 836 23646 290 ----
NM_005685chr7----197 --
NM_005711chr51678 ------
NM_005715chr622584 699 ----12640
NM_005721chr221035 82 --1249 --
NM_005724chr15------195
NM_005725chr11161 --21914 1818 --
NM_005734chr11----1638 --
NM_005738chr731721 653 44 ------
NM_005739chr1542045 1916 1575 186 --12214 --
NM_005748chr1223261 725 --2602 283 --
NM_005749chr171517 ------
NM_005756chrX1414 11265 1378 11357
NM_005765chrX169 ------
NM_005780chr13----2710 371 --
NM_005786chr18----11070 --
NM_005789chr1762102 2015 1940 1692 755 358 --21459 153 1127
NM_005795chr242337 1899 729 194 12778 1448 --
NM_005797chr1121806 1727 ------
NM_005802chr91662 ------
NM_005808chr31468 ------
NM_005840chrX107526 7359 7066 5968 5934 5210 2552 1909 1306 902 24926 1419 11182 15794
NM_005842chr131610 ------
NM_005843chr251534 1445 1258 753 242 ------
NM_005859chr5--11296 1517 --
NM_005863chr1031213 923 550 --11019 --
NM_005868chr71613 1156 12275 1485
NM_005884chr191798 ------
NM_005898chr1132869 1246 917 --13039 --
NM_005901chr18158581 8516 8457 7734 7310 6421 6245 5969 5642 5584 2714 2314 1439 1376 1115 --26198 365 --
NM_005903chr534243 1948 1896 13856 22090 1007 --
NM_005907chr621142 67 --1463 11592
NM_005909chr564200 3598 2976 2956 545 444 ----195
NM_005966chr232223 2065 716 11839 --1630
NM_005977chr13134 --1877 --
NM_005996chr121555 --11054 --
NM_005999chr131085 348 70 1243 11283 1408
NM_006007chr984426 4036 3825 2979 1374 1319 1148 1057 2620 558 ----
NM_006016chr651789 1783 461 370 356 12005 11442 --
NM_006022chr132918 193 --1726 --
NM_006029chr14123 ------
NM_006048chr11304 ------
NM_006055chr243210 2369 1239 718 --12405 --
NM_006080chr732640 2222 686 ------
NM_006094chr81789 ------
NM_006095chr433316 1423 89 11680 1559 1393
NM_006100chr33467 241 38 --164 --
NM_006106chr1131365 1122 877 --31384 1089 392 --
NM_006107chr172510 154 ------
NM_006110chr16----1133 --
NM_006136chr73946 129 31 --3407 266 209 --
NM_006139chr221972 611 --2564 376 --
NM_006141chr1622766 823 --22262 937 11002
NM_006154chr1551856 1019 1008 800 497 ------
NM_006166chr1211044 ----1682
NM_006197chr832044 1976 102 21884 408 11989 --
NM_006226chr23461 345 182 --148 --
NM_006243chr11852 1402 ----
NM_006251chr53923 672 282 11315 --12448
NM_006252chr144667 2869 1324 1063 12517 26588 377 --
NM_006256chr122127 881 ------
NM_006265chr851446 991 955 621 331 --11474 --
NM_006275chr2052138 2066 712 314 270 ------
NM_006298chr683418 1330 1195 1123 564 349 150 107 1892 ----
NM_006300chr1922377 1662 ------
NM_006313chr1221562 398 --21149 414 --
NM_006315chr443890 3327 773 611 14411 1359 --
NM_006322chr13--1374 ----
NM_006330chr831443 1170 1148 ------
NM_006352chr121934 766 --32037 1798 548 11780
NM_006357chr2--1197 ----
NM_006366chr611277 1355 1217 --
NM_006371chr344647 1602 764 388 1982 11027 --
NM_006379chr7----11934 --
NM_006380chr1743703 3426 1670 905 --24110 1511 --
NM_006386chr2222424 667 22164 166 ----
NM_006393chr1064584 3481 1309 1154 985 874 --23197 943 23903 511
NM_006416chr63607 592 508 --1636 --
NM_006420chr2052854 2160 698 631 517 13267 ----
NM_006421chr81169 ------
NM_006434chr1012514 --171 --
NM_006451chr52427 290 --1416 --
NM_006457chr463809 3639 3516 3030 2934 856 11546 12526 --
NM_006460chr171627 ----1354
NM_006467chr552200 2021 1909 1578 792 1165 11777 --
NM_006482chr12123882 3806 3477 3444 3229 2883 2455 1442 684 638 549 253 --22484 841 12938
NM_006489chr1432061 340 250 --11805 --
NM_006496chr131628 1320 495 --1686 --
NM_006520chrX3661 629 482 1648 --21707 1082
NM_006537chr15----2219 121 --
NM_006538chr234214 1175 474 13959 11004 --
NM_006544chr1465338 4170 4111 3705 1473 730 25981 1880 13688 --
NM_006557chr9------11338
NM_006558chr81378 ----1352
NM_006559chr131238 403 341 ------
NM_006560chr111483 ------
NM_006561chr1045518 5070 1806 65 13775 1187 --
NM_006584chr17143 ------
NM_006593chr22572 512 ------
NM_006595chr1131399 1288 447 --1389 --
NM_006599chr1647595 2238 667 406 36458 6237 1348 26570 1624 17381
NM_006603chrX41473 1242 365 253 ------
NM_006609chr262462 1892 872 420 294 274 --1473 --
NM_006620chr633437 1529 639 ------
NM_006621chr13771 289 218 ------
NM_006626chr92425 277 11768 12552 --
NM_006628chr15113612 3061 1871 1648 1352 907 596 576 270 258 173 --11665 11687
NM_006629chr1862393 2140 1839 1816 1112 670 ------
NM_006646chr1322177 285 --22566 911 --
NM_006654chr1251776 1764 1645 1272 274 --34508 4280 964 --
NM_006662chr161384 ------
NM_006710chr23905 262 255 ------
NM_006713chr5----2326 39 --
NM_006721chr101308 ------
NM_006722chr332207 2017 522 --12754 1606
NM_006726chr42984 232 ------
NM_006735chr71144 ------
NM_006738chr1543474 796 576 493 13896 11582 14612
NM_006745chr41945 ------
NM_006750chr1678126 6467 6233 2125 992 943 687 15715 26486 5503 --
NM_006751chr2----1771 --
NM_006759chr22211 39 ------
NM_006775chr632690 1066 535 --12992 12952
NM_006777chrX42922 2003 1045 220 ------
NM_006802chr1--1442 ----
NM_006815chr12175 11111 ----
NM_006826chr24885 833 476 286 ----11273
NM_006838chr1241915 1889 758 379 1258 11257 --
NM_006851chr1242309 812 224 180 1328 2963 376 --
NM_006856chr121745 --1893 --
NM_006873chr272995 2778 2211 1320 1199 922 684 1761 ----
NM_006874chr411142 --1979 11189
NM_006884chr321862 1330 ------
NM_006885chr1633845 3404 1645 ----11283
NM_006888chr1442631 1288 441 421 --21095 408 --
NM_006897chr121213 ------
NM_006902chr132499 2103 1025 1338 12119 --
NM_006915chrX32546 1646 499 11659 21889 686 --
NM_006918chr1185652 5360 4200 4088 3921 2211 1446 944 14008 15715 1843
NM_006922chr23611 378 311 ------
NM_006924chr1724062 275 21399 763 33939 1076 962 1223
NM_006930chr561647 1285 746 430 229 185 ------
NM_006948chr2122100 2048 --42227 2136 984 695 --
NM_006951chr101196 ------
NM_006981chr932940 2583 2553 ------
NM_006982chr121229 ------
NM_007006chr1653444 2900 2373 2230 1050 --11312 --
NM_007011chr1596075 5876 5300 5143 4727 4706 4224 2418 201 26481 195 31223 299 274 --
NM_007013chr8----2681 296 --
NM_007017chr51824 ------
NM_007023chr221095 996 ------
NM_007034chr12757 239 ------
NM_007035chr12129 --1596 --
NM_007036chr52862 350 ------
NM_007043chr1231772 1544 68 1406 --11904
NM_007054chr543776 3585 2823 159 --1693 --
NM_007114chr333150 3128 343 ----22389 2374
NM_007125chrY21064 64 1352 ----
NM_007129chr132784 758 ------
NM_007146chr1752656 2280 2142 1872 982 1115 32645 203 63 --
NM_007157chrX42767 2588 994 512 1919 ----
NM_007173chr1132068 1773 186 12174 21955 649 --
NM_007174chr121304 ------
NM_007175chr823516 3418 ------
NM_007187chr132946 863 ----1903
NM_007191chr12----1717 --
NM_007200chr1543474 796 576 493 13896 11582 14612
NM_007203chr922526 808 --23889 247 13730
NM_007212chr172110 1682 1626 787 647 373 131 ------
NM_007214chr6----1376 --
NM_007236chr1552017 1652 893 229 30 11879 ----
NM_007246chr41290 --1783 --
NM_007249chr1377820 7218 2387 2338 2103 1508 1349 28451 2263 28689 7960 1437
NM_007331chr422512 177 ----1519
NM_007347chr1532576 2406 332 --1802 21195 785
NM_007363chrX1772 ------
NM_012081chr553227 2540 2494 654 186 --22738 2387 --
NM_012082chr8140 ------
NM_012095chr1032865 703 191 1144 13549 198
NM_012096chr333096 1483 700 --32647 2353 949 --
NM_012097chr232063 339 191 ------
NM_012104chr1143117 1482 673 348 13754 23282 2966 --
NM_012104chr1143117 1482 673 348 13754 23282 2966 --
NM_012120chr62935 406 1730 ----
NM_012129chr772183 2050 1713 1664 903 852 153 11613 11739 --
NM_012137chr122901 287 1477 22874 319 12509
NM_012141chr1353479 3469 2891 1474 1238 ----13086
NM_012160chr61448 --2522 81 --
NM_012164chr956504 4758 2691 2384 857 1241 ----
NM_012207chr102306 43 1250 2957 429 --
NM_012210chr941054 559 281 56 ------
NM_012214chr245770 4921 4567 2163 --12184 21867 1739
NM_012233chr21459 --11016 1955
NM_012234chr332353 999 322 --33080 804 429 --
NM_012238chr1041364 1257 1178 329 --11535 --
NM_012249chr232821 1342 836 --22500 732 1685
NM_012252chr753548 1759 985 900 471 1380 11863 --
NM_012255chr201456 ------
NM_012261chr201522 ------
NM_012262chr155254 3969 3529 1487 763 ----1725
NM_012287chr361826 1412 1100 189 169 34 1992 ----
NM_012297chr442482 1763 874 733 --12556 1669
NM_012300chr52565 36 11975 11787 --
NM_012301chr71639 --41937 1821 1613 295 --
NM_012307chr183982 909 764 2990 831 1928 --
NM_012309chr11----24055 3885 13109
NM_012330chr1021355 1166 ------
NM_012345chr132709 224 21304 303 ----
NM_012382chr554462 3628 1502 248 101 --12797 11490
NM_012383chr9------1319
NM_012431chr723165 2907 13216 ----
NM_012454chr62382 218 ------
NM_012464chr441976 741 627 537 ------
NM_012482chr1----1137 --
NM_013261chr433650 3192 2690 ------
NM_013281chr202242 232 --11063 --
NM_013283chr51797 ------
NM_013341chr221847 838 12598 22715 2495 --
NM_013357chr81122 ----1694
NM_013361chr191184 1456 ----
NM_013374chr352989 2821 2364 826 538 1861 --23057 89
NM_013381chr1232170 2152 1802 --22351 138 --
NM_013396chr211151 --144 --
NM_013437chr831234 1020 81 --187 --
NM_013444chrX--1732 2270 120 --
NM_013450chr22914 407 ------
NM_013937chr631146 1055 429 --1781 --
NM_013943chr12514 462 --22617 912 --
NM_013986chr221130 ------
NM_013995chrX32565 2103 165 --22472 90 --
NM_014005chr563019 2207 2039 956 237 40 --22720 168 --
NM_014021chr163374 2939 2739 587 432 202 --1219 --
NM_014048chr1665021 4876 4581 4083 365 340 11138 ----
NM_014106chr1542007 1186 747 34 ------
NM_014112chr843928 3588 1492 523 --14733 11130
NM_014117chr1642559 903 559 480 --22488 535 --
NM_014141chr772090 1838 1278 1000 952 475 444 --11620 1926
NM_014154chr331077 447 369 ------
NM_014155chr1187498 5368 5342 2549 2002 1858 1805 520 11408 15322 12870
NM_014157chr1662890 2546 1223 1085 1024 65 --1250 --
NM_014176chr1--127 ----
NM_014181chr232662 2438 405 ------
NM_014241chr101329 ------
NM_014253chrX21650 928 --32410 2375 202 --
NM_014267chr11----1688 --
NM_014271chrX1310 --1315 --
NM_014280chr12796 114 ------
NM_014283chr111232 ------
NM_014294chr811271 ------
NM_014309chr2274378 4279 1607 1025 489 473 409 13378 24036 510 22104 1686
NM_014313chr111287 --1428 --
NM_014331chr467553 7153 5132 4945 4862 788 17102 17769 36699 717 173
NM_014332chrX----2364 162 --
NM_014333chr1122638 557 11114 42448 970 456 270 --
NM_014363chr1321098 968 ----1323
NM_014381chr1472492 2351 2335 2171 2123 2035 175 12572 12040 1578
NM_014393chr83916 861 193 ------
NM_014397chr9----1430 --
NM_014409chr1----11174 --
NM_014410chr181141 --1351 --
NM_014423chr574600 3582 3559 2231 2058 1573 342 23436 355 ----
NM_014426chr202550 480 --1102 1270
NM_014445chr362035 1667 978 522 177 77 ------
NM_014447chr411651 --21327 1230 --
NM_014452chr6140 ------
NM_014454chr61944 --1131 --
NM_014469chr11----2188 183 --
NM_014491chr71396 ------
NM_014503chr12--1416 ----
NM_014504chr731996 1760 1673 1169 1509 11861
NM_014547chr152522 115 1824 2221 137 --
NM_014547chr152522 115 1824 2221 137 --
NM_014554chr1221493 887 --21841 871 --
NM_014572chr1351609 1189 639 585 248 ------
NM_014574chr1421355 556 11257 1585 --
NM_014577chr22------195
NM_014607chr241635 822 536 278 ------
NM_014608chr152422 61 ------
NM_014612chr921567 1235 1283 2301 174 --
NM_014614chr221481 1349 ------
NM_014615chr1632929 2521 968 --22808 1083 --
NM_014616chr322323 362 12144 1248 1848
NM_014620chr122822 769 ------
NM_014633chr11185 ------
NM_014635chr2----11491 --
NM_014637chr841150 100 85 31 ------
NM_014647chr1622212 275 ------
NM_014660chr71777 ------
NM_014671chr721086 246 11455 ----
NM_014674chr373620 3496 3124 2681 1577 1434 1020 --23720 2813 1149
NM_014676chr131225 458 84 11180 ----
NM_014682chr821737 796 ------
NM_014686chr1921830 341 ----1493
NM_014689chr2------1419
NM_014702chr642275 749 211 38 --32600 932 903 12914
NM_014705chr721674 75 21466 1416 11312 --
NM_014707chr72513 375 ----1496
NM_014709chr21248 ------
NM_014711chr1642091 791 588 198 11833 ----
NM_014721chr654586 2521 2249 1986 1055 25678 1045 57149 7002 6750 2897 1546 --
NM_014723chr2012027 --1101 --
NM_014743chr41840 1821 12168 --
NM_014746chr263038 1718 1553 1539 1052 472 ------
NM_014751chr832069 679 239 --22062 1893 --
NM_014752chr111135 --1590 --
NM_014764chr124447 312 128 74 1933 ----
NM_014770chr121443 ------
NM_014774chr163154 2960 2373 783 546 88 --22015 710 --
NM_014776chr1242971 2470 1053 210 13150 1215 11203
NM_014779chr321188 998 ------
NM_014781chr811121 ------
NM_014787chr152115 930 872 800 221 1710 12650 --
NM_014795chr211066 ------
NM_014802chr122855 349 ------
NM_014819chr532072 845 695 11702 1223 --
NM_014827chr1296 54 ------
NM_014829chr512301 --12076 --
NM_014830chr1263589 2819 1195 922 271 259 23219 1250 2323 317 --
NM_014838chr2242024 2002 1961 395 --12338 --
NM_014840chr1252771 2244 2226 2184 662 175 ----
NM_014841chr62932 915 ------
NM_014847chr11457 ------
NM_014848chr1532826 1059 135 ----12166
NM_014850chr354881 4752 3211 1357 1090 13120 13388 --
NM_014860chr232507 2480 1684 --11714 --
NM_014873chr194870 3964 3773 3652 3317 1379 1017 598 449 13784 34767 4386 342 --
NM_014877chr1767631 6955 6082 5510 1923 848 1697 46631 6624 6209 1582 12264
NM_014890chr31225 ------
NM_014893chrY32377 2208 745 ------
NM_014897chr1752281 2164 2063 361 85 12427 ----
NM_014899chr573148 2690 2631 1183 507 272 138 ------
NM_014903chr1262207 2190 2068 1537 653 637 --1195 --
NM_014904chr1052958 2538 2490 1562 371 --13043 --
NM_014905chr231420 1390 83 --1435 --
NM_014906chr1732684 772 386 21266 336 21121 927 11209
NM_014912chr1033297 917 659 11314 33435 2705 556 --
NM_014932chr311274 ------
NM_014936chr662577 2306 1153 756 488 362 ------
NM_014942chr622627 216 ------
NM_014951chr1022215 1915 ----1532
NM_014962chr2032923 2774 1001 --2676 47 --
NM_014969chr121092 306 ------
NM_014977chr141579 ------
NM_014978chr101588 ------
NM_014989chr621501 510 --11272 --
NM_014999chr1221631 412 ------
NM_015000chr1233054 2457 566 22787 1008 11985 --
NM_015017chr121015 399 1978 2894 194 --
NM_015023chr11133 ------
NM_015025chr232246 356 340 ------
NM_015026chr1243210 2938 1435 380 ------
NM_015039chr194128 2671 1710 1661 884 387 348 309 200 --13554 24088 1564
NM_015045chr101455 11667 ----
NM_015049chr263081 3011 2593 2022 351 75 ----1513
NM_015051chr912609 ------
NM_015076chr654239 4089 3503 2914 930 11587 1563 --
NM_015092chr1643609 1129 693 502 --34350 2974 1878 128
NM_015093chr61753 ------
NM_015110chr962237 2078 869 838 486 407 ------
NM_015115chr453184 2857 2548 658 358 --22776 921 --
NM_015125chr191398 ------
NM_015132chr731730 791 106 ------
NM_015137chr842617 856 823 751 --1638 --
NM_015138chr1542708 2227 1843 1815 --22151 537 --
NM_015153chr6--1205 2492 295 --
NM_015156chr1443088 1201 1032 898 --12688 --
NM_015161chr1641103 976 398 314 1127 ----
NM_015163chr1441916 1812 1525 1474 ----11719
NM_015176chr131526 1352 1154 ------
NM_015200chr4----32382 2262 721 --
NM_015208chr1863467 2590 2478 1592 847 765 ------
NM_015215chr11872 ------
NM_015233chr1342641 1973 1884 434 1294 ----
NM_015235chr1032163 1610 864 --22100 1465 11818
NM_015247chr1633962 3450 337 --35037 3641 620 --
NM_015265chr2179 ------
NM_015271chr464236 3602 3064 2724 1509 1357 13295 13422 --
NM_015285chr182717 531 --134 1756
NM_015294chr173795 396 165 1308 ----
NM_015296chr1311148 ------
NM_015310chr8106470 5869 5499 5390 5087 2853 965 405 148 65 --31537 1153 520 --
NM_015313chr1164770 3337 1815 1128 439 164 --24561 3986 14643
NM_015317chr242612 1980 1100 387 ------
NM_015321chr1933527 3498 1575 --1926 1934
NM_015335chr1232019 971 938 1406 ----
NM_015336chr1221890 405 1458 21033 623 --
NM_015339chr201105 --2923 911 --
NM_015349chr632772 2517 208 1752 23058 461 --
NM_015365chrX53916 1707 1681 1161 867 1719 33900 640 458 --
NM_015375chr173592 3528 3362 1495 621 441 414 --1493 133
NM_015385chr1012514 --171 --
NM_015387chr221595 107 ------
NM_015396chr331220 1203 135 ------
NM_015397chr931774 1298 104 ----1672
NM_015435chr82979 54 1171 ----
NM_015436chr443182 2930 2345 237 --1349 12243
NM_015439chr61151 ------
NM_015444chr31102 ------
NM_015455chr543452 3197 3011 1402 ------
NM_015457chr11----1702 --
NM_015458chr864814 4498 3335 3260 1716 910 --23418 1279 --
NM_015460chr311972 ------
NM_015475chr22846 50 ----1697
NM_015483chr71369 ------
NM_015484chr13859 597 101 ------
NM_015525chr61193 --21082 1029 --
NM_015532chr1542231 786 376 256 ------
NM_015534chr12958 374 ------
NM_015535chr283833 2772 2721 2687 2643 555 512 431 1537 ----
NM_015541chr331121 370 273 ------
NM_015550chr763615 2752 2474 1107 996 547 12392 --13141
NM_015564chr523016 128 ------
NM_015565chr21--1454 ----
NM_015570chr731559 1452 1435 --11579 --
NM_015571chr642457 2336 2189 338 ------
NM_015601chr104887 715 303 28 ------
NM_015602chr151801 1543 1205 621 98 ----11333
NM_015607chr11149 ------
NM_015626chr171954 --1303 --
NM_015630chr221118 1045 ------
NM_015713chr853500 2363 2282 1380 673 11410 1666 --
NM_015723chr72258 230 ------
NM_015844chr18----1948 --
NM_015846chr18----1948 --
NM_015847chr18----1948 --
NM_015866chr1--11241 ----
NM_015874chr41406 ------
NM_015879chr18117305 6752 6707 6662 5993 5978 3171 2775 2034 896 440 37897 7616 2990 12012 --
NM_015885chr111155 ------
NM_015886chr884346 4081 4050 4003 1656 1257 1169 1093 34299 1387 744 --24638 954
NM_015888chr122865 2129 --22372 1109 22509 304
NM_015906chr154795 4476 4028 1495 567 23505 646 31807 1403 830 23120 467
NM_015975chrX31646 1488 152 ------
NM_015976chr11364 ------
NM_016018chr832518 2464 105 ------
NM_016021chr653019 2895 2741 1066 137 1365 ----
NM_016045chr2021322 679 21713 701 ----
NM_016048chr51763 ----1180
NM_016073chr151949 ------
NM_016083chr623074 862 12599 1485 --
NM_016087chr71637 31244 1118 367 ----
NM_016121chr13850 119 76 ------
NM_016129chr4----1387 --
NM_016132chr1542735 2273 2255 205 13194 2675 301 --
NM_016152chr331138 946 89 3800 313 238 ----
NM_016162chr121639 ------
NM_016200chr72786 284 ------
NM_016206chr398039 7564 7204 6087 5641 2417 2046 705 139 16147 --18767
NM_016227chr111232 ------
NM_016255chr632993 2752 2444 --1419 12932
NM_016260chr245166 1202 1060 1041 26211 4811 25714 4988 --
NM_016271chr18----1123 --
NM_016272chr2252640 2199 1048 668 378 --22727 2557 --
NM_016287chr121737 1300 --175 11788
NM_016297chr273331 3211 1370 985 810 519 30 ------
NM_016308chr182056 1926 1616 1569 666 504 329 308 1210 ----
NM_016315chr221665 340 1634 21846 1461 1301
NM_016322chr9--11979 ----
NM_016328chr7----197 --
NM_016338chr52841 276 ------
NM_016357chr1251049 795 504 478 425 ------
NM_016376chr1733395 2899 546 --12828 --
NM_016383chrX----1748 --
NM_016396chr1522149 659 12040 2574 533 32572 1000 937
NM_016422chr1112872 ------
NM_016424chr1732015 1659 1286 --1514 --
NM_016451chr11------1316
NM_016470chr20------160
NM_016507chr1742815 2756 1236 300 ------
NM_016529chr131326 1147 ----
NM_016530chr1563158 3046 1382 1317 945 868 --63917 3303 2521 1008 950 453 13789
NM_016542chrX21346 232 --21216 317 --
NM_016569chr121555 --11054 --
NM_016578chr111541 ------
NM_016588chr62242 78 ------
NM_016607chrX21675 1629 --1411 --
NM_016620chr11417 ------
NM_016623chr8172 ------
NM_016626chr1821574 197 1579 ----
NM_016631chr211780 ------
NM_016654chr151311 ------
NM_016818chr211570 ------
NM_016824chr102641 218 --1702 --
NM_016836chr23651 232 202 ------
NM_016839chr23651 232 202 ------
NM_017420chr1443285 2972 1516 1307 12964 2278 102 12372
NM_017423chr41540 ------
NM_017447chr2174217 4014 3972 2834 1683 728 170 --23847 3814 --
NM_017449chr111380 ----11752
NM_017519chr62845 259 --1859 --
NM_017545chr201537 ------
NM_017563chr396236 4867 3971 2515 2169 2155 988 898 73 12001 24872 2022 --
NM_017576chr9124 --1185 --
NM_017580chr1031947 1775 1584 --31797 1489 196 --
NM_017599chr1242060 592 366 136 --11496 --
NM_017610chr1521551 322 --1430 --
NM_017612chr124591 500 228 171 ------
NM_017628chr465048 4791 3856 1943 761 346 --23634 1213 --
NM_017629chr13787 556 346 ------
NM_017633chr672899 2706 2439 1583 1448 1281 134 ------
NM_017634chr831424 489 273 ------
NM_017635chr1151636 1198 1188 418 84 ------
NM_017637chr9108791 8442 8402 8135 7377 3677 3397 2828 2176 940 37029 6637 1711 --13338
NM_017641chr121185 ------
NM_017643chr172786 157 ------
NM_017644chr364498 4039 3858 3842 1867 1122 25087 1226 --24150 1959
NM_017645chr922223 737 ----12418
NM_017650chr765058 4333 2358 2020 1912 1201 --11365 15524
NM_017655chr141521 1410 1302 430 --21314 103 --
NM_017658chr1464481 3654 3535 1446 831 283 14584 24465 881 --
NM_017667chr71578 ----1533
NM_017672chr1531216 480 455 ------
NM_017681chrX4846 305 294 135 ------
NM_017686chr121092 124 --1286 --
NM_017709chr174040 3414 3407 3111 2927 1323 471 --1620 --
NM_017741chr432589 2447 1925 1473 11998 --
NM_017745chrX1582 ------
NM_017747chr51267 ------
NM_017752chrX2567 347 ------
NM_017754chr685032 5011 4303 4261 4168 3746 3647 3315 --11377 --
NM_017769chr1432966 2502 526 1100 32634 2164 808 --
NM_017779chr142536 2125 2107 386 --1633 12414
NM_017813chr885644 5053 4187 3930 2343 1923 1177 970 ----11184
NM_017824chr101370 1486 11009 --
NM_017910chr21315 --1249 --
NM_017915chr121809 ------
NM_017919chr965310 4943 4793 1535 537 341 24606 3565 22153 1827 --
NM_017922chr141139 ------
NM_017943chr142969 773 ----11040
NM_017964chr231015 629 58 ------
NM_017969chr2187 ------
NM_017994chr722183 1873 12215 11966 1640
NM_018014chr22973 78 ------
NM_018018chr1221536 466 --11294 --
NM_018027chr1032955 2566 2414 13016 23088 2960 --
NM_018036chr1423010 493 1920 34245 4158 1440 1128
NM_018043chr11--1962 ----
NM_018050chr12133 ------
NM_018061chr12706 607 11634 ----
NM_018062chr2----1446 --
NM_018070chr1----1170 --
NM_018084chr221127 758 --1443 11100
NM_018086chr2----31830 1528 340 --
NM_018092chr16--1544 11348 --
NM_018098chr3----1759 --
NM_018105chr81283 ----2993 397
NM_018115chr42756 581 --1728 --
NM_018121chr1062760 2533 2084 1234 496 135 1762 ----
NM_018126chr431358 1262 234 ------
NM_018131chr10------1764
NM_018133chr351709 803 407 357 204 ------
NM_018147chr3190 ------
NM_018157chr1253155 2626 2469 290 120 11020 1651 --
NM_018179chr121549 --1240 1426
NM_018181chr1831831 424 257 ------
NM_018195chr1132038 255 196 --21342 686 --
NM_018229chr1431003 924 870 --1385 --
NM_018237chr10197 ------
NM_018243chr443653 3628 3046 695 11461 23680 80 --
NM_018247chr613067 ----21063 84
NM_018254chr132298 1590 118 1919 ----
NM_018290chr421286 1174 ------
NM_018293chr342114 1860 1100 385 1721 11812 1478
NM_018307chr17----1739 --
NM_018313chr331624 467 432 --11843 165
NM_018319chr141192 ------
NM_018323chr41251 ------
NM_018339chr94660 296 119 39 ----11169
NM_018362chr1143717 3348 3121 872 --13796 --
NM_018364chr143930 3042 477 399 31589 1281 1202 2554 502 --
NM_018374chr773968 3225 2012 1698 1151 765 224 1672 --14997
NM_018375chr1441884 1581 1400 392 --1298 1530
NM_018403chr353095 1580 1505 1155 682 --31494 904 486 --
NM_018429chr542412 2367 2116 876 --11809 --
NM_018433chr21148 ----1522
NM_018440chr8168103 7798 7585 7509 7002 5484 5417 3179 2475 2222 2135 1992 1696 1616 752 105 --16880 --
NM_018444chr82910 184 12247 2750 677 --
NM_018448chr121229 --21067 868 --
NM_018482chr842329 1973 1032 216 12467 22113 1612 --
NM_018486chrX1495 ------
NM_018490chr111284 11320 ----
NM_018555chr19--1564 ----
NM_018566chr144033 3951 3654 1218 --23284 1795 --
NM_018602chr153572 302 219 --11606 --
NM_018638chr1234569 3849 1254 55508 4680 1762 715 83 43839 1026 1013 424 34475 3890 1622
NM_018640chr1242180 568 464 385 ------
NM_018649chr101457 ------
NM_018682chr72707 298 ----1286
NM_018691chr53395 369 97 ------
NM_018695chr522013 774 --11846 12308
NM_018696chr183803 685 84 ------
NM_018712chr1121479 1186 --11391 --
NM_018724chr1--1249 ----
NM_018834chr54748 634 320 119 ----1943
NM_018847chr91135 1390 ----
NM_018939chr52552 486 ------
NM_018945chr621448 890 12763 ----
NM_018948chr131332 997 473 1337 ----
NM_018958chr1573505 2871 1517 1427 1343 560 454 1981 21477 86 --
NM_018976chr1252832 2740 2715 1118 124 --11907 --
NM_018979chr1221847 904 1113 ----
NM_018999chr1074585 4322 3571 1057 896 870 478 ------
NM_019001chr344236 3966 3448 741 --24458 1193 --
NM_019006chr15----1240 --
NM_019022chr1852844 2374 2316 1103 893 1547 ----
NM_019027chr432448 2069 163 ----12523
NM_019036chr631144 953 282 ------
NM_019041chr632205 2129 1925 12188 --12402
NM_019050chr421696 837 ----1749
NM_019072chr554072 1670 568 432 335 21155 794 ----
NM_019091chr21815 ------
NM_019098chr82132 35 ------
NM_019102chr71341 ------
NM_019102chr71341 ------
NM_019114chr93889 436 129 ------
NM_019116chr1673693 3504 3061 2643 2422 1375 823 --23644 1223 --
NM_019590chr104453 339 265 192 ------
NM_019593chr2012617 13190 --12458
NM_019594chr9----2654 340 --
NM_019597chrX184 ------
NM_019600chr151328 --1538 --
NM_019903chr102641 218 --1702 --
NM_020066chr11954 --1801 --
NM_020122chr265782 4770 4553 4465 1948 403 --22318 1643 11692
NM_020123chr101622 ------
NM_020140chr12177 ------
NM_020141chr151980 1790 963 930 895 --11999 --
NM_020144chr741930 1892 1766 1443 ------
NM_020150chr1011899 --11589 --
NM_020159chr41268 ------
NM_020177chr553257 2158 2104 1111 336 --1268 11031
NM_020198chr1731229 1190 318 11508 ----
NM_020205chr143493 3253 1292 1180 23158 2364 --12635
NM_020245chr644864 1856 838 783 ----11677
NM_020336chr2053861 3371 2385 1266 178 --12599 1271
NM_020337chr413108 ------
NM_020341chr2031398 822 636 --11518 --
NM_020342chr211815 1913 ----
NM_020346chr11129 ------
NM_020357chr321466 228 --11353 --
NM_020379chr11764 --1371 --
NM_020381chr631817 1462 708 131 11928 11494
NM_020390chr384660 4579 4550 4384 3111 1098 609 141 1661 23251 1827 1315
NM_020420chrY31603 281 127 --2229 108 --
NM_020432chr761965 1689 901 225 187 162 ------
NM_020445chr7----1704 --
NM_020449chrX1206 ------
NM_020455chr622353 868 22072 766 22404 1053 --
NM_020463chr211143 --1150 --
NM_020466chr633671 3058 1573 11921 24277 3741 --
NM_020473chrX41904 1727 1373 107 ------
NM_020651chr251759 1633 355 278 96 --11386 --
NM_020654chr31491 ------
NM_020661chr1211959 ------
NM_020673chr2046144 5214 2952 210 17439 13053 --
NM_020686chr1622752 61 ------
NM_020696chr3122 ------
NM_020711chr252397 2010 1007 423 372 1942 12041 --
NM_020718chr1685338 5318 4803 2435 2330 2262 1899 1669 16172 25798 5623 --
NM_020727chr2123768 1248 12817 22916 1454 1395
NM_020732chr62845 259 --1859 --
NM_020734chr1242437 756 716 128 --22275 499 --
NM_020739chr154882 704 685 676 23439 441 ----
NM_020742chrX32451 2315 293 ------
NM_020748chr1721392 1357 --2774 539 --
NM_020752chr10----2741 672 --
NM_020766chrX54608 4547 4241 4211 2798 14070 13620 --
NM_020768chr542699 2690 2602 155 ----1227
NM_020771chr611514 ------
NM_020772chr17117677 7566 7053 6796 6213 5436 2293 1955 1703 714 283 --36146 5541 5300 16353
NM_020774chr1875075 4818 4246 2128 2060 1608 40 14226 25955 71 --
NM_020782chr1284638 3851 1690 1546 1073 903 494 34 --13964 --
NM_020787chr1711451 11010 --1258
NM_020791chr17----21339 1194 --
NM_020794chr11199 ------
NM_020808chr12739 395 ------
NM_020813chr1932830 2139 1152 1242 --22297 32
NM_020819chr621211 146 ----1406
NM_020841chr1253504 3452 3172 2546 821 ------
NM_020856chr19--1489 1252 --
NM_020858chr1522193 1688 ------
NM_020860chr411052 ------
NM_020870chr4----2802 664 11841
NM_020871chrX72446 2158 1854 1637 676 524 468 11738 21652 435 1749
NM_020872chr331632 675 569 --11117 --
NM_020873chr36866 809 721 152 106 24 --1268 --
NM_020918chr1021404 644 --13408 1422
NM_020921chr1432962 1038 136 --22530 2388 --
NM_020922chrX11394 --11375 --
NM_020940chr10----12110 12401
NM_020948chr162480 2412 2379 1403 380 40 --1269 23668 1271
NM_020962chr1562460 2119 1899 665 608 267 --22392 2029 --
NM_020964chr1874675 4435 3585 3546 3056 1485 763 24818 547 --13686
NM_020977chr421688 1514 12175 1315 --
NM_020988chr16----1195 --
NM_020989chr2151 ------
NM_021072chr522432 709 --1789 --
NM_021101chr322265 2183 --1699 --
NM_021132chr10----1924 --
NM_021151chr71960 ------
NM_021174chr81290 ------
NM_021180chr11797 ------
NM_021183chrX1924 --2979 702 1811
NM_021190chr161311 1249 1057 930 867 292 --1536 --
NM_021192chr21434 ------
NM_021218chr91674 ------
NM_021238chr1232111 1396 594 --1249 --
NM_021240chr91211 ------
NM_021252chr1022062 495 --11749 1703
NM_021255chr1433760 2786 2629 13052 13263 --
NM_021637chrX11177 ------
NM_021644chr102306 43 1250 2957 429 --
NM_021813chr685591 5168 4368 3771 2336 2066 1722 590 ----1947
NM_021814chr62631 452 1278 ----
NM_021911chr55849 829 513 271 119 --25324 4120 --
NM_021912chr1574038 3525 3474 610 563 536 494 1460 1433 --
NM_021914chr1432091 1713 469 1253 ----
NM_021940chr61464 --21092 64 --
NM_021951chr93912 255 139 --1347 --
NM_021960chr172640 2392 2043 894 756 597 276 1638 --22685 2265
NM_021961chr11117199 6919 6561 6347 2904 2804 1717 1264 1249 1152 211 16545 35437 2227 403 --
NM_021963chrX1161 2588 97 ----
NM_021964chr334574 1079 805 11485 ----
NM_021965chr911370 --1211 --
NM_021979chr141152 ------
NM_021998chrX21152 357 --21220 1059 --
NM_022048chr1553900 1759 352 341 261 --44962 1929 1685 758 1811
NM_022051chr1------1713
NM_022063chr1031795 1232 548 --11602 --
NM_022079chr104887 715 303 28 ------
NM_022117chrX1152 ------
NM_022133chr831487 737 566 --2704 479 --
NM_022136chr213578 539 501 ------
NM_022145chr51194 --1569 --
NM_022154chr421307 426 ----189
NM_022351chr873580 2450 1490 1143 650 605 259 1525 --11083
NM_022443chr3----127 --
NM_022456chr1246041 2645 1800 1345 --2914 185 --
NM_022458chr733151 2934 2448 12748 ----
NM_022459chr1355187 4927 2220 1060 936 15160 44695 2226 1269 493 --
NM_022462chr1952473 2416 1095 1061 787 --93079 2738 2674 2493 2374 1485 1387 1305 1239 --
NM_022473chr1553696 3147 834 683 35 --13831 --
NM_022650chr5----1943 --
NM_022652chr121753 ------
NM_022716chr142343 1947 1264 869 1182 11963 --
NM_022720chr222337 152 ------
NM_022725chr1131853 858 343 ------
NM_022733chr1----1876 --
NM_022753chr142368 838 760 362 21071 1012 22111 978 11946
NM_022756chr121092 210 11201 2584 356 11355
NM_022763chr342083 889 746 351 ------
NM_022781chr972423 1275 1014 810 599 563 264 --21236 26 --
NM_022784chr1521086 789 --2886 846 1743
NM_022824chr521675 604 --2748 237 --
NM_022826chr231181 844 826 ------
NM_022832chr4----12396 --
NM_022841chr1542647 2324 866 305 12393 12207 --
NM_022893chr243092 2840 2270 105 1893 1914 --
NM_022894chr221443 42 ------
NM_022902chr52381 279 ------
NM_022912chr252700 2022 718 435 429 --12944 12632
NM_022918chr1121843 1471 --1348 --
NM_022970chr1011009 ------
NM_022977chrX3653 191 176 ------
NM_023076chr1672720 2261 2189 691 587 204 85 ----1407
NM_023929chr882617 2387 2187 1965 1846 1835 571 416 --12282 --
NM_023931chr1611077 ------
NM_024016chr17------1661
NM_024017chr17--155 ----
NM_024057chr12143 ------
NM_024095chr1221349 1194 ------
NM_024501chr2----1146 1570
NM_024524chr33350 337 94 --1616 13025
NM_024529chr13818 409 197 ------
NM_024541chr1041840 1734 1295 733 ------
NM_024545chr22548 116 ------
NM_024546chr132429 113 ------
NM_024558chr1431000 423 229 ------
NM_024567chr8134 ------
NM_024624chr211180 --2386 323 11119
NM_024638chr331658 427 270 --3709 445 252 --
NM_024646chr143672 1425 1417 716 13713 ----
NM_024665chr354201 3805 1704 1399 1210 --14584 24413 3955
NM_024676chr111251 ------
NM_024680chr11121 ------
NM_024686chr11426 ------
NM_024713chr1521300 1155 --11433 --
NM_024719chr13193 ------
NM_024721chr852510 1912 891 530 384 --1797 1390
NM_024744chr252598 2256 2035 986 34 1911 22073 1022 11835
NM_024755chr151630 ------
NM_024763chr12450 171 ------
NM_024770chr275606 5272 5114 4120 2650 1822 1602 --1557 --
NM_024811chr11----11847 --
NM_024814chr71245 --1344 --
NM_024828chr9--1498 1428 --
NM_024835chr172159 81 ------
NM_024920chr431286 390 296 ----1197
NM_024947chr3138496 8229 7478 6263 6233 6186 2461 1565 773 581 544 448 405 13812 11015 --
NM_024949chr454461 1857 1030 778 557 ------
NM_024989chr2128192 6919 6318 5860 3102 2355 2008 1950 1329 515 325 143 25154 2877 25193 798 12108
NM_024991chr1012514 --171 --
NM_024993chr211285 11364 2483 336 1537
NM_024997chr1631286 343 263 --21038 170 --
NM_025047chr31329 ----1136
NM_025054chr823969 1573 12719 23934 2852 --
NM_025074chr462516 1209 1137 1050 767 281 ------
NM_025109chr172446 434 ------
NM_025134chr1651887 1803 792 602 489 ------
NM_025138chr1311177 --11306 --
NM_025146chr362766 2452 1712 674 614 491 22314 2195 1251 --
NM_025184chrX2155 63 --1843 --
NM_025187chr16------1481
NM_025191chr193202 2750 2536 2481 2444 2426 1302 564 341 12297 13568 12461
NM_025208chr111533 --145 --
NM_025211chr9----1238 --
NM_025214chr1832678 2563 669 ------
NM_025221chr431308 1088 561 ------
NM_030579chr1633635 378 249 --12840 23351 3186
NM_030594chr15----1271 --
NM_030621chr1413901 12773 34213 621 203 --
NM_030627chr553717 3181 3002 1579 820 --23786 1158 --
NM_030636chr711783 --32099 834 488 --
NM_030647chr776178 5832 5788 5777 4778 2357 2186 --11799 11349
NM_030648chr444372 2157 1038 346 --21266 651 --
NM_030650chr253923 3535 2600 871 696 ----23228 1010
NM_030674chr1255562 1163 973 929 793 14023 24414 2101 11603
NM_030752chr61179 ------
NM_030753chr17----1254 --
NM_030756chr102316 129 ------
NM_030758chr2251277 1231 428 415 72 ------
NM_030762chr1251857 1712 1674 1660 485 --11250 --
NM_030791chr1421455 636 11636 ----
NM_030809chr1232242 1532 972 --32441 1702 1657 --
NM_030817chr1253672 3143 2750 2535 1484 ------
NM_030881chr2222424 667 22164 166 ----
NM_030913chr1----1647 --
NM_030965chr11543 ------
NM_031157chr12----1207 --
NM_031216chr1821699 1454 --2901 362 --
NM_031243chr72787 287 --22065 1671 --
NM_031262chr93936 745 434 1949 1144 --
NM_031263chr93993 802 491 11006 1201 --
NM_031291chr45680 556 255 210 117 ------
NM_031296chr422315 961 --41814 657 621 582 --
NM_031314chr1431754 1396 685 --1394 --
NM_031372chr43584 161 115 ----1526
NM_031418chr1122398 616 --12419 12344
NM_031419chr3--11559 1128 --
NM_031427chr1442203 1913 886 576 1816 21854 1318 15203
NM_031438chr51459 ------
NM_031442chrX33006 906 304 33088 2680 526 --11283
NM_031483chr2073312 3099 2265 1072 951 494 266 --12312 23361 3187
NM_031490chr1641119 216 182 156 ----11322
NM_031844chr123708 70 13933 ----
NM_031845chr233635 3625 1013 ------
NM_031847chr233635 3625 1013 ------
NM_031892chrX4862 624 293 192 ------
NM_031911chr432764 966 346 ------
NM_031953chr4----1125 1112
NM_032012chr963711 3681 2027 1841 865 397 --24850 4802 --
NM_032041chr842062 846 806 636 ------
NM_032116chr1385167 3613 1429 1318 1111 1017 662 27 11941 ----
NM_032121chrX42728 1896 819 256 ----2333 306
NM_032128chr43928 789 24 ------
NM_032144chr221167 660 11397 11210 --
NM_032146chr3----1357 --
NM_032147chr121755 --1860 --
NM_032154chr101312 ------
NM_032160chr1834171 3788 88 --13128 14286
NM_032172chr72365 129 134 1172 1770
NM_032186chr11417 ------
NM_032199chr1053726 3372 3057 812 723 --43378 2982 2438 1514 --
NM_032217chr431080 300 291 1207 ----
NM_032228chr1123414 464 --22233 480 --
NM_032229chr131197 ------
NM_032288chr341773 1668 629 583 1810 ----
NM_032289chr511215 11442 11850 --
NM_032291chr141734 1472 556 523 1627 ----
NM_032321chr253179 1007 207 194 41 ------
NM_032352chr1421457 315 ------
NM_032373chr1045168 4737 4210 2093 23981 1031 45123 4645 4442 1457 --
NM_032410chr8----1169 --
NM_032412chr51256 ------
NM_032435chr112084 --1490 12241
NM_032446chr523668 224 ------
NM_032457chr462578 2476 1377 960 396 153 --11089 --
NM_032458chrX23402 676 ----1113
NM_032466chr82291 165 ------
NM_032468chr82291 165 ------
NM_032499chr1521174 258 ------
NM_032521chr2031042 501 61 12852 23209 1171 --
NM_032547chr411140 ------
NM_032574chr2----129 --
NM_032576chrY----159 --
NM_032622chr451427 1042 635 466 192 ------
NM_032635chr19155 ------
NM_032664chr821429 119 1230 1586 --
NM_032682chr332647 2638 1325 12606 --13246
NM_032711chr1741464 1211 1021 626 1897 21276 977 --
NM_032772chr10----1374 --
NM_032804chr1032348 1880 1825 1367 32267 655 467 --
NM_032810chr102616 344 --21043 36 --
NM_032833chr132623 1948 1775 --2238 126 12327
NM_032842chr721691 558 ------
NM_032859chr1331463 626 406 1978 ----
NM_032870chr6----1563 --
NM_032875chr172810 578 ------
NM_032961chr411409 ------
NM_032968chrX73970 3857 3639 3458 1356 784 698 --1405 --
NM_032969chrX73970 3857 3639 3458 1356 784 698 --1405 --
NM_032973chrY73962 3849 3631 3454 1356 784 698 --1405 --
NM_032975chr1823198 787 1337 1858 --
NM_032980chr1823198 787 1337 1858 --
NM_032991chr4----2382 31 --
NM_033012chr1311010 ------
NM_033020chr154795 4476 4028 1495 567 23505 646 31807 1403 830 23120 467
NM_033056chr103642 272 21 ------
NM_033081chr2011282 --11372 --
NM_033121chr1211204 ------
NM_033132chr13--1308 ----
NM_033135chr111533 --145 --
NM_033138chr742117 1503 764 647 ------
NM_033139chr742117 1503 764 647 ------
NM_033140chr742117 1503 764 647 ------
NM_033143chr433606 2834 1786 --1961 --
NM_033157chr742117 1503 764 647 ------
NM_033181chr623074 862 12599 1485 --
NM_033222chr91999 ----11401
NM_033224chr766772 6346 6119 2332 2240 1025 ------
NM_033225chr832497 963 786 ------
NM_033254chr31578 ------
NM_033285chr863910 3377 3147 1293 991 621 13491 ----
NM_033290chrX43306 3133 2564 1216 --33782 1400 508 11514
NM_033305chr9----2972 383 11194
NM_033326chr1111916 ------
NM_033360chr1263977 3159 1738 1456 495 34 11472 24122 2847 --
NM_033380chrX1706 ------
NM_033381chrX1706 ------
NM_033425chr114713 662 627 176 --22623 101 --
NM_033512chr852985 2481 2306 2115 46 --12913 1119
NM_033540chr34415 372 191 139 1233 ----
NM_033542chr201363 ------
NM_033644chr52565 36 11975 11787 --
NM_033645chr52565 36 11975 11787 --
NM_033656chr21105419 5327 5146 5076 4375 4145 1324 1130 802 560 24894 296 24725 1057 14388
NM_052827chr1241154 750 740 127 1249 11125 --
NM_052832chr832731 2175 2021 1207 1237 12910
NM_052834chr182717 531 --134 1756
NM_052879chr1253374 3331 1304 967 637 13289 23279 626 --
NM_052885chr1274860 3464 3188 1774 1501 1278 108 --191 126
NM_052886chr852119 739 421 116 33 1665 21812 146 --
NM_052904chr621205 981 --11017 --
NM_052917chr222912 110 --12605 1946
NM_052937chr832593 1035 42 22373 1838 1972 --
NM_052953chr3--1244 ----
NM_052962chr631569 1174 1088 ----11261
NM_053016chr977496 6698 2953 2320 2013 1451 884 12392 27274 403 --
NM_053042chr421199 538 --53143 2024 927 48 38 --
NM_054014chr20----1368 --
NM_054016chr131601 1428 114 ------
NM_054016chr131601 1428 114 ------
NM_054016chr131601 1428 114 ------
NM_054034chr21101 ------
NM_057168chr71637 31244 1118 367 ----
NM_057169chr1242971 2470 1053 210 13150 1215 11203
NM_057170chr1242971 2470 1053 210 13150 1215 11203
NM_057175chr432608 1774 45 ------
NM_057749chr821164 875 --2494 408 --
NM_058170chr1----11486 --
NM_078470chr1052551 1893 1771 903 782 --22532 1777 --
NM_080546chr921842 756 ------
NM_080617chr2011035 1300 2957 327 --
NM_080626chr12----1266 --
NM_080645chr612039 22074 362 --11631
NM_080667chr2160 ------
NM_080678chr2----1633 --
NM_080743chr642125 1726 905 483 1109 --11647
NM_080759chr1342604 2113 1878 1003 12591 22369 932 12267
NM_080760chr1342604 2113 1878 1003 12591 22369 932 12267
NM_080764chr225953 896 730 681 457 --42486 2334 926 196 12059
NM_080832chrX249 34 ------
NM_080867chr1473739 3189 1617 1437 1372 649 152 ------
NM_080872chr863943 3125 2784 1436 625 394 12762 --1950
NM_080881chr51726 ------
NM_130391chr921237 510 12865 32354 999 503 12417
NM_130392chr921237 510 12865 32354 999 503 12417
NM_130393chr921237 510 12865 32354 999 503 12417
NM_130798chr152251 198 --21364 473 11234
NM_130811chr2031194 1052 78 ------
NM_130838chr1521663 675 ------
NM_130839chr1521663 675 ------
NM_133265chrX43612 2603 1014 881 11468 ----
NM_133329chr211201 --11450 --
NM_133370chr433491 1148 1072 ------
NM_133372chr552809 2217 1978 446 389 ----1476
NM_133378chr2--1961 ----
NM_133432chr2--1961 ----
NM_133437chr2--1961 ----
NM_133445chr972989 2889 2434 1297 1130 629 392 --1318 23559 3493
NM_133468chr72611 35 --1394 1941
NM_133496chr144087 1822 853 47 --13313 --
NM_133503chr121298 ------
NM_133504chr121298 ------
NM_133505chr121298 ------
NM_133506chr121298 ------
NM_133510chr141112 ------
NM_133625chr31284 ------
NM_133638chr51225 ------
NM_133647chr1553626 2948 2460 1081 517 13075 13587 --
NM_134265chr171954 --1303 --
NM_138270chrX52876 2588 908 699 132 --11170 12752
NM_138286chr1994301 3989 3826 3792 3230 3083 1621 1086 938 --12892 11007
NM_138288chr1442131 1885 1850 366 --1829 --
NM_138333chr931038 673 494 1482 2533 53 --
NM_138348chr574311 4226 2268 2138 865 568 400 11559 ----
NM_138349chr171230 ------
NM_138370chr2--1806 ----
NM_138423chr1532148 2003 437 ------
NM_138494chr71384 ------
NM_138559chr22963 68 ------
NM_138621chr234214 1175 474 13959 11004 --
NM_138638chr1432091 1713 469 1253 ----
NM_138694chr662935 2761 1422 1308 403 217 --13328 1679
NM_138713chr1647595 2238 667 406 36458 6237 1348 26570 1624 17381
NM_138714chr1647595 2238 667 406 36458 6237 1348 26570 1624 17381
NM_138717chr63642 144 127 ------
NM_138730chr62289 133 ------
NM_138731chr1433974 2938 41 11059 ----
NM_138735chr221404 1097 --1595 --
NM_138771chr721517 1177 ------
NM_138782chr512204 22055 679 ----
NM_138927chr211778 ------
NM_138931chr31322 --1793 --
NM_138966chr181223 ------
NM_138970chr1432400 1741 133 --31687 1523 555 --
NM_138971chr1143117 1482 673 348 13754 23282 2966 --
NM_138971chr1143117 1482 673 348 13754 23282 2966 --
NM_138972chr1143117 1482 673 348 13754 23282 2966 --
NM_138972chr1143117 1482 673 348 13754 23282 2966 --
NM_138973chr1143117 1482 673 348 13754 23282 2966 --
NM_138973chr1143117 1482 673 348 13754 23282 2966 --
NM_138980chr4----2618 217 --
NM_138981chr4----2749 348 --
NM_138982chr4----2618 217 --
NM_139035chrX176 ------
NM_139057chr1532843 2088 311 ------
NM_139168chr531982 1638 1631 21579 378 192 --
NM_139215chr17----1187 --
NM_139279chr243160 2533 542 67 2778 25 ----
NM_139321chr2044266 3993 3042 678 --1535 --
NM_144567chr111897 12194 21076 503 22727 2570
NM_144571chr496559 6324 4542 2539 1741 1582 1452 1185 646 15263 35462 5244 855 --
NM_144574chr141599 ------
NM_144578chr1485291 4302 4053 1549 622 611 596 83 --12018 11121
NM_144590chr1032321 2112 924 ------
NM_144599chr1574657 4391 3646 3451 1939 449 130 --14833 1340
NM_144600chr1621506 397 ------
NM_144604chr16----1543 --
NM_144632chr251876 1816 1602 622 221 --1111 --
NM_144642chr331091 313 127 --1442 --
NM_144657chrX----2504 96 --
NM_144664chr1152176 2094 1798 447 193 ------
NM_144676chr161103 ------
NM_144684chr192762 37 ------
NM_144721chr4----12722 11886
NM_144767chr1543474 796 576 493 13896 11582 14612
NM_144778chr1311006 1417 ----
NM_144973chr1233422 1327 185 11305 ----
NM_145037chr331158 577 388 --11202 --
NM_145052chrX1295 1889 2375 117 1157
NM_145055chr1833721 3338 653 11183 43665 3188 3050 808 --
NM_145117chr1132572 2178 2036 --22984 1033 --
NM_145175chr2----11016 --
NM_145203chr13----2240 119 1697
NM_145235chr10----1111 --
NM_145251chr1431289 1061 544 --11325 --
NM_145259chr266803 6717 5335 4899 4872 1746 14353 26249 4967 --
NM_145284chrX3648 222 56 --22194 197 --
NM_145307chr1053475 1868 684 524 343 13653 14143 --
NM_145320chr763615 2752 2474 1107 996 547 12392 --13141
NM_145321chr763615 2752 2474 1107 996 547 12392 --13141
NM_145322chr763615 2752 2474 1107 996 547 12392 --13141
NM_145686chr243224 3017 2613 2115 --11000 12205
NM_145687chr243224 3017 2613 2115 --11000 12205
NM_145698chr1041606 1392 800 88 --1129 --
NM_145716chr1----1170 --
NM_145753chr3----11184 11112
NM_147150chr922526 808 --23889 247 13730
NM_147175chrX--1301 11888 --
NM_147181chr431308 1088 561 ------
NM_147182chr431308 1088 561 ------
NM_147183chr431308 1088 561 ------
NM_148571chr1751343 615 565 344 315 ------
NM_148898chr71396 ------
NM_148899chr71396 ------
NM_148957chr1332664 1869 804 ------
NM_152227chr202550 480 --1102 1270
NM_152238chr11364 ------
NM_152261chr1272342 1948 1822 691 437 315 215 12223 12298 --
NM_152263chr176098 5737 4620 4471 4406 3815 390 --11348 1420
NM_152271chr84973 797 90 83 1993 ----
NM_152277chr532135 1551 597 --2532 123 --
NM_152281chr12901 124 1352 1610 --
NM_152282chr31955 --168 --
NM_152291chr41879 --1972 --
NM_152330chr141860 --1322 --
NM_152344chr1731529 555 332 --11259 --
NM_152401chr4129 ------
NM_152409chr51348 --23365 1259 --
NM_152417chr8131 ------
NM_152420chr9136 ------
NM_152423chrX21430 226 ------
NM_152433chr112626 27 --2695 480 1111
NM_152437chr1221880 457 12025 32260 2177 2140 --
NM_152444chr141200 --1130 --
NM_152510chr223829 807 697 ------
NM_152522chr21953 --1402 1979
NM_152529chr253405 2908 483 264 56 ----13575
NM_152536chr32345 289 ------
NM_152588chr1211887 ------
NM_152594chr1542221 734 568 466 --21821 898 2641 239
NM_152608chr142346 2015 658 109 --3986 896 199 --
NM_152609chr1------1460
NM_152622chr553261 3081 2837 2198 1388 --22878 876 12132
NM_152624chr5116781 6606 6461 5103 5085 4496 2383 1764 1213 793 541 --15633 27478 289
NM_152629chr973605 3047 1417 937 915 866 772 1635 1205 --
NM_152633chrX----1126 --
NM_152678chr352456 1669 890 718 165 1124 11875 --
NM_152682chr451637 1140 698 227 80 11575 ----
NM_152695chrX52262 1482 766 698 134 ----11734
NM_152699chr332860 2638 76 23512 336 11444 13165
NM_152707chr1041003 980 150 128 ------
NM_152709chr101298 ------
NM_152727chr161271 ------
NM_152737chr621445 812 --11729 12006
NM_152754chr743734 3147 2990 583 33713 2386 686 12516 --
NM_152756chr574100 4069 3988 3329 2772 2650 860 --13642 --
NM_152758chr832910 2626 470 11947 ----
NM_152788chr12177 ------
NM_152793chr774887 4287 3914 3194 1261 623 488 ----11268
NM_152835chr152584 2559 1908 1838 670 ------
NM_152836chr831487 737 566 --2704 479 --
NM_152837chr831487 737 566 --2704 479 --
NM_152857chr61903 --1672 --
NM_152858chr61903 --1672 --
NM_152890chr131188 1063 842 ------
NM_152896chr93727 562 215 1335 2678 250 --
NM_152903chr1352525 2471 2262 277 248 --21037 127 --
NM_152924chr1596075 5876 5300 5143 4727 4706 4224 2418 201 26481 195 31223 299 274 --
NM_152994chr21558 ------
NM_152996chr1------1759
NM_152999chr765053 4004 3301 1810 799 199 14790 ----
NM_153020chr641421 1362 1205 62 --31328 1323 376 --
NM_153181chr181223 ------
NM_153184chr321556 1531 --11218 --
NM_153188chr565310 5198 4580 4467 3892 1320 24688 3844 11922 15327
NM_153207chr1283846 3157 3025 2984 2900 1486 685 348 --13061 --
NM_153226chr10------1155
NM_153240chr3----1184 --
NM_153256chr1011817 --21516 554 --
NM_153260chr1531418 497 269 --1369 --
NM_153261chr161223 --1629 --
NM_153262chr143190 1131 963 189 --1359 --
NM_153371chr1351748 1567 645 320 247 21832 175 22301 826 --
NM_153374chr151163 ------
NM_153607chr563200 2947 2512 2305 2152 1221 --22426 1133 --
NM_153616chr1522193 1688 ------
NM_153617chr1522193 1688 ------
NM_153618chr1522193 1688 ------
NM_153633chr122822 769 ------
NM_153686chr442350 278 224 92 11972 12402 --
NM_153689chr2--1214 1638 --
NM_153704chr82398 70 ------
NM_153712chr252691 2594 815 492 308 --13507 --
NM_153810chr1054727 4489 1731 1173 770 13649 1887 --
NM_153816chr61386 ----1121
NM_170674chr15----1903 --
NM_170677chr15----1903 --
NM_170679chr55952 325 304 194 51 ------
NM_170692chr11223 ------
NM_170706chr194128 2671 1710 1661 884 387 348 309 200 --13554 24088 1564
NM_170710chr473019 3005 1178 810 770 544 146 ------
NM_170719chr1311177 --11306 --
NM_170721chr1711084 ------
NM_170731chr1122763 875 --1597 --
NM_170732chr1122763 875 --1597 --
NM_170733chr1122763 875 --1597 --
NM_170734chr1122763 875 --1597 --
NM_170735chr1122763 875 --1597 --
NM_172069chr212006 ------
NM_172070chr221732 226 ------
NM_172159chr341575 1489 782 116 12283 ----
NM_172160chr341575 1489 782 116 12283 ----
NM_172218chr81182 ------
NM_172315chr15----1903 --
NM_172316chr15----1903 --
NM_172344chr211201 --11450 --
NM_173083chr121243 502 1843 1447 --
NM_173157chr12162 ------
NM_173167chr1712558 1717 ----
NM_173198chr932940 2583 2553 ------
NM_173200chr932940 2583 2553 ------
NM_173214chr1647595 2238 667 406 36458 6237 1348 26570 1624 17381
NM_173216chr342497 1935 1918 569 --22430 2360 --
NM_173217chr342497 1935 1918 569 --22430 2360 --
NM_173354chr2132176 626 435 --2594 136 --
NM_173468chr442088 1990 1400 1362 24023 1829 21474 1255 --
NM_173469chr1521302 125 1111 11098 --
NM_173470chrX52800 1955 1778 765 120 12579 11027 --
NM_173478chr173964 393 230 ------
NM_173495chrX22319 1878 1827 ----
NM_173500chr15----11155 --
NM_173510chr2212922 --1785 1536
NM_173531chr1933531 2695 1542 13694 12781 22806 2757
NM_173552chr31346 ------
NM_173557chr18----1497 --
NM_173576chr1031899 1834 1540 --21460 141 --
NM_173582chr1145584 1198 721 331 24627 411 24597 2336 --
NM_173602chr1253610 3367 3221 2627 1479 --33539 2968 2489 --
NM_173647chr21383 11099 1828 --
NM_173670chr54701 222 106 42 --1912 --
NM_173681chr711878 ------
NM_173694chrX42375 1881 1865 1612 ----1295
NM_173797chr521025 426 ------
NM_173808chr143627 2980 1711 66 --24232 876 --
NM_173814chr15197 ------
NM_173822chr211424 --21435 119 --
NM_173829chr5115682 5515 5460 5307 5045 2442 1769 1655 1057 710 653 --15949 --
NM_173851chr81947 12871 43919 3450 1381 142 --
NM_174887chr171306 ------
NM_174909chr52808 279 ------
NM_174916chr1562269 2205 2066 2044 1746 1517 --1379 --
NM_174938chr92371 71 ----1196
NM_175061chr751842 1740 886 807 671 1453 ----
NM_175607chr361546 1166 1116 537 290 54 ----11441
NM_175612chr361546 1166 1116 537 290 54 ----11441
NM_175623chr1246041 2645 1800 1345 --2914 185 --
NM_175634chr831269 1204 1188 ------
NM_175635chr831269 1204 1188 ------
NM_175636chr831269 1204 1188 ------
NM_175736chr12117731 7519 7228 7001 6550 6449 5342 2087 1404 936 396 ------
NM_175854chr1352181 1016 867 643 557 12199 22336 2004 --
NM_175863chr62845 259 --1859 --
NM_175884chr721260 508 11155 11271 --
NM_175907chr1831999 1072 246 11784 184 --
NM_175921chr584271 3921 3218 3000 2891 1220 978 705 13728 14118 --
NM_176814chr71462 --1402 11131
NM_176863chr1762102 2015 1940 1692 755 358 --21459 153 1127
NM_177438chr1413901 12773 34213 621 203 --
NM_177553chr112843 700 --171 1818
NM_177559chr201845 --1292 1880
NM_177560chr201845 --1292 1880
NM_177947chrX21675 1629 --1411 --
NM_177948chrX21675 1629 --1411 --
NM_177974chr1532148 2003 437 ------
NM_177976chr3----1357 --
NM_177985chr232063 339 191 ------
NM_177989chr32280 57 ------
NM_177990chr2031398 822 636 --11518 --
NM_178042chr32280 57 ------
NM_178120chr2----11315 --
NM_178123chr21380 --11005 --
NM_178151chrX85937 5375 5099 4778 2956 2194 1911 1905 --15536 --
NM_178152chrX85937 5375 5099 4778 2956 2194 1911 1905 --15536 --
NM_178153chrX85937 5375 5099 4778 2956 2194 1911 1905 --15536 --
NM_178154chr141677 --1824 --
NM_178155chr141677 --1824 --
NM_178156chr141677 --1824 --
NM_178157chr141677 --1824 --
NM_178422chr11949 ------
NM_178424chr51561 ------
NM_178454chr12737 673 ------
NM_178507chr111747 ------
NM_178509chr1733281 1634 594 ----1224
NM_178539chr1211577 ------
NM_178566chr941535 1454 1292 310 --11321 --
NM_178812chr81272 --21473 565 --
NM_180989chr1332446 1517 89 --22395 604 --
NM_181054chr142318 269 ------
NM_181265chr473019 3005 1178 810 770 544 146 ------
NM_181302chr141599 ------
NM_181308chr141599 ------
NM_181332chrX32451 2315 293 ------
NM_181354chr8----41417 1394 620 530 --
NM_181358chr143646 3255 2785 1567 23943 630 12858 --
NM_181442chr201105 --2923 911 --
NM_181443chr2032923 2774 1001 --2676 47 --
NM_181453chr2----11491 --
NM_181457chr22263 170 --21236 508 --
NM_181459chr22162 69 --21135 407 --
NM_181460chr22209 116 --21182 454 --
NM_181481chr18116607 6310 5928 5922 5380 4371 2775 1977 1569 1160 199 27017 5407 26735 6689 15751
NM_181482chr18116607 6310 5928 5922 5380 4371 2775 1977 1569 1160 199 27017 5407 26735 6689 15751
NM_181483chr18116607 6310 5928 5922 5380 4371 2775 1977 1569 1160 199 27017 5407 26735 6689 15751
NM_181492chr221300 ------
NM_181504chr573624 3499 3457 3135 1561 1420 443 13394 ----
NM_181523chr573624 3499 3457 3135 1561 1420 443 13394 ----
NM_181524chr573624 3499 3457 3135 1561 1420 443 13394 ----
NM_181670chr121949 --11478 --
NM_181689chr201805 ------
NM_181705chr564338 1248 1178 737 652 410 ------
NM_181782chr622175 836 ----1861
NM_181784chr221793 1719 1558 32560 2090 470 --
NM_181836chr532014 970 758 22031 505 11789 11026
NM_182485chr453378 1323 1271 976 941 --13610 --
NM_182493chr1674949 4464 4080 3297 1882 1068 674 1662 12164 14476
NM_182517chr11685 ------
NM_182551chr243526 2173 1382 758 13150 21102 683 --
NM_182607chrX31723 510 266 --11356 --
NM_182643chr81789 ------
NM_182646chr453378 1323 1271 976 941 --13610 --
NM_182666chr31214 ------
NM_182678chr2--1197 ----
NM_182763chr172629 2381 2032 883 745 586 265 1627 --22674 2254
NM_182767chr1231551 511 333 ----11350
NM_182789chr52427 290 --1416 --
NM_182796chr51797 ------
NM_182848chr132557 272 1166 1484 --
NM_182898chr732042 1019 245 1167 25859 2511 1894
NM_182899chr732042 1019 245 1167 25859 2511 1894
NM_182907chr622385 1784 ----1521
NM_182931chr72707 298 ----1286
NM_182964chr1132572 2178 2036 --22984 1033 --
NM_182975chr111034 1787 ----
NM_182976chr1----2193 188 --
NM_183043chr13134 --1877 --
NM_183044chr13134 --1877 --
NM_183323chr52427 290 --1416 --
NM_183393chr3--168 ----
NM_183394chr3--168 ----
NM_183419chr82979 54 1171 ----
NM_183422chr132918 193 --1726 --
NM_184085chr82726 638 --1668 --
NM_184086chr82726 638 --1668 --
NM_184087chr82726 638 --1668 --
NM_194247chr2123872 3785 3767 3718 3659 3604 3268 2904 2833 1402 789 419 --13914 11419
NM_194282chr463072 3058 2953 2409 2067 1121 1185 ----
NM_194291chr852422 2052 2034 1071 190 --2715 693 --
NM_194314chr145627 4029 335 233 --1102 --
NM_194328chr972423 1275 1014 810 599 563 264 --21236 26 --
NM_194329chr972423 1275 1014 810 599 563 264 --21236 26 --
NM_194330chr972423 1275 1014 810 599 563 264 --21236 26 --
NM_194332chr972423 1275 1014 810 599 563 264 --21236 26 --
NM_194356chr1231495 842 668 ------
NM_194442chr131502 1217 623 --11175 --
NM_197941chr543070 2861 891 617 ------
NM_197968chr13------1529
NM_198066chr1422885 944 1484 21971 1136 --
NM_198081chr652535 2039 1863 1068 260 --22403 785 11024
NM_198128chr18----1123 --
NM_198158chr332207 2017 522 --12754 1606
NM_198159chr332207 2017 522 --12754 1606
NM_198173chr11797 ------
NM_198174chr11797 ------
NM_198177chr332207 2017 522 --12754 1606
NM_198178chr332207 2017 522 --12754 1606
NM_198189chr23905 262 255 ------
NM_198215chr102341 110 ------
NM_198240chr1231317 195 161 ------
NM_198267chr71612 ------
NM_198268chr143646 3255 2785 1567 23943 630 12858 --
NM_198269chr143646 3255 2785 1567 23943 630 12858 --
NM_198270chrX33419 3076 186 --21334 1299 --
NM_198273chr582849 2820 2795 2759 1934 1114 198 163 --12248 --
NM_198279chrX1133 --1855 --
NM_198353chr4----1155 --
NM_198391chr202242 232 --11063 --
NM_198400chr1551856 1019 1008 800 497 ------
NM_198401chr841388 550 535 390 ------
NM_198439chr112626 27 --2695 480 1111
NM_198450chrX31993 843 294 32262 2024 601 ----
NM_198467chr73618 579 435 ------
NM_198468chr643216 2891 1209 1002 11058 44571 3261 1080 874 1244
NM_198485chr342022 1742 410 131 12464 ----
NM_198506chr4----21085 272 --
NM_198549chr142849 2307 2120 1102 ------
NM_198569chr622220 735 21939 633 22271 920 --
NM_198581chr287333 7097 6588 5904 2231 2142 1838 70 1725 1354 --
NM_198584chr831758 183 121 --22288 2034 --
NM_198700chr111483 ------
NM_198793chr363030 2632 2623 1362 794 120 21177 154 --1186
NM_198889chr431080 300 291 1207 ----
NM_198896chr111808 11540 ----
NM_198900chr12117731 7519 7228 7001 6550 6449 5342 2087 1404 936 396 ------
NM_198902chr15------195
NM_198903chr51576 ------
NM_198904chr51576 ------
NM_199000chr721605 429 1580 ----
NM_199072chr743099 2159 1236 203 ----12032
NM_199132chr1932103 1639 719 ------
NM_199167chr181141 --1351 --
NM_199168chr1021554 311 ------
NM_199188chr1253374 3331 1304 967 637 13289 23279 626 --
NM_199189chr54748 634 320 119 ----1943
NM_199190chr1253374 3331 1304 967 637 13289 23279 626 --
NM_199191chr21241 ------
NM_199194chr21241 ------
NM_199205chr81290 ------
NM_199246chr511306 --11211 --
NM_199320chr462908 2873 2373 2130 2065 910 12560 ----
NM_199320chr462908 2873 2373 2130 2065 910 12560 ----
NM_199328chr21----11078 --
NM_199413chr151182 --175 --
NM_199421chr1473739 3189 1617 1437 1372 649 152 ------
NM_199462chr173592 3528 3362 1495 621 441 414 --1493 133
NM_199482chr221595 107 ------
NM_201269chr11417 ------
NM_201570chr1021322 754 ------
NM_201571chr1021322 754 ------
NM_201572chr1021322 754 ------
NM_201590chr1021322 754 ------
NM_201591chr471805 1631 770 725 543 414 257 --1395 --
NM_201592chr471805 1631 770 725 543 414 257 --1395 --
NM_201593chr1021322 754 ------
NM_201596chr1021322 754 ------
NM_201597chr1021322 754 ------
NM_201613chr122724 226 ------
NM_201624chr121015 399 1978 2894 194 --
NM_201999chr411142 --1979 11189
NM_203282chr19------21750 1237
NM_203283chr41406 ------
NM_203284chr41406 ------
NM_203291chr18--151 ----
NM_203292chr18--144 ----
NM_203304chr19----1287 --
NM_203342chr132947 1227 870 --1923 --
NM_203343chr132947 1227 870 --1923 --
NM_203350chr121680 386 --21096 1084 --
NM_203365chr2----1582 --
NM_203394chr1242558 2410 2294 506 ------
NM_203458chr163583 3233 3068 2993 1208 717 --1978 1686
NM_203459chr121783 305 --22385 542 --
NM_203504chr442482 1763 874 733 --12556 1669
NM_203505chr442482 1763 874 733 --12556 1669
NM_205768chr121934 766 --32037 1798 548 11780
NM_206594chr131173 867 297 --22860 412 189
NM_206595chr131173 867 297 --22860 412 189
NM_206853chr644085 2542 831 164 --54047 2882 2799 1277 836 --
NM_206854chr645346 3803 2092 1425 --45308 4143 4060 2097 --
NM_206855chr636311 4768 2390 --36273 5108 5025 --
NM_206866chr214738 602 268 111 --1422 --
NM_206907chr53923 672 282 11315 --12448
NM_206909chr8106470 5869 5499 5390 5087 2853 965 405 148 65 --31537 1153 520 --
NM_207012chr1032865 703 191 1144 13549 198
NM_207015chr321512 387 1566 ----
NM_207123chr41575 --1598 1584
NM_207170chr13859 597 101 ------
NM_207174chr211570 ------
NM_207303chr1033375 2812 1418 13980 24021 3969 --
NM_207304chr131893 1304 ----
NM_207317chr51356 ------
NM_207325chr1931927 757 471 ------
NM_207418chr1_random180 1152 1910 --
NM_207517chr1531664 1455 510 ------
NM_207627chr211570 ------
NM_207628chr211570 ------
NM_207629chr211570 ------
NM_207647chr922493 1863 --32410 789 413 --
NM_212460chr731721 653 44 ------
NM_212471chr1732104 623 520 ----11906
NM_212472chr1732104 623 520 ----11906
NM_212474chr21949 --1985 --
NM_212475chr21949 --1985 --
NM_212476chr21949 --1985 --
NM_212478chr21949 --1985 --
NM_212482chr21949 --1985 --
NM_213654chr331077 447 369 ------