TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-708-5p
miRNA Sequence: AAGGAGCUUACAAUCUAGCUGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51269 ------
NM_000020chr12122341 2207 1886 1876 1556 1550 1535 875 524 474 297 214 ------
NM_000021chr142943 128 ------
NM_000024chr51495 --1211 --
NM_000035chr92292 26 136 ----
NM_000037chr872255 1951 1945 1657 1556 830 609 ------
NM_000038chr51778 ------
NM_000052chrX42555 807 696 175 1108 --12441
NM_000068chr1931501 451 71 ----11142
NM_000084chrX106423 6302 5819 5561 2645 1744 1520 950 824 537 36682 6548 1751 46287 5228 4853 2536 --
NM_000088chr1781215 1145 1093 969 865 508 365 25 ------
NM_000090chr22617 54 ------
NM_000092chr2113951 3613 3312 3131 3083 3069 2992 2957 398 156 116 --21013 593 11661
NM_000093chr951927 1835 1591 103 21 ------
NM_000097chr3--1999 1991 --
NM_000104chr2197 --2197 81 --
NM_000109chrX72320 2078 1993 1962 1923 1064 902 ------
NM_000115chr13------1266
NM_000125chr682947 2917 1717 1572 862 683 434 230 11288 44078 1218 792 277 --
NM_000129chr631321 251 128 --182 --
NM_000134chr41435 ------
NM_000138chr1541780 501 375 200 ------
NM_000141chr1031313 1058 1033 ------
NM_000161chr1421960 1327 --1652 --
NM_000165chr621643 266 ------
NM_000168chr783218 2828 2428 2296 2290 2169 1004 961 1655 1695 --
NM_000176chr533455 3142 3052 1688 --12451
NM_000183chr21193 --199 193
NM_000189chr22831 199 --11922 --
NM_000194chrX2554 209 ------
NM_000208chr1994534 4429 4025 3138 1326 1296 483 372 237 1126 23515 560 --
NM_000214chr2031581 300 265 ------
NM_000216chrX72895 2814 2520 1578 616 592 209 1568 11403 --
NM_000217chr1235324 2051 1613 ------
NM_000238chr7--1319 1127 --
NM_000244chr113787 491 41 --1304 --
NM_000245chr731799 338 92 ------
NM_000248chr322019 1926 --12052 --
NM_000258chr32231 194 ------
NM_000259chr1555714 5115 2433 1800 183 14073 23882 1869 11457
NM_000264chr983172 2875 2054 1327 574 323 305 242 ------
NM_000266chrX2194 24 ------
NM_000267chr1763442 2741 2138 986 367 45 1720 13318 12814
NM_000278chr10122083 1858 1768 1697 1677 1636 1562 767 749 739 40 26 ------
NM_000284chrX31625 651 446 11684 31895 1867 1496 --
NM_000286chr171647 ----1336
NM_000291chrX----123 --
NM_000304chr17------1941
NM_000314chr10----22689 1051 --
NM_000315chr11176 ------
NM_000318chr832745 2718 279 1108 --12442
NM_000321chr1341374 1276 1239 379 --1117 --
NM_000325chr4----1161 --
NM_000328chrX1455 ----1133
NM_000330chrX22111 706 --1436 --
NM_000332chr696642 5478 4546 4524 4362 1687 1270 540 239 35561 5355 1752 22295 960 --
NM_000334chr1762176 699 534 213 114 51 1714 1599 --
NM_000337chr576280 5976 5453 4863 2313 776 465 14263 24708 1349 --
NM_000340chr341051 1027 446 269 11116 ----
NM_000345chr42791 70 ------
NM_000346chr17--1522 ----
NM_000351chrX63879 2992 2910 1668 613 544 --13748 --
NM_000353chr162136 65 ------
NM_000361chr2051535 1507 1310 438 27 1637 ----
NM_000362chr22103395 3334 3203 2942 2922 2711 1431 679 367 48 ------
NM_000378chr1121147 146 ------
NM_000390chrX33227 3042 2845 --12523 --
NM_000399chr10129 ----11108
NM_000408chr232741 805 663 --22337 2288 12268
NM_000411chr2143065 2042 664 388 22878 2163 ----
NM_000428chr142864 166 ------
NM_000430chr1743616 2800 1278 78 ----1751
NM_000439chr532434 1762 40 ----1280
NM_000448chr112200 67 --1857 --
NM_000449chr131079 398 77 --21334 1013 --
NM_000451chrX41372 456 157 41 --2131 93 --
NM_000452chr1322019 29 1663 21515 780 --
NM_000461chr343306 1760 786 289 --53581 3232 1116 886 70 --
NM_000462chr1521820 1804 ------
NM_000476chr941376 429 306 267 ------
NM_000478chr1----1646 --
NM_000480chr111443 21283 251 ----
NM_000484chr211430 ------
NM_000489chrX42999 2648 1090 521 11081 ----
NM_000492chr721085 316 ------
NM_000493chr62343 227 ------
NM_000494chr102284 201 --124 --
NM_000503chr811382 --1346 --
NM_000516chr201229 ------
NM_000523chr231008 756 472 ------
NM_000533chrX41704 1483 1438 220 ------
NM_000539chr361512 1394 1378 1037 162 120 ----11439
NM_000555chrX107825 7800 5930 5354 2628 2293 1841 1617 997 494 23145 2758 22889 2572 --
NM_000567chr13904 754 461 1940 ----
NM_000598chr721351 476 ------
NM_000599chr284475 4048 3759 3696 3664 3139 1676 1084 ----11064
NM_000609chr1092793 2704 2521 2390 2355 919 451 302 45 --12159 --
NM_000610chr1152570 961 817 518 247 1293 11979 12255
NM_000611chr1176633 6100 5009 4409 337 265 39 11014 66413 5625 4844 2260 1051 21 --
NM_000615chr1132158 890 52 --21966 628 --
NM_000618chr1245949 4254 2057 1478 --34165 4062 762 --
NM_000618chr1245949 4254 2057 1478 --34165 4062 762 --
NM_000633chr1865051 4236 3475 1539 537 336 ------
NM_000636chr61508 --134 --
NM_000680chr8----174 --
NM_000682chr24614 370 186 58 ------
NM_000689chr9----3341 167 29 --
NM_000693chr1521211 406 11567 ----
NM_000706chr121645 ------
NM_000719chr12176617 6469 5616 5426 5106 4772 4749 4471 4439 2342 1349 1105 702 688 663 609 515 148 16305 --
NM_000721chr142080 2009 907 30 1397 11685 1451
NM_000723chr1751603 1416 1249 501 165 ------
NM_000724chr1021505 1416 11240 ----
NM_000725chr123857 214 135 --1660 --
NM_000739chr72292 164 ----171
NM_000756chr8--187 1387 --
NM_000800chr52453 409 2212 139 ----
NM_000801chr204962 932 789 26 ------
NM_000807chr41674 ------
NM_000811chr53549 134 94 ------
NM_000813chr575105 5018 4640 4563 1564 815 164 --11770 --
NM_000814chr1553926 1361 791 558 550 --12720 --
NM_000817chr21982 ------
NM_000820chr133266 67 26 ------
NM_000827chr532450 1597 42 --1772 --
NM_000829chr11----22250 1880 --
NM_000831chr1155944 5735 5634 5512 5056 4758 4016 3884 1978 1919 1822 1672 1414 961 886 1707 14070 25491 358
NM_000833chr1631008 593 142 ------
NM_000834chr1221294 108 1153 21136 335 --
NM_000838chr622296 2161 --32718 850 544 --
NM_000840chr7165 ------
NM_000844chr32285 110 ------
NM_000845chr71358 ------
NM_000859chr541411 1269 222 145 11292 11226 --
NM_000861chr362609 2229 2108 1959 1730 324 ------
NM_000866chr311439 1250 ----
NM_000872chr1051387 1002 319 297 234 --2513 63 --
NM_000875chr15105170 4895 4744 2252 2117 1577 970 953 765 179 25589 1137 1150 --
NM_000883chr71515 --2449 117 --
NM_000883chr71515 --2449 117 --
NM_000891chr1752947 2274 1276 320 161 ------
NM_000899chr1231704 1640 342 --11593 --
NM_000901chr442296 971 249 243 22417 2395 ----
NM_000919chr51158 ------
NM_000921chr122518 267 1497 --1219
NM_000922chr11------1313
NM_000926chr1179070 8283 7907 7714 7383 2627 879 --28092 7983 --
NM_000933chr2011383 ------
NM_000934chr172678 565 1276 1668 --
NM_000935chr32977 951 ------
NM_000944chr411652 ------
NM_000945chr211495 ------
NM_000949chr51108 --1116 1650
NM_000959chr163421 3399 2920 2710 1603 764 11539 ----
NM_000963chr11712 ------
NM_000965chr3145 ----1248
NM_000983chr141363 1172 550 370 ------
NM_001001132chr2121475 1177 ------
NM_001001323chr1233051 786 766 1140 ----
NM_001001389chr1152570 961 817 518 247 1293 11979 12255
NM_001001390chr1152570 961 817 518 247 1293 11979 12255
NM_001001391chr1152570 961 817 518 247 1293 11979 12255
NM_001001392chr1152616 1007 863 564 293 1339 12025 12301
NM_001001395chr1242656 1879 782 366 --12243 --
NM_001001396chr1134297 3947 3917 3554 2976 1503 1322 980 613 256 239 168 55 1146 ----
NM_001001419chr545081 1982 1208 1055 11139 13496 --
NM_001001420chr545081 1982 1208 1055 11139 13496 --
NM_001001433chr2053029 2694 2343 1068 662 --22818 1142 --
NM_001001438chr212314 261 ------
NM_001001481chr81291 --1722 13046
NM_001001484chr1011733 --1462 --
NM_001001522chr11----2158 43 --
NM_001001523chr131102 986 347 --2267 119 --
NM_001001549chr732503 2480 579 --12780 --
NM_001001550chr732503 2480 579 --12780 --
NM_001001555chr732503 2480 579 --12780 --
NM_001001556chr152510 155 ------
NM_001001557chr821584 694 ------
NM_001001560chr221124 ------
NM_001001586chr11386 187 ----
NM_001001661chr73766 113 53 ------
NM_001001664chr253669 3506 2640 1486 309 ------
NM_001001668chr19--31441 129 23 13738 --
NM_001001740chr11235 ------
NM_001001740chr11235 ------
NM_001001787chr11472 ------
NM_001001852chr221187 --1312 --
NM_001001890chr2184018 3986 3643 3536 3466 1139 590 335 ------
NM_001001933chr1----1508 --
NM_001001974chr1032062 1997 675 162 11913 --
NM_001001995chrX51937 1510 1217 467 40 ------
NM_001002006chr22561 116 ------
NM_001002031chr12157 ------
NM_001002259chr12--1111 ----
NM_001002265chr102212 129 --1265 --
NM_001002266chr102212 129 --1265 --
NM_001002269chr91453 ------
NM_001002295chr10------1944
NM_001002814chr863502 2864 2824 794 469 99 --1538 1388
NM_001002838chrX1341 --11355 --
NM_001002860chr1464278 4248 4183 4174 3719 515 24640 3128 ----
NM_001002909chr1741833 1577 592 341 --1904 --
NM_001003396chr6286 47 --1534 --
NM_001003397chr6286 47 --1534 --
NM_001003406chr22133080 3028 2784 2559 2516 2409 2062 2045 1126 1057 962 765 588 --22474 810 --
NM_001003407chr10135054 5014 4790 4758 4562 4116 3715 1689 1625 1143 791 756 562 11869 22046 609 11261
NM_001003408chr10135054 5014 4790 4758 4562 4116 3715 1689 1625 1143 791 756 562 11869 22046 609 11261
NM_001003652chr1888410 6435 5986 5464 3240 2302 1092 398 28647 7665 11824 15966
NM_001003674chr18116464 5584 5362 4617 2660 2487 2481 2219 1952 1196 861 --1551 --
NM_001003675chr18116464 5584 5362 4617 2660 2487 2481 2219 1952 1196 861 --1551 --
NM_001003682chr151362 1231 1225 1219 409 --11098 11030
NM_001003683chr2138 ------
NM_001003712chr12--14068 ----
NM_001003799chr71250 1630 1579 --
NM_001003800chr952831 1308 1122 396 180 --11508 --
NM_001003809chr182219 60 ------
NM_001003845chr23483 224 168 ------
NM_001004065chr923794 3040 ------
NM_001004067chr161350 ------
NM_001004127chr131893 --1351 --
NM_001004304chr12103224 2997 2835 2683 2546 2023 1250 485 308 173 --1520 --
NM_001004308chrX41372 1268 1059 584 ------
NM_001004342chr1155750 5442 5349 2451 2299 2143 2032 2014 1720 1455 1389 1312 1246 1030 976 --55879 4386 2224 1937 511 --
NM_001004360chr21749 ------
NM_001004722chr23271 243 146 ------
NM_001005209chr24673 199 188 38 ------
NM_001005217chr43360 60 34 ------
NM_001005271chr174831 816 736 368 --1148 --
NM_001005273chr174831 816 736 368 --1148 --
NM_001005354chr12158 ------
NM_001005366chr121766 --1683 --
NM_001005375chrY11393 21828 1219 ----
NM_001005377chr19164 --1215 --
NM_001005386chr221879 910 --32214 1621 512 --
NM_001005404chr1763878 3750 2837 563 456 221 24388 3838 2898 557 --
NM_001005463chr1032431 1972 729 ------
NM_001005473chr585745 5541 4692 4287 4113 2346 863 386 ------
NM_001005476chr21193 ------
NM_001005732chr21132 ------
NM_001005733chr21132 --1225 --
NM_001005739chr21645 ------
NM_001005743chr141544 ------
NM_001005744chr141544 ------
NM_001005745chr141544 ------
NM_001005781chr21225 ------
NM_001005782chr22741 674 ------
NM_001005845chr851709 377 356 285 188 ----1228
NM_001005910chr31517 ------
NM_001005911chr31517 ------
NM_001005920chr1651001 402 387 271 259 ------
NM_001006115chr392752 2685 2634 2585 1931 957 873 695 206 --1489 --
NM_001006600chr5----11977 --
NM_001006605chr13945 470 283 ------
NM_001006605chr13945 470 283 ------
NM_001006626chr72292 164 ----171
NM_001006627chr72292 164 ----171
NM_001006628chr72292 164 ----171
NM_001006629chr72292 164 ----171
NM_001006630chr72292 164 ----171
NM_001006631chr72292 164 ----171
NM_001006632chr72292 164 ----171
NM_001006938chrX1580 ------
NM_001006946chr271689 1524 1299 312 178 167 134 ------
NM_001007024chr1753693 3654 2722 1649 350 --34319 3685 956 14181
NM_001007025chr1753693 3654 2722 1649 350 --34319 3685 956 14181
NM_001007026chr12--2484 32 ----
NM_001007067chr81997 ------
NM_001007068chr81997 ------
NM_001007069chr81997 ------
NM_001007070chr81997 ------
NM_001007075chr41944 ------
NM_001007097chr964499 3638 1418 1355 377 264 --1689 --
NM_001007098chr11308 --1316 --
NM_001007156chr1591848 1683 1651 1269 1262 771 746 220 71 --1247 --
NM_001007226chr1721009 562 ------
NM_001007227chr1721009 562 ------
NM_001007228chr1721009 562 ------
NM_001007229chr1721009 562 ------
NM_001007230chr1721009 562 ------
NM_001007237chr13327 267 139 ------
NM_001007246chr2131546 1377 759 --1369 --
NM_001007257chr131254 1218 269 --1455 --
NM_001007277chr11272 53 --1177 --
NM_001007538chr1321167 23 --11380 --
NM_001007553chr1----1959 1813
NM_001007559chr1811649 ------
NM_001007565chr31274 ------
NM_001008222chrX21253 1182 ------
NM_001008225chr71124 ------
NM_001008239chr1893509 3217 2502 2414 1410 1137 582 90 84 --12643 --
NM_001008391chr112199 91 ------
NM_001008401chr1921447 1425 ------
NM_001008408chr795926 5615 5432 4038 1901 1088 773 604 486 1640 25961 5556 13964
NM_001008495chr821850 503 1637 ----
NM_001008539chr855300 4857 1617 1385 660 14796 ----
NM_001008541chr1021771 810 11716 12094 --
NM_001008541chr1021771 810 11716 12094 --
NM_001008564chr1331471 889 400 ------
NM_001008660chr1111355 ------
NM_001008701chr19102895 2762 2442 2309 2273 764 625 503 433 223 12780 2611 387 --
NM_001008707chr1411245 ------
NM_001008738chr522344 2128 12255 ----
NM_001008777chr171224 ------
NM_001008801chr1922105 567 ------
NM_001008860chr151809 --1750 --
NM_001008892chr151809 --1750 --
NM_001008894chr151809 --1750 --
NM_001008925chr41367 --13046 --
NM_001008938chr111171 --1386 --
NM_001009554chr463984 2950 2883 1378 1315 49 --13649 13258
NM_001009554chr463984 2950 2883 1378 1315 49 --13649 13258
NM_001009555chr42353 23 ------
NM_001009566chr14591 577 193 164 11205 ----
NM_001009812chr2176 ------
NM_001009899chr3105224 4694 4432 4262 2541 2434 2302 1409 1011 577 --21974 456 15191
NM_001009955chr1------1408
NM_001009955chr1------1408
NM_001009958chr72479 33 --2220 68 --
NM_001009959chr232501 1969 1018 ------
NM_001009960chr722157 2106 --1769 --
NM_001009993chr254275 3842 3218 1660 1196 14199 ----
NM_001010857chr11105 ------
NM_001010861chr142615 2157 856 632 --1172 --
NM_001010867chr1216650 6129 5938 5878 5770 5598 4765 4143 4119 4096 2580 1580 1388 1268 962 885 831 640 335 280 251 --25717 2668 14866
NM_001010888chrX43282 1494 1466 1329 13146 --1932
NM_001010891chr535633 4512 1170 --26744 4879 25723 2487
NM_001010898chr153549 3433 731 495 199 1909 43177 3069 2673 2644 --
NM_001010917chr1072053 1889 1714 1577 1460 470 88 ------
NM_001010935chr13167 111 22 --1800 --
NM_001010942chr123819 446 23 ----1417
NM_001010971chr11883 ------
NM_001010980chr132231 778 82 13364 195 --
NM_001010986chrX1257 ------
NM_001011513chr412941 22803 1415 ----
NM_001011537chr332404 1504 265 ------
NM_001011546chr202827 29 ------
NM_001011553chr72397 211 ------
NM_001011663chr103754 671 43 ------
NM_001011666chr755721 4550 4491 4432 635 --25686 4349 --
NM_001011708chr252847 2091 1190 1101 345 12887 12743 21791 883
NM_001011713chr1421576 341 ----1112
NM_001011722chr11451 ------
NM_001011722chr11451 ------
NM_001011885chr151137 11543 ----
NM_001012329chr172379 1771 1516 491 350 341 59 ----12226
NM_001012333chr11----1318 --
NM_001012334chr11----1318 --
NM_001012393chr1174182 1721 1347 290 258 90 37 --21755 1605 --
NM_001012398chr161885 ------
NM_001012426chr6122092 1252 941 914 858 793 774 705 631 505 322 140 12573 ----
NM_001012427chr6122092 1252 941 914 858 793 774 705 631 505 322 140 12573 ----
NM_001012614chr42591 208 ------
NM_001012732chr431262 1020 299 11189 11005 --
NM_001012755chrX63134 3099 1213 1055 348 136 --11093 --
NM_001012980chrX--141 ----
NM_001013031chr1043268 3046 2414 504 --21002 400 --
NM_001013398chr721351 476 ------
NM_001013438chr3149 --1269 1170
NM_001013439chr3----1115 --
NM_001013624chr173980 952 105 --1847 1338
NM_001013635chr1231021 234 111 --1859 --
NM_001013690chr1272286 2179 2141 618 508 484 175 --11769 --
NM_001013693chr182673 2629 2547 2277 850 794 781 171 --2404 256 --
NM_001013693chr182673 2629 2547 2277 850 794 781 171 --2404 256 --
NM_001014283chr1341774 1600 745 565 --2186 69 --
NM_001014286chr13123 ------
NM_001014442chr13--1133 ----
NM_001014809chr44712 339 315 131 1926 ----
NM_001014972chr2--1235 ----
NM_001015045chr441926 1585 143 71 11642 ----
NM_001015048chr1433138 2476 2136 152 22532 2363 --
NM_001015049chr1433138 2476 2136 152 22532 2363 --
NM_001015055chr22376 113 ------
NM_001015056chr22376 113 ------
NM_001015056chr22376 113 ------
NM_001015877chrX63027 2634 812 619 555 317 --12627 --
NM_001015880chr1041649 251 87 36 --11131 --
NM_001015881chrX3389 266 74 1410 ----
NM_001015887chr311169 ------
NM_001017368chr1762818 2420 998 873 779 712 --22091 1026 --
NM_001017369chr43804 259 72 1253 11100 --
NM_001017371chr211083 165 ----
NM_001017395chr343263 3219 3024 2778 12388 12711 --
NM_001017405chr41232 ------
NM_001017415chr1--1563 1216 --
NM_001017416chr1--1563 1216 --
NM_001017423chr105583 183 140 133 79 --193 --
NM_001017424chr121829 56 ------
NM_001017425chr121829 56 ------
NM_001017440chr7117909 5362 5164 1970 1825 1593 1423 905 826 447 174 21479 687 27493 6698 --
NM_001017523chr1241872 1584 1492 140 ------
NM_001017923chr141669 ----11203
NM_001017961chr11154 ------
NM_001017973chr5172 185 ----
NM_001017974chr5172 185 ----
NM_001017975chr1----1199 --
NM_001017979chr41290 --1166 --
NM_001017995chr5164862 4567 4270 4153 4088 3670 3347 1873 1859 1828 1587 758 727 604 536 95 14028 14204 --
NM_001017999chr131708 714 638 --12151 11795
NM_001017999chr131708 714 638 --12151 11795
NM_001018000chr131708 714 638 --12151 11795
NM_001018000chr131708 714 638 --12151 11795
NM_001018001chr131708 714 638 --12151 11795
NM_001018005chr15165 --1161 --
NM_001018009chr31348 --1172 1282
NM_001018025chrX133 ------
NM_001018050chr2232106 175 153 --1686 --
NM_001018052chr2232106 175 153 --1686 --
NM_001018057chr1131361 162 90 ----1552
NM_001018064chr951921 1781 328 239 142 11678 ----
NM_001018065chr955696 5630 1581 138 25 --44334 4114 3737 2429 14905
NM_001018066chr955696 5630 1581 138 25 --44334 4114 3737 2429 14905
NM_001018067chr174871 4828 4607 3450 677 389 29 ------
NM_001018068chr174871 4828 4607 3450 677 389 29 ------
NM_001018069chr174871 4828 4607 3450 677 389 29 ------
NM_001018072chr1241872 1584 1492 140 ------
NM_001018074chr533455 3142 3052 1688 --12451
NM_001018075chr533455 3142 3052 1688 --12451
NM_001018076chr533455 3142 3052 1688 --12451
NM_001018077chr533455 3142 3052 1688 --12451
NM_001018108chr1572094 1965 1900 1851 1561 821 781 --11582 --
NM_001018111chr763253 2456 1398 974 542 40 11537 12651 --
NM_001018676chr82174 145 ------
NM_001018677chr82174 145 ------
NM_001020658chr11602 --1438 --
NM_001020658chr11602 --1438 --
NM_001020818chr1911720 11839 21848 1831 --
NM_001020819chr1911720 11839 21848 1831 --
NM_001020820chr1911720 11839 21848 1831 --
NM_001020821chr1911720 11839 21848 1831 --
NM_001020825chr52930 527 ------
NM_001023567chr152733 347 --1456 --
NM_001024024chr1431014 381 36 --1152 --
NM_001024070chr1431010 377 32 --1148 --
NM_001024071chr142982 349 --1120 --
NM_001024094chr533455 3142 3052 1688 --12451
NM_001024380chr872518 2033 838 383 229 145 42 ------
NM_001024381chr872518 2033 838 383 229 145 42 ------
NM_001024455chrX32341 823 731 1337 ----
NM_001024463chr154751 736 332 227 ------
NM_001024649chr542195 831 691 128 12773 1541 12112
NM_001024808chr1252523 2453 2380 1902 890 --1588 --
NM_001024847chr351906 710 671 539 349 ----12293
NM_001024858chr1492474 2380 2299 2270 2013 690 554 229 209 1415 22528 237 --
NM_001024934chr6162 ------
NM_001024935chr6162 ------
NM_001024936chr6162 ------
NM_001024937chr173772 244 42 --1226 --
NM_001024948chr142615 2318 1289 705 --13292 1627
NM_001024959chr34795 761 543 213 ------
NM_001024960chr34795 761 543 213 ------
NM_001025068chr331267 389 170 ------
NM_001025069chr331267 389 170 ------
NM_001025076chr10125791 5397 5162 5117 5021 4945 4798 3918 2249 2203 1119 792 24876 4865 35521 2236 2105 --
NM_001025077chr10107149 6755 6520 6475 6379 6303 6156 5276 2477 2150 26234 6223 16879 --
NM_001025079chr332652 2576 751 --23536 2554 --
NM_001025081chr1831559 451 243 --21142 37 --
NM_001025090chr1831559 451 243 --21142 37 --
NM_001025092chr1831559 451 243 --21142 37 --
NM_001025101chr1831559 451 243 --21142 37 --
NM_001025105chr521350 510 ------
NM_001025108chr232788 2682 627 1479 21190 213 --
NM_001025201chr2171 ------
NM_001025205chr34418 354 316 186 ------
NM_001025252chr832880 2269 211 --12262 12937
NM_001025253chr832880 2269 211 --12262 12937
NM_001025266chr394562 4468 4441 3794 3745 1322 879 802 607 --1155 24726 4225
NM_001025389chr111443 21283 251 ----
NM_001025390chr111443 21283 251 ----
NM_001025580chrX21088 133 --14025 --
NM_001025595chr431098 520 492 --11322 --
NM_001025596chr11----1125 --
NM_001025603chr131079 398 77 --21334 1013 --
NM_001025616chr441310 1250 757 344 11184 ----
NM_001029835chr7--1343 ----
NM_001029858chr642648 2085 839 487 ------
NM_001029863chr632258 2083 534 --22008 1194 --
NM_001029864chr2082021 1800 1705 1689 368 259 168 77 ------
NM_001029875chr542425 2065 2012 576 --2726 372 12078
NM_001029882chr1141 --1106 --
NM_001029882chr1141 --1106 --
NM_001029989chr151612 ------
NM_001030006chr1762616 2154 1978 1650 260 176 ----12190
NM_001030007chr1663859 1226 766 758 572 210 33742 1544 916 23706 2833 --
NM_001030055chr1422970 985 24716 1432 13142 --
NM_001031677chr52386 213 --2482 63 --
NM_001031680chr162151 1746 744 630 80 72 1643 ----
NM_001031685chr11337 1371 ----
NM_001031690chr772651 2244 2060 1947 592 271 123 --21134 812 12405
NM_001031694chr12232 221 --1778 --
NM_001031694chr12232 221 --1778 --
NM_001031695chr2274983 4175 3804 3397 1607 822 795 13318 21691 1284 --
NM_001031702chr32154 28 ------
NM_001031710chr71340 1130 ----
NM_001031723chr43400 156 123 ------
NM_001031732chr443391 3342 2911 2846 --13503 --
NM_001031804chr1623544 715 ------
NM_001031855chrX2204 26 ------
NM_001032221chr941197 1132 415 55 --179 --
NM_001032279chr112282 39 --1292 --
NM_001032280chr631491 570 75 ------
NM_001032283chr121234 ------
NM_001032284chr121234 ------
NM_001032288chr202576 124 ------
NM_001032293chr172222 75 --1493 --
NM_001032296chr1332755 2520 510 --22605 212 --
NM_001032380chr1031841 1370 1306 ------
NM_001032393chrX----1146 --
NM_001032999chr20125119 4885 4676 4486 4185 3932 3575 3410 1265 970 310 256 --24357 442 --
NM_001033044chr111208 ------
NM_001033045chr2--24355 1017 --12730
NM_001033056chr111208 ------
NM_001033057chr311881 --12039 --
NM_001033059chr631748 1549 819 ------
NM_001033081chr171543 1277 1198 464 348 293 188 ----11302
NM_001033082chr171543 1277 1198 464 348 293 188 ----11302
NM_001033085chr2----1214 --
NM_001033087chr2023129 1119 13208 1893 --
NM_001033112chr53791 366 83 ------
NM_001033117chr344522 1316 289 234 ------
NM_001033506chr111171 ------
NM_001033507chr141811 1554 1486 31 --1333 --
NM_001033551chr17113795 3490 3350 3292 2490 1643 1409 1368 676 168 89 --13570 --
NM_001033554chr17----136 --
NM_001033557chr21464 ------
NM_001033578chr8------12252
NM_001033602chr1352298 1826 504 34 27 --1652 --
NM_001033723chr862463 2378 2194 1845 858 42 1201 1763 --
NM_001033756chr631436 1413 714 ------
NM_001033756chr631436 1413 714 ------
NM_001033952chr113255 85 71 --1242 --
NM_001034837chr5126 ------
NM_001034838chr5126 ------
NM_001034845chr42225 202 ------
NM_001034954chr1072495 2268 1099 1014 433 359 242 ------
NM_001034955chr1072495 2268 1099 1014 433 359 242 ------
NM_001034956chr1072495 2268 1099 1014 433 359 242 ------
NM_001034957chr1072495 2268 1099 1014 433 359 242 ------
NM_001035chr11137 --11276 --
NM_001035005chr18--1656 1205 --
NM_001035254chr922506 841 1358 32520 2161 744 --
NM_001035511chr13255 246 212 ------
NM_001035512chr13362 353 319 ------
NM_001035513chr13362 353 319 ------
NM_001035534chr941110 941 458 69 11477 11103 --
NM_001037132chr72641 622 --12137 --
NM_001037133chr72641 622 --12137 --
NM_001037163chr71102 ------
NM_001037164chr721269 183 ------
NM_001037317chr142615 2157 856 632 --1172 --
NM_001037331chr183796 753 128 ------
NM_001037334chr1821737 705 ------
NM_001037582chr431255 589 68 --11477 --
NM_001037872chr2--1646 ----
NM_001037954chr1133445 3003 1384 --43121 803 224 124 --
NM_001038493chr2137 1108 1542 --
NM_001038640chr152913 800 ------
NM_001038707chr152024 1556 1461 633 431 --31764 780 314 --
NM_001038707chr152024 1556 1461 633 431 --31764 780 314 --
NM_001039350chr751723 1528 1430 1118 33 --1169 --
NM_001039366chr223182 90 32 --155 --
NM_001039459chr73910 206 199 ------
NM_001039465chr141412 ------
NM_001039479chr1421910 27 --31516 227 46 --
NM_001039538chr212934 --148 --
NM_001039550chr24665 604 202 36 ------
NM_001039570chr2294455 4216 4152 3997 3787 3256 2957 678 400 24508 4067 21836 1823 --
NM_001039571chr2294455 4216 4152 3997 3787 3256 2957 678 400 24508 4067 21836 1823 --
NM_001039577chr1134424 4045 3980 3867 3302 2811 1793 1182 1164 1146 874 383 163 ----23710 1091
NM_001039585chr163678 3656 3177 2967 1021 188 ------
NM_001039590chrX22474 829 --21161 398 14014
NM_001039591chrX22474 829 --21161 398 14014
NM_001039618chr1143890 1465 653 245 25087 4388 1538 --
NM_001039619chr14252 39 ------
NM_001039690chr1662159 2016 959 884 287 220 --1869 --
NM_001039693chr213904 --14090 --
NM_001039709chr20125119 4885 4676 4486 4185 3932 3575 3410 1265 970 310 256 --24357 442 --
NM_001039711chr111058 ----1379
NM_001039712chr111058 ----1379
NM_001039716chr16780 319 300 123 109 56 ------
NM_001039771chr145894 432 335 313 241 1106 ----
NM_001039802chr1--1954 ----
NM_001039840chrX46022 3981 3725 133 --14263 --
NM_001039888chr14725 661 571 502 1522 ----
NM_001039916chr122845 107 ----1258
NM_001039917chr122845 107 ----1258
NM_001039918chr122845 107 ----1258
NM_001039919chr122845 107 ----1258
NM_001039920chr122845 107 ----1258
NM_001039937chr1322928 959 --13736 --
NM_001039960chr1231748 1416 300 2482 465 ----
NM_001040020chr711539 ------
NM_001040101chr431469 211 121 11321 1249 --
NM_001040102chr1062194 2106 2055 994 123 94 ------
NM_001040103chr1062194 2106 2055 994 123 94 ------
NM_001040108chr1432997 2108 365 12457 32537 2410 1253 12963
NM_001040110chr771751 1471 1269 1223 751 696 626 --11452 --
NM_001040142chr2--11658 ----
NM_001040143chr2--11658 ----
NM_001040144chr1662159 2016 959 884 287 220 --1869 --
NM_001040146chr1662159 2016 959 884 287 220 --1869 --
NM_001040152chr774403 4090 3375 3130 2011 820 143 --21205 695 --
NM_001040153chr131850 ------
NM_001040167chr741209 399 338 94 ------
NM_001040214chr631615 707 411 ------
NM_001040260chr451049 874 868 300 200 --1742 --
NM_001040261chr451049 874 868 300 200 --1742 --
NM_001040272chr962159 1881 759 445 282 269 ------
NM_001040284chr1644643 4036 1061 1038 --24705 4522 11527
NM_001040402chr42155 95 ------
NM_001040424chr2142600 1111 929 225 21952 417 ----
NM_001040427chr16141 ------
NM_001040429chr1322528 2304 22282 477 ----
NM_001040439chr1651307 965 950 374 256 --1246 --
NM_001040440chr5--1178 ----
NM_001040441chr154137 3689 2108 2040 1560 --13714 --
NM_001040446chr51559 --22032 944 --
NM_001040455chr1121261 1120 11028 145 --
NM_001040624chr822172 362 --42732 2065 1877 154 --
NM_001040625chr822172 362 --42732 2065 1877 154 --
NM_001040626chr822172 362 --42732 2065 1877 154 --
NM_001040627chr822172 362 --42732 2065 1877 154 --
NM_001040628chr822172 362 --42732 2065 1877 154 --
NM_001040629chr822172 362 --42732 2065 1877 154 --
NM_001040630chr822172 362 --42732 2065 1877 154 --
NM_001040709chr131845 690 227 1353 --11921
NM_001040712chr933585 3254 391 12661 22927 2524 --
NM_001040715chr1671168 835 791 453 401 244 43 ------
NM_001040876chr43635 208 196 ------
NM_001042361chr101177 ------
NM_001042364chr101177 ------
NM_001042365chr101177 ------
NM_001042387chr101177 ------
NM_001042388chr181746 ------
NM_001042393chr101177 ------
NM_001042396chr101177 ------
NM_001042397chr101177 ------
NM_001042413chr951248 998 555 439 191 ------
NM_001042424chr482519 1979 1072 930 570 557 512 221 ------
NM_001042425chr631491 570 75 ------
NM_001042453chrX2392 89 ------
NM_001042473chr1022101 690 ------
NM_001042476chr1631764 1717 1594 11985 12015 --
NM_001042479chrX62064 2057 1734 1323 400 54 ------
NM_001042480chrX62064 2057 1734 1323 400 54 ------
NM_001042481chr1431820 699 681 --1114 --
NM_001042492chr1763442 2741 2138 986 367 45 1720 13318 12814
NM_001042494chr1563576 3415 2537 751 426 167 ------
NM_001042495chr1563576 3415 2537 751 426 167 ------
NM_001042496chr1563576 3415 2537 751 426 167 ------
NM_001042497chr1563576 3415 2537 751 426 167 ------
NM_001042498chrX198 --1413 --
NM_001042510chr841440 1381 674 450 ------
NM_001042511chr841440 1381 674 450 ------
NM_001042537chrX32158 967 433 ------
NM_001042539chr1661031 955 363 182 150 117 --1238 --
NM_001042555chr1231285 1278 1173 --1552 --
NM_001042599chr237719 6148 5560 35938 5304 410 1741 --
NM_001042601chr312053 12844 --11001
NM_001042603chr12144785 3849 3832 3525 3517 3467 3459 3409 3401 3351 3343 1496 803 282 ------
NM_001042604chr374438 3750 3461 1549 949 913 887 1507 ----
NM_001042610chr1661413 1141 1017 297 143 105 --31263 1196 25 --
NM_001042632chr2041778 1698 777 576 ------
NM_001042633chr2041778 1698 777 576 ------
NM_001042669chr441310 1250 757 344 11184 ----
NM_001042681chr152471 2425 2091 2053 266 1827 ----
NM_001042682chr152471 2425 2091 2053 266 1827 ----
NM_001042682chr152471 2425 2091 2053 266 1827 ----
NM_001042683chr611211 1109 11436 --
NM_001042749chrX----1624 --
NM_001042750chrX----1624 --
NM_001042751chrX----1624 --
NM_001043318chr1461262 967 663 650 612 224 13742 13214 --
NM_001044305chr631180 302 66 1481 ----
NM_001044385chr253333 3064 1260 751 608 --1844 --
NM_001045556chr841281 1184 603 46 ------
NM_001045557chr841281 1184 603 46 ------
NM_001046chr512884 ------
NM_001050chr1741113 521 408 57 1104 ----
NM_001071775chr1341279 279 227 37 ------
NM_001077628chr11164 ------
NM_001083621chr1124627 4613 4458 3420 3290 2951 1563 1519 1137 852 671 155 --31799 783 655 11068
NM_001092chr1781939 1625 1573 1564 839 550 487 128 --1420 --
NM_001095chr1241606 1280 1197 284 11829 ----
NM_001096chr171189 ------
NM_001106chr3119585 8541 7655 7569 7499 7101 6723 3413 3379 3183 1857 26960 1277 49126 7669 6220 2661 --
NM_001113490chrX33614 2973 1261 ------
NM_001116chr1663047 2816 1138 970 584 463 11895 11994 --
NM_001117chr1821554 738 ----12404
NM_001121chr101230 11896 ----
NM_001122679chr51269 ------
NM_001128chr1663859 1226 766 758 572 210 33742 1544 916 23706 2833 --
NM_001146chr811915 12005 ----
NM_001148chr42448 223 --1126 --
NM_001160chr12----12438 195
NM_001172chr142519 295 ------
NM_001173chr1422970 985 24716 1432 13142 --
NM_001189chr441116 131 125 45 ------
NM_001191chr2021377 203 --21430 1106 --
NM_001204chr2106931 6863 2771 2613 2200 1668 1468 827 551 459 17435 26697 5366 --
NM_001206chr932864 2851 125 11201 ----
NM_001219chr742202 1765 896 183 --31825 339 51 --
NM_001222chr1051762 1610 1490 1335 589 11301 1467 --
NM_001234chr32507 293 ------
NM_001241chr211508 1385 ----
NM_001241chr211508 1385 ----
NM_001256chr1752725 1884 756 404 202 ------
NM_001258chr174573 524 505 403 ------
NM_001259chr735684 4892 142 ------
NM_001260chr132135 61 ------
NM_001273chr12----168 --
NM_001275chr141400 ------
NM_001277chr112763 88 --1798 --
NM_001280chr192157 62 ------
NM_001282chr1762616 2154 1978 1650 260 176 ----12190
NM_001284chr51108 ----1210
NM_001290chr441025 998 892 192 ------
NM_001292chr152701 246 --3184 160 97 --
NM_001293chr11--134 1385 --
NM_001299chr192320 51 ------
NM_001304chr1742937 1196 565 97 11454 33033 2502 54 --
NM_001308chr10142 ------
NM_001310chr1222019 86 ----1676
NM_001313chr44712 339 315 131 1926 ----
NM_001328chr42591 208 ------
NM_001331chr1162870 2628 2505 1892 1878 1846 --1498 --
NM_001332chr541533 1138 450 388 ------
NM_001343chr511537 --1593 --
NM_001351chr311809 11188 1728 --
NM_001352chr19132 ------
NM_001356chrX22545 85 ------
NM_001358chr4178 1299 ----
NM_001364chr1144466 3169 1784 336 33608 1287 1141 1894 --
NM_001378chr22363 76 ------
NM_001385chr82379 140 ------
NM_001387chr563095 2998 2911 2025 957 557 1822 ----
NM_001391chr1821028 107 ------
NM_001392chr18164 ------
NM_001395chrX1991 ------
NM_001396chr2122411 549 ------
NM_001397chr142589 2256 2178 1636 --21843 607 --
NM_001400chr12426 34 --1182 1296
NM_001406chr1761668 1637 1377 659 483 51 --11645 --
NM_001407chr331479 153 127 --11570 --
NM_001408chr151434 1120 1093 67 32 ------
NM_001412chrX33329 3211 2411 ------
NM_001416chr171190 ------
NM_001417chr1221835 1300 ------
NM_001419chr1954786 4727 3700 3018 727 --23652 484 --
NM_001420chr1942854 2690 2416 371 --22106 1923 --
NM_001423chr1221988 547 --1754 --
NM_001426chr22494 272 ------
NM_001427chr761989 1753 766 685 641 301 ----1425
NM_001429chr221305 ------
NM_001430chr231890 382 52 ------
NM_001438chr173679 3096 1203 785 299 284 171 1683 ----
NM_001447chr55461 396 302 199 147 ------
NM_001448chrX31508 599 203 ------
NM_001449chrX21020 875 ------
NM_001453chr6--11687 ----
NM_001478chr124886 615 608 373 --3862 748 121 --
NM_001482chr151771 1147 ----
NM_001483chr71742 ------
NM_001497chr921973 204 ------
NM_001518chr71986 11099 1378 --
NM_001527chr634425 1816 1335 --24727 3571 --
NM_001530chr1421107 165 ------
NM_001542chr13327 267 139 ------
NM_001543chr5144618 4439 4377 3849 3769 3344 3053 2954 1863 1803 1778 1280 467 250 44536 1520 607 560 ----
NM_001565chr41242 ------
NM_001584chr112457 149 ------
NM_001610chr112777 59 ------
NM_001616chr243113 2553 865 600 --22731 983 --
NM_001620chr113708 198 169 168 1288 --
NM_001621chr721144 403 --11867 --
NM_001621chr721144 403 --11867 --
NM_001622chr31316 ------
NM_001624chr641874 1778 1589 1494 11765 ----
NM_001625chr1179 ------
NM_001634chr631748 1549 819 ------
NM_001635chr7--190 1953 --
NM_001655chr1141393 653 322 269 ------
NM_001656chr52771 415 ----11801
NM_001659chr1222305 911 --22625 2461 --
NM_001660chr3----1265 --
NM_001662chr72137 131 --137 --
NM_001663chr1452047 1985 1903 763 277 ------
NM_001664chr32916 281 ------
NM_001665chr113534 484 397 ------
NM_001668chr132025 577 476 --191 --
NM_001677chr111110 ------
NM_001678chr17101461 1368 1268 1242 1225 1186 660 543 463 42 ------
NM_001682chr1232765 500 480 ------
NM_001684chr1114014 3664 3634 3271 2693 1589 1552 1220 1039 697 330 ------
NM_001686chr12154 ------
NM_001690chr321635 93 ----149
NM_001694chr162385 315 ------
NM_001695chr834309 3329 106 23515 1510 ----
NM_001696chr223182 90 32 --155 --
NM_001699chr1931151 1128 732 ------
NM_001702chr82424 60 ------
NM_001704chr61541 ------
NM_001706chr32227 182 ------
NM_001709chr1142471 2349 1992 599 ------
NM_001718chr621310 531 --1273 --
NM_001730chr1321507 39 11394 ----
NM_001730chr1321507 39 11394 ----
NM_001741chr113255 85 71 --1242 --
NM_001742chr71319 ------
NM_001746chr542195 831 691 128 12773 1541 12112
NM_001753chr7172 ------
NM_001754chr2184018 3986 3643 3536 3466 1139 590 335 ------
NM_001755chr1642061 2004 805 475 21995 98 31881 873 340 --
NM_001762chr7183 --1705 --
NM_001773chr141090 957 947 563 ----11363
NM_001777chr332652 2576 751 --23536 2554 --
NM_001782chr9180 ------
NM_001788chr72397 211 ------
NM_001789chr331743 310 35 ------
NM_001791chr1--1954 ----
NM_001797chr161779 1566 ----
NM_001798chr1211098 ------
NM_001804chr53792 300 60 --1194 --
NM_001806chr1962899 2484 2328 1886 1195 311 --12526 --
NM_001822chr2171 ------
NM_001826chr11158 ------
NM_001833chr92246 219 --160 --
NM_001839chr11659 ------
NM_001842chr9--1504 1401 --
NM_001859chr943537 3465 1471 95 --33935 2889 1281 --
NM_001865chr6145 ------
NM_001884chr52441 217 ------
NM_001892chr521350 510 ------
NM_001893chr172297 118 ------
NM_001895chr2031051 422 381 --2450 295 --
NM_001908chr872153 1812 1765 992 751 373 361 --11739 1345
NM_001918chr168409 6585 5824 3457 3310 35 ----27816 3630
NM_001921chr431262 1020 299 11189 11005 --
NM_001933chr144982 519 292 174 ----1370
NM_001935chr2--1761 ----
NM_001936chr751723 1528 1430 1118 33 --1169 --
NM_001938chr131421 690 338 ------
NM_001939chrX41479 977 824 546 --22341 1195 --
NM_001940chr12--2484 32 ----
NM_001946chr121443 ------
NM_001949chr632814 237 206 --22302 528 --
NM_001955chr63751 169 111 ------
NM_001962chr52234 184 1577 ----
NM_001964chr52914 94 ------
NM_001965chr24186 174 76 53 ------
NM_001967chr3173 --1164 --
NM_001968chr41261 ------
NM_001969chr1422902 350 --23921 523 --
NM_001977chr41160 1591 ----
NM_001978chr85970 788 404 396 105 ------
NM_001981chr122187 2080 --1310 --
NM_001987chr1283917 3649 1696 1666 1376 601 533 500 --21633 1112 --
NM_001995chr4137 ------
NM_001999chr521333 1322 ------
NM_002006chr475424 5087 3533 1742 1526 1122 737 15019 44958 1183 1102 475 --
NM_002009chr1532149 432 29 ------
NM_002010chr132186 99 ------
NM_002014chr121653 ------
NM_002015chr1322400 1340 11142 23328 2103 22926 2307
NM_002017chr1121408 1215 ------
NM_002024chrX11670 ------
NM_002025chrX108980 8378 6700 6231 5799 2906 2819 2438 349 125 18738 17025 --
NM_002026chr22991 136 --1155 --
NM_002027chr82174 145 ------
NM_002039chr41227 1759 ----
NM_002040chr21------163
NM_002044chr152510 155 ------
NM_002048chr91245 1896 1194 --
NM_002051chr10------1944
NM_002054chr2----1483 --
NM_002060chr1----1508 --
NM_002062chr641470 1050 423 294 ------
NM_002065chr111208 ------
NM_002071chr18190 --1174 --
NM_002072chr91801 ------
NM_002073chr222626 446 --1610 --
NM_002074chr121642 1515 ------
NM_002076chr1283140 2532 2221 2180 2060 980 902 613 13183 1698 --
NM_002077chr972060 1792 1558 1530 866 262 26 11872 12149 --
NM_002080chr162346 63 ------
NM_002086chr1742057 495 428 242 11570 12007 --
NM_002092chr454967 1622 1161 855 83 1142 44918 3250 3241 3114 --
NM_002095chr83295 288 95 ------
NM_002103chr193990 211 156 2889 74 1171 --
NM_002107chr11491 ------
NM_002114chr61158 ------
NM_002126chr1753391 525 257 219 211 23771 1277 1454 --
NM_002129chr4197 ------
NM_002139chrX1130 ------
NM_002140chr92452 109 --21148 204 --
NM_002141chr7169 ------
NM_002145chr17140 ------
NM_002146chr172262 58 --1140 11319
NM_002147chr171163 --1638 --
NM_002148chr21112 ------
NM_002151chr191260 ------
NM_002156chr2163 ------
NM_002165chr201297 ------
NM_002189chr103264 242 94 1468 ----
NM_002193chr251819 1429 560 163 57 ------
NM_002196chr2031088 736 144 ----11021
NM_002196chr2031088 736 144 ----11021
NM_002199chr42406 35 --1164 --
NM_002202chr52868 434 ------
NM_002205chr121380 --1115 --
NM_002210chr22745 726 --11405 --
NM_002211chr101984 ------
NM_002214chr755421 3581 2187 1740 840 154 34334 3752 1765 --
NM_002221chr161093 1000 916 788 641 464 170 12468 --
NM_002222chr31397 ------
NM_002228chr12853 392 ------
NM_002232chr121251 205 11004 ----
NM_002241chr15932 856 648 417 388 --32936 1899 205 --
NM_002247chr101661 --12104 --
NM_002249chr11414 ------
NM_002254chr271562 861 646 576 292 204 159 --11904 --
NM_002264chr344392 3083 762 308 ------
NM_002265chr17------1827
NM_002267chr1331883 759 91 22418 125 ----
NM_002268chr31534 ------
NM_002271chr1321894 580 12255 1205 --
NM_002274chr171251 ------
NM_002276chr17289 22 ------
NM_002285chr232788 2682 627 1479 21190 213 --
NM_002293chr132529 2160 1083 ------
NM_002298chr1381513 1480 1446 1356 506 429 354 235 ------
NM_002310chr565224 1848 1835 1129 1044 970 12182 22335 229 24867 45
NM_002313chr10135054 5014 4790 4758 4562 4116 3715 1689 1625 1143 791 756 562 11869 22046 609 11261
NM_002317chr51300 ------
NM_002334chr115405 339 302 89 34 1132 ----
NM_002336chr1224043 856 --1879 13724
NM_002347chr82106 26 ------
NM_002351chrX31292 465 338 ------
NM_002355chr1241191 567 175 113 ------
NM_002359chr1753134 2780 2705 1290 1208 11635 33198 1374 739 --
NM_002360chr752479 2461 528 319 177 12137 ----
NM_002372chr5----190 --
NM_002373chr1541333 1308 1278 990 --144 --
NM_002374chr212934 --148 --
NM_002375chr342138 1756 1513 204 ------
NM_002381chr2191 ------
NM_002382chr1421187 169 --2344 156 --
NM_002383chr163854 778 186 --161 --
NM_002384chr181170 ------
NM_002385chr1831559 451 243 --21142 37 --
NM_002387chr574102 3667 3505 1344 1100 943 207 13308 21687 1054 --
NM_002390chr1761898 1647 1594 1284 273 131 ----1831
NM_002391chr11----1318 --
NM_002395chr621444 1018 ------
NM_002397chr52792 274 ------
NM_002398chr221101 396 ------
NM_002399chr1511332 --11016 --
NM_002401chr1772374 1971 1755 861 457 223 82 --12219 --
NM_002402chr731027 420 171 ------
NM_002408chr14--1720 ----
NM_002442chr1231565 1323 189 ------
NM_002451chr933531 3109 2825 ------
NM_002479chr12305 115 ------
NM_002480chr123572 394 291 ------
NM_002481chr177682 5923 5896 5517 5507 5389 1976 26631 1021 16826 --
NM_002494chr4152 ------
NM_002499chr1552311 2067 526 213 153 ------
NM_002500chr22511 119 --2212 180 --
NM_002501chr19104127 4092 3898 2801 1565 1492 1389 607 79 31 --31147 986 614 --
NM_002507chr1731876 1528 1402 --1118 --
NM_002509chr204284 278 203 138 ------
NM_002515chr1411539 ------
NM_002516chr191105 ------
NM_002518chr21385 --11163 --
NM_002519chr111159 ------
NM_002522chr1783277 3067 2883 2844 2701 2579 1495 804 ------
NM_002524chr131030 379 139 --1122 --
NM_002545chr1174182 1721 1347 290 258 90 37 --21755 1605 --
NM_002547chrX2759 587 11273 1112 1239
NM_002570chr152274 221 2183 169 1292 --
NM_002572chr112109 35 ------
NM_002575chr181111 ------
NM_002576chr1131047 832 102 ------
NM_002577chr331135 523 443 --1503 --
NM_002581chr925060 4803 15350 24504 960 1443
NM_002583chr12------1546
NM_002588chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_002592chr20--152 137 --
NM_002594chr2042081 805 130 43 ------
NM_002595chr122718 691 ------
NM_002601chr23390 175 152 ------
NM_002609chr551916 1426 434 136 35 ------
NM_002616chr171367 --1113 --
NM_002622chr51283 --281 22 --
NM_002628chr31776 11072 ----
NM_002634chr172830 287 ------
NM_002648chr651080 1071 945 510 71 --159 --
NM_002651chr11672 ------
NM_002655chr835109 4368 1979 23957 2000 25250 4183 1455
NM_002657chr2053653 1461 1337 869 467 ------
NM_002660chr201200 ----1982
NM_002698chr19102900 2566 2524 1960 1183 1129 1030 943 794 75 ------
NM_002699chr141505 1363 1076 586 ------
NM_002710chr122908 224 ------
NM_002714chr65226 146 129 74 54 --1775 --
NM_002716chr1133147 2317 282 --23486 3335 --
NM_002717chr81162 170 ----
NM_002719chr1462016 1551 1503 1492 844 505 ------
NM_002726chr61168 ------
NM_002731chr12841 653 --1102 --
NM_002734chr172237 112 ------
NM_002737chr1774284 4227 4121 2444 2381 1651 1420 25601 1527 ----
NM_002740chr31194 --1996 --
NM_002742chr141214 1609 ----
NM_002745chr2264071 2954 1257 1220 831 318 14100 ----
NM_002748chr15--1955 ----
NM_002752chr51416 ------
NM_002753chr44845 820 546 295 ------
NM_002787chr71587 ------
NM_002808chr31112 ------
NM_002809chr172340 44 ------
NM_002811chr163508 479 122 ------
NM_002814chrX1145 ------
NM_002822chr121478 ------
NM_002828chr181182 --127 --
NM_002830chr21390 ------
NM_002833chr1531260 1160 647 --21491 639 --
NM_002835chr71618 ------
NM_002836chr201366 1126 ----
NM_002837chr1264532 1708 1685 1651 1434 1280 --22802 21 --
NM_002839chr933585 3254 391 12661 22927 2524 --
NM_002840chr151259 594 292 262 42 --160 --
NM_002843chr1143046 2694 2543 1231 ----12270
NM_002845chr181122 ------
NM_002847chr73633 517 118 --1544 --
NM_002849chr124930 711 106 80 169 1168 --
NM_002852chr31581 ------
NM_002855chr11173454 3167 2557 2339 2257 1166 1004 935 812 747 736 688 579 569 453 430 35 --22588 1476 11383
NM_002857chr142648 1774 663 244 ------
NM_002859chr1281501 1440 1350 615 539 461 267 216 11230 11465 --
NM_002860chr105583 183 140 133 79 --193 --
NM_002868chr1282384 2273 2169 1954 1588 328 138 114 1617 22213 1749 --
NM_002869chr1141462 743 650 162 ------
NM_002884chr13167 111 22 --1800 --
NM_002886chr363377 1347 1297 580 465 223 --24890 3777 --
NM_002890chr5181 ------
NM_002893chrX1116 ------
NM_002898chr122565 178 ------
NM_002900chr102308 121 ------
NM_002906chr111774 --1153 --
NM_002911chr1951303 1145 1105 651 413 11366 ----
NM_002912chr6--1767 ----
NM_002918chr1921054 779 --165 --
NM_002930chr18----121 --
NM_002940chr43635 208 196 ------
NM_002941chr311510 ------
NM_002942chr33975 940 325 ------
NM_002957chr993820 3640 3596 2788 2750 2709 1393 1368 481 13576 ----
NM_002959chr183643 3357 1690 1023 791 398 110 68 --23164 546 --
NM_002966chr13245 76 23 ------
NM_002968chr163924 905 856 ------
NM_002971chr31895 ------
NM_002973chr12--155 ----
NM_002977chr212683 22850 1331 ----
NM_002997chr271689 1524 1299 312 178 167 134 ------
NM_003001chr13362 353 319 ------
NM_003010chr1742331 2216 1494 230 ------
NM_003011chr941426 1381 584 283 ------
NM_003016chr1711698 ------
NM_003024chr211629 1250 1960 1146
NM_003028chr9113463 3383 3374 3317 2388 1540 1191 846 830 340 309 --12849 13900
NM_003029chr11527 --21309 1119 --
NM_003030chr351358 1332 216 208 74 --11772 --
NM_003035chr15622 336 296 279 85 ------
NM_003045chr13125037 4590 4051 3852 3280 1783 1305 950 791 663 608 491 --23414 277 --
NM_003046chr855300 4857 1617 1385 660 14796 ----
NM_003047chr14516 303 272 71 21055 920 21021 158 --
NM_003060chr531069 920 136 ------
NM_003069chrX2221 114 ------
NM_003070chr92696 626 ------
NM_003071chr321755 199 ------
NM_003074chr351821 1806 729 115 71 1370 ----
NM_003075chr12----1124 --
NM_003076chr1271341 1088 608 553 395 220 200 --21689 1677 --
NM_003079chr173980 389 196 ------
NM_003081chr202436 148 --150 --
NM_003091chr202198 30 ------
NM_003094chr141178 1024 324 166 ------
NM_003099chr1595535 5268 5101 4727 2522 2266 1269 1001 173 --34314 1195 974 --
NM_003101chr121025 47 ------
NM_003107chr652428 1890 565 488 382 ------
NM_003108chr2136309 6176 5639 5530 5386 2878 2812 2604 2580 1960 1832 51 22 --17200 --
NM_003110chr172879 214 ------
NM_003111chr211083 165 ----
NM_003112chr73760 556 119 ------
NM_003128chr272821 2697 2354 1865 517 272 99 --12776 --
NM_003131chr661886 1608 840 619 570 502 --1537 --
NM_003137chr631999 1696 1393 --193 --
NM_003139chr113704 659 134 ------
NM_003140chrY145 ------
NM_003144chr631600 1591 768 ------
NM_003150chr1722043 939 ----11917
NM_003152chr1721098 21 ------
NM_003153chr1241048 922 381 313 --136 --
NM_003155chr852688 2467 2417 907 152 ----1109
NM_003156chr114865 373 292 285 1904 2435 312 --
NM_003161chr1723445 317 13129 ----
NM_003162chr21993 ------
NM_003165chr941296 1231 514 154 --1178 --
NM_003173chrX21197 354 1128 ----
NM_003178chr342015 1871 562 178 --2661 154 --
NM_003180chr192357 96 ------
NM_003182chr7130 ------
NM_003182chr7130 ------
NM_003183chr21595 1780 ----
NM_003185chr20----1137 --
NM_003186chr11----2158 43 --
NM_003188chr61574 ------
NM_003199chr1855443 4895 3935 3706 892 11672 14467 12232
NM_003202chr541315 1190 718 22 --1697 11743
NM_003215chr431214 1132 22 3535 164 136 ----
NM_003216chr22132957 2910 2726 2393 2363 2343 1295 1209 1020 843 642 148 60 12807 22971 530 --
NM_003220chr631491 570 75 ------
NM_003221chr6103954 3620 3073 2774 2643 2599 2564 1657 820 645 --31645 1026 799 --
NM_003239chr143878 120 60 ------
NM_003242chr351906 710 671 539 349 ----12293
NM_003244chr181123 ------
NM_003246chr151653 ------
NM_003247chr6184 ------
NM_003250chr17--1337 ----
NM_003253chr2141744 1492 611 103 11723 ----
NM_003255chr1772489 2362 947 864 535 471 68 ------
NM_003262chr373610 3541 3483 3472 1598 1446 892 13526 11843 --
NM_003269chr621113 395 ------
NM_003275chr911481 ------
NM_003289chr9130 ------
NM_003290chr193314 222 43 --176 --
NM_003291chr13----1854 --
NM_003292chr131766 526 253 ------
NM_003295chr13151 ------
NM_003304chr311582 ----11046
NM_003305chr4----1317 1140
NM_003318chr61217 ------
NM_003320chr11134175 4087 3791 3067 2784 1684 1402 969 839 827 722 158 130 ------
NM_003324chr1241395 1089 958 949 --1385 --
NM_003325chr222250 149 ------
NM_003330chr1231788 501 96 --11344 --
NM_003334chrX179 ------
NM_003337chr541754 1710 1346 484 ----11285
NM_003339chr51360 --11252 --
NM_003340chr4162 ------
NM_003342chr1712427 --1758 --
NM_003344chr741497 1107 506 353 --1395 --
NM_003349chr202576 124 ------
NM_003352chr22741 674 ------
NM_003368chr1--1563 1216 --
NM_003370chr192584 27 --1763 --
NM_003375chr101319 ------
NM_003385chr22943 144 ------
NM_003387chr252767 1149 379 81 42 --11169 --
NM_003392chr352708 2649 1309 1141 1092 --13605 1433
NM_003404chr2021897 1388 --21849 1340 --
NM_003405chr221209 --1533 --
NM_003406chr821566 539 --11887 11229
NM_003409chr181175 --1325 --
NM_003410chrX22381 1027 ------
NM_003411chrY11501 1127 --1507
NM_003412chr342536 1939 1095 340 --1918 --
NM_003413chrX11395 ------
NM_003418chr31312 ------
NM_003423chr1922056 1003 11712 ----
NM_003427chr61728 ------
NM_003432chr51486 ------
NM_003439chr73632 361 68 ----21259 1030
NM_003455chr1151661 1318 461 363 232 1311 ----
NM_003457chr172222 75 --1493 --
NM_003458chr362553 1300 830 720 517 87 --13730 --
NM_003463chr632693 833 101 ------
NM_003466chr262377 1631 1532 572 393 353 12169 2977 867 --
NM_003468chr274138 3502 2791 1248 994 875 349 --23338 495 --
NM_003470chr1631565 499 155 ----11865
NM_003472chr631145 1005 229 ------
NM_003478chr1111208 12805 ----
NM_003482chr1252755 2170 2122 1109 240 ------
NM_003483chr1242966 2954 2784 2040 ------
NM_003489chr2112848 ------
NM_003503chr121288 265 2438 244 ----
NM_003505chr751566 505 446 160 130 1635 1149 --
NM_003508chr71301 ------
NM_003509chr6151 ------
NM_003511chr6137 ------
NM_003512chr6250 21 ------
NM_003517chr1133 ------
NM_003520chr6154 ------
NM_003521chr6151 ------
NM_003522chr6135 ------
NM_003524chr6130 ------
NM_003525chr6142 ------
NM_003527chr6133 ------
NM_003529chr6138 ------
NM_003531chr6134 ------
NM_003532chr6137 ------
NM_003536chr6138 ------
NM_003558chr9------1529
NM_003559chr17103389 3069 2855 1442 1099 1043 761 551 440 433 --13086 --
NM_003563chr1721009 562 ------
NM_003564chr13560 426 97 --1106 --
NM_003567chr1149 ------
NM_003576chr1332755 2520 510 --22605 212 --
NM_003587chr6----135 --
NM_003590chr233795 1600 181 --1227 --
NM_003591chr10160 ------
NM_003603chr431831 1536 356 ----1837
NM_003607chr173973 3687 3449 3207 1188 731 393 --22853 1044 1443
NM_003612chr154598 510 464 33 --189 --
NM_003613chr152661 258 --1572 --
NM_003615chr343812 1346 787 474 ------
NM_003618chr221300 1189 ------
NM_003626chr114984 887 854 496 ------
NM_003628chr21193 ------
NM_003629chr133158 2487 2183 ------
NM_003633chr522028 1973 11890 ----
NM_003642chr2----1214 --
NM_003644chr17135792 5670 4498 4489 4392 4343 4096 1198 590 366 351 167 51 1980 ----
NM_003655chr174752 710 276 79 ------
NM_003663chr31626 --13191 --
NM_003670chr331111 451 353 --2944 220 --
NM_003671chr993493 3129 3077 2833 2690 2508 1010 733 210 12585 22992 1202 --
NM_003673chr172165 22 ------
NM_003692chr9--1800 ----
NM_003704chr42243 216 ------
NM_003714chr542735 2050 1986 1095 12324 32235 582 394 --
NM_003716chr311030 ------
NM_003722chr332649 2095 1670 --193 --
NM_003735chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_003736chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_003743chr241390 369 350 305 12131 1516 --
NM_003744chr141544 ------
NM_003758chr1521614 1390 ------
NM_003758chr1521614 1390 ------
NM_003759chr493710 3595 3386 2840 1519 635 596 319 278 ------
NM_003763chr2053029 2694 2343 1068 662 --22818 1142 --
NM_003768chr131825 1572 496 1748 1194 --
NM_003774chr1232830 2529 1238 --13092 --
NM_003779chr13439 336 164 --171 --
NM_003787chr1821512 1251 ------
NM_003794chr31272 ------
NM_003795chr6----1216 --
NM_003800chr642207 916 610 329 ------
NM_003816chr811323 --1397 --
NM_003822chr131971 576 21 ------
NM_003831chr182503 115 --11122 --
NM_003840chr852131 1433 477 462 28 --22043 1667 --
NM_003850chr131242 ------
NM_003862chr51101 ------
NM_003872chr232171 1876 847 --1687 --
NM_003873chr104825 803 563 136 11653 ----
NM_003884chr331876 573 21 1598 ----
NM_003887chr241941 1521 436 37 ------
NM_003888chr1541465 1301 1115 73 --11150 --
NM_003893chr103485 449 413 ------
NM_003895chr211579 ------
NM_003901chr1042666 1949 516 318 11686 1377 --
NM_003902chr11554 ------
NM_003907chr32325 49 ------
NM_003908chr2021095 451 ------
NM_003913chr653998 3188 1669 1096 463 ----1831
NM_003924chr42660 274 11633 ----
NM_003927chr18------1935
NM_003930chr712056 ----185
NM_003931chr6162 ------
NM_003934chr91228 ------
NM_003936chr24985 838 449 406 ------
NM_003939chr1093988 3530 3156 1520 1391 969 649 553 456 13737 23743 3643 --
NM_003948chr442423 2095 780 34 12575 1966 --
NM_003949chr1761931 1833 1570 717 247 22 ------
NM_003955chr175546 534 389 294 110 --1224 --
NM_003957chr115921 848 842 143 71 --1131 --
NM_003966chr5107590 5234 3076 2939 2562 1946 1195 629 405 23 --2774 41 --
NM_003968chr31250 ------
NM_003971chr17182 ------
NM_003987chr10122083 1858 1768 1697 1677 1636 1562 767 749 739 40 26 ------
NM_003988chr10132160 1935 1845 1774 1754 1713 1639 844 826 816 117 103 38 ------
NM_003989chr10102019 1794 1704 1633 1613 1572 1498 703 685 675 ------
NM_003990chr10102019 1794 1704 1633 1613 1572 1498 703 685 675 ------
NM_003994chr1231704 1640 342 --11593 --
NM_004004chr132250 178 ------
NM_004006chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004007chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004009chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004010chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004011chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004012chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004013chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004014chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004015chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004016chrX72234 1992 1907 1876 1837 978 816 ------
NM_004017chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004018chrX72234 1992 1907 1876 1837 978 816 ------
NM_004020chrX72320 2078 1993 1962 1923 1064 902 ------
NM_004021chrX72234 1992 1907 1876 1837 978 816 ------
NM_004022chrX72234 1992 1907 1876 1837 978 816 ------
NM_004023chrX72234 1992 1907 1876 1837 978 816 ------
NM_004035chr1724337 1013 ----13181
NM_004036chr22478 154 --1672 --
NM_004050chr1452653 1979 1873 744 682 --22345 2331 --
NM_004055chr1172033 1818 1468 712 475 463 361 ------
NM_004068chr34418 354 316 186 ------
NM_004077chr122311 190 --1372 --
NM_004080chr721363 1178 --11149 --
NM_004081chrY11393 21828 1219 ----
NM_004082chr21127 --1109 --
NM_004089chrX3389 266 74 1410 ----
NM_004090chr1752660 2345 2313 2167 1097 11090 12263 12588
NM_004093chr1352567 1309 1076 620 397 ------
NM_004094chr1442623 882 432 192 ------
NM_004112chr1721619 308 --1360 11404
NM_004113chr321964 1661 ------
NM_004114chrX1838 ------
NM_004116chr2293 77 ------
NM_004124chr1413372 ------
NM_004157chr33331 203 95 ------
NM_004162chr311038 ------
NM_004171chr1169214 7922 1693 566 325 289 2923 612 59017 8010 3592 2284 147 15951
NM_004172chr521540 1271 ------
NM_004185chr12213 164 1111 ----
NM_004187chrX51103 940 920 557 82 --2950 188 --
NM_004199chr5172 185 ----
NM_004200chr1173015 2375 2215 990 829 521 196 --11235 12249
NM_004202chrY1172 ------
NM_004206chr3134 --1469 --
NM_004225chr831327 1046 298 --1993 1506
NM_004227chr772317 2226 2197 2067 2011 809 350 --13120 --
NM_004228chr19----1120 --
NM_004229chrX------11406
NM_004231chr72264 107 ------
NM_004232chr1833414 3056 847 23887 2691 ----
NM_004235chr91123 --1748 --
NM_004240chr192246 45 ----1305
NM_004241chr10188 --1173 --
NM_004247chr17----124 --
NM_004249chr4180 ------
NM_004261chr11376 ------
NM_004263chr251587 1517 1433 1241 692 ----11463
NM_004274chr1442263 1219 1088 703 --12065 --
NM_004279chr71724 --21736 791 1375
NM_004293chr953324 3124 2999 2745 1510 2348 287 13839 --
NM_004297chr9174 ------
NM_004304chr22295 70 1345 ----
NM_004311chr1092990 2853 2691 2212 1188 1091 896 810 106 ------
NM_004326chr131139 354 74 ------
NM_004329chr101307 ------
NM_004331chr862705 2481 2025 955 929 262 ------
NM_004338chr18116464 5584 5362 4617 2660 2487 2481 2219 1952 1196 861 --1551 --
NM_004349chr811012 ------
NM_004350chr162151 1746 744 630 80 72 1643 ----
NM_004352chr162520 205 ------
NM_004370chr641938 1527 676 261 --1465 --
NM_004379chr21674 --2652 357 --
NM_004380chr1652289 1916 1722 1715 1628 ------
NM_004389chr21565 ------
NM_004392chr1322035 781 11626 --11739
NM_004395chr53712 502 95 ----1295
NM_004396chr17145 ------
NM_004397chr1164101 1388 1350 1338 1300 71 ------
NM_004405chr21398 11050 ----
NM_004407chr41373 ----1270
NM_004411chr72637 610 1792 ----
NM_004414chr2121591 359 ------
NM_004416chr1241033 966 806 197 ------
NM_004417chr5251 24 --1128 --
NM_004418chr24424 248 187 66 ------
NM_004422chr172158 34 176 ----
NM_004423chr3122714 2662 2441 2402 2332 2075 1081 969 706 388 54 22 12107 ----
NM_004426chr1221874 702 ------
NM_004427chr12811 334 --2998 457 --
NM_004429chrX31028 233 199 --21167 1076 --
NM_004430chr842606 2192 1739 923 ------
NM_004432chr922192 1477 ------
NM_004433chr13617 447 395 11605 21725 625 --
NM_004434chr1411245 ------
NM_004437chr1103531 3470 3366 3191 2335 2279 1331 853 799 572 12354 1664 --
NM_004438chr272690 2621 2152 1266 1103 907 792 --1333 --
NM_004440chr631566 684 270 ------
NM_004441chr32299 99 --1515 --
NM_004444chr72890 355 ------
NM_004447chr12--1160 ----
NM_004454chr332170 1546 44 195 1507 --
NM_004456chr7147 ------
NM_004458chrX22274 361 ------
NM_004459chr1721586 343 ----11384
NM_004463chrX------1491
NM_004468chr14558 120 85 55 1191 ----
NM_004474chr13973 341 141 --158 --
NM_004475chr1731092 744 352 --11126 --
NM_004481chr182674 1898 1690 1012 697 637 509 282 ------
NM_004493chrX130 ------
NM_004494chr171289 1065 1010 967 298 270 37 --1500 --
NM_004496chr141856 1508 ----
NM_004499chr51172 ------
NM_004501chr144069 3651 2795 118 --13129 --
NM_004503chr122328 157 1670 ----
NM_004504chr21171 12235 22925 513 --
NM_004514chr1782805 2625 2475 2312 1956 1901 1895 1879 --33071 2680 1949 1246
NM_004520chr5--1176 ----
NM_004529chr91489 ------
NM_004535chr2061704 1606 1491 701 522 171 ------
NM_004537chr1221501 486 11042 --1429
NM_004539chr182777 50 ------
NM_004540chr211788 ------
NM_004554chr1441183 520 362 109 --3476 371 125 --
NM_004556chr66899 693 295 223 94 32 ------
NM_004560chr93916 333 153 ------
NM_004576chr51156 1312 ----
NM_004586chrX44893 202 144 132 --15372 12049
NM_004588chr1193553 3007 1082 799 715 659 457 244 80 1671 1510 --
NM_004598chr563127 2314 1125 978 839 420 --12769 --
NM_004603chr73938 770 340 ------
NM_004612chr963408 3012 1695 1659 211 47 --13516 --
NM_004621chr1131247 425 382 ------
NM_004627chr211709 ------
NM_004637chr331113 886 240 ------
NM_004650chrX2578 397 ------
NM_004654chrY1993 --11174 --
NM_004655chr17----2874 45 --
NM_004660chrY184 --1722 --
NM_004670chr1041649 251 87 36 --11131 --
NM_004675chr1----126 --
NM_004687chr1731972 1735 76 --1761 --
NM_004689chr142374 132 ------
NM_004690chr6--1505 ----
NM_004703chr1732491 2424 2121 ------
NM_004709chrX21147 615 --11798 132
NM_004711chr22103446 3102 2831 2679 2640 1361 949 802 655 68 13045 ----
NM_004715chr182512 126 ------
NM_004716chr112585 32 --156 --
NM_004717chr731243 236 70 ------
NM_004718chr21237 --153 --
NM_004719chr1212778 ----1504
NM_004726chrX65105 4489 4168 1225 566 275 --25165 5152 --
NM_004730chr52816 297 --21926 1517 1224
NM_004734chr1322919 2203 --272 29 --
NM_004736chr121878 1427 11958 1127 --
NM_004739chr111533 --1667 --
NM_004742chr341565 1532 1266 262 --1654 --
NM_004745chr885497 5039 4267 2016 1739 586 572 542 14713 35181 4961 4891 --
NM_004746chr182219 60 ------
NM_004747chr1031144 533 368 11236 162 --
NM_004748chr1543983 3477 850 601 --11358 --
NM_004753chr12277 92 --1115 --
NM_004755chr141262 ------
NM_004762chr1741479 219 132 50 --41309 517 251 44 --
NM_004768chr131092 879 107 --1133 --
NM_004770chr81246 ------
NM_004772chr551312 599 584 356 345 --11271 --
NM_004774chr1722095 222 ------
NM_004775chr181257 164 11871 --
NM_004781chr151695 1484 1167 545 252 11724 --1672
NM_004781chr151695 1484 1167 545 252 11724 --1672
NM_004783chr162119 113 --1148 --
NM_004786chr18----149 --
NM_004788chr1162473 2275 2181 1815 147 85 --11673 1631
NM_004789chr9----1284 --
NM_004796chr1432005 934 301 ----12312
NM_004798chr2063504 3443 1285 1145 640 372 1169 21261 714 --
NM_004801chr21168 ------
NM_004815chr164633 4035 4027 3846 3369 1292 11783 23885 3508 1526
NM_004821chr53808 568 93 --1126 --
NM_004822chr17103474 3225 3068 1570 1487 1251 1223 1032 549 279 --1628 --
NM_004824chr641199 287 67 61 1279 1203 1544
NM_004831chr191166 ------
NM_004834chr252985 2590 2443 315 158 ------
NM_004839chr154616 178 91 63 --1522 --
NM_004842chr621554 1507 11785 ----
NM_004844chr31348 --1172 1282
NM_004845chrX123523 3508 3320 2994 2686 1386 1359 683 557 470 427 277 34136 3651 3600 2843 548 --
NM_004863chr1455093 1839 723 388 71 33769 1057 180 25133 3509 --
NM_004865chr61137 ------
NM_004866chr51639 --1912 --
NM_004867chrX----1164 --
NM_004869chr181132 21646 533 ----
NM_004871chr1753693 3654 2722 1649 350 --34319 3685 956 14181
NM_004872chr12369 297 ------
NM_004873chr1433138 2476 2136 152 22532 2363 --
NM_004898chr421157 90 --22135 130 --
NM_004902chr204745 736 726 268 ------
NM_004904chr755721 4550 4491 4432 635 --25686 4349 --
NM_004922chr104790 771 660 38 --1256 --
NM_004923chr113701 146 108 ------
NM_004926chr14----1211 11582
NM_004932chr52176 89 ------
NM_004947chr321843 1818 --1968 --
NM_004952chr11710 1963 ----
NM_004956chr753080 3026 3014 1300 1108 14497 ----
NM_004961chrX31123 302 39 11456 ----
NM_004965chr211105 ------
NM_004968chr74573 494 482 47 ------
NM_004973chr61103 ------
NM_004976chr11115133 4446 4312 3228 3167 1997 1671 1576 1569 408 62 14084 ----
NM_004978chr1101726 1576 1257 1097 592 430 424 408 383 265 --157 --
NM_004979chrX3955 359 308 ------
NM_004992chrX278164 7951 6931 6781 6532 6493 6373 6351 5741 5705 5529 5257 3178 3046 2974 2788 2638 2552 2331 1672 1345 1163 648 436 427 263 90 --17657 --
NM_004992chrX278164 7951 6931 6781 6532 6493 6373 6351 5741 5705 5529 5257 3178 3046 2974 2788 2638 2552 2331 1672 1345 1163 648 436 427 263 90 --17657 --
NM_004993chr141329 --11379 --
NM_004995chr1441061 1027 370 125 --1617 --
NM_004998chr153104 74 38 1315 ----
NM_005010chr72641 622 --12137 --
NM_005011chr771751 1471 1269 1223 751 696 626 --11452 --
NM_005020chr71527 --162 --
NM_005045chr72933 720 ------
NM_005055chr113183 155 45 ------
NM_005056chr12145029 4093 4076 3769 3761 3711 3703 3653 3645 3595 3587 1740 1047 526 ------
NM_005057chr111744 11613 ----
NM_005060chr131102 986 347 --2267 119 --
NM_005068chr611458 1137 ----
NM_005079chr832880 2269 211 --12262 12937
NM_005080chr222827 793 --1929 --
NM_005087chr3----1115 --
NM_005088chrX3810 625 70 ------
NM_005093chr20125119 4885 4676 4486 4185 3932 3575 3410 1265 970 310 256 --24357 442 --
NM_005096chrX31111 320 116 1382 11057 --
NM_005099chr111132 --170 --
NM_005105chr121525 343 1633 ----
NM_005109chr31212 162 ----
NM_005110chr56733 699 543 276 132 114 ------
NM_005112chr41394 ------
NM_005114chr42674 448 ------
NM_005116chr2094604 3843 3814 1709 1427 1307 561 315 259 --153 --
NM_005117chr11--172 ----
NM_005120chrX----1225 --
NM_005121chr1722348 1129 ----12915
NM_005126chr31735 ------
NM_005133chr112282 39 --1292 --
NM_005134chr181746 ------
NM_005135chr1563576 3415 2537 751 426 167 ------
NM_005144chr851227 947 851 774 408 ------
NM_005151chr1821737 705 ------
NM_005153chr163747 668 86 1521 1169 --
NM_005155chr64716 527 510 182 ------
NM_005156chr913376 13428 25276 4739 --
NM_005157chr961886 1874 1815 318 160 121 --3747 621 246 --
NM_005159chr153891 397 53 1137 12077 --
NM_005160chr2285876 5640 5080 2053 1372 879 154 111 ------
NM_005168chr2----11298 --
NM_005176chr12157 ------
NM_005181chr8279 59 ------
NM_005184chr1941306 1219 1095 169 ------
NM_005187chr1641537 1363 1289 55 ------
NM_005194chr201212 1430 ----
NM_005197chr1485490 5108 4854 4289 4238 4111 2401 625 ----13814
NM_005204chr10--1603 ----
NM_005206chr171892 --1340 --
NM_005207chr2253553 3400 3217 2731 1463 ----1952
NM_005219chr541766 1277 487 167 1544 31564 704 28 --
NM_005220chr1721335 1288 --2447 322 --
NM_005224chr191698 --1499 --
NM_005229chrX31284 987 189 ------
NM_005230chr121477 ----1250
NM_005233chr361761 1044 1031 585 101 22 ------
NM_005235chr237719 6148 5560 35938 5304 410 1741 --
NM_005238chr1132545 625 411 12453 --12506
NM_005241chr3152 ------
NM_005252chr14197 ------
NM_005254chr152232 142 ------
NM_005256chr111169 ------
NM_005257chr182349 31 --11171 --
NM_005259chr2--1259 ----
NM_005264chr102179 115 --2947 159 --
NM_005266chr171191 579 547 478 430 211 109 ----1380
NM_005276chr1271694 1519 1433 1406 1160 524 465 --1585 --
NM_005276chr1271694 1519 1433 1406 1160 524 465 --1585 --
NM_005277chr451721 1691 1283 612 98 ----1215
NM_005281chr14842 177 87 69 ------
NM_005311chr732503 2480 579 --12780 --
NM_005312chr9112476 2404 2364 2267 2086 1875 1814 1016 1003 394 52 --1861 --
NM_005316chr1111081 ------
NM_005321chr6151 ------
NM_005324chr1731722 1299 238 11928 11850 11669
NM_005326chr16141 ------
NM_005329chr1642039 897 284 171 ------
NM_005330chr11127 ------
NM_005336chr291877 1850 1671 1664 841 551 314 169 111 --1264 --
NM_005339chr4----14066 --
NM_005342chrX52515 2177 2043 555 445 --1956 --
NM_005359chr1845957 5907 5297 2083 34668 4201 145 26459 6417 11711
NM_005374chr1782247 1970 1821 1780 872 839 604 128 --2673 612 --
NM_005378chr21348 ------
NM_005380chr161252 1172 1042 879 476 236 1273 ----
NM_005385chr342573 2147 2127 896 12016 ----
NM_005386chr20145 --1834 --
NM_005392chr91329 --11352 --
NM_005397chr763253 2456 1398 974 542 40 11537 12651 --
NM_005400chr262293 946 749 478 413 300 ----1980
NM_005406chr182477 59 ------
NM_005407chr1481530 1522 1504 1369 519 271 52 27 11228 ----
NM_005413chr21360 ------
NM_005425chr16127 ------
NM_005426chr11337 1371 ----
NM_005433chr181284 --22373 1121 --
NM_005436chr1053377 2659 2590 2545 316 13011 12922 --
NM_005437chr1051364 1221 418 304 217 --11151 --
NM_005439chr12--1452 ----
NM_005442chr31412 ------
NM_005445chr101306 1231 ----
NM_005450chr172167 79 ------
NM_005458chr921645 1518 1806 1405 --
NM_005461chr2011662 11314 ----
NM_005465chr111803 ----182
NM_005467chr111163 ------
NM_005476chr9----140 --
NM_005493chr6165 ------
NM_005501chr1731207 1184 1063 ------
NM_005502chr933053 2248 327 ------
NM_005504chr1251969 1474 1187 1044 350 1762 15636 --
NM_005505chr122852 77 ------
NM_005506chr452871 2635 834 489 290 --22515 1067 1669
NM_005507chr111439 ------
NM_005515chr73214 168 56 --1620 --
NM_005519chr102449 72 ----1135
NM_005522chr741053 376 311 283 --21281 134 --
NM_005524chr3--1314 ----
NM_005537chr131846 ------
NM_005539chr102497 346 11423 11209 --
NM_005544chr21969 --1754 --
NM_005546chr531851 1708 548 ------
NM_005558chr12390 320 1925 1177 --
NM_005573chr51252 --1746 --
NM_005578chr333740 1917 701 ------
NM_005593chr121235 ------
NM_005594chr12196 ------
NM_005596chr954940 4735 4512 3884 2343 ------
NM_005598chr1111495 1487 1476 1372 1319 1309 1193 625 481 320 206 --1407 --
NM_005604chr642029 773 408 35 --22172 665 --
NM_005607chr82771 109 ------
NM_005613chr131873 850 85 --11841 1889
NM_005618chr6--1243 ----
NM_005625chr81997 ------
NM_005626chr12523 363 ------
NM_005632chr1651088 1047 697 351 141 --11006 --
NM_005634chrX2237 215 --1571 --
NM_005637chr1811649 ------
NM_005639chr1221251 43 ------
NM_005647chrX53385 3222 2596 691 69 ----12832
NM_005652chr162979 70 144 ----
NM_005653chr12133 ------
NM_005660chrX2204 160 ------
NM_005668chr534338 1737 738 ------
NM_005688chr33894 886 126 1862 11089 --
NM_005700chr111357 ------
NM_005707chr15138 ----1827
NM_005711chr511037 ------
NM_005718chr34795 761 543 213 ------
NM_005721chr21326 ------
NM_005722chr221879 910 --32214 1621 512 --
NM_005724chr152845 302 ------
NM_005730chr1263107 2947 2511 1178 1110 1066 12757 ----
NM_005734chr112777 258 1542 ----
NM_005738chr721269 183 ------
NM_005739chr1531543 485 361 --11556 --
NM_005746chr722781 2098 12194 ----
NM_005748chr1253423 3335 3280 998 585 ------
NM_005756chrX1981 11261 1559 --
NM_005759chr254697 4612 4319 3479 1296 23359 856 11425 --
NM_005776chr141849 ------
NM_005778chr32479 163 ------
NM_005780chr13----2807 713 --
NM_005783chr21418 ------
NM_005785chr1261690 1644 1563 1438 1359 1183 --1624 --
NM_005786chr18----11073 --
NM_005795chr23315 169 37 ------
NM_005813chr231940 1745 789 ----1708
NM_005819chr132415 1021 157 --4771 450 368 27 --
NM_005826chr12216 190 ------
NM_005828chr1794677 4551 1763 1482 1413 1292 1024 734 259 11519 44098 2023 1721 149 --
NM_005832chr33933 300 105 ------
NM_005839chr11296 ------
NM_005840chrX136668 6293 6169 5535 5092 4737 2515 2454 2394 2262 1617 325 124 36860 4675 1789 27449 2596 --
NM_005850chr1----180 --
NM_005851chr11160 ------
NM_005852chr174831 816 736 368 --1148 --
NM_005857chr111186 --167 --
NM_005868chr732525 2084 235 12311 1390 --
NM_005870chr1311294 1216 ----
NM_005876chr2--1136 ----
NM_005877chr2252527 2276 2198 1890 501 1118 11849 --
NM_005882chr41232 ------
NM_005885chr531630 1279 427 --1225 --
NM_005895chr1283743 3050 2940 2783 2620 1274 629 281 146 ----
NM_005898chr1132883 2227 735 --12991 22779 2745
NM_005901chr1888410 6435 5986 5464 3240 2302 1092 398 28647 7665 11824 15966
NM_005902chr1584232 3765 3608 2916 1300 1070 983 453 --14639 --
NM_005903chr545081 1982 1208 1055 11139 13496 --
NM_005904chr183919 410 177 ------
NM_005906chr611232 --155 --
NM_005909chr564301 3924 3619 2958 2905 2800 11219 33904 1184 690 13551
NM_005910chr17103729 3312 3279 3090 3027 2999 2783 1362 361 105 ------
NM_005911chr261029 591 578 461 396 61 --2528 110 --
NM_005917chr21134 ------
NM_005920chr163704 2988 1203 1183 870 80 12533 52433 2358 1174 1161 1003 --
NM_005922chr61152 ------
NM_005924chr72186 21 --1826 --
NM_005933chr1172757 2239 931 843 766 134 88 ------
NM_005934chr19102223 2185 2042 1907 936 781 501 274 241 156 ------
NM_005935chr453548 1755 1063 685 633 --14386 --
NM_005937chr17134006 3786 3574 3527 3502 3349 3056 2854 2660 2636 1466 1456 1104 --23035 148 23589 907
NM_005941chr863873 3314 3184 1506 553 186 ------
NM_005943chr651711 1254 264 256 189 ------
NM_005955chr184679 4491 4265 3392 2197 1532 1322 417 14035 ----
NM_005962chr1021771 810 11716 12094 --
NM_005962chr1021771 810 11716 12094 --
NM_005966chr211577 --11708 --
NM_005967chr121471 ------
NM_005968chr191255 ------
NM_005977chr131351 ------
NM_005984chr222438 116 ------
NM_005996chr1231240 1002 261 ------
NM_006003chr19128 ------
NM_006007chr953708 3658 1764 806 281 ------
NM_006011chr1573856 3482 3097 2950 1412 1244 1109 11632 13453 --
NM_006015chr12264 205 --1125 --
NM_006016chr62681 339 --22033 1957 --
NM_006036chr241023 282 231 128 ----1521
NM_006037chr253078 2998 1870 1361 927 --14572 --
NM_006038chr2021872 24 --21555 1370 --
NM_006039chr172791 439 --1809 --
NM_006041chr172379 159 ------
NM_006047chr2033203 528 366 ----12983
NM_006054chr1111638 --11112 --
NM_006060chr753773 3321 2905 1742 541 --22937 1252 --
NM_006070chr31274 ------
NM_006080chr721875 136 ------
NM_006089chrX21766 101 ------
NM_006094chr821557 264 1714 12346 --
NM_006095chr474269 3947 1579 1127 1023 725 607 --33312 1674 960 --
NM_006099chr11897 ----1736
NM_006106chr1142843 2713 418 151 12689 ----
NM_006109chr14252 39 ------
NM_006121chr12127 --2332 147 --
NM_006122chr1572688 2641 2184 1101 1071 831 798 --1997 --
NM_006129chr82530 231 ------
NM_006139chr211063 --12420 1541
NM_006141chr1651086 1056 1046 265 236 --1854 12090
NM_006142chr12485 120 ------
NM_006145chr193880 467 351 ------
NM_006148chr178934 924 680 622 585 442 405 177 --2341 136 --
NM_006153chr3--1254 1198 --
NM_006154chr1511981 ------
NM_006157chr11----1377 --
NM_006158chr831634 1349 84 ------
NM_006164chr21419 ----162
NM_006176chr116736 634 319 285 163 27 ------
NM_006180chr951921 1781 328 239 142 11678 ----
NM_006185chr112474 96 ------
NM_006187chr1252991 2717 2216 2135 456 --1261 --
NM_006191chr124948 170 137 32 ------
NM_006195chr911359 ------
NM_006201chrX21180 210 ------
NM_006202chr1961882 1708 570 395 334 328 --11388 --
NM_006203chr545454 3917 1012 928 13841 --13645
NM_006216chr21107 ------
NM_006223chrX3478 144 125 ----1417
NM_006224chr17142374 2198 2120 1963 1924 1799 1759 862 846 703 545 461 223 62 12430 ----
NM_006226chr2----21369 1276 --
NM_006238chr662030 1403 1351 537 192 157 --21970 229 --
NM_006241chr3167 --1899 1369
NM_006245chr63810 332 275 ------
NM_006246chr14----1320 --
NM_006251chr583347 3035 2418 2264 2164 744 611 425 ------
NM_006252chr156919 6308 5734 2044 1477 --11441 12488
NM_006255chr142394 346 ------
NM_006256chr142773 2567 463 177 11969 192 --
NM_006257chr103326 227 76 ------
NM_006258chr102181 22 --11164 --
NM_006267chr22599 517 ------
NM_006268chr111166 1897 11181 --
NM_006277chr22239 99 ------
NM_006279chr13732 713 226 --1932 --
NM_006282chr20124636 4307 2932 2900 1609 1417 1343 1331 886 731 628 30 --14285 --
NM_006283chr833371 549 45 --13103 11294
NM_006285chr93279 108 88 ------
NM_006288chr116867 858 848 238 138 40 ------
NM_006289chr92345 316 ------
NM_006290chr641222 665 564 251 --1140 --
NM_006292chr11----132 --
NM_006298chr643088 2201 798 360 --62746 2668 461 352 220 146 12641
NM_006309chr3132 ------
NM_006310chr173970 365 145 --1936 --
NM_006315chr454212 1031 908 601 309 --22745 481 --
NM_006317chr51773 ------
NM_006328chr111184 --1496 --
NM_006352chr12650 561 1763 1328 --
NM_006353chr621244 22 --11402 --
NM_006356chr17123 ------
NM_006357chr21530 ------
NM_006359chrX32158 967 433 ------
NM_006364chr141372 ------
NM_006366chr621007 219 1979 ----
NM_006367chr12851 109 198 ----
NM_006369chr12355 302 ------
NM_006371chr353792 3688 3347 1497 1125 ------
NM_006372chr61167 ------
NM_006375chrX11697 --21477 99 --
NM_006379chr721886 403 ------
NM_006380chr1774420 3648 3583 3470 3148 2810 1693 33060 1459 1389 ----
NM_006383chr153545 539 77 ------
NM_006389chr1161172 877 517 497 395 172 --2558 110 --
NM_006391chr112272 51 ------
NM_006401chr9----1145 --
NM_006405chr14----171 --
NM_006409chr7----1228 --
NM_006421chr8144 ------
NM_006434chr1072495 2268 1099 1014 433 359 242 ------
NM_006439chr41508 ------
NM_006449chr242025 1731 1700 869 --11524 --
NM_006454chr4152841 2622 2522 2265 2179 2139 1983 1057 1043 1033 1007 867 478 229 120 --1813 --
NM_006457chr412941 22803 1415 ----
NM_006459chr1041941 1913 739 512 ------
NM_006465chr1562170 2139 1680 536 267 150 --21454 1423 --
NM_006489chr1411539 ------
NM_006494chr193230 91 46 1689 ----
NM_006496chr111816 --1777 --
NM_006497chr174793 750 311 127 1323 1521 --
NM_006510chr641018 921 851 408 --1330 --
NM_006516chr161576 1512 1431 503 172 120 ----1436
NM_006517chrX61817 1669 1651 1525 286 150 12047 137 11779
NM_006526chr201508 --11502 --
NM_006527chr41238 --135 --
NM_006534chr2043077 2403 1205 120 23124 2324 ----
NM_006540chr84606 366 355 23 ------
NM_006544chr1455389 5341 5062 1647 1248 --21726 35 --
NM_006546chr17186273 6015 5947 5612 5490 4663 4198 4151 4093 4083 4044 2627 2423 1547 1229 1192 1134 275 11056 14863 --
NM_006547chr732103 604 266 1389 ----
NM_006548chr321339 244 ------
NM_006549chr12102826 2674 2490 2272 1984 1818 1167 941 920 768 1456 32968 2306 1973 --
NM_006557chr92436 23 ------
NM_006559chr11175 ------
NM_006560chr11----1125 --
NM_006561chr10125791 5397 5162 5117 5021 4945 4798 3918 2249 2203 1119 792 24876 4865 35521 2236 2105 --
NM_006562chr10--2258 36 ----
NM_006566chr182467 325 ------
NM_006572chr171389 21203 236 ----
NM_006574chr31241 ------
NM_006589chr11431 --1192 1525
NM_006599chr1667865 3152 1834 1723 1391 637 28229 1491 25649 2241 --
NM_006601chr122354 89 ------
NM_006603chrX----1624 --
NM_006609chr242996 2446 2156 36 --1978 --
NM_006614chr3--13428 --22637 579
NM_006618chr121094 427 ------
NM_006621chr14491 405 209 182 --11560 --
NM_006624chr101169 ------
NM_006625chr11390 ------
NM_006625chr11390 ------
NM_006625chr11390 ------
NM_006626chr94965 927 253 157 --3956 910 790 --
NM_006628chr1564093 3854 3067 1726 1631 1349 --11738 1818
NM_006629chr1822057 667 ------
NM_006640chr1741829 1394 305 281 1542 ----
NM_006646chr1352805 2031 1994 905 127 --1957 --
NM_006654chr1231285 1278 1173 --1552 --
NM_006662chr161323 ------
NM_006667chrX11012 ------
NM_006670chr61475 ------
NM_006682chr7----12779 --
NM_006690chr20112281 2080 2069 2042 1685 854 509 394 345 267 75 1861 ----
NM_006696chr5179 ------
NM_006699chr132482 993 575 --12522 --
NM_006703chr62321 76 ------
NM_006708chr64874 867 256 150 ------
NM_006717chr983296 3144 3126 2440 1227 1066 796 584 ------
NM_006720chr10135054 5014 4790 4758 4562 4116 3715 1689 1625 1143 791 756 562 11869 22046 609 11261
NM_006722chr322019 1926 --12052 --
NM_006724chr61152 ------
NM_006726chr41445 11234 11132 --
NM_006734chr61463 --11228 --
NM_006738chr1574620 4224 4181 3441 2879 930 105 --11105 12842
NM_006744chr10259 45 ------
NM_006745chr43804 259 72 1253 11100 --
NM_006748chr841281 1184 603 46 ------
NM_006750chr1687303 6598 5440 2743 1940 1831 1812 210 17943 46223 3098 2487 515 --
NM_006751chr2--1404 ----
NM_006761chr171129 ------
NM_006766chr872602 2437 2100 1864 1808 602 388 --1535 --
NM_006772chr641614 1544 1307 1084 ------
NM_006775chr61430 --11208 --
NM_006777chrX52458 2418 1967 1174 823 12471 12934 --
NM_006783chr131249 --179 --
NM_006788chr1841961 1517 701 299 --21955 711 11678
NM_006791chr15----1165 --
NM_006795chr114583 539 428 158 --11406 --
NM_006805chr51159 --144 --
NM_006807chr17--1964 ----
NM_006811chr20--2916 901 ----
NM_006814chr2062554 2250 546 511 200 178 --3827 260 239 --
NM_006822chr17193 --1196 --
NM_006823chr821306 291 ------
NM_006826chr21225 1459 ----
NM_006827chr1422342 2207 --21062 501 --
NM_006836chr123627 504 495 ------
NM_006838chr1231706 1699 1343 --11546 --
NM_006851chr1222827 902 --12282 1253
NM_006852chr1741919 1892 587 193 ----11025
NM_006854chr731823 284 269 ------
NM_006856chr1241033 1027 401 360 --11137 --
NM_006861chr12101889 1850 1755 761 735 711 641 563 477 68 ------
NM_006870chr202827 29 ------
NM_006874chr41937 ------
NM_006875chrX3861 260 185 1615 ----
NM_006876chr11142 --1503 --
NM_006884chr351358 1332 216 208 74 --11772 --
NM_006885chr1621695 1383 --1969 197
NM_006887chr2------1477
NM_006888chr1422404 269 ----11170
NM_006892chr203366 127 90 ------
NM_006892chr203366 127 90 ------
NM_006893chr1147 ------
NM_006896chr751108 839 818 754 180 --1785 --
NM_006897chr121608 ------
NM_006902chr163097 2961 2472 631 442 350 ------
NM_006906chr113270 166 116 ------
NM_006914chr91181 ------
NM_006915chrX22507 2280 --1808 --
NM_006922chr221027 738 ------
NM_006924chr1732744 1206 936 23651 146 13183 --
NM_006925chr141412 ------
NM_006930chr521778 1230 --1204 --
NM_006931chr1252056 1671 445 351 93 11542 ----
NM_006939chr14--1110 ----
NM_006940chr1211595 ------
NM_006950chrX----1377 --
NM_006951chr103627 517 155 ------
NM_006981chr972974 2936 2919 2807 2335 903 154 --1118 --
NM_006990chr192540 2419 2235 1923 1778 1620 1610 1541 211 --1959 --
NM_006997chr103311 74 66 ------
NM_007005chr91345 11386 ----
NM_007007chr1264653 3644 3115 3095 175 81 ------
NM_007011chr15176056 5836 5827 5068 5030 5014 4991 4874 4626 4221 2491 2216 2146 828 510 462 173 12500 1161 --
NM_007013chr82782 308 --129 --
NM_007017chr51778 ------
NM_007026chr171438 ------
NM_007030chr5125173 5073 4667 4402 3292 3259 1733 1660 1562 1510 1178 632 14057 --13551
NM_007033chr121669 126 ------
NM_007034chr11357 ------
NM_007039chr1422194 2048 1472 11986 --
NM_007040chr194883 721 388 21 --1745 --
NM_007042chr342599 697 614 401 --2498 94 --
NM_007050chr20197656 6812 6769 6486 5896 5648 2797 2712 2300 1842 1736 1680 1033 751 445 417 369 291 91 15469 25627 5099 --
NM_007052chrX1167 ------
NM_007067chr1761556 1434 1099 1054 144 84 ------
NM_007068chr22126 ------
NM_007096chr92246 219 --160 --
NM_007118chr52748 605 ------
NM_007124chr641736 99 91 74 --11301 --
NM_007129chr13----1787 --
NM_007144chr1721043 350 --196 --
NM_007146chr1732805 2665 582 ----1815
NM_007150chrX42124 1771 1607 1330 --21551 211 --
NM_007158chr1----1959 1813
NM_007159chr31290 ------
NM_007166chr1111355 ------
NM_007170chr12886 139 1718 ----
NM_007174chr1252215 1982 599 286 182 --21780 1711 --
NM_007178chr121131 ------
NM_007187chr131847 1173 ----
NM_007189chr73439 426 31 ------
NM_007191chr121123 1460 --1662
NM_007192chr144909 312 243 25 1764 11042 --
NM_007195chr1883435 3127 2769 2654 2569 1467 1455 530 --172 --
NM_007200chr1574620 4224 4181 3441 2879 930 105 --11105 12842
NM_007203chr923794 3040 ------
NM_007207chr11668 ------
NM_007212chr11906 ------
NM_007214chr62494 461 ------
NM_007236chr1552356 1898 1889 832 400 11833 1339 12376
NM_007238chr2084811 4753 3504 3414 3320 3271 3175 364 --44851 3784 3145 415 --
NM_007245chr165711 362 327 187 110 ------
NM_007249chr13108124 8080 8015 7160 6903 6344 6307 3565 3244 1510 --16958 --
NM_007275chr321108 309 11117 ----
NM_007285chr161457 ------
NM_007286chr592094 1982 1750 1729 1510 854 629 572 125 11779 ----
NM_007292chr1724337 1013 ----13181
NM_007294chr1721183 1034 --181 --
NM_007295chr1721183 1034 --181 --
NM_007296chr1721183 1034 --181 --
NM_007297chr1721183 1034 --181 --
NM_007298chr1721183 1034 --181 --
NM_007299chr1721183 1034 --181 --
NM_007300chr1721183 1034 --181 --
NM_007302chr1721183 1034 --181 --
NM_007303chr1721183 1034 --181 --
NM_007304chr1721183 1034 --181 --
NM_007305chr1721183 1034 --181 --
NM_007313chr961886 1874 1815 318 160 121 --3747 621 246 --
NM_007320chr192312 287 ------
NM_007332chr831043 480 125 127 --11026
NM_007345chr18187 ------
NM_007349chr7192 ------
NM_007350chr1253774 3232 3031 2967 1637 --14494 --
NM_007358chr111570 ------
NM_007361chr141111 ------
NM_007363chrX------1946
NM_007371chr92458 111 --1639 --
NM_007373chr1021842 680 ------
NM_009588chr62591 206 ------
NM_012064chr1231063 788 420 --135 --
NM_012081chr523304 180 ----12360
NM_012082chr82683 375 ------
NM_012083chr1011067 ----162
NM_012089chr121396 1241 1598 ----
NM_012090chr131131 1072 1044 ------
NM_012095chr1012281 12855 12482 --
NM_012102chr152471 2425 2091 2053 266 1827 ----
NM_012110chr41230 ------
NM_012115chr6153 ------
NM_012120chr622875 2484 --12385 --
NM_012125chr151607 1495 ----
NM_012129chr732279 1806 203 --168 --
NM_012141chr1322928 959 --13736 --
NM_012153chr1162480 2373 1839 1769 846 324 --11608 --
NM_012156chr2053328 2542 2506 2328 718 11053 --13010
NM_012158chr1321626 1379 ------
NM_012161chr411031 ------
NM_012164chr9117157 6800 6281 6213 6113 5770 2596 2097 1653 1363 804 12238 16894 1467
NM_012175chr111786 ------
NM_012180chr42533 117 ------
NM_012183chr11414 ------
NM_012192chr113513 486 129 1371 11872 11511
NM_012193chr11105220 4847 4368 4343 3689 3674 2155 2048 1906 1284 14471 15089 --
NM_012197chr9----21364 643 --
NM_012199chr162842 2830 1616 1430 1145 599 14684 34608 3635 3100 13611
NM_012214chr242417 2166 1730 1571 15767 ----
NM_012215chr1011333 --11946 --
NM_012223chr2136 ------
NM_012224chr44964 802 770 71 ------
NM_012232chr1741905 1883 1804 37 --21451 378 --
NM_012233chr2------1457
NM_012234chr343625 3082 845 255 --13068 --
NM_012238chr10----11630 11255
NM_012244chr1441502 751 733 553 --11159 --
NM_012247chr10----1215 --
NM_012249chr283399 2853 2456 2335 1362 825 713 161 ------
NM_012250chr1131381 1285 258 ------
NM_012252chr721869 830 --23529 283 13783
NM_012261chr201499 ------
NM_012262chr153709 3227 1600 1225 68 --13903 --
NM_012264chr2272063 1601 829 657 639 440 401 --21968 1313 --
NM_012264chr2272063 1601 829 657 639 440 401 --21968 1313 --
NM_012272chr124395 372 162 47 ------
NM_012281chr72267 137 11966 11637 --
NM_012286chrX1406 --1171 --
NM_012287chr343627 3592 3447 440 1937 1695 --
NM_012290chr2----21679 153 --
NM_012297chr432247 739 424 ------
NM_012300chr542082 2072 1959 210 --1663 --
NM_012301chr721836 1455 --1875 --
NM_012306chr12143517 3448 3303 3112 3008 2546 2317 1270 1259 1119 737 712 264 72 --23508 676 --
NM_012307chr18176 ------
NM_012308chr1142012 1988 967 190 12427 1713 --
NM_012309chr11144558 4167 3698 3594 3543 1637 949 906 840 647 631 411 314 33 --33352 1226 344 14059
NM_012316chr175197 4545 4136 1908 1360 602 133 11947 23667 622 --
NM_012323chr22147 21530 344 11097 --
NM_012325chr2011105 --11292 --
NM_012326chr22312 34 ------
NM_012327chr181492 --2273 170 --
NM_012330chr101304 ------
NM_012334chr564143 3655 3586 1860 916 65 --23889 123 11014
NM_012343chr511132 --1106 --
NM_012384chr2052202 2183 2083 2071 1972 1728 1798 --
NM_012392chr13725 575 50 ------
NM_012395chr732364 1285 1162 --22125 1377 --
NM_012398chr1962919 2170 1133 965 917 34 ------
NM_012408chr202869 826 ------
NM_012410chr162496 335 ------
NM_012417chr172569 109 ------
NM_012428chr152347 28 ------
NM_012429chr22--1395 ----
NM_012430chr31103 ------
NM_012446chr51429 ------
NM_012448chr1732268 2175 84 --2730 28 --
NM_012461chr142666 285 ------
NM_012464chr432830 2423 564 --12139 --
NM_012465chr1082656 2334 2304 2204 1041 354 288 208 1318 ----
NM_012470chr7----1190 --
NM_012479chr732654 936 919 ------
NM_012482chr11163 ------
NM_013229chr12----12438 195
NM_013231chr1454265 3814 3374 1445 1425 ------
NM_013233chr221248 1227 --11278 --
NM_013247chr23493 367 26 --1554 --
NM_013253chr1131361 162 90 ----1552
NM_013255chr7127602 7227 6041 5997 3256 2596 2218 1892 1562 906 890 67 25772 1350 57431 6025 5936 5918 2002 --
NM_013257chr8------12252
NM_013261chr453398 3013 2430 1378 434 ------
NM_013262chr641096 907 448 219 ------
NM_013279chr1172105 2074 1843 858 843 629 104 ------
NM_013281chr2011196 ------
NM_013283chr51135 ------
NM_013286chr363299 2962 2732 1523 806 518 22631 2325 ----
NM_013302chr16114703 3812 3734 3004 2958 2853 1557 1497 1196 895 167 ------
NM_013305chr183881 188 132 --1763 --
NM_013309chr1532678 1816 953 --1430 --
NM_013322chr7166 --1183 --
NM_013326chr18----166 --
NM_013341chr252847 2091 1190 1101 345 12887 12743 21791 883
NM_013348chr1941045 441 195 96 ------
NM_013354chr81910 1158 ----
NM_013365chr221124 ------
NM_013372chr1542962 1092 754 390 1547 ----
NM_013373chr221727 ------
NM_013374chr322307 161 --1801 --
NM_013381chr121212 ------
NM_013382chr1492142 2116 2066 1947 1720 726 625 195 136 22234 1853 22342 1488 --
NM_013390chr951223 1159 638 333 164 ------
NM_013401chr113886 680 29 ------
NM_013411chr142282 1969 1091 691 163 12317 11080
NM_013433chr1921958 1253 --21866 566 --
NM_013434chr261967 1677 1670 1510 776 439 1487 ----
NM_013434chr261967 1677 1670 1510 776 439 1487 ----
NM_013438chr911689 152 ----
NM_013443chr911109 1875 ----
NM_013444chrX--154 1998 --
NM_013446chr711319 ------
NM_013448chr141603 ------
NM_013449chr12122952 2928 2845 2800 2437 2122 2111 2098 747 625 539 194 ------
NM_013450chr21329 ------
NM_013937chr63998 420 378 --11043 --
NM_013951chr262377 1631 1532 572 393 353 12169 2977 867 --
NM_013952chr272454 1708 1609 649 470 430 23 12246 1944 --
NM_013953chr272454 1708 1609 649 470 430 23 12246 1944 --
NM_013960chr82608 85 --1254 --
NM_013992chr272454 1708 1609 649 470 430 23 12246 1944 --
NM_013995chrX41699 419 410 53 22618 1619 1104 --
NM_013996chr7130 ------
NM_013996chr7130 ------
NM_013997chr7130 ------
NM_013997chr7130 ------
NM_013998chr7130 ------
NM_013998chr7130 ------
NM_014007chr95987 513 392 324 143 ------
NM_014016chr3----1346 --
NM_014021chr111108 --11202 --
NM_014023chr1032232 2109 1951 --11917 1511
NM_014030chr1751135 1118 942 877 350 --1200 --
NM_014035chr51103 1173 ----
NM_014038chr7188 ------
NM_014046chr61582 ------
NM_014055chr12------1435
NM_014056chr332135 1737 484 ------
NM_014057chr911311 ------
NM_014089chr1331471 889 400 ------
NM_014109chr8----1931 140
NM_014112chr884977 4814 4618 4425 4013 3757 3464 780 --23675 1222 11859
NM_014117chr1652567 2506 1966 1780 979 1417 12554 --
NM_014141chr754964 4601 906 601 583 33791 3529 442 15052 --
NM_014153chr161119 ------
NM_014154chr351358 602 591 474 252 ------
NM_014155chr11146585 6199 6071 5473 4688 4594 2723 2551 2336 2320 1327 1198 974 461 --25371 544 --
NM_014178chr143569 222 90 ------
NM_014181chr222385 1140 12827 ----
NM_014183chr201259 ------
NM_014190chr441609 1332 646 305 --1573 --
NM_014191chr121796 ------
NM_014217chr121829 56 ------
NM_014230chr172529 72 ------
NM_014231chr1262026 1709 1386 828 265 116 1717 ----
NM_014232chr17160 --11252 --
NM_014232chr17160 --11252 --
NM_014233chr173765 621 45 ------
NM_014253chrX----11584 12113
NM_014264chr4--1223 ----
NM_014268chr182970 273 ------
NM_014271chrX1699 ------
NM_014275chr5----1791 --
NM_014278chr4------1300
NM_014282chr931296 903 162 --1918 --
NM_014283chr1--1339 1288 --
NM_014286chr972993 2584 2251 1326 724 307 197 ------
NM_014288chr11222 ------
NM_014289chrX11303 --1425 --
NM_014294chr821380 104 ------
NM_014299chr1991756 1533 1478 1466 1442 592 576 470 40 --11431 --
NM_014300chr154368 323 111 21 ------
NM_014309chr2274973 4165 3794 3387 1597 812 785 13308 21681 1274 --
NM_014316chr1631764 1717 1594 11985 12015 --
NM_014319chr121345 11781 --1413
NM_014325chr1241448 1416 794 607 12224 ----
NM_014329chr161278 ------
NM_014331chr447534 6330 2344 2009 27766 7466 12624 --
NM_014333chr1142294 2065 894 325 ------
NM_014345chr6--144 ----
NM_014352chr1151022 362 295 276 206 11523 ----
NM_014363chr1331229 1047 75 ------
NM_014365chr122720 49 ------
NM_014381chr1432997 2108 365 12457 32537 2410 1253 12963
NM_014386chr5131 ------
NM_014392chr431469 211 121 11321 1249 --
NM_014393chr821866 1552 --11648 --
NM_014400chr191391 --2476 139 --
NM_014415chr311074 ------
NM_014423chr544686 4583 1070 326 13777 21872 1262 14304
NM_014445chr311936 ----1564
NM_014447chr431097 520 492 --11321 --
NM_014452chr61287 1406 ----
NM_014454chr61190 --1914 --
NM_014462chr8127 ------
NM_014469chr111291 --1222 --
NM_014472chr103679 636 82 ------
NM_014489chr113803 252 166 ------
NM_014491chr7--1311 ----
NM_014494chr1642071 1845 1692 955 ------
NM_014496chrX------1268
NM_014497chr2--1235 ----
NM_014498chr31339 ------
NM_014515chr1221073 1045 ------
NM_014517chr32727 232 ----1295
NM_014548chr1521380 521 ------
NM_014554chr123680 630 293 --147 --
NM_014562chr21680 ------
NM_014569chr731505 1137 336 --21309 373 --
NM_014572chr131140 ----11799
NM_014573chr1761698 1622 1561 1335 1162 594 ------
NM_014574chr142419 400 ------
NM_014575chr34535 428 151 47 --1491 --
NM_014577chr221316 --1103 --
NM_014584chr1411110 --11410 --
NM_014587chr1631348 193 100 11409 ----
NM_014592chr5126 ------
NM_014600chr22553 261 11543 ----
NM_014601chr1971697 1278 1202 561 192 42 34 ------
NM_014603chr17111618 1596 1532 1264 1257 1123 498 329 272 225 71 ------
NM_014607chr2----1270 --
NM_014612chr911343 ------
NM_014613chr552922 2447 639 492 433 --1942 --
NM_014614chr22108 30 --1163 --
NM_014615chr1673247 2811 2274 695 679 300 143 12880 22319 602 --
NM_014616chr342624 1059 402 85 13275 ----
NM_014620chr121150 ------
NM_014630chr15133431 2906 2532 1130 918 485 415 392 383 342 239 213 201 13966 13672 --
NM_014634chr22133535 3513 3451 3424 3281 2986 2751 2739 2591 2372 2289 448 248 12333 --1262
NM_014636chr943112 1097 923 36 1724 11238 --
NM_014646chr1873080 3015 2960 1166 394 115 68 --32891 2033 190 11063
NM_014653chr124870 661 375 127 --11718 --
NM_014655chr141777 227 174 160 ------
NM_014657chr202320 280 ------
NM_014659chr154751 736 332 227 ------
NM_014660chr71376 ------
NM_014663chr13971 330 312 ------
NM_014665chr893515 3324 3199 3098 2704 808 702 390 132 --32793 2427 1160 --
NM_014666chr51418 ------
NM_014667chr342300 1621 411 382 12482 ----
NM_014674chr353985 3842 2872 931 879 --12907 13489
NM_014676chr11602 --1438 --
NM_014686chr1962140 2015 1849 182 161 135 --2657 330 12564
NM_014689chr21132 1561 1537 --
NM_014690chr772651 2244 2060 1947 592 271 123 --21134 812 12405
NM_014701chr1552452 882 746 724 409 ------
NM_014702chr633503 3273 3246 --13189 --
NM_014705chr751982 1901 1829 732 705 --1105 --
NM_014711chr16--12100 21955 721 --
NM_014712chr162478 57 --1171 --
NM_014713chr2180 ------
NM_014717chr191709 ------
NM_014718chr122715 215 ------
NM_014720chr104733 445 402 35 ------
NM_014721chr687249 5698 2800 1153 857 308 180 156 17347 --1683
NM_014723chr20112793 2484 2419 2360 2051 2035 870 810 455 297 188 11109 12945 --
NM_014726chr1751166 219 207 184 177 11212 2492 383 --
NM_014729chr821960 171 ------
NM_014730chr12144619 4098 4060 2009 1923 1761 1710 1691 1587 1472 1402 1280 341 226 22029 1933 23399 1734 15038
NM_014730chr12144619 4098 4060 2009 1923 1761 1710 1691 1587 1472 1402 1280 341 226 22029 1933 23399 1734 15038
NM_014731chr2051223 1145 467 168 142 ------
NM_014733chr532254 351 129 1688 ----
NM_014735chrX11489 1605 21358 414 --
NM_014737chr2063842 3234 3154 1639 170 115 --41437 1237 1226 1185 --
NM_014739chr654085 4061 1385 375 309 ----11216
NM_014741chr1181910 1629 1322 772 678 489 321 123 ------
NM_014742chr2051251 514 450 255 127 11317 1398 --
NM_014743chr4103057 2612 2532 2458 1985 1176 1105 974 951 382 --12437 --
NM_014746chr294010 3763 3193 2813 1697 1113 1085 337 118 1346 13484 --
NM_014748chr22378 308 ------
NM_014751chr81685 --21680 121 --
NM_014752chr1121807 187 --11388 --
NM_014755chr243550 1434 1280 210 --1655 --
NM_014756chr111171 --1386 --
NM_014757chr582157 2026 1906 1800 1719 1664 573 128 --1712 --
NM_014758chr1161617 534 448 384 301 210 1457 21737 692 --
NM_014761chr1631100 234 157 ------
NM_014765chr152498 2310 693 537 70 --1778 --
NM_014767chr10143311 3104 2728 2560 2353 1407 1037 917 699 513 500 443 262 47 --12657 --
NM_014771chr164883 430 285 180 ------
NM_014772chr18133309 2900 2550 2461 2357 2257 2229 1386 1276 1127 924 819 674 --11204 --
NM_014774chr142583 1290 907 831 21006 721 --12547
NM_014776chr12102864 2489 2381 2188 2176 1250 1153 948 734 666 12989 32724 1241 1110 1632
NM_014786chr1131121 1049 189 ----1277
NM_014790chr5--125 --1155
NM_014791chr9------1288
NM_014795chr2123 ------
NM_014798chr171652 11854 21507 733 --
NM_014800chr73910 206 199 ------
NM_014810chr152603 2554 2342 1285 97 ----11102
NM_014819chr522069 1957 1864 ----
NM_014826chr173973 3687 3449 3207 1188 731 393 --22853 1044 1443
NM_014827chr11597 11264 ----
NM_014828chr1442337 2063 1623 84 11640 ----
NM_014830chr1263200 3152 3064 1381 1255 30 ------
NM_014832chr1331510 571 34 --12092 --
NM_014835chr2062039 1868 1683 837 302 208 ------
NM_014836chr1031841 1370 1306 ------
NM_014840chr1273281 2922 2588 2493 1336 350 179 11192 1816 12174
NM_014841chr6----11175 --
NM_014847chr12141 45 ------
NM_014850chr344522 1316 289 234 ------
NM_014858chr12781 151 --1127 --
NM_014860chr242471 2244 1925 613 1858 ----
NM_014868chr122185 115 ------
NM_014869chr341217 1141 1016 510 ------
NM_014870chr1124627 4613 4458 3420 3290 2951 1563 1519 1137 852 671 155 --31799 783 655 11068
NM_014872chr931783 1745 787 22195 108 ----
NM_014873chr133961 1891 1173 ------
NM_014874chr131625 89 68 --11708 --
NM_014876chr222688 184 --11795 --
NM_014877chr17136945 6866 6836 6620 6156 5618 4703 2881 2854 2606 1699 1664 94 --15642 17696
NM_014881chr10----136 --
NM_014883chr441926 1585 143 71 11642 ----
NM_014888chr711539 ------
NM_014891chr721527 1225 1552 ----
NM_014892chr61551 ------
NM_014893chrY1426 --22323 748 --
NM_014897chr1751978 916 903 537 118 ------
NM_014900chr21868 --11011 --
NM_014901chr551997 1424 187 109 43 --11627 --
NM_014903chr1222393 239 ------
NM_014904chr1043793 405 326 244 --13672 --
NM_014906chr1753895 3136 1604 1163 29 ------
NM_014909chr14113837 3653 3086 2937 2525 2475 974 772 746 708 372 --23970 2966 --
NM_014912chr1021350 837 ----11310
NM_014921chr19102895 2762 2442 2309 2273 764 625 503 433 223 12780 2611 387 --
NM_014924chr1422210 378 --1456 --
NM_014925chr122679 290 --1347 --
NM_014932chr31707 ------
NM_014934chr1343841 3228 2756 89 --13265 --
NM_014935chr183270 2479 1357 1141 916 644 94 44 --23137 2751 13494
NM_014936chr62714 458 ------
NM_014939chr1811246 --21280 463 --
NM_014944chr14591 577 193 164 11205 ----
NM_014945chr521335 168 --1606 --
NM_014946chr222675 2619 --11081 --
NM_014947chr152090 766 723 629 524 --1861 1230
NM_014949chr11152 ------
NM_014950chr141140 ------
NM_014961chr452070 1763 1545 315 87 ----31594 1384 220
NM_014969chr11453 --2410 253 --
NM_014974chr1031455 1432 1410 --11535 --
NM_014978chr1021320 329 ------
NM_014982chr14105118 4768 3635 3601 2136 927 912 893 790 448 --21019 855 --
NM_014988chr452472 857 497 122 92 ------
NM_014989chr611503 1240 ----
NM_014990chr142832 149 130 ----
NM_014991chr412614 2800 225 ----
NM_014992chr141716 ------
NM_014994chr1551905 1509 752 361 145 ------
NM_014996chr3----174 --
NM_014997chr792860 2580 1974 1937 922 725 341 207 201 1739 11855 --
NM_015000chr1222120 189 ------
NM_015002chr1252036 1702 1661 311 165 ------
NM_015008chr343263 3219 3024 2778 12388 12711 --
NM_015012chr111356 ------
NM_015013chr12112 62 ------
NM_015015chr1941875 673 350 260 ------
NM_015020chr1633293 1383 1249 --23675 1058 --
NM_015023chr151520 1169 629 611 457 --11422 --
NM_015024chr82201 99 --11289 --
NM_015025chr2----12221 --
NM_015026chr1284740 3837 3755 1246 862 682 584 184 154 24597 1483 --
NM_015035chr20125945 5743 5226 4940 4716 4184 4077 1676 1456 1151 551 128 --14629 --
NM_015037chr101107 ------
NM_015039chr184108 3563 3135 1650 1559 1532 573 430 --13570 13498
NM_015042chr15103968 3710 3669 2826 2780 1616 1243 824 737 34 1932 13471 --
NM_015044chr1643073 2618 717 548 12879 32485 829 695 12276
NM_015045chr1011378 1828 1458 --
NM_015050chr681252 1198 1141 938 376 256 195 81 ------
NM_015051chr943119 2965 2885 783 --2856 657 --
NM_015052chr721361 194 --11124 --
NM_015054chr12134 ------
NM_015059chr15123928 3428 3219 2853 1552 1428 864 793 735 658 352 65 13080 23009 596 --
NM_015061chr91650 ------
NM_015063chr195959 519 488 215 65 ------
NM_015064chr1272773 2449 2222 1307 1049 231 163 --23255 1374 --
NM_015068chr743255 2942 1255 863 --157 --
NM_015071chr585201 4663 4565 4545 2152 1540 994 148 --22470 2250 --
NM_015074chr151675 1403 786 751 147 --2911 860 --
NM_015075chrX51867 400 278 193 106 1729 32084 2072 2046 --
NM_015076chr653281 1423 956 713 46 13543 2359 163 --
NM_015077chr17164358 4288 4156 4031 3992 3530 3337 1895 1668 1533 1506 1359 913 792 591 106 --33130 968 68 --
NM_015078chr34307 184 32 25 ------
NM_015079chr1593049 2544 2432 2226 1193 1100 1055 710 117 --23199 2138 --
NM_015080chr113909 231 116 ------
NM_015086chr1241585 1215 970 87 --1243 --
NM_015090chr1125721 4845 4438 4278 4077 2352 1380 1365 1326 1182 749 652 --15730 --
NM_015092chr1624582 3182 --14320 --
NM_015093chr611729 ------
NM_015100chr121884 1713 ------
NM_015106chr31152 ------
NM_015107chrX42273 1538 776 170 ------
NM_015112chr1148 ------
NM_015113chr1771952 1616 1586 1548 552 159 104 12246 1667 --
NM_015115chr42155 95 ------
NM_015129chrX41731 705 165 152 156 11258 --
NM_015130chr431237 1140 852 --1873 --
NM_015132chr7--1703 11218 --
NM_015133chr1651307 965 950 374 256 --1246 --
NM_015137chr832368 796 226 12079 ----
NM_015138chr1532745 936 22 --22670 961 --
NM_015147chr221287 226 --11155 --
NM_015149chr132066 1784 686 --2745 128 11557
NM_015153chr61626 ------
NM_015155chr1033228 1011 889 --21005 667 --
NM_015156chr1453485 375 336 204 174 --33515 2868 320 13408
NM_015158chr92868 55 ------
NM_015171chr164445 180 145 108 ------
NM_015173chr42297 104 ------
NM_015176chr12163 22 --1706 1102
NM_015178chr861985 1706 817 669 327 64 1545 22491 134 --
NM_015185chrX52623 2350 2338 2239 589 --1551 --
NM_015191chr1172728 2706 2618 2555 825 262 234 2291 52 11850 12384
NM_015192chr204350 281 174 138 ----12888
NM_015193chr851148 601 290 207 126 ----11089
NM_015197chr1462327 2137 1268 1178 717 595 --1163 --
NM_015199chr322151 37 --12857 --
NM_015200chr422132 49 --32392 305 56 --
NM_015205chr13135157 4029 3931 3783 3734 3697 3607 3562 1600 1111 829 150 57 23660 3312 --43465 3412 3353 3205
NM_015206chr1553738 3368 2749 825 432 ------
NM_015208chr1813967 --1912 --
NM_015209chr131708 714 638 --12151 11795
NM_015213chr11152 ------
NM_015215chr132962 2084 444 --12396 --
NM_015221chr1031391 972 87 --1519 --
NM_015225chr942584 2222 753 725 --22715 2593 --
NM_015229chr175902 879 864 339 253 ------
NM_015233chr1352298 1826 504 34 27 --1652 --
NM_015234chr621163 1131 11269 11232 --
NM_015236chr411171 ------
NM_015265chr2------12212
NM_015268chr31256 ------
NM_015270chr1242156 1893 1577 564 --1685 --
NM_015272chr1621680 438 11314 --159
NM_015278chr642887 2201 1287 376 --13024 --
NM_015284chr171808 1622 1513 596 563 474 35 --21568 336 --
NM_015288chr5113781 2998 2686 2619 2587 1083 844 588 566 281 214 --22750 964 --
NM_015291chr173054 2904 2458 1363 1256 342 115 1453 12485 1480
NM_015293chr62494 278 ------
NM_015294chr172938 442 ------
NM_015299chr14153915 3811 3711 3552 3426 3269 2834 2718 916 530 369 303 281 192 38 1902 1426 --
NM_015305chr1431465 762 260 11795 127 --
NM_015308chr11----1835 --
NM_015310chr8138268 7958 7880 6780 6585 6467 5710 2501 2364 2354 2085 541 172 27182 7024 --16897
NM_015313chr1184808 4430 3324 1247 601 578 462 74 1643 33828 3447 1283 --
NM_015315chr51987 --22923 236 --
NM_015317chr212124 12754 1992 --
NM_015319chr121337 ------
NM_015323chr611605 1564 --11412
NM_015326chr152706 2278 2153 935 774 22315 864 ----
NM_015327chr151212 1181 930 537 269 --11122 --
NM_015328chr762806 2732 2559 2401 753 91 12123 ----
NM_015332chr793423 2890 2763 1387 1036 917 768 444 71 --12386 --
NM_015335chr121590 --22471 35 --
NM_015338chr2081936 1506 1447 1387 1349 1330 651 237 ------
NM_015339chr201136 ------
NM_015346chr1441315 1307 1199 290 --1463 --
NM_015349chr642760 2229 1113 76 ------
NM_015355chr1721530 1289 11714 1587 --
NM_015359chr842858 2706 2582 2482 1647 --12512
NM_015361chr21313 --178 --
NM_015365chrX21088 133 --14025 --
NM_015375chr184872 3772 3530 1588 1424 1173 575 496 14553 ----
NM_015378chr182823 2672 2444 2320 2142 1070 1011 68 --12164 --
NM_015379chr7287 37 ------
NM_015381chr2281878 1576 1328 1264 820 333 169 42 ------
NM_015382chr14----1287 --
NM_015385chr1072495 2268 1099 1014 433 359 242 ------
NM_015387chr2----22073 98 --
NM_015393chr473866 3242 2791 2558 1225 434 275 12484 1558 --
NM_015397chr951277 360 306 155 94 --11401 --
NM_015417chr202491 442 ------
NM_015439chr61398 ------
NM_015443chr1731274 944 51 ------
NM_015444chr32225 177 --2442 105 --
NM_015446chr11634 ------
NM_015455chr533391 3290 1165 --33580 3120 899 --
NM_015460chr321932 215 ------
NM_015464chr71329 ------
NM_015466chr31189 --2217 77 --
NM_015475chr211014 ------
NM_015483chr71394 1331 ----
NM_015488chr261633 1514 1427 1180 1171 1127 --1347 --
NM_015493chr194202 182 134 76 ----12032
NM_015497chr153289 118 79 --1214 --
NM_015503chr163584 562 515 --1572 --
NM_015508chr321547 1240 ------
NM_015509chr1231426 1203 604 --1133 --
NM_015520chr332579 635 407 --12737 --
NM_015530chr24726 602 341 273 ------
NM_015534chr12152 125 ------
NM_015535chr294213 3735 3065 1576 1200 1177 854 784 157 11260 11497 11318
NM_015541chr331310 1158 531 ------
NM_015550chr733192 2544 641 --32726 2713 480 13583
NM_015553chr651689 1607 797 172 119 1245 --11265
NM_015554chr1532622 1875 1043 --1371 --
NM_015557chr143547 3122 2537 805 --12685 --
NM_015565chr2122265 1651 ------
NM_015567chr131134 ------
NM_015568chr20133817 3724 3662 2744 1683 1664 1321 1302 990 758 308 287 42 12851 23315 3286 --
NM_015569chr121926 1062 --3678 617 481 --
NM_015570chr721588 1437 ------
NM_015571chr612013 --12306 --
NM_015575chr262960 2572 1189 952 746 520 11467 --13037
NM_015576chr352741 2651 1157 76 23 --22138 430 --
NM_015578chr1921630 1481 --142 --
NM_015602chr131589 1504 207 --4462 454 247 82 --
NM_015605chr101177 ------
NM_015607chr11157 ------
NM_015609chr142945 1836 788 447 --22456 654 --
NM_015635chr91188 ------
NM_015640chr174871 4828 4607 3450 677 389 29 ------
NM_015645chr112341 312 ------
NM_015646chr123819 446 23 ----1417
NM_015651chr941910 1680 184 64 ------
NM_015652chr101223 ------
NM_015660chr7--1256 ----
NM_015670chr17----176 --
NM_015678chr132636 538 ------
NM_015686chrX92510 1965 1917 1885 252 166 76 51 45 --1398 12334
NM_015695chr651915 767 661 320 96 1856 ----
NM_015696chr1----1216 --
NM_015713chr833133 1062 790 --1854 --
NM_015716chr173772 244 42 --1226 --
NM_015726chr151712 1579 1360 1171 486 11786 ----
NM_015834chr212910 120 ------
NM_015844chr181170 ------
NM_015846chr181170 ------
NM_015847chr181170 ------
NM_015850chr841928 1785 728 338 11641 --12226
NM_015855chr113573 363 194 ------
NM_015866chr131254 1218 269 --1455 --
NM_015872chr151450 1407 464 278 183 11220 ----
NM_015878chr8--12229 ----
NM_015879chr18158304 8158 7490 7174 5855 5834 5613 5446 3303 2714 2653 2312 2022 338 148 --48547 8054 5655 5207 12517
NM_015881chr1131361 162 90 ----1552
NM_015886chr875250 4059 2158 2135 1658 1143 938 1306 1932 13667
NM_015898chr1962450 1931 1635 751 738 245 ------
NM_015904chr22664 209 --2692 319 --
NM_015906chr154668 4322 4198 1470 870 11063 24479 4031 --
NM_015912chr861773 1650 1007 941 299 99 --21938 857 --
NM_015913chr13639 586 541 ------
NM_015916chr10121 ------
NM_015926chr32264 106 ------
NM_015980chr581264 1190 447 435 414 365 195 67 --11147 --
NM_015981chr592882 2794 2460 2342 2198 2102 2007 1077 1020 --22495 2182 --
NM_015982chr17------1292
NM_015990chr41944 ------
NM_015995chr15125417 5128 4955 3980 3389 2205 1910 1842 1296 1274 927 813 11750 15240 --
NM_015999chr11137 ------
NM_016002chr11248 --150 --
NM_016009chr163951 3298 3202 3172 1960 1952 ----21514 255
NM_016018chr822640 1023 --11140 --
NM_016019chr7134 ------
NM_016021chr62461 347 --1211 --
NM_016022chr11743 ------
NM_016025chr1621598 538 ------
NM_016032chrX21253 1182 ------
NM_016035chr94416 280 86 67 ------
NM_016037chr11860 --11112 --
NM_016039chr14----122 --
NM_016059chr62274 173 --126 155
NM_016061chr221274 436 --21448 1104 --
NM_016062chr16----152 --
NM_016075chr1343185 3164 2594 446 12161 --12467
NM_016076chr122787 261 --22488 584 --
NM_016083chr623803 3563 1963 ----
NM_016090chr1121078 810 ------
NM_016096chr841440 1381 674 450 ------
NM_016100chr20179 ------
NM_016107chr52273 226 --1990 --
NM_016131chr221657 792 ------
NM_016132chr1512476 --13350 --
NM_016133chr21349 ------
NM_016138chr1631529 1469 348 ------
NM_016141chr3198 ------
NM_016144chr5134 --1558 --
NM_016147chr115827 230 221 116 36 --2871 258 --
NM_016152chr3145 ----1248
NM_016169chr1063181 2671 2490 2271 2178 977 13026 42622 2440 1288 452 --
NM_016173chr3123355 3234 3114 2971 2904 1649 1553 1415 1150 1090 827 161 --23789 626 --
NM_016201chr351439 895 492 324 215 --3904 782 500 --
NM_016205chr421183 414 --2187 23 --
NM_016210chr321591 59 ------
NM_016223chr112300 108 --2279 56 --
NM_016227chr1--1339 1288 --
NM_016250chr14----1184 --
NM_016255chr642538 916 593 558 --13213 --
NM_016256chr162232 60 --2503 133 --
NM_016257chr162793 2680 2647 1198 689 412 --22425 1020 --
NM_016260chr246200 2559 1971 1658 11864 15329 --
NM_016269chr43763 479 231 ------
NM_016271chr18--1152 21725 737 --
NM_016272chr2262097 1874 1791 1760 1111 353 --11906 --
NM_016281chr121892 ------
NM_016284chr162951 378 --2668 87 --
NM_016312chr12127 163 ----
NM_016315chr21219 ------
NM_016316chr2--1646 ----
NM_016322chr932783 848 539 ----1899
NM_016333chr163330 165 133 ------
NM_016338chr51862 1320 ----
NM_016339chr1771469 1351 1315 1204 298 221 191 --3654 404 253 --
NM_016340chr511085 --1484 --
NM_016351chr7194 --1419 --
NM_016377chr621554 1507 11785 ----
NM_016395chr152758 23 --11603 --
NM_016396chr1522486 2017 --12304 --
NM_016399chr123726 643 568 ------
NM_016403chr112730 607 ------
NM_016410chr91135 ------
NM_016418chr22103593 2803 2615 1000 977 962 872 570 177 58 ------
NM_016422chr1132501 2273 529 1307 22574 263 --
NM_016436chr2052531 2042 781 464 58 ------
NM_016441chr232275 2264 910 --11530 1717
NM_016453chr32669 31 ------
NM_016467chr21515 --11112 --
NM_016480chr53791 366 83 ------
NM_016484chrX2185 164 --1553 --
NM_016507chr1743080 493 372 193 ------
NM_016516chr21645 ------
NM_016521chrX127 ------
NM_016522chr11----11183 --
NM_016530chr1521248 52 --33994 3855 1074 --
NM_016536chr19179 ------
NM_016542chrX2392 89 ------
NM_016544chr2103769 3227 2843 2397 1375 1237 601 321 269 104 13844 1481 --
NM_016545chr12719 278 ------
NM_016559chr311217 ------
NM_016569chr1231240 1002 261 ------
NM_016570chr121309 ------
NM_016577chr364300 4070 3988 2829 581 68 --13075 --
NM_016578chr11144 ------
NM_016603chr51619 ------
NM_016604chr5176 --123 --
NM_016605chr572324 1972 1873 1742 599 487 115 ------
NM_016607chrX31197 541 293 --1513 --
NM_016619chr4------123
NM_016621chr1164260 3994 3149 1770 1522 882 13925 44115 3458 3328 3273 14431
NM_016623chr81125 ------
NM_016641chr1641489 1379 676 209 ------
NM_016654chr152232 142 ------
NM_016824chr101230 11896 ----
NM_016829chr32260 162 --170 --
NM_016834chr17103729 3312 3279 3090 3027 2999 2783 1362 361 105 ------
NM_016835chr17103729 3312 3279 3090 3027 2999 2783 1362 361 105 ------
NM_016841chr17103729 3312 3279 3090 3027 2999 2783 1362 361 105 ------
NM_016929chr662971 1548 1128 1084 528 65 --23389 312 --
NM_016931chr111346 ------
NM_016936chr1681761 1429 1423 426 406 259 228 138 --1597 --
NM_016946chr173001 2915 2515 1230 1180 1096 398 11224 41338 1104 1026 616 --
NM_017409chr122782 33 ------
NM_017410chr1241061 783 435 144 ------
NM_017413chrX6717 566 404 172 98 71 --1138 --
NM_017415chr573677 3531 3387 3176 3129 2857 675 11488 2909 817 --
NM_017420chr1413014 ----12960
NM_017423chr431806 278 107 ----11593
NM_017426chr4----1182 --
NM_017432chr191347 ------
NM_017450chr1751156 972 924 81 39 ------
NM_017451chr1761008 927 892 427 381 226 ------
NM_017455chr152347 28 ------
NM_017456chr1741479 219 132 50 --41309 517 251 44 --
NM_017457chr19----1120 --
NM_017488chr231458 600 356 11603 ----
NM_017491chr41394 ------
NM_017519chr61114 ------
NM_017548chr31435 ------
NM_017551chr1042613 1762 1684 447 ------
NM_017558chr162399 160 ------
NM_017563chr374857 4808 4670 3872 1924 355 211 11635 24967 4143 25150 1664
NM_017569chr13160 ------
NM_017575chr1781586 1497 1385 1048 639 423 165 40 1553 11238 --
NM_017580chr1042166 544 403 396 ----11928
NM_017581chr42372 132 ------
NM_017582chr121350 124 ------
NM_017583chr1131739 189 73 11757 ----
NM_017590chr2222104 288 1319 ----
NM_017596chr194536 3955 3948 2972 1395 1139 983 309 86 14652 21790 1307 --
NM_017599chr124756 214 59 38 ------
NM_017602chrX179 --1794 --
NM_017610chr152779 251 ------
NM_017622chr172507 120 ------
NM_017633chr653230 3043 2941 2427 130 ------
NM_017635chr111355 11490 ----
NM_017637chr9139208 8734 8250 8063 8056 7856 6459 6191 6032 5903 862 654 31 --17400 --
NM_017643chr1763023 2172 2076 972 872 123 --1461 --
NM_017651chr611070 11368 ----
NM_017658chr1464286 3224 1125 445 354 175 ------
NM_017660chr19133368 3266 3033 2979 2606 2150 2113 1369 989 456 407 319 31 --22381 2120 --
NM_017664chr131147 ------
NM_017666chrX31382 802 124 --21852 139 155
NM_017668chr161113 --2550 142 --
NM_017670chr111262 --1828 --
NM_017680chr92980 380 ------
NM_017693chr13----11260 --
NM_017694chr221439 42 2406 119 ----
NM_017709chr193271 2924 1564 1311 1250 844 504 309 112 12646 33114 3030 878 --
NM_017714chr202707 257 ------
NM_017715chr72565 183 ------
NM_017719chr321631 691 ------
NM_017721chr191339 ------
NM_017737chr11357 --12001 1205
NM_017739chr11177 1411 ----
NM_017744chr13776 741 308 --31701 663 141 --
NM_017745chrX--1632 ----
NM_017748chr17--1874 ----
NM_017753chr911016 --1967 --
NM_017754chr6124811 4795 3878 3794 3752 1973 1459 926 884 823 640 434 --24536 3193 --
NM_017755chr5152 ------
NM_017757chr185255 124 114 79 52 2819 752 ----
NM_017763chr175932 459 351 190 76 ------
NM_017766chr12505 83 1169 1466 --
NM_017769chr1411055 12441 2106 29 --
NM_017778chr831229 1001 535 ------
NM_017780chr82798 649 ------
NM_017784chr311151 --1318 --
NM_017786chr82537 108 --1475 --
NM_017789chr2--2799 573 --148
NM_017790chr92250 28 ------
NM_017799chr142733 39 11724 11526 --
NM_017801chr332072 938 339 --21686 73 --
NM_017805chr19--149 ----
NM_017807chr14----132 --
NM_017810chr161476 1278 2644 31 --
NM_017811chr982871 2799 2638 2445 2356 1911 629 161 --1128 --
NM_017813chr8166 15469 14328 --
NM_017822chr121830 --1224 --
NM_017824chr1011816 1109 11062 1990
NM_017830chr4144 ------
NM_017845chr4--1659 ----
NM_017848chrX64543 4508 4035 3538 1243 349 ------
NM_017856chrX62064 2057 1734 1323 400 54 ------
NM_017866chr83445 431 425 ------
NM_017880chr23429 417 97 1113 ----
NM_017893chr1041231 567 221 27 --11446 21140 277
NM_017902chr10165579 5437 4660 4322 3977 3798 3779 3768 2226 1662 1556 1205 822 551 460 375 --43640 1840 1313 777 --
NM_017907chr111202 --125 --
NM_017916chr19123 ------
NM_017921chr1792269 2252 2234 1853 1451 535 244 168 137 --31772 424 156 --
NM_017923chr42737 682 --1101 --
NM_017926chr143891 346 284 ------
NM_017933chr231324 481 293 ------
NM_017955chr144881 872 222 59 ------
NM_017958chr252923 2251 2216 528 473 --2398 31 --
NM_017972chr143891 346 284 ------
NM_017982chr141263 518 148 34 21143 397 ----
NM_017983chr171167 ------
NM_017987chr103834 372 82 ------
NM_018008chr31258 ------
NM_018010chr331611 1309 245 ------
NM_018011chr133508 499 57 ------
NM_018015chrX1113 ------
NM_018027chr1043121 2543 2051 315 ------
NM_018028chr193502 71 33 ------
NM_018031chr33626 420 125 ------
NM_018036chr1474146 3851 2913 746 384 341 69 --13426 --
NM_018045chr1122697 2651 2442 2383 2289 2012 761 695 449 118 81 28 12198 22709 2629 --
NM_018046chr511565 11320 --11910
NM_018047chr51860 ------
NM_018048chr1252044 1833 1710 1691 1391 --1781 --
NM_018061chr131372 543 102 ------
NM_018063chr101467 ------
NM_018064chr62258 36 ------
NM_018070chr1------1408
NM_018084chr242509 1307 1133 404 ------
NM_018086chr231716 1392 1363 --1185 --
NM_018092chr1631018 352 336 --11321 11049
NM_018107chr14----1165 --
NM_018111chr19182 ------
NM_018116chr1----1464 --
NM_018121chr1042701 1966 802 429 ----13098
NM_018125chr11451 ------
NM_018133chr311704 --192 --
NM_018150chr14760 676 247 211 1304 ----
NM_018156chr182823 2672 2444 2320 2142 1070 1011 68 --12164 --
NM_018157chr1222201 58 ------
NM_018171chr121732 --1742 1839
NM_018172chr1151052 601 445 341 261 ------
NM_018178chr131789 1536 151 11305 ----
NM_018181chr1851717 1492 1387 696 632 --1345 --
NM_018184chr331997 220 61 ------
NM_018193chr152260 37 ------
NM_018195chr1132044 1607 688 ------
NM_018199chr1441189 868 818 146 ------
NM_018201chr992492 2264 1621 401 359 341 182 161 59 21851 878 1335 --
NM_018205chr1042350 936 686 318 --22238 813 --
NM_018214chr63367 85 55 ------
NM_018227chr423099 2362 1707 43079 2853 2512 1241 --
NM_018239chr1042350 936 686 318 --22238 813 --
NM_018244chr2031187 1147 210 ------
NM_018247chr61148 --12001 --
NM_018252chr11520 ------
NM_018254chr122085 1549 1362 1817 --
NM_018263chr231896 1800 1020 22393 644 ----
NM_018275chr71523 --1219 --
NM_018281chr11203 ------
NM_018286chr173866 798 145 ------
NM_018287chr101413 ------
NM_018293chr312332 --1678 --
NM_018299chr81291 --1722 13046
NM_018320chr1121259 372 11098 1948 --
NM_018323chr4187 1404 ----
NM_018327chr2021214 488 --11274 --
NM_018330chr101202 --1633 --
NM_018334chr73515 155 140 ------
NM_018351chr1224566 3936 ----1534
NM_018354chr202246 34 ------
NM_018361chr841582 947 539 389 ----1398
NM_018362chr111963 13954 ----
NM_018364chr1--12968 23116 2660 --
NM_018367chr1142145 1018 751 711 ------
NM_018370chr1232076 943 689 1574 12136 2295 145
NM_018371chr851481 1446 1307 1127 1117 ------
NM_018373chr1466107 5807 5291 4326 3921 1431 --14336 14491
NM_018374chr721926 311 ------
NM_018383chr222021 717 --1310 --
NM_018386chr132340 114 ------
NM_018387chr91399 ------
NM_018388chrX21405 1165 ------
NM_018403chr383949 3924 2617 2551 1571 1384 907 468 --12634 1483
NM_018416chr1222514 2222 2927 812 1855 --
NM_018424chr941878 1839 1666 289 ------
NM_018441chr2160 ------
NM_018444chr822379 577 --1265 --
NM_018445chr151147 1121 ----
NM_018448chr1221270 98 ------
NM_018449chr92687 599 ------
NM_018452chr6_random22369 1478 ------
NM_018457chr12158 ------
NM_018460chr21152 ------
NM_018469chr171123 ------
NM_018482chr81453 1367 ----
NM_018490chr1111447 ------
NM_018509chr1751680 1626 1525 1462 1324 --11317 --
NM_018553chr172129 104 --11613 --
NM_018557chr231432 1353 505 ------
NM_018566chr143278 1355 1283 789 14833 13599 --
NM_018584chr121250 200 ------
NM_018602chr1521066 654 1300 11636 1576
NM_018639chr123512 400 23 --11000 --
NM_018640chr1242656 1879 782 366 --12243 --
NM_018644chr115536 517 422 300 131 ------
NM_018650chr132239 1763 571 ------
NM_018660chr852130 1937 996 660 28 ------
NM_018667chr1682468 2146 2088 716 599 553 528 338 --1933 --
NM_018674chr24559 552 505 73 --1123 --
NM_018682chr71123 ------
NM_018684chrX51293 1285 1101 1084 166 1151 ----
NM_018685chr7------11159
NM_018695chr5----11977 --
NM_018698chrX41732 693 667 38 11960 ----
NM_018710chr811108 ------
NM_018712chr11----1418 --
NM_018715chr141783 1712 1478 786 --22004 1637 --
NM_018718chr73826 544 439 --1153 --
NM_018719chr731293 1130 449 11078 21267 335 --
NM_018834chr51326 1864 ----
NM_018837chr201724 ------
NM_018841chr132646 1295 543 --31161 58 21 13594
NM_018844chr721981 1910 ----1201
NM_018846chr71340 1130 ----
NM_018896chr173199 118 87 --156 --
NM_018897chr2--127 ----
NM_018898chr542089 2051 134 80 ------
NM_018899chr542089 2051 134 80 ------
NM_018900chr542089 2051 134 80 ------
NM_018901chr542089 2051 134 80 ------
NM_018902chr542089 2051 134 80 ------
NM_018903chr542089 2051 134 80 ------
NM_018904chr542089 2051 134 80 ------
NM_018905chr542089 2051 134 80 ------
NM_018906chr542089 2051 134 80 ------
NM_018907chr542089 2051 134 80 ------
NM_018908chr542089 2051 134 80 ------
NM_018909chr542089 2051 134 80 ------
NM_018910chr542089 2051 134 80 ------
NM_018911chr542089 2051 134 80 ------
NM_018912chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018913chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018914chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018915chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018916chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018917chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018918chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018919chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018920chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018921chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018922chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018923chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018924chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018925chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018926chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018927chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018928chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018929chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_018951chr721191 105 ------
NM_018952chr172565 169 ------
NM_018958chr1583767 3697 3554 3253 2879 1186 854 608 183 22896 2543 --
NM_018959chr191484 ----1532
NM_018963chr2131450 144 80 --1158 --
NM_018970chr7--11965 ----
NM_018976chr1222201 959 --22105 1941 --
NM_018977chrX2292 34 --1431 --
NM_018979chr1292572 1947 1835 926 765 749 637 503 237 --1366 --
NM_018994chr11531 ------
NM_018999chr1074550 4254 3416 877 589 542 524 13513 --1864
NM_019001chr374438 3750 3461 1549 949 913 887 1507 ----
NM_019004chr73471 155 139 ------
NM_019006chr151455 ------
NM_019027chr431948 841 694 12373 ----
NM_019030chr5----1177 --
NM_019045chrX1363 ------
NM_019060chr1173 ----1314
NM_019066chr15397 77 25 ------
NM_019072chr533564 1444 366 --1359 12939
NM_019083chr111356 ------
NM_019091chr2----1875 --
NM_019098chr82320 37 ------
NM_019102chr73414 400 90 ------
NM_019102chr73414 400 90 ------
NM_019106chr2252234 1266 1064 614 259 --12497 --
NM_019114chr952424 2261 2255 891 782 ------
NM_019116chr16153334 3206 3055 2875 2743 2433 2301 2293 1058 915 813 718 643 219 200 --12977 --
NM_019555chr331234 687 357 ----1378
NM_019556chrX1202 11249 ----
NM_019557chr13774 669 36 ------
NM_019558chr21127 ------
NM_019590chr1021296 505 11456 11443 11320
NM_019593chr2042743 2328 1989 98 --13093 --
NM_019595chr22239 99 ------
NM_019597chrX----1146 --
NM_019605chr1151 --1185 --
NM_019606chr7----1381 --
NM_019610chr111357 21891 719 11870 --
NM_019613chr1751259 901 313 285 276 ------
NM_019845chr23820 745 335 ------
NM_019849chr19----1190 --
NM_019859chr1051418 1033 350 328 265 --2544 94 --
NM_019860chr1051466 1081 398 376 313 --2592 142 --
NM_019884chr19----2534 82 --
NM_019885chr282955 2355 2305 940 346 203 197 185 12968 ----
NM_019891chr1--11350 ----
NM_019903chr101230 11896 ----
NM_020039chr1241606 1280 1197 284 11829 ----
NM_020116chr411268 ------
NM_020122chr2105958 5516 5208 5149 4507 3871 1687 1585 1247 571 --11332 --
NM_020123chr101296 ------
NM_020134chr221164 204 ------
NM_020141chr121982 204 --22359 332 --
NM_020148chr1842493 2469 2319 303 --1342 --
NM_020150chr1052110 546 169 95 60 --11983 --
NM_020151chr22453 311 2172 35 11132 --
NM_020152chr211100 ----1155
NM_020159chr411229 ------
NM_020177chr523278 377 12207 12999 --
NM_020178chr1751027 900 867 455 85 --11125 --
NM_020179chr112415 332 ------
NM_020180chr18--1965 ----
NM_020182chr20143460 3416 3242 2902 2828 2757 2749 2643 2356 2268 1382 942 815 61 ------
NM_020184chr232074 454 177 --2629 539 --
NM_020198chr1721112 43 ------
NM_020211chr1551209 1065 979 240 31 --1341 --
NM_020226chr4--1520 ----
NM_020228chr112266 64 --180 --
NM_020229chr113394 174 120 ------
NM_020239chr152024 1556 1461 633 431 --31764 780 314 --
NM_020248chr172379 1771 1516 491 350 341 59 ----12226
NM_020310chr1782497 2412 1739 875 693 274 262 75 ------
NM_020336chr201190 --11525 --
NM_020337chr452409 1991 969 373 273 ------
NM_020338chr1043278 2442 975 760 --12504 --
NM_020342chr242214 667 431 61 12613 ----
NM_020357chr321309 398 ----1577
NM_020362chr12832 83 ----1748
NM_020382chr1211016 --1463 --
NM_020390chr323795 270 33729 1733 1687 ----
NM_020403chr131622 --11797 --
NM_020420chrY11393 21828 1219 ----
NM_020423chr11383 --1526 --
NM_020428chr192800 293 ------
NM_020429chr732378 2243 177 --2331 61 --
NM_020432chr72692 570 11508 ----
NM_020433chr20111731 1648 1568 1449 1392 1371 652 290 277 224 212 --21588 28 --
NM_020440chr193090 2961 2892 2513 2485 1088 629 417 190 12529 12407 --
NM_020443chr1196613 6536 6455 6360 6068 5646 5547 5340 5048 4394 2432 2426 2151 1978 1924 1479 1109 765 660 11336 55957 4228 2131 432 62 21895 362
NM_020452chr11396 ------
NM_020463chr21338 --1261 --
NM_020465chr1611464 ------
NM_020474chr181719 ------
NM_020475chr862192 1888 1882 1594 767 546 ------
NM_020476chr862192 1888 1882 1594 767 546 ------
NM_020477chr862192 1888 1882 1594 767 546 ------
NM_020478chr872255 1951 1945 1657 1556 830 609 ------
NM_020480chr862192 1888 1882 1594 767 546 ------
NM_020530chr222220 79 --1924 --
NM_020546chr572540 2489 2410 2214 995 851 778 32949 2865 206 12577 --
NM_020647chr812132 --32263 1887 1839 --
NM_020673chr2056693 1445 1213 690 633 12562 27479 2860 11844
NM_020689chr2031147 258 132 --2548 31 --
NM_020692chr143189 150 60 1418 187 --
NM_020697chr81359 11145 21191 491 --
NM_020699chr194610 3973 3428 3338 3317 1949 1801 1570 1536 --14285 --
NM_020703chr11430 ------
NM_020704chr74502 114 102 43 --1239 --
NM_020708chr206943 861 604 418 397 48 1907 1202 --
NM_020711chr232501 1969 1018 ------
NM_020713chr20122834 1973 1268 1156 1022 732 638 592 554 336 208 69 ------
NM_020717chrX125033 4678 4566 4004 1817 1722 1543 1535 1360 1344 785 400 11830 11620 1197
NM_020718chr1654331 2610 985 846 456 24643 4250 15052 --
NM_020727chr2133712 3515 280 --12577 --
NM_020728chr722513 38 --1246 1217
NM_020732chr61114 ------
NM_020734chr123610 528 459 ------
NM_020739chr1543983 3477 850 601 --11358 --
NM_020742chrX42646 1892 1806 1799 --12396 --
NM_020747chr5170 ------
NM_020748chr1722006 1840 ------
NM_020753chr172295 270 --2508 167 --
NM_020754chr331405 1060 460 ------
NM_020760chr221925 303 ------
NM_020764chr1641303 975 962 178 --1896 --
NM_020766chrX64236 3889 3746 3442 971 386 12891 21739 60 11773
NM_020769chrX2744 61 --1683 --
NM_020771chr611307 --11194 --
NM_020772chr1768200 7453 7147 3406 2203 1861 37954 1969 80 26904 351 22945 1157
NM_020773chr492376 2126 2070 1969 1927 927 652 593 104 ------
NM_020777chr4101829 1798 1651 818 780 718 653 554 440 402 --1929 --
NM_020778chr15174615 3892 3830 3318 3191 3041 1693 1541 1415 1175 1154 1134 863 769 639 312 228 --14667 --
NM_020792chr322241 356 --12041 --
NM_020794chr111509 --1330 --
NM_020795chr17----21943 1808 --
NM_020801chr542632 1969 1784 1665 --1371 --
NM_020802chr1141270 1048 329 256 ------
NM_020804chr6122545 2283 2054 1931 1884 1854 1646 1637 1048 798 264 89 --12383 --
NM_020807chr1621467 335 --21525 77 --
NM_020824chr101691 ------
NM_020830chr232652 71 42 13252 ----
NM_020836chr141126 ------
NM_020841chr12--14068 ----
NM_020843chr15176 --1403 --
NM_020850chr1632449 1228 1097 --22985 992 --
NM_020854chr1821121 57 ------
NM_020856chr191460 ------
NM_020858chr1531728 756 183 ------
NM_020860chr41783 ------
NM_020868chr21749 ------
NM_020870chr421761 521 ------
NM_020871chrX12036 ----11571
NM_020872chr3--11650 11120 --
NM_020873chr3121 ------
NM_020886chr1131253 470 33 ------
NM_020888chr171449 1364 1297 590 554 167 68 --11625 --
NM_020889chr17122 ------
NM_020895chr191269 ------
NM_020898chr126773 523 322 189 133 103 ------
NM_020899chr17102459 2193 1774 1660 777 617 591 329 253 67 ------
NM_020918chr1033473 2252 174 --33142 64 47 --
NM_020920chr141333 ------
NM_020922chrX1341 --11355 --
NM_020927chr1612271 1618 1914 1386
NM_020947chr1672086 2072 1913 1696 833 691 564 ------
NM_020956chr19124728 4548 4436 4049 1616 1562 1548 1538 1429 1044 841 526 ------
NM_020962chr153943 559 119 11970 1526 --
NM_020967chr202866 404 --1432 --
NM_020971chr192746 100 ------
NM_020975chr1052021 1888 1373 222 112 --11306 --
NM_020977chr42448 223 --1126 --
NM_020993chr1252523 2453 2380 1902 890 --1588 --
NM_021003chr142753 617 1818 ----
NM_021007chr2--11658 ----
NM_021025chr52492 179 ------
NM_021032chr321964 1661 ------
NM_021033chr1311277 --12690 1463
NM_021035chr2031242 1175 56 --11166 --
NM_021064chr631235 501 57 ------
NM_021069chr431831 1536 356 ----1837
NM_021076chr222554 460 ------
NM_021079chr1773243 2733 2243 2123 2036 806 544 --1632 --
NM_021083chrX33594 628 129 --23181 144 --
NM_021090chr2284526 4216 3160 1514 1474 1198 746 655 21966 43 23237 1848 23223 1842
NM_021096chr22133080 3028 2784 2559 2516 2409 2062 2045 1126 1057 962 765 588 --22474 810 --
NM_021097chr252939 1038 845 767 120 ------
NM_021120chrX62855 2251 1218 969 450 411 ------
NM_021132chr1021285 124 ------
NM_021136chr142157 58 ----1684
NM_021140chrX--1171 ----
NM_021145chr7--1902 ----
NM_021155chr1992290 2275 2233 2201 1974 1083 998 983 476 --32488 2066 33 --
NM_021156chr202369 50 --1106 --
NM_021159chr42421 66 1541 11432 --
NM_021183chrX42259 1834 1563 724 ------
NM_021188chr141412 --1172 --
NM_021189chr121084 234 ------
NM_021202chr2062886 2606 2123 499 125 55 21226 1021 22784 348 --
NM_021220chr20289 70 ------
NM_021227chr4142 ------
NM_021229chr121332 ------
NM_021235chr19145 ------
NM_021238chr1231390 490 108 --21438 752 --
NM_021239chr14122 ------
NM_021240chr91195 ------
NM_021249chr14--11284 11563 --
NM_021253chr61414 --11344 --
NM_021255chr1443926 3274 3112 1209 21284 270 --1788
NM_021260chr1451347 962 882 486 452 ------
NM_021267chr1951315 1097 435 155 99 ------
NM_021269chr19--1112 ----
NM_021614chr51223 ------
NM_021622chr1032062 1997 675 162 11913 --
NM_021625chr121189 1210 125 --
NM_021627chr32419 405 ------
NM_021629chr334983 3572 508 24976 3767 13890 --
NM_021638chr4184942 4433 4277 3712 3587 3249 3187 3145 1846 1794 1751 964 896 861 725 131 118 80 ------
NM_021639chr1------1336
NM_021647chr463984 2950 2883 1378 1315 49 --13649 13258
NM_021648chr642299 1842 825 335 32657 1736 252 21715 23 --
NM_021722chr7----1378 --
NM_021723chr7194 --1419 --
NM_021724chr171263 ------
NM_021728chr141125 ------
NM_021808chr12----2483 192 --
NM_021809chr2062051 1927 1826 273 264 30 ------
NM_021813chr685206 4841 3587 2318 2202 1824 1749 1328 11250 --1393
NM_021825chr11135 ------
NM_021831chr2169 --1303 --
NM_021905chr681556 1499 1411 879 670 575 401 120 ------
NM_021908chr7139 --1828 --
NM_021911chr575105 5018 4640 4563 1564 815 164 --11770 --
NM_021912chr1553926 1361 791 558 550 --12720 --
NM_021913chr1931151 1128 732 ------
NM_021914chr14138 ------
NM_021935chr32682 101 ------
NM_021940chr631180 302 66 1481 ----
NM_021943chr641834 1623 670 382 ------
NM_021945chr6102574 2519 2433 1421 1270 1087 810 623 393 25 --3843 670 575 --
NM_021956chr641236 970 311 232 ------
NM_021961chr11106991 6930 6105 2769 2611 2276 1960 1594 1586 832 22496 2104 17379 --
NM_021962chr1781939 1625 1573 1564 839 550 487 128 --1420 --
NM_021963chrX1549 ------
NM_021964chr334226 4133 1651 ----15218
NM_021965chr911344 --1880 --
NM_021970chr42585 250 ------
NM_021976chr641041 904 784 25 ------
NM_021979chr141168 ------
NM_021984chrX31123 302 39 11456 ----
NM_021987chrX31123 302 39 11456 ----
NM_021988chr202576 124 ------
NM_021990chrX31123 302 39 11456 ----
NM_021991chr176648 592 580 241 166 25 --1527 --
NM_021998chrX----11345 --
NM_022048chr1585963 5462 5219 4220 1688 1076 580 232 --25502 62 --
NM_022060chr1471377 1294 1283 1110 954 502 459 ------
NM_022062chr1151239 586 181 163 118 --1469 --
NM_022066chr1721017 744 ------
NM_022073chr14147 ----11159
NM_022075chr12288 85 ------
NM_022085chr641213 439 341 36 --1554 --
NM_022090chr5----1517 --
NM_022091chr631946 1784 701 ----11836
NM_022095chr20143 ------
NM_022112chr1162004 1443 673 404 222 210 ------
NM_022114chr194539 4366 3875 3761 3228 3194 3152 1198 1085 --13867 --
NM_022117chrX1230 ------
NM_022123chr14--1474 ----
NM_022124chr101644 ------
NM_022130chr521141 110 ------
NM_022138chr651372 1021 578 404 308 ----128
NM_022143chr721351 1309 ------
NM_022165chr19157 ------
NM_022166chr16126060 5057 5044 4584 4294 2395 2158 1816 1339 677 593 268 --25212 1316 --
NM_022169chr1161389 440 239 185 128 98 11281 ----
NM_022170chr751505 624 427 297 269 --11497 --
NM_022307chr74573 494 482 47 ------
NM_022337chr111655 --1504 --
NM_022343chr951201 1006 979 853 494 --11287 --
NM_022351chr8----13357 --
NM_022373chr71133 --1919 --
NM_022442chr202576 124 ------
NM_022457chr11235 ------
NM_022459chr1356316 4488 2500 1467 1309 --2528 180 --
NM_022461chr31199 ----1892
NM_022463chr1721475 630 ------
NM_022465chr1252461 1949 1167 1040 509 --52707 2498 2070 429 402 --
NM_022473chr1543971 3433 2790 152 --34070 3586 1574 13898
NM_022474chr1432037 778 159 1447 ----
NM_022476chr161885 ------
NM_022477chr2031626 635 391 --11588 --
NM_022494chr101320 ------
NM_022497chr32806 782 --1472 --
NM_022552chr241216 987 902 249 ------
NM_022572chr261633 1514 1427 1180 1171 1127 --1347 --
NM_022574chr752168 1732 861 697 81 --21367 594 --
NM_022648chr294556 4198 3577 3357 3131 1242 1054 1025 383 --11331 --
NM_022650chr5181 ------
NM_022652chr121443 ------
NM_022658chr1241326 375 337 153 11144 ----
NM_022659chr81172 --175 --
NM_022716chr172941 2805 2316 1261 475 286 194 ------
NM_022719chr2263617 3474 2527 2481 774 482 11416 13253 --
NM_022730chr25906 703 258 216 96 ------
NM_022733chr1----21169 330 --
NM_022739chr172746 459 --2863 447 --
NM_022745chr142833 2309 1045 341 --12932 --
NM_022749chr831076 380 101 11136 ----
NM_022750chr72653 496 ------
NM_022755chr982642 2325 2232 2130 1805 1667 969 603 --2987 889 --
NM_022758chr652587 2274 1024 875 74 12287 12386 --
NM_022768chr1185 ------
NM_022780chr231746 595 565 ------
NM_022781chr931312 1259 37 --11150 --
NM_022782chr121403 ------
NM_022821chr12200 176 --1420 --
NM_022824chr531316 1217 256 ----1323
NM_022828chr531693 1551 1222 ------
NM_022831chr131494 406 64 --11570 11532
NM_022832chr42928 63 --1427 --
NM_022833chr941110 941 458 69 11477 11103 --
NM_022836chr131247 1226 711 --21527 1398 --
NM_022841chr1522561 1845 ------
NM_022845chr1642015 1958 759 429 21949 52 31835 827 294 --
NM_022893chr242572 2109 965 440 ------
NM_022898chr1494706 4430 4136 3617 3000 2967 1259 1049 832 11418 ----
NM_022899chr311042 21516 1083 143 --
NM_022900chr7----1848 --
NM_022910chr1611464 ------
NM_022912chr221976 646 --22091 862 --
NM_022918chr111194 ------
NM_022970chr1031313 1058 1033 ------
NM_022977chrX22274 361 ------
NM_023009chr12255 224 ------
NM_023019chr21127 --1109 --
NM_023076chr1682632 2333 2281 2258 764 82 51 42 12561 ----
NM_023079chr1741672 1315 1161 139 --1322 --
NM_023105chr841928 1785 728 338 11641 --12226
NM_023106chr841928 1785 728 338 11641 --12226
NM_023110chr841928 1785 728 338 11641 --12226
NM_023111chr841928 1785 728 338 11641 --12226
NM_023112chr1472958 2502 2037 1063 947 928 71 12479 ----
NM_023925chr12--1111 ----
NM_023926chr191141 ------
NM_024007chr532514 1275 335 12765 12934 --
NM_024016chr174783 583 260 91 --1184 --
NM_024017chr1781680 1505 1499 1447 1365 1229 1210 1142 1243 135 1290
NM_024019chr43408 335 262 1432 ----
NM_024043chr1661413 1141 1017 297 143 105 --31263 1196 25 --
NM_024046chr371138 871 456 313 277 261 66 ------
NM_024047chr41280 ------
NM_024061chr72479 33 --2220 68 --
NM_024076chr1982345 2295 2245 2140 2050 1626 503 200 --1263 --
NM_024085chr23839 83 21 1931 ----
NM_024090chr431402 1373 745 ------
NM_024095chr124989 965 95 37 --11309 11098
NM_024107chr173851 809 803 ------
NM_024294chr652587 2274 1024 875 74 12287 12386 --
NM_024295chr8126 ------
NM_024312chr124469 369 208 61 ------
NM_024326chr101121 ------
NM_024332chrX11300 --11689 --
NM_024345chr955035 4843 1212 295 229 25026 758 46061 5153 4155 284 --
NM_024416chr911311 ------
NM_024424chr1121147 146 ------
NM_024425chr1121147 146 ------
NM_024426chr1121147 146 ------
NM_024430chr1841882 1743 369 38 --21795 1641 --
NM_024494chr12213 164 1111 ----
NM_024496chr14----140 --
NM_024511chr432936 2373 1114 12444 12974 --
NM_024519chr16286 21 ------
NM_024522chr161710 1674 1534 757 414 193 --11649 --
NM_024524chr33751 714 143 ----1705
NM_024525chr12491 47 ------
NM_024539chrX11036 ------
NM_024540chr1----121 --
NM_024541chr1051736 1450 1199 389 260 ------
NM_024545chr22118 111 ------
NM_024546chr132944 835 ------
NM_024551chr1262404 2002 1026 916 451 298 ------
NM_024551chr1262404 2002 1026 916 451 298 ------
NM_024556chr113444 370 323 ------
NM_024581chr6123 ------
NM_024586chr12487 171 1117 ----
NM_024594chr531626 1318 243 11392 ----
NM_024595chr12796 91 ------
NM_024607chr874210 3897 3144 737 676 556 51 --13358 1808
NM_024612chr1721051 165 156 ----
NM_024613chr82571 78 ------
NM_024617chr9--145 ----
NM_024624chr211459 ------
NM_024628chr331098 1045 81 --1793 --
NM_024646chr153778 3355 719 416 357 13089 11500 --
NM_024665chr364664 4586 4259 3908 3057 626 --11061 --
NM_024670chr102694 587 --11381 --
NM_024689chrX41794 240 143 118 1494 ----
NM_024692chr241197 713 600 594 ------
NM_024698chr1141295 1144 473 364 ------
NM_024701chr103148 114 75 ------
NM_024702chr171118 1203 ----
NM_024704chr2031048 72 56 ------
NM_024705chr133354 320 95 1404 1165 1225
NM_024713chr1531192 621 210 11406 ----
NM_024721chr8178 --187 --
NM_024722chr172217 175 --1368 --
NM_024740chr1173759 3662 3309 1654 1500 1294 435 13875 1555 22554 461
NM_024744chr242713 1764 217 155 --12539 1958
NM_024749chr132154 1767 42 ------
NM_024751chr421839 160 --1312 --
NM_024761chr964365 3851 3311 3291 1971 549 1170 22109 506 --
NM_024770chr2146720 6281 5763 5598 5336 5150 4859 4797 2581 2390 1838 1496 377 256 --46472 968 560 138 15118
NM_024778chrX2204 26 ------
NM_024787chr84923 673 343 71 2393 144 ----
NM_024792chr171283 ------
NM_024798chr1542690 2399 1910 1842 1195 32149 1180 1155 --
NM_024808chr132775 174 1283 141 --
NM_024828chr921374 1281 ------
NM_024830chr581961 1684 1590 1411 160 127 88 82 ------
NM_024837chr1531337 684 67 ------
NM_024854chr1221314 34 --11473 --
NM_024866chr2263025 2837 1058 811 568 432 --13494 11213
NM_024875chr1051676 1666 544 269 59 ----148
NM_024881chr19103354 1425 1413 1350 1044 818 765 235 198 140 --43423 1218 650 602 --
NM_024887chr171613 1355 717 520 404 183 50 --1372 --
NM_024909chr631100 1055 517 ------
NM_024911chr1--1111 ----
NM_024920chr43400 156 123 21604 206 11188 --
NM_024922chr1692076 1642 1594 1478 1289 837 398 264 149 ------
NM_024930chr532575 2080 159 --22489 1881 --
NM_024939chr1651640 1032 373 149 114 --31146 238 94 --
NM_024944chr2151298 1203 877 481 120 ------
NM_024947chr3128965 8739 7834 6737 6552 6475 6290 2912 2610 1655 1236 1140 ----19183
NM_024953chr1221856 510 --21134 657 --
NM_024954chr102679 166 ------
NM_024969chr22853 308 ------
NM_024991chr1072495 2268 1099 1014 433 359 242 ------
NM_024993chr221389 600 1592 ----
NM_025052chr2129 ------
NM_025054chr813545 ------
NM_025057chr143550 526 64 ------
NM_025075chr3179 ------
NM_025076chr21166 ------
NM_025079chr11526 ------
NM_025083chr1561960 1601 1316 293 75 44 1165 11818 12009
NM_025104chr1731461 1228 1178 --11299 --
NM_025126chr121206 --1639 --
NM_025133chr21433 ------
NM_025134chr1611652 ------
NM_025138chr13--1446 ----
NM_025140chr122237 134 --1451 --
NM_025146chr352636 2094 1813 1802 831 ------
NM_025152chr141471 ------
NM_025154chr721503 369 1571 1274 --
NM_025160chr174117 3345 2948 2734 1562 792 342 13005 ----
NM_025164chr1151736 785 572 491 380 ----11367
NM_025179chr1124650 4434 3925 3740 3669 3518 3240 3077 1865 1657 1513 181 --63866 3723 3008 1872 1814 1293 --
NM_025181chr21750 ------
NM_025182chr92723 278 --1156 --
NM_025191chr12423 221 ------
NM_025235chr1061789 1699 1581 1427 842 729 --1764 --
NM_025238chr15--11340 ----
NM_025244chr21205 ------
NM_025248chr1773082 3026 2733 2306 2119 1984 566 --1357 --
NM_025251chr881078 1021 889 871 450 348 275 233 --1430 --
NM_025268chr143322 149 97 ------
NM_030576chr1792357 1948 1861 1668 1627 908 877 358 296 --12041 --
NM_030594chr15----1274 --
NM_030621chr1433355 2625 946 ------
NM_030625chr1052620 2064 2012 1617 735 11057 1400 --
NM_030627chr512729 --24029 2618 23988 2554
NM_030634chr132137 2000 1802 12168 22118 600 --
NM_030647chr733974 646 67 --25457 2160 11428
NM_030648chr435180 4725 1509 --23720 3381 --
NM_030650chr233697 2882 806 --23630 447 --
NM_030651chr6151 --2637 181 --
NM_030660chr141329 --11379 --
NM_030661chr761581 1292 1097 1078 365 248 ------
NM_030664chr1011733 --1462 --
NM_030665chr1721137 978 1499 ----
NM_030751chr1021816 542 --11865 --
NM_030751chr1021816 542 --11865 --
NM_030761chr1102680 2620 2452 2034 1896 1840 1792 1660 952 807 --22434 1786 12299
NM_030762chr122540 281 11445 1183 --
NM_030767chr952495 2482 2058 1924 1060 --2666 105 --
NM_030790chr161237 ------
NM_030806chr1139215 8545 8079 7877 7626 7418 7260 6437 2284 1554 1458 875 479 21827 402 ----
NM_030809chr1242319 1960 1793 508 ------
NM_030810chr641213 439 341 36 --1554 --
NM_030884chr342138 1756 1513 204 ------
NM_030906chr112114 43 ------
NM_030912chr101283 ------
NM_030915chr232162 121 46 ----12183
NM_030918chr1124979 4971 4902 4883 4619 4512 4403 4226 1619 201 131 93 24712 4166 24149 699 14495
NM_030920chr122024 1421 21588 1538 12059 11777
NM_030922chr151809 --1750 --
NM_030927chr1051611 1350 1261 1138 285 ------
NM_030937chr141388 1009 944 266 ------
NM_030939chr6----11186 --
NM_030952chr1--1443 1382 --
NM_030958chr81198 ------
NM_030964chr583640 3533 3310 2840 2754 1356 634 137 12914 12599 1573
NM_030978chr9----1459 --
NM_030981chr112301 128 ------
NM_031203chr191255 ------
NM_031216chr1831593 786 279 --21675 73 --
NM_031244chr621120 307 ------
NM_031262chr92395 52 --21091 147 --
NM_031263chr92452 109 --21148 204 --
NM_031266chr51172 ------
NM_031271chr821230 285 ------
NM_031283chr24824 745 669 362 ------
NM_031284chr154874 804 656 234 1943 ----
NM_031286chr12328 21 ------
NM_031305chr441310 1250 757 344 11184 ----
NM_031372chr431444 643 310 1456 1629 --
NM_031407chrX1167 ------
NM_031411chr542089 2051 134 80 ------
NM_031417chr1951952 1748 270 97 43 ----11134
NM_031427chr1445646 4910 1995 521 15814 35760 794 479 1994
NM_031442chrX32446 801 632 --1376 --
NM_031443chr7--1343 ----
NM_031445chr272665 2444 2127 731 575 250 125 --11022 --
NM_031459chr141648 516 207 33 ------
NM_031468chr7117909 5362 5164 1970 1825 1593 1423 905 826 447 174 21479 687 27493 6698 --
NM_031469chr64871 822 692 514 1895 12793 --
NM_031477chr16285 28 --1124 --
NM_031483chr2042739 1429 447 97 --13527 --
NM_031492chr112404 215 ------
NM_031844chr144069 3651 2795 118 --13129 --
NM_031845chr212934 --148 --
NM_031847chr212934 --148 --
NM_031849chr542089 2051 134 80 ------
NM_031857chr542089 2051 134 80 ------
NM_031860chr542089 2051 134 80 ------
NM_031866chr10----2974 243 --
NM_031885chr16----129 --
NM_031891chr181134 ------
NM_031892chrX----1772 --
NM_031911chr431755 1725 1053 ------
NM_031918chr1951963 1298 666 653 39 ------
NM_031935chr11750 ------
NM_031940chr872518 2033 838 383 229 145 42 ------
NM_031948chr162132 36 ------
NM_031992chr751505 624 427 297 269 --11497 --
NM_032012chr954123 3683 1212 654 530 --1625 --
NM_032013chr2031626 635 391 --11588 --
NM_032017chr161745 1425 798 775 667 430 ------
NM_032021chr11----1993 --
NM_032041chr822172 362 --42732 2065 1877 154 --
NM_032042chr52524 292 --22055 777 --
NM_032047chr312385 --11982 --
NM_032051chr22197 --1117 --
NM_032052chr222950 77 --21171 161 --
NM_032088chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_032092chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_032102chr111679 ------
NM_032121chrX32511 949 758 --1450 --
NM_032124chr1821197 1116 --140 --
NM_032139chr191274 --1132 --
NM_032144chr221319 239 ------
NM_032145chr631389 754 302 ------
NM_032148chr122368 65 ------
NM_032153chr331933 1788 871 11866 ----
NM_032154chr103754 671 43 ------
NM_032156chr12--1111 ----
NM_032181chr23572 155 90 ------
NM_032189chr13114959 3831 3733 3585 3536 3499 3409 3364 1402 913 631 23462 3114 --33267 3214 3155
NM_032192chr173550 117 89 1474 ----
NM_032193chr1152000 1772 1347 360 318 --292 56 11291
NM_032199chr105897 865 597 545 47 --21266 614 13123
NM_032208chr213431 ------
NM_032217chr41316 ----1962
NM_032233chr143813 315 167 --1844 --
NM_032239chr4--11186 1507 --
NM_032242chr3123233 2909 2702 2629 2389 2253 2228 2086 1254 1080 878 167 12606 12207 --
NM_032246chr151336 1474 1537 --
NM_032268chr1692869 2715 2599 2522 2179 2124 1206 1129 562 ------
NM_032270chr1--138 ----
NM_032281chr1942854 2690 2416 371 --22106 1923 --
NM_032283chr181846 1809 1730 1382 1159 567 466 411 --3723 668 657 --
NM_032288chr332404 1504 265 ------
NM_032303chr951795 1742 1309 1302 190 --1328 11249
NM_032316chr352216 2195 2145 1505 591 --1182 --
NM_032320chr112750 202 ------
NM_032325chr112117 50 ------
NM_032327chr101381 ------
NM_032339chr17275 22 --1103 --
NM_032376chr172687 659 ------
NM_032379chr112152 21 ------
NM_032382chr16----1487 --
NM_032403chr561702 1680 1568 1362 1236 207 --2383 56 --
NM_032408chr721110 1087 --2891 158 2932 327
NM_032413chr15199 ------
NM_032431chr116739 386 213 117 80 33 ------
NM_032434chr241361 349 272 248 124 1125 --
NM_032440chr1031894 816 107 ------
NM_032445chr1552187 2170 2118 830 97 ------
NM_032457chr443206 3185 1234 989 ------
NM_032458chrX63357 2964 1142 949 885 647 --22957 2134 --
NM_032466chr8----11201 --
NM_032468chr8----11201 --
NM_032482chr1972403 2060 1035 471 308 127 88 --1583 --
NM_032486chr1642285 2208 1726 36 1915 ----
NM_032491chr122917 836 ------
NM_032501chr20122 ------
NM_032510chr1851820 871 119 36 30 12046 ----
NM_032538chr6102577 2188 2117 1986 1781 994 979 660 509 77 --22593 1912 --
NM_032547chr4------11174
NM_032552chr971792 1773 1639 1362 1334 774 248 --11854 --
NM_032558chr931474 937 911 --11061 --
NM_032560chr141214 ------
NM_032569chr162790 437 --21734 224 --
NM_032575chr1671960 1512 495 415 235 214 41 11390 1267 --
NM_032580chr171186 ------
NM_032581chr751713 1509 1421 129 57 --1487 1378
NM_032582chr171201 ------
NM_032594chr141824 --1436 --
NM_032595chr1731285 147 51 ------
NM_032622chr431535 1518 1478 --11194 --
NM_032632chr1431731 1238 743 --21279 799 1543
NM_032645chr113183 155 45 ------
NM_032646chr1791659 1506 1451 1113 623 601 566 547 497 --11733 --
NM_032682chr332983 2531 2427 23091 2586 ----
NM_032711chr1753134 2780 2705 1290 1208 11635 33198 1374 739 --
NM_032781chr113270 166 116 ------
NM_032784chr61221 ------
NM_032801chr1182560 2205 2168 1978 1579 962 874 454 1256 ----
NM_032808chr151838 ------
NM_032812chr101105 ------
NM_032813chr131942 ------
NM_032832chr63676 425 386 --184 --
NM_032833chr132470 770 410 12595 ----
NM_032840chr124774 287 153 24 --165 --
NM_032846chr14142 --11036 1547
NM_032859chr132132 62 ----1822
NM_032869chr831815 774 210 ------
NM_032870chr6----1558 --
NM_032873chr1164479 4224 3917 3568 2895 670 12805 --13454
NM_032876chr142826 565 --42212 798 673 648 --
NM_032880chr11117 ------
NM_032883chr202890 312 ------
NM_032900chr1023531 959 13464 22915 1252 --
NM_032905chr1011058 ------
NM_032906chr42653 238 --1357 --
NM_032924chr71219 1443 150 --
NM_032932chr17176477 6425 6390 6122 5895 5548 5217 4180 2349 2088 2056 1715 1556 1016 1009 943 392 --46372 6134 5748 485 --
NM_032943chr112152 21 ------
NM_032947chr571281 1017 983 906 832 371 363 --21149 968 --
NM_032978chr1821028 107 ------
NM_032979chr1821028 107 ------
NM_032981chr1821028 107 ------
NM_032983chr7103114 2773 2742 2701 2085 1150 721 625 608 335 --33194 995 354 12729
NM_032998chr111058 ----1379
NM_032999chr71986 11099 1378 --
NM_033000chr71986 11099 1378 --
NM_033001chr71986 11099 1378 --
NM_033014chr911311 ------
NM_033018chrX21180 210 ------
NM_033020chr154668 4322 4198 1470 870 11063 24479 4031 --
NM_033025chr192928 841 --1108 --
NM_033027chr36975 382 339 294 250 65 ------
NM_033030chr2174 ------
NM_033044chr131131 1072 1044 ------
NM_033046chr22376 113 ------
NM_033071chr62494 278 ------
NM_033089chr2021015 598 1472 1499 --
NM_033102chr151096 430 275 60 52 --1446 --
NM_033102chr151096 430 275 60 52 --1446 --
NM_033116chr141266 ------
NM_033127chr12751 198 ------
NM_033129chr2081970 1809 1779 767 740 376 347 269 ----1691
NM_033136chr531209 634 590 2393 320 ----
NM_033137chr531209 634 590 2393 320 ----
NM_033143chr444499 1478 426 226 ------
NM_033181chr623803 3563 1963 ----
NM_033201chr163749 429 87 ------
NM_033207chr1062194 2106 2055 994 123 94 ------
NM_033211chr522088 120 ------
NM_033215chrX4415 142 123 79 ------
NM_033224chr757913 7353 6847 6580 198 16621 1268 --
NM_033225chr833070 882 573 12094 ----
NM_033253chr22561 116 ------
NM_033259chr35894 611 582 328 26 ------
NM_033274chr5103295 3256 3033 1368 1339 756 549 417 406 36 --32773 281 104 --
NM_033281chr5----1179 --
NM_033285chr843406 3124 3032 1729 ------
NM_033290chrX63774 3573 3541 3209 3050 703 --1871 --
NM_033312chr1----157 --
NM_033315chr1751806 1720 866 643 460 --2846 514 --
NM_033326chr1131844 1673 92 11645 11694 --
NM_033331chr993493 3129 3077 2833 2690 2508 1010 733 210 12585 22992 1202 --
NM_033360chr1222882 989 ------
NM_033389chr1764232 4188 3435 3345 1430 312 --53450 3314 1695 1379 521 11553
NM_033393chr452417 2215 2108 755 687 --42970 2938 2601 957 --
NM_033394chr241465 1174 1055 442 --11401 1585
NM_033401chr162444 148 181 ----
NM_033407chr11483 ------
NM_033425chr1133445 3003 1384 --43121 803 224 124 --
NM_033426chr1452800 2042 2015 888 303 --22324 1948 --
NM_033449chr552118 2006 1749 1558 333 --11511 --
NM_033495chrX31016 784 156 ------
NM_033505chr296463 4680 4375 4244 4170 4130 762 739 584 26356 251 ----
NM_033512chr862660 949 683 369 363 42 --11882 --
NM_033535chr411031 ------
NM_033540chr3------1287
NM_033549chr561031 848 774 366 148 90 ------
NM_033551chr51987 --22923 236 --
NM_033624chr1252036 1702 1661 311 165 ------
NM_033631chr1123918 3817 3750 1193 982 942 695 607 483 339 41 35 22945 2906 22396 49 --
NM_033637chr1093988 3530 3156 1520 1391 969 649 553 456 13737 23743 3643 --
NM_033642chrX1838 ------
NM_033644chr542082 2072 1959 210 --1663 --
NM_033645chr542082 2072 1959 210 --1663 --
NM_033656chr2155926 5481 5335 4528 837 45174 5160 4149 1600 12276 --
NM_044472chr11697 ------
NM_048368chr184631 530 245 65 ------
NM_052818chr1362159 2075 1929 1842 330 88 1176 ----
NM_052827chr1211098 ------
NM_052840chr1541603 1349 1094 285 11228 ----
NM_052841chr1165 ------
NM_052845chr1292928 2921 2700 2647 2264 2241 1039 217 85 ------
NM_052846chr2091226 1196 1148 1113 1096 985 505 499 197 ------
NM_052849chr156810 766 673 589 572 299 ------
NM_052851chr1311842 1302 ----
NM_052864chr42409 44 1221 11884 --
NM_052869chr1791659 1506 1451 1113 623 601 566 547 497 --11733 --
NM_052879chr1253984 3956 3599 1369 1050 --12580 13783
NM_052885chr1234603 3116 1503 21686 83 23984 1110 --
NM_052896chr132077 1934 80 ------
NM_052898chr81458 --11339 1109
NM_052899chr54337 258 189 46 --1776 --
NM_052900chr81623 ------
NM_052905chr231828 1171 155 ----11244
NM_052907chr122567 504 ------
NM_052910chr1351862 618 424 237 179 --11341 --
NM_052918chr1053467 3245 2613 703 55 --21201 599 --
NM_052925chr191970 ------
NM_052938chr141103 272 245 22 ------
NM_052948chr191130 ------
NM_052954chr2132168 1705 894 --21623 581 --
NM_052962chr6144 11257 ----
NM_052978chr1461235 678 475 291 162 95 ------
NM_052998chr11208 ------
NM_053001chr82281 162 --1134 --
NM_053002chr311010 11170 ----
NM_053016chr998006 7570 7092 6329 4889 4876 2046 555 370 --77996 7723 7662 7075 7002 1272 1245 --
NM_053023chr1151304 1140 1021 702 117 22666 435 12634 1254
NM_053024chr311098 21394 42 ----
NM_053025chr32610 395 --11350 --
NM_053026chr32610 395 --11350 --
NM_053027chr32610 395 --11350 --
NM_053028chr32610 395 --11350 --
NM_053031chr32610 395 --11350 --
NM_053032chr32610 395 --11350 --
NM_053043chr795926 5615 5432 4038 1901 1088 773 604 486 1640 25961 5556 13964
NM_053046chr19298 75 ------
NM_053056chr1142011 1947 152 115 --22580 1243 --
NM_053064chr1442907 2344 1203 35 22898 1145 ----
NM_053067chr9--152 ----
NM_054013chr5----1791 --
NM_054016chr1--11918 ----
NM_054016chr1--11918 ----
NM_054016chr1--11918 ----
NM_054025chr115536 517 422 300 131 ------
NM_054027chr521968 1656 1411 ----
NM_054033chr22222 206 ------
NM_054112chr201186 ------
NM_057161chr63350 185 79 ------
NM_057169chr1210