TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-744-3p
miRNA Sequence: CUGUUGCCACUAACCUCAACCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000089chr71172 ------
NM_000093chr911688 32482 2221 757 --1783
NM_000096chr3--1966 ----
NM_000097chr31835 ------
NM_000109chrX22557 507 ----12088
NM_000138chr1521823 829 12279 ----
NM_000145chr21215 1191 ----
NM_000183chr2253 38 ------
NM_000202chrX43410 2921 2403 160 --11424 11469
NM_000210chr242142 1562 795 679 ------
NM_000214chr201145 1456 --11479
NM_000216chrX11544 21153 359 ----
NM_000217chr1275000 4232 3377 1474 1435 1389 484 --23489 2086 --
NM_000232chr41350 11185 11235 --
NM_000245chr732255 390 24 --1849 --
NM_000248chr322673 1943 32977 2777 2556 ----
NM_000252chrX1188 ----11505
NM_000259chr1564451 4295 4048 2379 1778 210 --2519 312 15073
NM_000267chr1712455 1657 ----
NM_000271chr182558 201 1453 1125 --
NM_000314chr1063128 2866 2601 2212 743 694 1805 32793 428 85 --
NM_000315chr11------152
NM_000318chr852378 1005 884 850 517 ------
NM_000329chr11685 ------
NM_000332chr645928 2782 2668 951 15605 ----
NM_000337chr565358 5230 1273 814 558 401 --24500 32 --
NM_000368chr964444 3300 1093 981 558 327 13842 13257 11554
NM_000390chrX42900 2611 2324 2207 33037 1105 102 ----
NM_000393chr211812 --11740 --
NM_000408chr232622 2320 836 23158 58 ----
NM_000428chr1432075 1821 23 2804 685 ----
NM_000439chr51879 --11743 --
NM_000459chr9--1251 ----
NM_000462chr151679 --11705 --
NM_000474chr71240 1683 --1431
NM_000484chr211144 --11014 --
NM_000486chr12--1556 42985 2878 1184 1141 12193
NM_000489chrX32930 1186 590 1277 ----
NM_000503chr8----11496 --
NM_000533chrX11631 1129 ----
NM_000544chr6_cox_hap153274 3172 2666 2100 579 --1588 --
NM_000555chrX97785 7769 7641 6240 6074 2543 1761 722 491 --37491 6482 241 --
NM_000599chr263600 3045 2863 1639 902 473 24247 1180 --1186
NM_000615chr11------1804
NM_000621chr13121 --11442 11271
NM_000633chr1835094 3558 1307 11621 ----
NM_000676chr171371 ------
NM_000719chr1246600 1059 1052 635 25055 1413 16184 --
NM_000721chr141022 657 491 484 1620 2613 535 11088
NM_000724chr1021261 150 ------
NM_000793chr1421877 1398 --11950 14436
NM_000801chr20--11106 ----
NM_000806chr511489 ------
NM_000813chr544854 4405 4020 2138 1776 ----
NM_000814chr1543758 3331 3243 1330 --11076 --
NM_000826chr41819 ------
NM_000827chr512190 1251 ----
NM_000831chr144964 1713 1377 577 46148 4693 2129 2035 ----
NM_000840chr71442 --1341 --
NM_000844chr3--1844 ----
NM_000849chr123064 2588 ------
NM_000860chr411103 ------
NM_000868chrX22491 1730 12186 1323 --
NM_000875chr1585248 4935 4644 2785 2711 1892 664 272 --47014 4262 2081 697 --
NM_000877chr233007 2552 946 22908 2830 1488 1521
NM_000899chr1223469 3168 --2555 47 1456
NM_000912chr863426 2696 1266 954 833 201 23546 434 12942 --
NM_000917chr101182 ------
NM_000944chr462399 2233 2106 2032 711 427 11484 ----
NM_000945chr21220 1606 ----
NM_000949chr5----152 --
NM_000962chr962576 2264 2143 862 718 301 --1805 --
NM_000990chr1123516 2932 --13684 11569
NM_000991chr1963324 3188 2971 2329 585 545 123 22869 840 --
NM_001001323chr1212565 ------
NM_001001330chr10--1161 ----
NM_001001433chr2042626 2571 1262 122 1593 ----
NM_001001481chr862648 656 371 358 188 110 1315 ----
NM_001001521chr22253 228 ------
NM_001001664chr232730 2508 961 --1528 --
NM_001001665chr232910 668 426 --32251 1169 514 12822
NM_001001683chr17--2411 396 ----
NM_001001711chr113143 77 52 1104 --1730
NM_001001924chr84701 625 575 121 ------
NM_001001925chr84701 625 575 121 ------
NM_001001928chr22128153 7642 6987 6088 5492 3111 2663 1560 1222 338 138 75 1487 22284 2034 25922 5673
NM_001001931chr84701 625 575 121 ------
NM_001001995chrX1293 --1227 --
NM_001002032chr171575 1472 ----
NM_001002033chr171675 1572 ----
NM_001002860chr1434671 3775 1512 13268 21094 919 --
NM_001003407chr1075067 3648 1457 559 178 116 21 ------
NM_001003408chr1075067 3648 1457 559 178 116 21 ------
NM_001003652chr1898273 7828 6928 6884 6268 6181 5422 5414 2901 21452 42 16533 --
NM_001003674chr1866975 5668 5565 5247 2038 1666 11061 15498 --
NM_001003675chr1866975 5668 5565 5247 2038 1666 11061 15498 --
NM_001003688chr41220 --1179 --
NM_001003712chr1222723 2632 ----1995
NM_001003792chr311098 --1394 --
NM_001003793chr311098 --1394 --
NM_001004065chr92455 140 23855 3582 12411 2918 817
NM_001004317chr633620 3071 1168 11070 23204 898 --
NM_001004329chr1231147 241 48 ------
NM_001004330chr1231760 1210 74 2514 181 ----
NM_001004419chr1253511 1486 814 806 530 ----13801
NM_001005271chr171763 ------
NM_001005273chr171763 ------
NM_001005366chr122809 191 ------
NM_001005386chr251593 1520 936 837 431 ----1592
NM_001005474chr3130 --1254 --
NM_001005753chr242275 2035 1720 539 ------
NM_001005849chr171502 ------
NM_001006600chr542336 2270 1519 980 2936 646 21713 332 --
NM_001006610chr161169 ------
NM_001006684chrX2620 526 ------
NM_001006945chr11562 --1523 --
NM_001007023chr1421877 1398 --11950 14436
NM_001007075chr411112 ------
NM_001007097chr9114916 4612 3609 1857 1744 1392 1183 467 233 224 213 34841 1118 775 13715 --
NM_001007102chr62509 115 ------
NM_001007214chr11130 ------
NM_001007559chr18--1410 1226 1763
NM_001007565chr31400 ------
NM_001007794chr12627 53 --1139 --
NM_001008222chrX21150 1112 ------
NM_001008225chr72665 51 ------
NM_001008239chr1822994 1239 2952 672 ----
NM_001008392chr323078 2482 --13131 --
NM_001008564chr1322176 36 ----1767
NM_001008738chr51346 32953 2715 231 ----
NM_001008756chr352024 1906 1873 844 224 ------
NM_001008895chr1321161 1038 ------
NM_001009552chr8182 1106 ----
NM_001009899chr336474 4142 394 24630 4182 36227 5919 4884 --
NM_001009955chr1--1181 ----
NM_001009955chr1--1181 ----
NM_001009993chr274164 3866 3647 3610 3134 1771 225 14536 13788 --
NM_001010000chr1822196 517 ------
NM_001010853chr622761 2212 ------
NM_001010891chr545815 4699 4216 2355 ------
NM_001010971chr12666 151 11007 ----
NM_001010984chr112557 22414 359 22345 684 --
NM_001010986chrX42403 2265 1932 62 ------
NM_001011663chr1021040 743 1869 ----
NM_001011666chr766410 5213 5003 2328 1408 404 15279 15017 --
NM_001011708chr242224 1857 1818 549 187 12409 --
NM_001011713chr14--21614 1282 --1555
NM_001011885chr1521293 38 ----1148
NM_001012329chr142017 922 879 577 12319 180 --
NM_001012393chr1154044 3769 1928 1122 28 11405 14259 --
NM_001012398chr161903 ------
NM_001012420chr1552500 2369 1835 1796 373 --12393 --
NM_001012423chr1552500 2369 1835 1796 786 --12393 --
NM_001012761chr512072 ------
NM_001012969chr151304 ------
NM_001013415chr41253 41604 1510 464 414 1136 --
NM_001013438chr33975 387 133 ----129
NM_001013439chr32821 233 ------
NM_001013746chr732251 659 327 11455 1745 --
NM_001013839chr1752543 1961 1742 1712 331 11971 --12016
NM_001014443chr11243 ------
NM_001014797chr1077783 7638 6455 5578 2829 2365 1466 58161 5670 5528 2568 1294 --15430
NM_001015880chr1021291 220 1586 ----
NM_001015892chr5122 ------
NM_001017395chr343645 304 164 50 12280 ----
NM_001017424chr11680 ----1328
NM_001017425chr11680 ----1328
NM_001017440chr778255 7906 7218 5091 2829 2660 1722 1242 37359 4997 1709 11905
NM_001017926chr811690 ------
NM_001017962chr101182 ------
NM_001017977chr11254 ------
NM_001017999chr1----12253 --
NM_001017999chr1----12253 --
NM_001018000chr1----12253 --
NM_001018000chr1----12253 --
NM_001018001chr1----12253 --
NM_001018038chr92618 119 ------
NM_001018041chr6196 ------
NM_001018054chr121396 156 ------
NM_001018056chr9162 --1450 --
NM_001018065chr954621 1177 957 404 286 ------
NM_001018066chr954621 1177 957 404 286 ------
NM_001018067chr194939 4858 4408 3900 3447 1978 1899 1803 1139 1184 --13344
NM_001018068chr194939 4858 4408 3900 3447 1978 1899 1803 1139 1184 --13344
NM_001018069chr194939 4858 4408 3900 3447 1978 1899 1803 1139 1184 --13344
NM_001018090chr1542658 1829 307 229 ------
NM_001018091chr1542768 1939 417 339 ------
NM_001018102chr1542658 1829 307 229 ------
NM_001020658chr141625 1509 1470 268 ------
NM_001020658chr141625 1509 1470 268 ------
NM_001023567chr1552261 1774 1542 789 373 11818 ----
NM_001024858chr1452238 937 924 456 52 11955 --1790
NM_001024947chr51771 ------
NM_001025076chr1065655 5039 4972 2351 1370 417 25483 2479 --1409
NM_001025077chr1057013 6397 6330 2728 1775 16841 --11767
NM_001025079chr353399 3250 889 651 334 --1270 24093 1012
NM_001025580chrX3922 232 163 1835 ----
NM_001029858chr633369 603 418 ----11105
NM_001029860chr81276 ------
NM_001029863chr622790 280 1178 ----
NM_001029875chr572506 2210 2009 1133 1049 767 687 22688 609 ----
NM_001030001chr141116 ------
NM_001030007chr1633469 2960 1143 1378 ----
NM_001030055chr142423 287 11048 ----
NM_001031679chr1222891 1151 33567 3259 3024 21336 1318 --
NM_001031695chr2274973 4669 4305 3620 513 468 63 14113 13965 --
NM_001031716chr21858 1409 ----
NM_001031743chr61164 ------
NM_001031801chr223389 73 67 ------
NM_001031812chr522137 609 --22185 1490 --
NM_001031855chrX--183 ----
NM_001032280chr621484 195 31499 1135 364 1643 --
NM_001032293chr17--1470 ----
NM_001032296chr1322079 343 12188 12216 --
NM_001032380chr10--11905 ----
NM_001032394chr652741 1801 1791 352 230 ------
NM_001032395chr662608 1668 1658 1074 219 97 ------
NM_001033045chr244341 3688 609 94 13024 23317 1286 --
NM_001033047chr441945 822 724 551 11759 1787 --
NM_001033059chr61690 ------
NM_001033081chr151811 1345 1274 323 253 ------
NM_001033082chr151811 1345 1274 323 253 ------
NM_001033578chr832340 1842 591 21612 898 --1856
NM_001033925chr1031766 1572 867 1847 ----
NM_001034025chr121304 ----1925
NM_001034954chr1032942 2600 616 31139 1118 406 12166 --
NM_001034955chr1032942 2600 616 31139 1118 406 12166 --
NM_001034956chr1032942 2600 616 31139 1118 406 12166 --
NM_001034957chr1032942 2600 616 31139 1118 406 12166 --
NM_001035267chr12--1259 ----
NM_001037126chr7138 ------
NM_001037174chr212307 ------
NM_001037339chr111333 --1557 --
NM_001037340chr111333 --1557 --
NM_001037341chr111333 --1557 --
NM_001037341chr111333 --1557 --
NM_001037582chr421679 441 ------
NM_001037631chr22299 91 11139 11054 --
NM_001039199chr2054487 4431 3861 664 594 14564 34684 4158 1517 --
NM_001039538chr222985 198 1988 ----
NM_001039547chr327782 2320 42596 1534 1280 1104 47343 5431 4868 2312 1202
NM_001039574chr12847 808 ------
NM_001039577chr174094 3378 3311 1807 1655 1236 213 1484 13297 --
NM_001039585chr154185 3878 3867 1348 1043 --33801 316 59 --
NM_001039590chrX52789 1318 648 570 528 1434 ----
NM_001039591chrX52789 1318 648 570 528 1434 ----
NM_001039618chr1135352 839 696 --24346 351 13856
NM_001039693chr224006 736 --23208 2889 --
NM_001039762chr1032225 2023 1841 ------
NM_001039802chr11338 1104 ----
NM_001039840chrX35740 1255 615 45643 4382 3703 778 --15527
NM_001039937chr1324176 2642 ------
NM_001040057chr7----11370 --
NM_001040152chr741991 1358 691 149 11778 1896 --
NM_001040153chr1321011 195 ------
NM_001040202chr431649 234 41 ------
NM_001040214chr61460 1794 ----
NM_001040284chr1645781 5408 908 901 --14721 --
NM_001040402chr433059 2606 606 --32019 1171 1053 --
NM_001040409chr22854 75 1350 ----
NM_001040427chr16150 ------
NM_001040429chr1322888 2288 13253 13402 --
NM_001040432chr31125 ------
NM_001040441chr135452 4087 467 --15102 21892 1038
NM_001040665chr734505 3336 739 24716 3394 14441 --
NM_001040712chr911415 11244 ----
NM_001042355chr1631019 563 96 ------
NM_001042361chr10----1190 --
NM_001042364chr10----1190 --
NM_001042365chr10----1190 --
NM_001042387chr10----1190 --
NM_001042393chr10----1190 --
NM_001042396chr10----1190 --
NM_001042397chr10----1190 --
NM_001042403chr122927 175 ----1700
NM_001042412chr1631019 563 96 ------
NM_001042413chr943854 3357 2649 1232 ------
NM_001042425chr621484 195 31499 1135 364 1643 --
NM_001042440chr541287 717 596 308 --21927 89 11461
NM_001042441chr541287 717 596 308 --21927 89 11461
NM_001042442chr541287 717 596 308 --21927 89 11461
NM_001042443chr541287 717 596 308 --21927 89 11461
NM_001042444chr541287 717 596 308 --21927 89 11461
NM_001042445chr541287 717 596 308 --21927 89 11461
NM_001042446chr541287 717 596 308 --21927 89 11461
NM_001042453chrX5677 623 612 562 114 21624 1458 ----
NM_001042481chr1472528 2333 1631 853 713 337 30 1591 11769 --
NM_001042492chr1712455 1657 ----
NM_001042494chr1573797 3779 3390 3189 2445 1527 690 ------
NM_001042495chr1573797 3779 3390 3189 2445 1527 690 ------
NM_001042496chr1573797 3779 3390 3189 2445 1527 690 ------
NM_001042497chr1573797 3779 3390 3189 2445 1527 690 ------
NM_001042517chr131611 2805 640 ----
NM_001042529chr171285 ------
NM_001042530chr171285 ------
NM_001042531chr171285 ------
NM_001042532chr171285 ------
NM_001042533chr362412 2312 1178 1126 519 472 ------
NM_001042550chr91432 --1379 --
NM_001042555chr1274524 3611 1540 1025 449 384 217 24800 4120 --14208
NM_001042573chr1762074 2044 1948 857 649 103 --11429 --
NM_001042599chr267748 6694 1421 1251 1147 282 --26262 2778 --
NM_001042601chr321054 689 ------
NM_001042603chr1274428 4415 2113 1769 1256 509 386 24735 4061 ----
NM_001042749chrX31424 1303 672 ------
NM_001042750chrX31424 1303 672 ------
NM_001042751chrX31424 1303 672 ------
NM_001043318chr143913 878 153 --22571 2527 1451
NM_001044722chr522137 609 --22185 1490 --
NM_001044723chr522137 609 --22185 1490 --
NM_001046chr522019 585 23023 274 ----
NM_001048183chr12561 553 --12501 1964
NM_001083620chr41818 ------
NM_001106chr388758 7963 7676 6699 2006 1878 736 704 --18283 --
NM_001117chr1842130 2031 869 622 11691 ----
NM_001119chr411507 ------
NM_001128chr1633469 2960 1143 1378 ----
NM_001146chr832224 1708 920 2115 35 ----
NM_001160chr1221836 517 --12547 --
NM_001167chrX25123 4745 16504 24438 151 14279
NM_001173chr142423 287 11048 ----
NM_001177chr1222158 129 ------
NM_001186chr2142901 1027 318 53 23132 1050 22462 833 --
NM_001198chr6--1399 ----
NM_001201chr423666 3288 1345 ----
NM_001203chr41232 ------
NM_001204chr245835 3086 1389 515 36559 5674 123 16234 --
NM_001256chr1742650 2166 2058 176 ------
NM_001263chr4199 ------
NM_001270chr5------11046
NM_001289chrX11039 ------
NM_001293chr111469 ------
NM_001304chr1743196 3040 2791 219 13332 ----
NM_001316chr20--1489 ----
NM_001331chr1132458 2299 544 ------
NM_001364chr1154233 3546 1247 963 812 11724 11570 --
NM_001412chrX32590 1278 1184 ------
NM_001419chr1963764 3648 3346 3289 3179 1666 ------
NM_001420chr1942633 2537 855 105 32650 1999 1964 23132 40 --
NM_001438chr163666 3124 1116 923 768 699 1133 --11458
NM_001448chrX1395 11488 ----
NM_001453chr61502 11406 11700 --
NM_001460chr143114 2268 1014 25 11297 --1628
NM_001463chr2123 1268 1715 --
NM_001497chr922128 610 ------
NM_001498chr6--11219 ----
NM_001508chr21682 ------
NM_001527chr654872 4842 3721 999 518 14831 ----
NM_001543chr564297 4092 3478 774 117 98 --24367 4159 --
NM_001564chr4--197 ----
NM_001609chr1031326 899 720 11354 --11516
NM_001616chr232991 1335 422 1672 ----
NM_001621chr712639 --12230 --
NM_001621chr712639 --12230 --
NM_001625chr1144 ------
NM_001634chr61690 ------
NM_001649chrX42322 2123 1746 1560 22481 142 --11729
NM_001656chr511633 12066 21425 448 11303
NM_001663chr1422249 2133 1914 ----
NM_001664chr33844 415 307 ------
NM_001677chr11175 1182 ----
NM_001679chr3158 ------
NM_001681chr122622 68 ----1737
NM_001682chr1212279 ------
NM_001701chr941074 464 393 328 1546 ----
NM_001704chr61148 1469 ----
NM_001718chr631155 1038 247 ------
NM_001723chr62779 107 ----1725
NM_001743chr21205 ------
NM_001750chr541287 717 596 308 --21927 89 11461
NM_001759chr1233974 2026 324 11462 ----
NM_001777chr353399 3250 889 651 334 --1270 24093 1012
NM_001791chr11338 1104 ----
NM_001826chr11146 ------
NM_001842chr91557 ------
NM_001855chr91762 ------
NM_001858chr623118 1792 25168 1109 24405 33 1561
NM_001904chr31272 1815 ----
NM_001918chr149153 7705 2303 1890 27948 1290 38517 1575 555 --
NM_001920chr121680 ------
NM_001938chr111734 11932 --1512
NM_001945chr531250 1169 974 1419 ----
NM_001949chr632980 1115 1099 1478 12588 --
NM_001951chr8293 46 ------
NM_001968chr42781 596 ------
NM_001969chr1443825 3533 584 72 ------
NM_001987chr1243392 1661 960 768 14238 23363 1086 --
NM_001999chr52343 203 11530 ----
NM_002006chr435469 2246 574 --12173 --
NM_002009chr1552617 813 710 484 275 ------
NM_002015chr1323161 2257 --1884 1168
NM_002017chr1141278 1193 474 160 11205 ----
NM_002024chrX11745 21701 170 11678 11465
NM_002025chrX48311 7322 2410 539 45911 1929 924 364 16351 --
NM_002106chr4--1307 ----
NM_002111chr463607 3486 2763 1502 656 33 13103 1135 --
NM_002126chr1713677 1730 14035 --
NM_002128chr1312173 ------
NM_002129chr4151 ------
NM_002136chr121602 ------
NM_002137chr722120 1922 --165 --
NM_002140chr92364 269 1397 --1880
NM_002158chr243103 2760 1124 341 11151 2456 22 --
NM_002160chr91465 --1153 --
NM_002167chr1--1445 ----
NM_002190chr611177 1846 1155 --
NM_002210chr263392 3183 3086 3079 1144 1121 ------
NM_002211chr101979 --2321 80 --
NM_002214chr755320 4988 4777 4546 1055 ------
NM_002222chr31364 ------
NM_002227chr11982 155 --11214
NM_002232chr1------11234
NM_002245chr11517 ------
NM_002253chr41381 ------
NM_002264chr344426 3318 3192 211 --14157 --
NM_002267chr1311893 183 ----
NM_002270chr514484 25304 1885 ----
NM_002293chr192731 2503 1944 1807 1762 1699 1012 749 723 --124 --
NM_002313chr1075067 3648 1457 559 178 116 21 ------
NM_002349chr22659 289 ------
NM_002356chr612332 22118 1779 ----
NM_002372chr5--2259 67 ----
NM_002374chr222985 198 1988 ----
NM_002376chr14------187
NM_002395chr61527 11178 11353 --
NM_002397chr521656 406 ------
NM_002399chr1521068 466 21176 483 ----
NM_002430chr2222427 2161 ------
NM_002470chr17--1104 ----
NM_002489chr71340 ------
NM_002499chr1541851 994 742 210 ------
NM_002508chr1144 11456 ----
NM_002515chr141513 ------
NM_002520chr5157 ------
NM_002545chr1154044 3769 1928 1122 28 11405 14259 --
NM_002568chr81371 ------
NM_002572chr111263 ------
NM_002581chr913829 --25404 4233 --
NM_002583chr12190 ------
NM_002594chr2021515 106 12115 2952 854 --
NM_002600chr111333 --1557 --
NM_002601chr21163 ------
NM_002610chr232539 972 247 ----12799
NM_002613chr1654461 1444 1327 610 131 1195 --14090
NM_002627chr10155 ------
NM_002655chr833551 1241 391 ----11403
NM_002662chr331953 664 530 2800 304 1632 12200
NM_002670chr341273 1126 1062 595 11287 2657 180 --
NM_002709chr222986 1325 23418 1245 22311 885 --
NM_002710chr12137 ------
NM_002711chr71754 1339 ----
NM_002716chr1133038 2751 2632 ----1123
NM_002717chr81632 ------
NM_002718chr32644 147 --32180 2017 287 --
NM_002719chr1431545 967 528 ----1129
NM_002731chr112341 1175 12708 1582
NM_002736chr73647 615 399 1578 12080 --
NM_002745chr2284494 4222 4045 3142 2982 828 758 205 1556 13162 --
NM_002758chr171477 ------
NM_002791chr14------157
NM_002806chr141126 ------
NM_002825chr7--1426 ----
NM_002837chr1234554 4485 3497 13601 24425 161 13897
NM_002839chr911415 11244 ----
NM_002843chr1152373 1067 957 814 649 --22192 781 --
NM_002868chr1221945 181 1169 22434 94 --
NM_002904chr6--1162 ----
NM_002912chr61705 ------
NM_002938chr421709 1678 21392 623 11743 --
NM_002941chr311127 ------
NM_002942chr311084 1553 ----
NM_002948chr31360 1142 ----
NM_002956chr12160 ------
NM_002959chr143263 2939 744 657 11338 2711 632 --
NM_002968chr1641118 748 302 291 ------
NM_002973chr121128 ------
NM_002994chr41280 ------
NM_002998chr821895 630 --11380 --
NM_003010chr1742320 2075 1582 515 1113 ----
NM_003011chr9--11618 ----
NM_003012chr872892 2674 2189 734 301 257 143 1355 ----
NM_003016chr1711320 1504 ----
NM_003022chrX21056 327 ------
NM_003028chr973845 3567 3443 3011 2428 1511 1166 --1203 --
NM_003034chr1247531 6850 2622 1325 16754 --12010
NM_003042chr32549 270 22018 1425 ----
NM_003043chr383737 2942 2854 2734 1396 1341 1031 393 --13219 --
NM_003045chr1393727 3524 3272 3185 3141 1831 977 656 90 --131 --
NM_003048chr242759 1891 898 75 12406 2858 127 12155
NM_003068chr8--1825 ----
NM_003070chr92307 197 ------
NM_003071chr311635 1194 ----
NM_003105chr11196 ------
NM_003108chr246260 6100 2052 1432 22830 391 1506 --
NM_003112chr733239 3140 2093 13050 ----
NM_003139chr11--1915 ----
NM_003144chr631800 535 102 1188 --1626
NM_003161chr1762512 2285 2215 1382 742 243 11334 13538 --
NM_003178chr321795 805 22269 1555 12071 --
NM_003182chr7149 ------
NM_003182chr7149 ------
NM_003185chr201167 ------
NM_003187chr5122 ------
NM_003189chr122563 1244 --12868 --
NM_003193chr1--1185 ----
NM_003199chr1854869 4290 1422 981 300 44565 1900 537 421 ----
NM_003203chr212159 11567 ----
NM_003216chr2272879 2683 2662 1082 615 489 177 12998 ----
NM_003220chr621484 195 31499 1135 364 1643 --
NM_003221chr633365 2990 1636 21442 191 ----
NM_003244chr181317 ------
NM_003248chr5------1122
NM_003262chr334912 1661 300 34899 555 547 --13428
NM_003281chr174709 3808 3720 3580 2033 1836 1121 21633 271 14753 --
NM_003291chr131309 ------
NM_003298chr364006 2336 1842 454 219 30 ----11949
NM_003319chr21679 1992 ----
NM_003338chr10----1764 --
NM_003341chr31222 ------
NM_003342chr17--32325 733 144 12924 12052
NM_003348chr1211693 ------
NM_003367chr19--1537 ----
NM_003369chr1142768 1762 867 489 ------
NM_003373chr1011652 ------
NM_003383chr9162 --1450 --
NM_003385chr21831 1845 --1761
NM_003392chr343755 3172 2828 1089 1945 23457 687 1193
NM_003403chr141835 ----1848
NM_003410chrX3805 365 351 --1220 --
NM_003411chrY31707 1195 349 1210 ----
NM_003412chr31978 12950 ----
NM_003439chr733574 2960 326 1647 --22577 701
NM_003441chr4--1284 ----
NM_003452chr91888 ------
NM_003457chr17--1470 ----
NM_003458chr343357 3144 1065 740 --32794 1282 1075 --
NM_003463chr623248 157 ------
NM_003468chr244083 976 838 119 11291 --1293
NM_003470chr1631853 255 239 11306 ----
NM_003473chr101939 ------
NM_003478chr1121250 498 12132 22041 1194 12501
NM_003483chr1231020 448 34 21896 823 ----
NM_003487chr17--1269 ----
NM_003489chr2143250 2820 1353 1207 --11001 --
NM_003566chr1233149 482 106 ------
NM_003576chr1322079 343 12188 12216 --
NM_003589chr1321161 1038 ------
NM_003590chr233462 1106 878 23986 1033 --1418
NM_003597chr232253 738 644 ----1291
NM_003607chr133609 871 263 44388 3427 878 188 33936 3015 116 --
NM_003615chr343442 737 317 256 24026 1100 1461 --
NM_003617chr124007 1344 ----14354
NM_003618chr23932 435 56 ------
NM_003621chr113526 444 47 ------
NM_003630chr6181 1767 ----
NM_003637chr151282 1105 966 615 37 ------
NM_003651chr12--1122 ----
NM_003671chr941340 930 326 54 --12681 --
NM_003690chr2--1495 ----
NM_003714chr532517 899 403 22187 1247 13058 --
NM_003716chr31216 ------
NM_003718chr71559 1368 --170
NM_003722chr312280 22741 2047 12190 --
NM_003749chr1322051 1581 12440 ----
NM_003750chr101305 ------
NM_003758chr152308 277 31470 1105 415 ----
NM_003758chr152308 277 31470 1105 415 ----
NM_003759chr451651 1613 1530 923 472 ------
NM_003763chr2042626 2571 1262 122 1593 ----
NM_003783chr11983 2489 246 ----
NM_003787chr181543 ------
NM_003796chr191167 ----1122
NM_003800chr62440 194 ------
NM_003873chr1021749 578 1703 32073 1703 924 --
NM_003884chr3--11756 ----
NM_003887chr242209 661 148 101 ------
NM_003888chr15--21751 1685 11427 --
NM_003895chr21--187 ----
NM_003899chr133644 609 493 2813 265 21907 521 --
NM_003901chr10--12734 ----
NM_003922chr15181 1153 ----
NM_003930chr72623 305 --31914 965 702 --
NM_003934chr93361 249 63 1397 ----
NM_003939chr1033267 1620 770 295 86 23348 843 --
NM_003941chr752535 2274 846 548 150 11683 ----
NM_003958chr643976 2717 2700 805 --1646 --
NM_003959chr12------11183
NM_003968chr3186 --1561 --
NM_003971chr171208 ------
NM_003985chr171684 ------
NM_003993chr11269 ------
NM_003994chr1223469 3168 --2555 47 1456
NM_004006chrX22557 507 ----12088
NM_004007chrX22557 507 ----12088
NM_004009chrX22557 507 ----12088
NM_004010chrX22557 507 ----12088
NM_004011chrX22557 507 ----12088
NM_004012chrX22557 507 ----12088
NM_004013chrX22557 507 ----12088
NM_004014chrX22557 507 ----12088
NM_004015chrX22557 507 ----12088
NM_004016chrX22471 421 ----12002
NM_004017chrX22557 507 ----12088
NM_004018chrX22471 421 ----12002
NM_004020chrX22557 507 ----12088
NM_004021chrX22471 421 ----12002
NM_004022chrX22471 421 ----12002
NM_004023chrX22471 421 ----12002
NM_004040chr21434 11103 11043 --
NM_004050chr1432531 2235 1850 ------
NM_004060chr531202 884 455 ------
NM_004067chr711182 ------
NM_004074chr11--1203 ----
NM_004077chr1221316 532 ------
NM_004086chr14--1805 ----
NM_004093chr1343101 2331 2106 529 --12065 21063 613
NM_004094chr14----23020 1003 --
NM_004096chr1031859 1707 763 132 198 --
NM_004099chr931914 1561 493 ------
NM_004113chr3--11925 ----
NM_004114chrX131 ------
NM_004136chr1533184 85 37 13107 --12816
NM_004156chr8182 1106 ----
NM_004161chr211527 1569 11425 --
NM_004162chr321098 1083 11110 ----
NM_004170chr91629 1549 ----
NM_004171chr11109566 8839 6328 6176 3355 3088 1819 1388 1256 55 17231 17663 37963 5881 1279
NM_004215chr8160 1588 ----
NM_004225chr821244 531 ------
NM_004227chr762814 2638 2169 1023 709 607 12726 1757 --
NM_004229chrX21679 504 ------
NM_004232chr1843370 3025 987 574 33629 3213 2937 12496 --
NM_004242chr6--1332 ----
NM_004255chr151139 ------
NM_004272chr521714 756 11895 --11831
NM_004282chr61178 ------
NM_004296chr1483657 2964 2808 2783 2649 968 907 129 33759 2816 1484 ----
NM_004323chr92947 103 --22600 1032 --
NM_004331chr822041 375 12476 11775 1562
NM_004338chr1866975 5668 5565 5247 2038 1666 11061 15498 --
NM_004342chr72460 453 1503 11925 --
NM_004354chr4--150 ----
NM_004361chr18142 ------
NM_004384chr522137 609 --22185 1490 --
NM_004392chr1321651 724 ------
NM_004393chr322231 432 22215 1634 ----
NM_004397chr1153141 2644 1622 1394 1138 13494 ----
NM_004415chr61588 1244 --1679
NM_004419chr102952 86 1329 --21012 316
NM_004432chr911854 ------
NM_004437chr143435 2835 2451 2228 12618 33079 2581 2432 13119
NM_004438chr242935 2053 1301 1095 ----11196
NM_004440chr61502 21324 755 ----
NM_004442chr1----11084 --
NM_004443chr3------1781
NM_004447chr12--31134 342 334 ----
NM_004449chr211375 ------
NM_004451chr111121 2603 487 ----
NM_004454chr331996 869 301 ------
NM_004456chr7172 1213 ----
NM_004458chrX------12469
NM_004466chr13--194 ----
NM_004491chr1953746 3454 2708 408 245 14044 122 1836
NM_004496chr14----1452 --
NM_004500chr1431668 1592 383 1488 ----
NM_004501chr113759 22864 1047 13440 --
NM_004504chr232203 456 178 --12939 12618
NM_004571chr2111226 13390 12508 11380
NM_004593chr3--1369 156 --
NM_004595chrX186 ------
NM_004612chr954421 1336 750 304 121 ----13003
NM_004631chr121396 156 ------
NM_004654chrY2544 502 1208 ----
NM_004660chrY11937 ------
NM_004670chr1021291 220 1586 ----
NM_004671chr18--1331 ----
NM_004687chr172757 338 11726 11873 --
NM_004703chr1751748 927 421 337 60 12389 ----
NM_004719chr121311 12301 11030 --
NM_004721chr31269 1148 ----
NM_004726chrX95491 4669 4639 4549 4159 4042 1775 1427 681 23570 118 ----
NM_004739chr11--1641 ----
NM_004744chr453825 3810 3361 258 104 --11555 12581
NM_004745chr896801 6565 4836 4807 4667 4579 2603 2221 691 --14752 --
NM_004748chr1574023 3651 3543 3256 3110 569 349 ------
NM_004756chr192249 180 --41463 1379 1285 1235 --
NM_004768chr121061 189 ------
NM_004770chr8--1200 ----
NM_004772chr531619 1524 1122 1408 ----
NM_004775chr1811673 --11796 --
NM_004796chr14--22439 924 ----
NM_004801chr211405 ------
NM_004804chr222771 586 --12674 11111
NM_004815chr134576 1728 542 24830 1452 ----
NM_004834chr241214 472 368 99 1890 ----
NM_004840chrX22215 370 12034 11638 --
NM_004842chr6----1588 11607
NM_004849chr631562 158 93 ------
NM_004850chr231767 1247 192 31389 1379 673 ----
NM_004857chr1434540 4463 511 184 34171 3528 894 --
NM_004859chr1732753 1103 660 --191 --
NM_004860chr171170 ------
NM_004869chr18------1474
NM_004874chr81105 ------
NM_004883chr51223 ------
NM_004887chr52920 826 ------
NM_004898chr411839 12471 22351 2260 --
NM_004904chr766410 5213 5003 2328 1408 404 15279 15017 --
NM_004906chr61214 ------
NM_004921chr131942 401 204 1859 1715 --
NM_004922chr103828 735 80 --1314 --
NM_004937chr1772590 2268 2096 853 568 278 259 ----11925
NM_004965chr211592 ------
NM_004967chr42427 82 ------
NM_004975chr201687 2961 227 1356 --
NM_004978chr131510 1471 547 --1133 --
NM_004985chr1224245 639 ------
NM_004992chrX148427 8132 8030 6465 6247 6222 5345 3135 2702 1840 1726 1316 370 48 11477 15749 17807
NM_004992chrX148427 8132 8030 6465 6247 6222 5345 3135 2702 1840 1726 1316 370 48 11477 15749 17807
NM_005006chr22997 703 ------
NM_005028chr102931 869 1751 ----
NM_005036chr22128153 7642 6987 6088 5492 3111 2663 1560 1222 338 138 75 1487 22284 2034 25922 5673
NM_005044chrX54294 3038 1699 1099 647 --32839 1621 1257 --
NM_005056chr1274672 4659 3408 2013 1500 753 630 24979 4305 ----
NM_005065chr1474779 4634 4562 4549 4426 4168 1762 ------
NM_005087chr32821 233 ------
NM_005095chr11382 21594 283 ----
NM_005112chr41193 ------
NM_005114chr41591 ------
NM_005116chr2043686 2944 1737 1654 24249 66 11249 13255
NM_005121chr17----1841 --
NM_005123chr12----1375 1356
NM_005126chr32144 35 ------
NM_005135chr1573797 3779 3390 3189 2445 1527 690 ------
NM_005156chr935149 5127 2090 15016 ----
NM_005171chr121964 ------
NM_005184chr1911051 21014 138 21559 638 --
NM_005188chr1197056 6940 6549 6221 5937 3006 2638 2069 1352 12891 17204 17767
NM_005197chr1455739 5556 4629 2030 1625 36206 1769 1326 180 --
NM_005201chr31225 ------
NM_005203chr101444 ------
NM_005214chr22262 54 11102 11017 --
NM_005230chr12----1514 --
NM_005233chr332419 447 417 --22484 1794 --
NM_005235chr267748 6694 1421 1251 1147 282 --26262 2778 --
NM_005238chr112648 399 ------
NM_005243chr22--1300 ----
NM_005254chr1521055 156 ------
NM_005274chr11102 ------
NM_005277chr42428 409 ------
NM_005312chr992321 2230 2188 2046 1996 681 340 215 49 --12244 --
NM_005326chr16150 ------
NM_005329chr1641874 1861 365 337 22159 494 21843 188 --
NM_005339chr443586 3488 3032 2815 11544 ----
NM_005342chrX32343 780 351 ----12473
NM_005359chr1835330 1431 917 26540 5515 34722 4156 1412 --
NM_005370chr1951237 464 439 356 229 ------
NM_005381chr2----1159 --
NM_005384chr9149 ------
NM_005385chr352609 1022 494 284 46 ----12350
NM_005387chr112447 103 ------
NM_005392chr951862 1536 640 627 413 --21768 577 --
NM_005400chr252427 2417 2112 1236 1008 ----1871
NM_005402chr711644 --11475 --
NM_005406chr18--11252 11182 --
NM_005433chr1821826 723 --1774 --
NM_005436chr1064021 3592 3269 2642 1200 286 21615 845 ----
NM_005443chr41179 145 ----
NM_005465chr122009 691 ----11355
NM_005479chr101161 11170 ----
NM_005493chr6--1817 ----
NM_005502chr92669 479 2677 353 ----
NM_005509chr51355 11609 --11387
NM_005520chr53642 310 211 ------
NM_005562chr121353 204 11196 11588 --
NM_005573chr5----1530 --
NM_005584chr131271 ------
NM_005595chr12295 210 ------
NM_005596chr975788 3881 1850 1747 823 346 253 16131 15004 --
NM_005602chr3--21322 1016 1822 --
NM_005604chr62760 244 ------
NM_005611chr1631204 117 46 ------
NM_005637chr18--1410 1226 1763
NM_005639chr1251742 1692 1457 634 223 11537 ----
NM_005665chr134890 3631 376 --14128 --
NM_005668chr553283 3272 1782 1694 334 ------
NM_005721chr22873 115 1230 ----
NM_005722chr251593 1520 936 837 431 ----1592
NM_005724chr15----1322 --
NM_005735chr21187 ------
NM_005748chr1233399 2210 449 --12757 --
NM_005749chr171652 ------
NM_005754chr51832 ------
NM_005756chrX21464 1087 --1110 --
NM_005759chr211501 ----13163
NM_005776chr141860 ------
NM_005779chr532241 1323 325 23303 2852 1311 --
NM_005789chr17--11441 ----
NM_005801chr173702 256 220 2729 159 ----
NM_005802chr91602 ------
NM_005808chr323078 2482 --13131 --
NM_005813chr232084 701 462 1240 ----
NM_005819chr163052 2981 2427 1385 878 364 ------
NM_005828chr1754370 3901 3857 3564 1173 --33215 827 373 --
NM_005832chr311397 1134 ----
NM_005836chr8162 ------
NM_005839chr11715 1633 ----
NM_005840chrX75462 4975 2437 1665 1638 806 307 37107 5616 4782 ----
NM_005845chr1311372 --1610 194
NM_005852chr171763 ------
NM_005862chr311000 ------
NM_005863chr1031132 155 110 ------
NM_005868chr732212 1640 359 ------
NM_005880chr1611116 --11626 --
NM_005896chr2141 1709 ----
NM_005900chr41220 --1179 --
NM_005901chr1898273 7828 6928 6884 6268 6181 5422 5414 2901 21452 42 16533 --
NM_005906chr6--11474 ----
NM_005909chr534247 3900 2984 1868 13865 --
NM_005920chr152821 1534 1322 865 691 13253 ----
NM_005933chr1152174 2018 1901 1841 57 11016 ----
NM_005935chr445019 1343 1003 623 --14554 --
NM_005937chr1753700 3632 3515 1309 842 ----11588
NM_005955chr185523 4924 3777 3731 737 685 627 512 24141 1227 14220 14516
NM_005957chr194909 1676 1359 1092 1068 801 483 336 137 --34746 4209 4038 --
NM_005966chr23917 897 689 ----12414
NM_005977chr131724 --1920 --
NM_005999chr1--11341 ----
NM_006007chr923540 325 14048 14098 --
NM_006037chr274884 3733 3476 1407 236 204 133 --1322 --
NM_006060chr784108 3986 3942 3513 1635 1562 1340 84 23804 3329 22836 920 14078
NM_006064chrX1271 ------
NM_006070chr31400 ------
NM_006080chr7172 ------
NM_006090chr12627 53 --1139 --
NM_006094chr822161 966 --1491 --
NM_006095chr464216 4203 1214 969 359 186 --13435 --
NM_006139chr232079 664 36 --22052 1078 --
NM_006153chr3--1467 ----
NM_006186chr231007 894 387 ------
NM_006194chr141469 21207 230 ----
NM_006195chr9157 ------
NM_006197chr832232 771 265 --11477 --
NM_006202chr1931430 1214 264 ------
NM_006203chr545173 3669 361 309 1412 13517 --
NM_006206chr441933 1139 704 335 12033 ----
NM_006247chr192340 96 ------
NM_006251chr542653 2588 2254 466 132 ----
NM_006252chr143029 599 593 92 57084 6859 6567 5084 732 2339 227 17535
NM_006256chr11633 12663 ----
NM_006265chr83462 454 275 11016 ----
NM_006267chr21277 ------
NM_006275chr2012224 1608 ----
NM_006279chr12895 49 2925 814 --2277 118
NM_006287chr232288 751 21 ------
NM_006300chr1912292 12384 ----
NM_006306chrX55795 5480 5421 5077 1203 15389 35590 5572 5564 25397 1337
NM_006311chr171214 ------
NM_006315chr444124 3520 3204 2818 --1278 --
NM_006321chr322210 440 --2136 102 --
NM_006322chr131384 ------
NM_006380chr1764097 4001 3950 3493 1760 885 ------
NM_006393chr10104460 4313 2856 1512 1470 1067 805 797 445 179 ------
NM_006401chr91326 ------
NM_006416chr6--1793 ----
NM_006434chr1032942 2600 616 31139 1118 406 12166 --
NM_006451chr5--1247 ----
NM_006460chr1731372 383 59 ------
NM_006469chr121493 110 ------
NM_006489chr141513 ------
NM_006497chr17--1837 ----
NM_006520chrX2155 109 1532 11402 --
NM_006534chr2033251 747 677 1876 22423 181 --
NM_006540chr8--11252 ----
NM_006541chr10--1195 ----
NM_006544chr1454787 2410 1918 1547 892 --25458 2245 --
NM_006546chr1796561 6451 6100 5609 4617 4341 1614 1594 1296 21578 1569 15870 --
NM_006561chr1065655 5039 4972 2351 1370 417 25483 2479 --1409
NM_006572chr1722901 2250 23515 804 1831 --
NM_006575chr1421468 1251 1293 ----
NM_006577chr221219 1107 ------
NM_006595chr112534 213 --11926 11597
NM_006599chr1675788 5690 2938 2873 2334 2268 976 --1539 --
NM_006601chr1251068 441 279 269 192 ----1214
NM_006603chrX31424 1303 672 ------
NM_006609chr222415 1165 --1996 --
NM_006621chr122006 1747 22030 1897 ----
NM_006624chr1022112 198 1764 ----
NM_006625chr1----1257 --
NM_006625chr1----1257 --
NM_006625chr1----1257 --
NM_006628chr1534515 2869 211 1284 1561 13811
NM_006636chr22854 75 1350 ----
NM_006646chr1323054 969 ------
NM_006654chr1274524 3611 1540 1025 449 384 217 24800 4120 --14208
NM_006667chrX2761 53 --1938 --
NM_006682chr742272 773 228 46 ----12693
NM_006698chr2011002 11231 ----
NM_006699chr162376 2062 2048 990 599 414 1521 ----
NM_006713chr52823 305 ------
NM_006717chr922854 2186 ----1961
NM_006720chr1075067 3648 1457 559 178 116 21 ------
NM_006722chr322673 1943 32977 2777 2556 ----
NM_006729chrX35286 4529 1766 14683 21672 1002 --
NM_006751chr2--1288 ----
NM_006759chr22253 228 ------
NM_006761chr17----1583 --
NM_006763chr111377 ------
NM_006775chr632267 2119 674 1256 ----
NM_006777chrX22642 1123 ------
NM_006788chr18----11505 --
NM_006805chr521540 1454 --11325 --
NM_006826chr22992 981 11040 ----
NM_006837chr8158 ------
NM_006838chr1221719 1488 ----11879
NM_006839chr21212 1324 ----
NM_006852chr172662 190 --1445 11131
NM_006855chr22171 2890 247 ----
NM_006873chr212369 13155 11033 --
NM_006874chr41831 ------
NM_006885chr1612723 14072 --13004
NM_006888chr1422855 1137 12934 ----
NM_006914chr9199 ----21199 1068
NM_006924chr1744345 3700 646 482 11164 ----
NM_006930chr52719 27 1804 ----
NM_006931chr12--1711 ----
NM_006937chr171502 ------
NM_006947chr4----170 --
NM_007005chr91505 ------
NM_007007chr1274131 3965 3693 1011 554 498 165 14803 13729 --
NM_007011chr1524936 157 22103 848 24902 2340 15642
NM_007017chr51695 ------
NM_007030chr564905 4504 3437 1657 646 423 --1340 --
NM_007036chr51250 ------
NM_007050chr2068064 5415 3087 1667 1494 1018 12197 14980 12263
NM_007054chr533971 3524 341 ------
NM_007078chr1021158 633 1292 12785 157
NM_007079chr8------1463
NM_007106chr1311972 1607 ----
NM_007114chr321099 183 12301 ----
NM_007115chr21118 1498 ----
NM_007159chr311333 1211 ----
NM_007172chr2211140 23321 3116 ----
NM_007176chr1411198 21692 628 11238 --
NM_007191chr121632 ------
NM_007203chr92455 140 23855 3582 12411 2918 817
NM_007214chr641362 991 429 409 ------
NM_007222chr811690 ------
NM_007231chrX1150 ------
NM_007235chr12--1177 ----
NM_007249chr13159015 7090 6460 6449 6118 3442 3436 2945 1990 1751 1572 576 554 487 168 27542 1010 ----
NM_007347chr1522987 2022 1753 --12675
NM_007358chr141696 720 659 638 ------
NM_007372chr172639 59 ------
NM_007375chr122485 2479 12138 22493 2063 --
NM_012069chrX32413 2143 321 ------
NM_012073chr52272 139 ------
NM_012074chr1431097 95 27 ------
NM_012081chr511051 ----12404
NM_012082chr84888 719 637 98 ------
NM_012090chr11202 11190 ----
NM_012095chr1053523 3280 2713 2555 285 --43257 2751 2595 1217 --
NM_012096chr332534 2374 497 ----171
NM_012097chr212307 ------
NM_012104chr1132723 2351 1367 --1918 13649
NM_012104chr1132723 2351 1367 --1918 13649
NM_012111chr141176 ------
NM_012141chr1324176 2642 ------
NM_012156chr2053263 2426 1292 1231 90 2535 245 12359 --
NM_012158chr1311539 --11194 --
NM_012161chr421130 1025 ------
NM_012164chr966516 6129 2172 692 200 73 16418 11287 --
NM_012193chr1175165 4736 3505 989 784 511 366 1114 ----
NM_012197chr921429 166 ----11421
NM_012198chr2--1163 ----
NM_012199chr154633 4624 3723 3663 770 14319 1274 --
NM_012207chr101141 1885 ----
NM_012214chr245624 4657 4445 2238 16036 11518 --
NM_012218chr1953037 2919 1089 939 304 --22533 2300 13016
NM_012223chr2--1940 ----
NM_012249chr23986 719 188 21050 706 ----
NM_012257chr71850 --1906 --
NM_012259chr65965 504 209 201 24 11316 ----
NM_012286chrX1568 ------
NM_012287chr322832 497 33902 1014 683 ----
NM_012288chr655312 4389 4258 1817 804 24945 4886 ----
NM_012294chr734004 1105 34 13977 ----
NM_012297chr422644 516 --21811 526 --
NM_012300chr532572 2017 720 ------
NM_012306chr1232880 924 854 --22636 605 12503
NM_012307chr183405 334 250 1229 ----
NM_012309chr1164099 3397 3173 1975 1758 408 13271 ----
NM_012330chr1041137 725 284 157 ----11416
NM_012343chr51843 ------
NM_012347chr642306 2143 1062 572 --1741 --
NM_012383chr9184 ------
NM_012395chr753421 3130 2121 779 319 ------
NM_012399chr2211614 11635 ----
NM_012419chr6--1491 ----
NM_012421chr1245 23 ------
NM_012425chr1032334 1874 1003 11821 22447 2281 --
NM_012434chr631657 506 478 --2566 248 --
NM_012463chr12--11153 ----
NM_012465chr1011076 12237 ----
NM_012475chr11243 ------
NM_012479chr731722 620 21 12410 ----
NM_013229chr1221836 517 --12547 --
NM_013255chr768818 8475 7142 6378 6034 3069 16467 ----
NM_013257chr832340 1842 591 21612 898 --1856
NM_013261chr433314 3175 2511 43252 2663 2457 1333 1429 --
NM_013269chr1253438 1413 741 733 457 ----13728
NM_013281chr2011181 --1570 --
NM_013309chr1521695 1663 22337 62 --11841
NM_013322chr741667 1574 429 326 --11086 --
NM_013341chr242224 1857 1818 549 187 12409 --
NM_013357chr81627 ------
NM_013367chr4--187 ----
NM_013374chr312020 163 1884 --
NM_013381chr122595 528 ------
NM_013386chr11691 ----1132
NM_013437chr8143 ------
NM_013444chrX1883 ------
NM_013445chr2154 ------
NM_013448chr141673 184 ----
NM_013449chr1221999 388 11938 ----
NM_013450chr21281 ------
NM_013943chr153295 2341 891 655 393 ------
NM_013981chr51223 ------
NM_013982chr51223 ------
NM_013983chr51223 ------
NM_013986chr22--1300 ----
NM_013989chr1421877 1398 --11950 14436
NM_013996chr7149 ------
NM_013996chr7149 ------
NM_013997chr7149 ------
NM_013997chr7149 ------
NM_013998chr7149 ------
NM_013998chr7149 ------
NM_014000chr1011652 ------
NM_014021chr133276 2803 206 ----1664
NM_014028chr643315 2109 778 614 --22334 721 --
NM_014039chr1121232 1075 --1198 --
NM_014048chr16105045 4896 4833 4363 4164 3779 2090 1501 938 319 24506 1618 13447 --
NM_014079chr31101 169 ----
NM_014089chr1322176 36 ----1767
NM_014112chr895246 5041 4782 4265 1975 1049 987 604 493 21571 598 11722 15474
NM_014117chr161494 ------
NM_014141chr755244 4525 1954 786 131 13752 21797 332 13650
NM_014155chr1156154 6032 2467 2368 223 26496 4801 --36717 4585 1669
NM_014160chr32511 373 11428 11339 1260
NM_014189chr411507 ------
NM_014217chr11680 ----1328
NM_014223chr12180 62 1759 ----
NM_014240chr353972 2737 1536 706 693 --13933 --
NM_014245chr3--1402 11033 --
NM_014253chrX2647 406 ------
NM_014264chr42466 424 ------
NM_014268chr1821192 946 11411 ----
NM_014279chr93653 624 297 --1912 --
NM_014290chr9--148 ----
NM_014294chr8----1410 --
NM_014309chr2274963 4659 4295 3610 503 458 53 14103 13955 --
NM_014331chr467695 7025 6821 5775 2450 26 16957 ----
NM_014332chrX1285 ------
NM_014333chr1131970 1914 484 ------
NM_014344chr111219 ------
NM_014352chr1121459 1435 --1307 --
NM_014372chr111802 ------
NM_014393chr842053 2003 1654 1509 ------
NM_014396chr712198 159 --11618
NM_014409chr121007 203 1900 134 --
NM_014415chr31125 ------
NM_014421chr431951 1406 529 ------
NM_014423chr545519 5294 3902 223 12194 12256 --
NM_014445chr312409 1224 ----
NM_014506chr911473 --31361 475 362 11681
NM_014515chr122822 130 ------
NM_014522chrX1197 ------
NM_014548chr1521259 216 11400 ----
NM_014554chr121106 42087 2045 1869 775 22000 1886 --
NM_014572chr13--1430 --11552
NM_014574chr1411575 126 ----
NM_014586chr2154746 4481 3305 1539 213 14161 21904 1014 --
NM_014606chr4--11558 ----
NM_014607chr231780 1497 212 126 ----
NM_014614chr221302 1185 ------
NM_014615chr1622264 310 1551 12423 --
NM_014616chr333365 2182 641 22291 1249 ----
NM_014620chr12--1758 ----
NM_014629chr81139 --1520 --
NM_014633chr111112 ------
NM_014661chr1083798 3494 3444 2420 899 817 560 227 --23711 2675 --
NM_014670chr21432 ------
NM_014675chr11187 1500 ----
NM_014676chr141625 1509 1470 268 ------
NM_014677chr821227 300 --181 --
NM_014682chr832219 846 120 22304 695 123 --
NM_014699chr161254 1359 ----
NM_014701chr1522141 463 ----12567
NM_014709chr21205 ------
NM_014730chr1254906 4486 3504 1860 1399 11034 13821 11525
NM_014730chr1254906 4486 3504 1860 1399 11034 13821 11525
NM_014733chr511519 1893 ----
NM_014739chr611673 24222 795 ----
NM_014747chr185667 5463 4752 1552 1206 862 613 583 ----15809
NM_014751chr82547 105 22163 534 ----
NM_014755chr254159 3646 3123 2918 465 13703 ----
NM_014765chr152296 1828 1681 1000 842 --11700 --
NM_014767chr1052912 1118 914 64 55 13369 1751 --
NM_014776chr1222980 2253 33158 810 437 ----
NM_014779chr31403 ------
NM_014781chr811033 ------
NM_014790chr51373 ------
NM_014804chr171182 --2254 235 --
NM_014810chr153063 1277 1221 1215 561 13287 ----
NM_014826chr133609 871 263 44388 3427 878 188 33936 3015 116 --
NM_014827chr12626 69 ------
NM_014829chr512358 12011 ----
NM_014830chr1281432 1190 1077 898 702 598 186 39 ------
NM_014836chr10--11905 ----
NM_014838chr2242356 1975 548 418 ------
NM_014839chr121946 1778 ----11746
NM_014841chr631171 1005 144 11387 ----
NM_014848chr1522318 566 22785 2226 ----
NM_014853chr1711509 ------
NM_014864chr143570 3091 1027 229 1100 --1475
NM_014868chr12--1906 ----
NM_014873chr144797 4723 4062 1866 3538 515 492 ----
NM_014877chr1755555 5136 1490 1312 1019 --1494 17752
NM_014893chrY42272 2116 2041 332 11835 ----
NM_014899chr532920 661 600 13167 ----
NM_014903chr1242259 2167 915 276 --1140 --
NM_014906chr1764138 3737 3292 3148 2990 636 12502 12979 13173
NM_014912chr1042956 2300 2192 683 1896 12859 --
NM_014918chr15--1339 ----
NM_014920chr653395 3331 3107 900 403 ------
NM_014923chr1321546 335 ----1295
NM_014924chr141506 23214 691 ----
NM_014932chr331931 1597 1357 ------
NM_014934chr1333767 1473 115 --1611 13350
NM_014947chr153046 2407 2180 2134 637 ------
NM_014950chr1411089 1200 ----
NM_014961chr43689 639 437 ------
NM_014978chr1021701 1247 ------
NM_014988chr472814 2610 2546 2337 2301 700 60 1341 ----
NM_014991chr473262 3234 3050 2398 2382 475 234 ------
NM_014997chr732639 908 421 1428 1555 --
NM_015000chr1253006 1998 1975 376 333 --21206 397 --
NM_015008chr343645 304 164 50 12280 ----
NM_015020chr1643139 2984 2692 942 13889 ----
NM_015025chr2------1631
NM_015026chr1274222 3556 3357 2994 1852 444 106 23273 754 ----
NM_015032chr1332666 984 711 22562 2337 1188 --
NM_015035chr2086299 6072 5003 4981 4397 4355 2144 690 1196 15526 16212
NM_015039chr144293 3400 1310 767 1786 123 --
NM_015040chr222590 2227 --23111 1331 --
NM_015052chr72875 233 --11201 --
NM_015057chr131629 ------
NM_015068chr741391 1273 843 210 1630 ----
NM_015071chr595324 5090 5024 4524 1996 1563 922 718 502 ------
NM_015074chr134952 3372 637 14778 1836 --
NM_015076chr643743 1477 436 53 1855 13390 --
NM_015090chr165406 4069 2020 1808 1436 1411 25569 107 25493 4007 --
NM_015092chr1643435 585 476 283 14483 21774 493 14393
NM_015097chr321496 154 21677 1536 --11609
NM_015115chr433059 2606 606 --32019 1171 1053 --
NM_015124chr2212445 1114 11823 --
NM_015138chr1542636 1926 1802 371 11871 1365 --
NM_015143chr421438 367 ------
NM_015144chr1643539 2599 636 340 23651 753 1887 --
NM_015153chr6--1276 ----
NM_015156chr1453099 2943 2842 868 316 ------
NM_015176chr141738 519 204 82 ------
NM_015184chr31201 ------
NM_015185chrX32577 1843 856 12788 32877 2255 1124 --
NM_015192chr2022351 682 ------
NM_015199chr352203 739 529 328 317 ----1393
NM_015200chr432619 2168 929 2739 379 ----
NM_015202chr16--11125 ----
NM_015205chr1345066 2003 1920 826 15257 11077 --
NM_015206chr1551530 473 409 230 71 23608 3593 --183
NM_015208chr1842938 2689 1337 231 --14065 13000
NM_015209chr1----12253 --
NM_015215chr11853 2426 83 ----
NM_015219chr1752543 1961 1742 1712 331 11971 --12016
NM_015226chr1623053 2346 13215 1462 13476
NM_015247chr1631019 563 96 ------
NM_015263chr15165 ------
NM_015265chr241908 1743 676 27 ------
NM_015272chr161479 ------
NM_015277chr1821156 726 ------
NM_015288chr543704 3585 3179 2516 11460 ----
NM_015296chr132977 937 --1329 --
NM_015299chr1463324 2901 2824 2662 2555 913 --23165 2981 --
NM_015310chr866580 6202 5541 3135 790 538 27193 6824 --28312 767
NM_015313chr1143592 1396 1361 181 14102 ----
NM_015328chr7--13103 12915 --
NM_015346chr1421765 500 --147 --
NM_015349chr653090 2735 1972 1179 178 22613 761 12031 11145
NM_015365chrX3922 232 163 1835 ----
NM_015367chr2211673 ------
NM_015375chr134690 3302 1468 14803 74376 4209 3657 3128 1994 951 360 --
NM_015385chr1032942 2600 616 31139 1118 406 12166 --
NM_015415chr11210 ------
NM_015429chr31126 11139 ----
NM_015435chr81464 ------
NM_015442chr31243 ------
NM_015455chr554021 730 596 369 167 43629 3519 2654 2603 ----
NM_015457chr111914 ------
NM_015458chr845094 3720 2051 697 --23602 623 1449
NM_015461chr181575 ------
NM_015475chr21863 11098 ----
NM_015481chr121789 ----1393
NM_015497chr152814 739 ------
NM_015526chr192443 97 ------
NM_015530chr21387 1771 ----
NM_015532chr1542658 1829 307 229 ------
NM_015541chr321320 568 ------
NM_015548chr61827 ------
NM_015549chr14--1624 ----
NM_015554chr1532062 2001 435 12744 ----
NM_015564chr553542 2808 1389 1304 1100 --11316 --
NM_015568chr2084185 4112 3311 2678 1059 904 749 92 13998 ----
NM_015569chr143725 662 52 22 ----13384
NM_015570chr721201 487 ------
NM_015578chr1951935 1535 747 589 349 11813 21822 1668 --
NM_015601chr102927 376 ------
NM_015605chr10----1190 --
NM_015622chr71110 ------
NM_015630chr21823 2877 99 174 --
NM_015640chr194939 4858 4408 3900 3447 1978 1899 1803 1139 1184 --13344
NM_015660chr7------1318
NM_015678chr1321543 129 --165 --
NM_015691chrX21024 844 --1177 --
NM_015878chr822166 1965 2546 263 --1114
NM_015879chr18138486 8359 7667 7583 6798 6634 6513 2955 2635 1413 1049 956 621 11578 ----
NM_015904chr2138 --1778 --
NM_015905chr72609 549 ----1516
NM_015906chr134264 1013 690 13677 ----
NM_015975chrX31727 1450 248 ----11624
NM_015990chr411112 ------
NM_015999chr1------1166
NM_016018chr822169 1119 12559 ----
NM_016023chr821976 1761 1421 --11436
NM_016025chr161322 ----1375
NM_016032chrX21150 1112 ------
NM_016072chr1232295 1922 679 22207 150 12086 --
NM_016079chr242275 2035 1720 539 ------
NM_016083chr643735 3306 1440 844 --33715 1488 22 --
NM_016106chr14176 ------
NM_016125chr173513 242 211 ------
NM_016133chr221677 1157 ------
NM_016179chr131162 ------
NM_016185chr171675 1572 ----
NM_016206chr388516 7729 5627 2361 1462 1007 87 32 --22750 2574 --
NM_016218chr511263 1114 ----
NM_016220chr732251 659 327 11455 1745 --
NM_016230chr62381 156 ------
NM_016231chr1711522 ------
NM_016235chr16----185 --
NM_016242chr4--1175 --135
NM_016248chr1323820 2548 ------
NM_016260chr236249 1205 740 25572 5434 1902 --
NM_016271chr18--11769 ----
NM_016277chr61507 ------
NM_016287chr112041 1220 ----
NM_016298chr342852 924 766 596 --1671 11143
NM_016308chr1180 --11884 --
NM_016315chr211403 --21689 1501 --
NM_016322chr932454 2187 1957 12049 ----
NM_016334chr11424 ------
NM_016351chr71628 ------
NM_016357chr121788 --1317 --
NM_016374chr12549 236 1198 11311 --
NM_016374chr12549 236 1198 11311 --
NM_016376chr1721502 295 13842 1114 --
NM_016377chr6----1588 11607
NM_016395chr1541773 1569 1248 141 ------
NM_016400chr15------146
NM_016422chr1142837 2116 743 291 12965 1285 --
NM_016441chr211653 --21987 370 --
NM_016513chr653395 3331 3107 900 403 ------
NM_016530chr1553130 2577 874 392 26 ------
NM_016531chr484121 3739 2920 2713 1553 1364 807 749 ------
NM_016542chrX5677 623 612 562 114 21624 1458 ----
NM_016570chr12176 ------
NM_016577chr394432 4282 3845 3672 3461 1632 816 745 660 --33405 3278 669 --
NM_016578chr111545 ------
NM_016599chr411241 21373 103 ----
NM_016605chr562565 1990 1016 875 480 128 ------
NM_016607chrX2558 29 11700 ----
NM_016620chr111095 ------
NM_016621chr1194137 4010 3714 3658 3610 3570 930 683 310 --13353 11055
NM_016626chr18----1166 --
NM_016628chr101266 ------
NM_016631chr212864 638 1828 ----
NM_016654chr1521055 156 ------
NM_016656chrX1271 ------
NM_017415chr544505 4154 4005 2876 12837 34241 837 245 --
NM_017420chr1423575 3250 11476 13658 --
NM_017423chr411869 ------
NM_017437chr14191 ------
NM_017447chr2174315 4087 3656 1714 1412 1367 396 14352 23771 2772 --
NM_017449chr1----11084 --
NM_017451chr173889 118 39 11100 --11126
NM_017491chr41193 ------
NM_017519chr62880 496 ------
NM_017522chr121396 156 ------
NM_017544chrX3908 789 776 1327 ----
NM_017548chr352183 2018 1720 680 32 ------
NM_017563chr345166 1605 1496 1489 16039 15284 15953
NM_017577chr32639 147 --11401 --
NM_017628chr484703 3965 3462 3295 1438 870 684 668 11854 --1252
NM_017629chr141778 1222 620 151 ------
NM_017633chr613368 43772 706 609 470 ----
NM_017637chr999146 7372 7269 7245 6737 5710 1725 1501 1454 59107 8930 6397 5895 5844 --13070
NM_017643chr1712935 --1310 --
NM_017644chr334397 998 833 --23528 988 --
NM_017645chr942426 1925 1069 99 ------
NM_017650chr785661 4403 1799 1568 833 475 401 161 26084 4728 ----
NM_017658chr1444382 3084 1733 1269 12829 ----
NM_017693chr1321412 1400 ------
NM_017709chr153747 2958 2683 948 343 ------
NM_017719chr342582 2338 1778 688 1443 --11825
NM_017728chr1762938 2916 2851 2472 992 202 --22983 2613 --
NM_017730chr31651 ------
NM_017737chr111525 ------
NM_017740chr163665 659 97 1129 ----
NM_017754chr655005 4524 3245 1563 51 ------
NM_017768chr1167 ------
NM_017769chr1433018 2989 702 ------
NM_017778chr8------11412
NM_017780chr81108 ------
NM_017799chr1411625 ------
NM_017803chr161246 1277 ----
NM_017813chr815746 21739 499 ----
NM_017831chr1823051 1096 34111 3453 874 33799 3616 799 --
NM_017847chr132295 700 508 32038 1981 245 ----
NM_017849chr231050 858 30 1782 1775 --
NM_017851chr15151 ------
NM_017864chr8--1178 ----
NM_017913chr9--1475 ----
NM_017919chr934836 4534 1349 15843 34741 3982 2123 --
NM_017922chr141126 ------
NM_017923chr43592 336 274 ------
NM_017938chrX51891 704 638 206 194 ------
NM_018015chrX--11184 ----
NM_018024chr8--1496 ----
NM_018036chr1464366 4143 4079 3460 2756 729 --23083 1541 --
NM_018043chr1111420 11146 11041 1264
NM_018046chr52725 85 11534 1542 --
NM_018070chr1--1181 ----
NM_018084chr223125 700 190 13193 --
NM_018085chr176368 6277 5128 5088 2532 868 682 16079 26360 5744 11853
NM_018086chr231710 563 503 11847 ----
NM_018099chr12--186 ----
NM_018113chr121330 1500 ----
NM_018116chr11639 138 ----
NM_018121chr1032591 808 209 11095 22954 2364 --
NM_018126chr421352 346 11588 ----
NM_018155chr312335 12275 ----
NM_018181chr182333 112 21792 1563 ----
NM_018182chr1721575 28 12099 ----
NM_018195chr11--11882 1411 1821
NM_018211chr121944 138 2330 169 ----
NM_018225chr945328 4791 4509 535 15225 11826 --
NM_018243chr443989 3397 3342 760 --1269 11129
NM_018293chr33573 302 260 22931 1951 1738 --
NM_018297chr3------132
NM_018299chr862648 656 371 358 188 110 1315 ----
NM_018315chr41253 41604 1510 464 414 1136 --
NM_018317chr4--2313 219 124 --
NM_018327chr2011280 11878 --1281
NM_018334chr71343 ------
NM_018364chr133828 2886 1494 12906 --1254
NM_018372chr11562 --1523 --
NM_018373chr1435342 4145 1922 22317 1643 2812 315 --
NM_018374chr723838 3578 35238 5139 3933 ----
NM_018387chr91379 ------
NM_018388chrX21114 272 1444 ----
NM_018394chr31373 ------
NM_018403chr383986 3757 3312 1415 1192 648 632 465 --13008 --
NM_018424chr921722 588 --11584 --
NM_018427chr1621334 1248 --1336 --
NM_018429chr562851 2134 961 809 701 670 ------
NM_018439chr181764 1713 1261 --
NM_018442chr11254 ------
NM_018448chr1241276 522 450 242 1814 ----
NM_018462chr32237 103 ------
NM_018469chr1721139 380 11394 --1311
NM_018475chr41687 1171 ----
NM_018490chr111273 ------
NM_018566chr144177 3497 1857 78 ------
NM_018569chr4--11186 --11594
NM_018571chr21596 --1503 --
NM_018584chr1----2393 49 --
NM_018593chr6--1757 ----
NM_018638chr1245118 4105 1950 1660 15690 ----
NM_018650chr111568 2776 129 ----
NM_018695chr542336 2270 1519 980 2936 646 21713 332 --
NM_018698chrX21794 690 31820 1740 1595 ----
NM_018700chr511334 11566 ----
NM_018723chr16169 ------
NM_018841chr142484 837 224 90 --11072 --
NM_018896chr171265 ------
NM_018945chr642736 2340 421 82 --13032 1343
NM_018948chr11536 ------
NM_018958chr1542579 2551 521 436 --1241 --
NM_018970chr722355 144 22265 2083 32574 757 125 --
NM_018976chr1212046 12608 11030 --
NM_018999chr1044400 3879 1537 658 14623 ----
NM_019027chr422289 1836 11622 ----
NM_019046chr10----1788 125
NM_019049chr12119 84 1519 ----
NM_019050chr41545 ------
NM_019063chr212131 --167 --
NM_019072chr51846 23498 2927 --14295
NM_019084chr1022049 759 ------
NM_019091chr21256 ------
NM_019590chr10187 11048 ----
NM_019593chr20--1117 --13222
NM_019596chr213947 246 49 ----1730
NM_019610chr1--11465 ----
NM_020123chr1021229 150 ------
NM_020126chr19--1609 ----
NM_020144chr741462 565 440 358 12142 11531 --
NM_020159chr4--1286 ----
NM_020177chr563129 3123 2237 1148 581 223 --145 --
NM_020180chr183863 305 188 ------
NM_020182chr2063626 3601 3233 1186 519 392 198 ----
NM_020193chr1111057 ------
NM_020198chr1721562 112 ----11252
NM_020199chr52984 83 ------
NM_020205chr133271 2858 1258 1854 ----
NM_020235chr31287 ------
NM_020248chr142017 922 879 577 12319 180 --
NM_020338chr1043713 2818 1158 889 1932 ----
NM_020341chr20--21485 437 1320 --
NM_020342chr222122 1966 ------
NM_020354chr10------1992
NM_020384chrX41895 1567 641 173 ------
NM_020390chr354193 3871 3175 1807 1361 13020 --13879
NM_020403chr1331204 1144 159 21804 1460 ----
NM_020440chr143049 2538 2060 686 22505 218 ----
NM_020443chr1106645 6209 5530 5453 4960 4868 2622 2245 1506 355 --16567 16818
NM_020455chr652741 1801 1791 352 230 ------
NM_020456chr1322203 472 --21961 1505 --
NM_020546chr542593 1934 969 536 --23023 2922 22875 302
NM_020647chr82780 550 --11988 --
NM_020650chr19------1405
NM_020654chr31280 1541 11046 --
NM_020666chr51834 ------
NM_020673chr2067199 6563 5928 5295 604 322 22477 165 ----
NM_020676chr32848 594 2794 740 ----
NM_020703chr1------1557
NM_020708chr2042249 2184 2081 580 22524 282 ----
NM_020717chrX54503 4045 3122 1864 1650 2624 216 24942 3786 --
NM_020718chr1636013 1968 1717 16605 21350 549 14319
NM_020732chr62880 496 ------
NM_020739chr1574023 3651 3543 3256 3110 569 349 ------
NM_020742chrX42742 2342 2109 49 11901 ----
NM_020744chr2--175 ----
NM_020747chr51953 1156 ----
NM_020748chr171395 2869 69 ----
NM_020749chr84701 625 575 121 ------
NM_020752chr1032909 2315 1033 32938 1781 169 22667 222 --
NM_020760chr221715 1300 1590 1375 --
NM_020766chrX44217 3990 2988 727 34173 3634 3256 31240 1233 178 --
NM_020772chr1772627 2475 2091 1384 182 96 36 16971 12826 1374
NM_020774chr181721 25286 710 36235 4786 4000 --
NM_020778chr1584277 3962 3633 3123 1970 372 267 35 11272 33712 1770 1280 --
NM_020781chr722075 573 1965 22258 1965 --
NM_020796chr552577 1146 631 609 198 12854 ----
NM_020801chr552486 1705 802 684 172 ------
NM_020804chr622031 902 --1226 --
NM_020808chr121064 172 --1250 --
NM_020810chr1463297 2463 2404 1391 1303 827 11221 12301 --
NM_020818chr141407 2414 45 ----
NM_020819chr61194 ------
NM_020830chr252584 2403 1319 935 925 13085 ----
NM_020841chr1222723 2632 ----1995
NM_020844chr837298 5054 243 --36883 921 764 --
NM_020845chr1262107 1982 1929 1862 1632 992 21810 1582 ----
NM_020850chr1663155 3032 3024 2482 222 75 --12159 --
NM_020856chr1931500 1363 1287 --11579 --
NM_020860chr441058 880 297 155 ------
NM_020866chr13----1384 --
NM_020872chr331704 1232 1150 ------
NM_020873chr3--2840 681 1648 --
NM_020899chr1742428 2235 289 280 11539 --12219
NM_020917chr1942992 2488 1548 753 13578 23949 3303 --
NM_020921chr1442394 2375 1290 105 12352 13423 --
NM_020935chr244463 4108 1710 869 1111 33588 1264 25 --
NM_020940chr1042510 795 732 299 ----1932
NM_020951chr19181 12275 ----
NM_020959chr19136 1275 ----
NM_021005chr1531078 1004 785 ------
NM_021032chr3--11925 ----
NM_021033chr1322801 166 23430 973 12732 --
NM_021072chr51385 --11711 --
NM_021076chr222162 74 2563 359 ----
NM_021104chr12--1259 ----
NM_021111chr911363 ------
NM_021116chr788855 8060 7987 7059 3072 1616 1285 492 26163 921 36503 5876 1673 13005
NM_021136chr14----153 --
NM_021137chr1712220 1700 --11688
NM_021183chrX52313 1819 1601 1018 779 12153 ----
NM_021191chr1222428 376 22247 988 ----
NM_021202chr2033039 2764 704 --12219 --
NM_021240chr9--1142 ----
NM_021620chr62659 182 ------
NM_021644chr101141 1885 ----
NM_021649chr511857 1440 ----
NM_021722chr71587 ------
NM_021723chr71628 ------
NM_021809chr2021878 455 ------
NM_021813chr635500 2055 597 23825 135 ----
NM_021814chr611120 ------
NM_021911chr544854 4405 4020 2138 1776 ----
NM_021912chr1543758 3331 3243 1330 --11076 --
NM_021914chr142755 720 2836 272 22362 481 --
NM_021935chr31125 ------
NM_021945chr682606 2571 2533 1341 839 716 315 40 22634 1213 1401 --
NM_021946chrX------1103
NM_021954chr1363207 2363 1195 368 335 312 23547 2551 ----
NM_021960chr122272 1827 1230 11106 --
NM_021961chr1136982 6742 5655 1842 ----
NM_021964chr325280 4771 14652 --26119 1040
NM_021977chr623438 621 22406 663 --11498
NM_022003chr1131051 527 99 1823 21043 943 --
NM_022041chr1632273 116 80 12416 --1387
NM_022048chr1585138 4665 4416 4306 4116 922 547 161 13984 ----
NM_022079chr102927 376 ------
NM_022080chr2022108 2031 22832 2152 22706 2508 --
NM_022114chr143971 2982 2958 449 14792 ----
NM_022143chr7134 ----1541
NM_022151chr142927 31 ------
NM_022160chr93427 372 152 ------
NM_022166chr1666236 5220 1550 1189 1004 338 --22206 944 --
NM_022351chr832600 2388 662 23106 1522 ----
NM_022366chr1198 ------
NM_022373chr71915 2807 227 ----
NM_022374chr2--1427 ----
NM_022451chr101839 ------
NM_022459chr1345853 4715 2356 1862 11132 12129 11199
NM_022465chr1242809 2703 1942 584 11969 ----
NM_022469chr152542 2289 2065 1071 900 22805 121 ----
NM_022476chr161903 ------
NM_022483chr53772 373 214 11545 ----
NM_022552chr2130 41117 402 389 376 ----
NM_022574chr741569 1335 518 42 11684 1778 --
NM_022648chr263979 3482 1435 961 727 131 11007 13876 12983
NM_022658chr12--1888 ----
NM_022726chr621627 1184 ------
NM_022728chr72764 573 1511 1607 --
NM_022737chr1911316 ------
NM_022763chr341049 739 478 472 ------
NM_022776chr331360 1195 222 1159 1322 1541
NM_022781chr962365 2358 1159 899 876 727 1787 12378 --
NM_022784chr152194 99 165 ----
NM_022826chr2157 ----11108
NM_022832chr452379 2334 2251 1698 166 ------
NM_022838chrX3216 118 50 ------
NM_022893chr212864 1326 1281 --
NM_022897chr52782 120 ------
NM_022898chr1433811 3082 1435 1221 ----
NM_022913chr51253 1285 ----
NM_022918chr1131556 675 275 --11483 --
NM_022977chrX------12469
NM_023009chr11728 ------
NM_023012chr121542 ------
NM_023079chr17--11905 ----
NM_023923chr12561 553 --12501 1964
NM_023927chr51507 1187 --1468
NM_023928chr12--11064 ----
NM_023929chr811016 ----12735
NM_024012chr721129 1036 ----11192
NM_024016chr171681 ------
NM_024052chr1732479 1091 989 12718 1762 --
NM_024060chr111282 ----1108
NM_024295chr821390 547 ------
NM_024345chr954422 4111 2073 216 201 25332 593 11800 --
NM_024524chr332516 1288 1051 ------
NM_024548chr311748 --21248 699 --
NM_024556chr11--1109 ----
NM_024582chr441105 1073 743 249 ------
NM_024594chr551664 1559 441 221 153 --1486 --
NM_024607chr854115 1636 710 241 93 --23453 1210 --
NM_024613chr821709 1299 1440 ----
NM_024631chr111449 ------
NM_024639chr662775 2559 1172 1165 1051 952 ------
NM_024645chr811216 21625 1297 --11282
NM_024664chr1--1455 ----
NM_024665chr341498 980 821 453 13785 --13757
NM_024689chrX41224 1145 386 189 11333 11454 --
NM_024692chr211408 ------
NM_024697chr3--131 ----
NM_024740chr1183938 3756 3671 3629 1607 1006 456 86 ------
NM_024749chr12375 151 22317 407 1643 --
NM_024757chr911011 ------
NM_024778chrX--183 ----
NM_024852chr11198 ------
NM_024854chr1221433 430 ------
NM_024887chr11813 11975 1759 11745
NM_024911chr11273 ------
NM_024915chr852796 2148 2134 1797 610 ------
NM_024930chr51305 12553 ----
NM_024947chr349513 6452 2164 707 12253 29414 3638 --
NM_024948chr102299 67 ------
NM_024949chr434072 3077 104 13438 1411 --
NM_024953chr124573 330 71 37 ----1251
NM_024991chr1032942 2600 616 31139 1118 406 12166 --
NM_024993chr221002 502 --11273 --
NM_025027chr192835 742 ------
NM_025047chr33415 382 202 ------
NM_025054chr821303 399 --13241 --
NM_025074chr442225 2026 1149 917 ------
NM_025077chr11191 ------
NM_025099chr1711077 --21280 184 --
NM_025113chr13------11127
NM_025133chr2137 --1172 --
NM_025134chr1642447 2122 1730 418 1408 ----
NM_025135chr181344 1461 ----
NM_025160chr124080 1417 ------
NM_025182chr91382 ------
NM_025191chr163390 2906 2800 776 255 237 ------
NM_025203chr211361 --11061 --
NM_025208chr111803 12067 12417 --
NM_025222chr352735 2175 755 420 205 ----12513
NM_025233chr171285 ------
NM_025239chr91387 1151 ----
NM_025244chr21102 ------
NM_030627chr553402 1569 1164 609 278 1405 ----
NM_030647chr744739 4336 4093 503 1175 ----
NM_030648chr495033 3642 1699 1287 1183 888 879 870 501 33501 202 131 14469 --
NM_030650chr223713 3461 --13303 14268
NM_030670chr1252353 2154 2022 2011 548 --2915 624 1234
NM_030671chr1252353 2154 2022 2011 548 --2915 624 1234
NM_030674chr1254673 4621 3924 772 597 --15120 --
NM_030751chr1031284 275 268 1309 ----
NM_030751chr1031284 275 268 1309 ----
NM_030755chr1411950 23103 244 ----
NM_030761chr13479 162 27 21024 327 ----
NM_030763chrX1882 --133 --
NM_030780chr82384 302 ----142
NM_030791chr1411461 ------
NM_030805chr241134 1087 857 218 --1401 --
NM_030806chr1138962 8009 7912 7415 7373 6736 6718 6057 5939 5860 3119 2420 667 21722 278 29204 6660 --
NM_030816chr13621 590 500 --13139 --
NM_030918chr155444 4490 3727 3389 2140 45084 4642 3937 3919 ----
NM_030920chr131435 567 44 ------
NM_030934chr1--11832 ----
NM_030953chr5----11526 --
NM_030963chr61548 ------
NM_030979chr131396 ------
NM_031157chr121602 ------
NM_031243chr722120 1922 --165 --
NM_031262chr92307 212 1340 --1823
NM_031263chr92364 269 1397 --1880
NM_031267chr71559 1368 --170
NM_031268chr1654461 1444 1327 610 131 1195 --14090
NM_031283chr2------1130
NM_031291chr4--1126 ----
NM_031296chr4--22344 2099 ----
NM_031309chr852278 254 180 113 41 11986 1461 --
NM_031314chr1431668 1592 383 1488 ----
NM_031371chr12549 236 1198 11311 --
NM_031371chr12549 236 1198 11311 --
NM_031419chr3130 --1254 --
NM_031427chr1431960 1130 743 --31783 1065 459 --
NM_031435chr1221168 111 11201 ----
NM_031442chrX32051 585 363 2796 775 ----
NM_031461chr8275 47 ------
NM_031468chr778255 7906 7218 5091 2829 2660 1722 1242 37359 4997 1709 11905
NM_031483chr2041296 863 378 371 12899 33414 3005 833 --
NM_031844chr113759 22864 1047 13440 --
NM_031845chr222985 198 1988 ----
NM_031847chr222985 198 1988 ----
NM_031954chr1232818 2245 327 1125 12915 --
NM_032012chr965152 5036 4680 4006 3424 808 --21514 732 --
NM_032102chr113324 77 25 ----12276
NM_032105chr157577 5421 4943 1613 1286 15602 37156 4964 974 17495
NM_032119chr51309 ------
NM_032147chr122927 175 ----1700
NM_032154chr1021040 743 1869 ----
NM_032160chr1824293 4181 23384 2974 ----
NM_032186chr111095 ------
NM_032189chr1344868 1805 1722 628 15059 1879 --
NM_032199chr1033664 3544 2996 --11497 11065
NM_032228chr1143568 1424 693 148 --12436 --
NM_032229chr131192 ------
NM_032236chr121057 1041 ------
NM_032281chr1942633 2537 855 105 32650 1999 1964 23132 40 --
NM_032373chr1035429 726 577 --25560 1724 --
NM_032434chr211605 ------
NM_032435chr131764 1563 1554 21678 467 ----
NM_032438chr62509 115 ------
NM_032439chr1031466 1394 425 11234 ----
NM_032440chr1042894 2887 2509 1128 22048 948 ----
NM_032445chr1551980 1869 1705 718 680 --22549 2238 11842
NM_032446chr522447 113 13888 13468 --
NM_032457chr442933 1328 1067 504 11513 ----
NM_032466chr811662 31719 1378 356 ----
NM_032468chr811662 31719 1378 356 ----
NM_032471chr62117 89 --199 --
NM_032505chr311015 --1402 1390
NM_032538chr612730 ------
NM_032548chr3------1425
NM_032560chr141899 ------
NM_032576chrY----1145 --
NM_032590chr122981 363 ------
NM_032594chr142954 918 ------
NM_032611chr8------1463
NM_032632chr142332 210 ------
NM_032663chr1221566 775 12068 11430 1438
NM_032664chr831498 1099 436 ----11565
NM_032682chr353335 2528 2368 979 322 11057 11108 --
NM_032689chr1931483 1455 1265 21095 359 ----
NM_032717chr431053 1007 188 ----1670
NM_032727chr1011645 ------
NM_032778chr362412 2312 1178 1126 519 472 ------
NM_032784chr6--1283 ----
NM_032804chr1042248 143 124 107 12592 1668 --
NM_032833chr142494 1958 146 77 ------
NM_032858chr1136 ------
NM_032859chr1323686 484 23990 2813 ----
NM_032873chr1133647 1452 964 1944 ----
NM_032876chr1441509 1487 658 207 11611 ----
NM_032932chr1785729 5619 4991 2035 1210 838 767 747 --1196 11032
NM_032968chrX43962 1648 877 313 23909 725 ----
NM_032969chrX43962 1648 877 313 23909 725 ----
NM_032973chrY43954 1642 877 313 33901 2837 725 ----
NM_033020chr134264 1013 690 13677 ----
NM_033027chr3182 ------
NM_033044chr11202 11190 ----
NM_033055chr11862 ------
NM_033083chr323456 1043 --12498 --
NM_033121chr1251428 1150 741 400 109 --11577 1117
NM_033132chr131335 22328 734 ----
NM_033133chr1763421 3284 3194 2431 1398 1131 --1746 --
NM_033135chr111803 12067 12417 --
NM_033138chr72460 453 1503 11925 --
NM_033139chr72460 453 1503 11925 --
NM_033140chr72460 453 1503 11925 --
NM_033143chr464470 3333 1574 1494 1185 58 24653 1794 ----
NM_033157chr72460 453 1503 11925 --
NM_033181chr643735 3306 1440 844 --33715 1488 22 --
NM_033211chr522014 1640 --11305 --
NM_033224chr787733 6160 2717 2150 2089 1584 1073 135 18089 15334 12305
NM_033227chr51163 1596 ----
NM_033228chr51203 1636 ----
NM_033285chr854267 3805 3760 2893 1637 ------
NM_033331chr941340 930 326 54 --12681 --
NM_033360chr1224366 760 ------
NM_033364chr351948 1665 1588 649 619 ------
NM_033393chr432918 1119 742 --2485 81 --
NM_033394chr221119 366 ------
NM_033407chr11536 ----1197
NM_033426chr1442309 806 381 359 --11845 22070 1147
NM_033429chr1552848 2798 2762 532 417 2513 148 22606 687 --
NM_033480chr642306 2143 1062 572 --1741 --
NM_033481chr642306 2143 1062 572 --1741 --
NM_033495chrX1950 1879 1189 --
NM_033535chr421130 1025 ------
NM_033631chr183745 3668 3120 2542 2526 2433 937 370 11153 12968 --
NM_033632chr41253 41604 1510 464 414 1136 --
NM_033637chr1033267 1620 770 295 86 23348 843 --
NM_033642chrX131 ------
NM_033644chr532572 2017 720 ------
NM_033645chr532572 2017 720 ------
NM_033646chr18142 ------
NM_033656chr2135262 1101 185 23732 2229 14285 1330
NM_044472chr11163 ------
NM_052832chr812844 13010 ----
NM_052857chr171173 ------
NM_052873chr14--1147 ----
NM_052885chr1223998 771 --1340 --
NM_052886chr812122 1754 ----
NM_052900chr8--11638 ----
NM_052905chr231836 685 220 ------
NM_052906chr2284404 3870 3771 1650 1379 1237 1015 491 15094 33781 1482 865 --
NM_052907chr1244095 1725 1127 77 --34296 3975 1044 --
NM_052911chr182760 265 ----1115
NM_052927chr521668 483 1216 ----
NM_052937chr82252 142 1520 1506 --
NM_053016chr967972 7539 6154 1111 82 32 12743 26850 6676 --
NM_053024chr321059 517 --1506 --
NM_053064chr1422913 2010 12567 11012 1627
NM_053279chr852770 2229 582 501 123 22513 685 ----
NM_054016chr13303 204 132 --1746 --
NM_054016chr13303 204 132 --1746 --
NM_054016chr13303 204 132 --1746 --
NM_057169chr1222980 2253 33158 810 437 ----
NM_057170chr1222980 2253 33158 810 437 ----
NM_057175chr421904 688 ------
NM_058172chr41223 2333 324 11335 --
NM_080546chr92622 243 11708 ----
NM_080591chr962576 2264 2143 862 718 301 --1805 --
NM_080617chr2031041 343 239 ------
NM_080655chr9185 ------
NM_080670chr52315 140 2905 104 1271 1369
NM_080738chr161911 1892 1692 490 466 390 ----11774
NM_080743chr61718 --21879 1023 --
NM_080759chr1321651 724 ------
NM_080760chr1321651 724 ------
NM_080798chr101444 ------
NM_080799chr101444 ------
NM_080800chr101444 ------
NM_080801chr101444 ------
NM_080802chr101444 ------
NM_080803chr101444 ------
NM_080804chr101444 ------
NM_080805chr101444 ------
NM_080806chr101444 ------
NM_080807chr101444 ------
NM_080808chr101444 ------
NM_080809chr101444 ------
NM_080810chr101444 ------
NM_080811chr101444 ------
NM_080812chr101444 ------
NM_080813chr101444 ------
NM_080814chr101444 ------
NM_080815chr101444 ------
NM_080821chr2032128 1826 939 12155 ----
NM_080836chr2094246 4049 4007 1760 1705 1474 1389 806 146 13619 11679 --
NM_080867chr1434268 3525 986 1573 11256 --
NM_100264chr101266 ------
NM_100486chr101266 ------
NM_101395chr2162907 2428 646 407 398 254 11342 1189 --
NM_130391chr911415 11244 ----
NM_130392chr911415 11244 ----
NM_130393chr911415 11244 ----
NM_130434chr1531124 233 113 ------
NM_130437chr2162866 2387 605 366 357 213 11301 1148 --
NM_130438chr2162816 2337 555 316 307 163 11251 198 --
NM_130838chr151679 --11705 --
NM_130839chr151679 --11705 --
NM_133170chr2068064 5415 3087 1667 1494 1018 12197 14980 12263
NM_133372chr51346 32953 2715 231 ----
NM_133378chr21679 1992 ----
NM_133432chr21679 1992 ----
NM_133437chr21679 1992 ----
NM_133445chr942569 758 404 157 12563 23280 699 11242
NM_133478chr21636 --42016 987 821 509 --
NM_133486chrX1301 1473 ----
NM_133503chr121680 ------
NM_133504chr121680 ------
NM_133505chr121680 ------
NM_133506chr121680 ------
NM_133507chr121858 ------
NM_133510chr14----1134 --
NM_133631chr311127 ------
NM_133638chr5137 ------
NM_133646chr244317 3732 3394 454 15600 14225 --
NM_133647chr1573797 3779 3390 3189 2445 1527 690 ------
NM_134447chr191167 ----1122
NM_138270chrX32930 1186 590 1277 ----
NM_138288chr1411937 12241 ----
NM_138316chr1011184 11035 --1882
NM_138426chr742116 1931 1657 537 ------
NM_138444chr1311628 23283 1600 1800 --
NM_138448chr2121 ------
NM_138459chr642892 2345 1219 1011 13586 ----
NM_138473chr1244738 4577 3851 821 33515 3124 1786 --14854
NM_138576chr1433811 3082 1435 1221 ----
NM_138633chr6----1588 11607
NM_138638chr142755 720 2836 272 22362 481 --
NM_138713chr1675788 5690 2938 2873 2334 2268 976 --1539 --
NM_138714chr1675788 5690 2938 2873 2334 2268 976 --1539 --
NM_138730chr6--1357 ----
NM_138731chr1433822 3488 1623 --13921 --
NM_138735chr211387 ------
NM_138771chr7192 11366 ----
NM_138782chr541940 1785 1712 1668 ------
NM_138811chr7--11108 --1216
NM_138927chr212898 235 ------
NM_138966chr18--2601 578 ----
NM_138967chr1542474 2242 1515 482 ------
NM_138970chr14--22439 924 ----
NM_138971chr1132723 2351 1367 --1918 13649
NM_138971chr1132723 2351 1367 --1918 13649
NM_138972chr1132723 2351 1367 --1918 13649
NM_138972chr1132723 2351 1367 --1918 13649
NM_138973chr1132723 2351 1367 --1918 13649
NM_138973chr1132723 2351 1367 --1918 13649
NM_139045chr92307 197 ------
NM_139072chr21597 ------
NM_139131chr112447 103 ------
NM_139215chr17--1269 ----
NM_139242chr152589 478 11537 ----
NM_139244chr6------1397
NM_139246chr942275 1941 809 131 21806 1551 11669 --
NM_139279chr243300 2604 992 104 11264 --1387
NM_139319chr1231326 1276 127 1523 ----
NM_139321chr2073168 2835 1693 1563 971 897 500 ----11385
NM_144571chr486849 5785 5352 2614 2239 1340 614 379 ----17024
NM_144574chr141556 ------
NM_144578chr1475381 5163 5108 4462 4265 4047 893 24442 860 ----
NM_144590chr1022612 1950 --22745 357 22020 1195
NM_144595chr1321011 195 ------
NM_144599chr1551466 1346 1000 993 119 24336 2025 ----
NM_144600chr1631674 1397 1219 ----1593
NM_144633chr331377 1041 22 ----1253
NM_144660chr10--1418 ----
NM_144664chr113340 298 244 1306 ----
NM_144703chr2051055 936 753 398 211 ------
NM_144709chr21153 ------
NM_144723chr51637 ------
NM_144778chr1322649 2047 2532 400 12625 --
NM_144967chrX----1893 11017
NM_144973chr12199 11372 33379 1879 1183 24200 1223
NM_144992chr22541 438 ------
NM_145049chr51173 ----1792
NM_145055chr1822994 1239 2952 672 ----
NM_145117chr1123046 2687 ------
NM_145251chr142178 152 1298 ----
NM_145259chr244623 2122 615 225 25993 2628 1138 26685 5369
NM_145263chr441962 1855 1667 115 12388 11805 --
NM_145307chr1022839 1192 --11534 --
NM_145686chr241214 472 368 99 1890 ----
NM_145687chr241214 472 368 99 1890 ----
NM_145693chr241982 1971 777 768 12589 ----
NM_145716chr1--1181 ----
NM_145733chr221337 1766 ----
NM_145753chr3------141
NM_145808chr732828 1909 299 ------
NM_145861chr161911 1892 1692 490 466 390 ----11774
NM_145912chr22103612 3605 3569 1837 1452 1085 516 389 347 52 --14159 --
NM_147150chr932414 455 140 23855 3582 --2918 817
NM_147164chr91557 ------
NM_148174chr822166 1965 2546 263 --1114
NM_148977chr1011184 11035 --1882
NM_148978chr1011184 11035 --1882
NM_152253chr22104017 3740 2981 2788 1563 1450 874 437 267 175 --14078 --
NM_152263chr125471 5442 13703 34566 1674 1220 16108
NM_152272chr821137 978 ------
NM_152275chr242375 1907 1819 259 2535 245 ----
NM_152277chr521851 1617 ----1706
NM_152284chr82949 713 ------
NM_152287chr164989 688 584 399 1285 12205 --
NM_152309chr1022191 2126 ------
NM_152317chr12299 28 ------
NM_152330chr1472528 2333 1631 853 713 337 30 1591 11769 --
NM_152332chr1412819 2928 216 ----
NM_152380chr12331 34 ----21570 1165
NM_152381chr23683 147 29 11410 1284 --
NM_152400chr451796 1617 653 342 287 ----11341
NM_152409chr52465 221 ------
NM_152424chrX11723 14702 ----
NM_152446chr141985 1608 --1978
NM_152467chr17--137 ----
NM_152519chr22499 177 --1699 --
NM_152523chr21551 1188 ----
NM_152524chr21194 ------
NM_152529chr244341 3688 609 94 13024 23317 1286 --
NM_152536chr31442 21205 29 ----
NM_152553chr6----142 --
NM_152556chr7--21637 1598 ----
NM_152581chrX41264 354 126 58 ------
NM_152594chr1532245 832 85 --11877 --
NM_152608chr111718 ------
NM_152622chr522825 34 ----12296
NM_152624chr531082 938 112 26151 369 15572 15756
NM_152625chr51329 ------
NM_152629chr943854 3357 2649 1232 ------
NM_152641chr12--22781 2218 ----
NM_152666chr11787 ------
NM_152695chrX42148 2041 269 67 11899 --12138
NM_152707chr1041009 853 693 407 ------
NM_152723chr112886 115 ----1759
NM_152724chr1032334 1874 1003 11821 22447 2281 --
NM_152745chr7--1867 ----
NM_152756chr544156 1422 1046 543 13190 --194
NM_152758chr832143 2038 622 12732 ----
NM_152765chr832304 2093 932 --1181 --
NM_152785chr352024 1906 1873 844 224 ------
NM_152787chrX23203 723 23799 1476 12737 --
NM_152789chr7----11370 --
NM_152890chr121107 352 ------
NM_152903chr1312327 --11823 1328
NM_152924chr1524936 157 22103 848 24902 2340 15642
NM_152998chr7172 1213 ----
NM_152999chr734505 3336 739 24716 3394 14441 --
NM_153013chr532050 2036 250 ------
NM_153020chr631479 671 403 1273 ----
NM_153035chr11376 --13253 --
NM_153181chr18--2601 578 ----
NM_153182chr362412 2312 1178 1126 519 472 ------
NM_153184chr331931 1759 409 ------
NM_153188chr514484 25304 1885 ----
NM_153207chr1222672 271 13880 ----
NM_153235chr61342 11493 12060 21714 242
NM_153260chr1521421 1344 --31178 331 238 --
NM_153262chr142952 2130 1965 365 --138 --
NM_153333chrX2620 526 ------
NM_153498chr101320 ------
NM_153619chr1533359 2710 309 11414 11382 --
NM_153633chr12--1758 ----
NM_153634chr124495 474 194 87 ------
NM_153645chr2211140 23321 3116 ----
NM_153687chr1221306 1165 ------
NM_153689chr22306 156 --1742 --
NM_153759chr2130 41117 402 389 376 ----
NM_153810chr1024806 3474 13255 21724 1309 --
NM_170606chr7----11361 --
NM_170665chr1264457 3903 3826 2856 1498 768 13545 22819 344 14572
NM_170674chr1521068 466 21176 483 ----
NM_170675chr152744 142 2852 159 ----
NM_170676chr152744 142 2852 159 ----
NM_170677chr1521068 466 21176 483 ----
NM_170686chr722075 573 1965 22258 1965 --
NM_170695chr181317 ------
NM_170696chr15--21751 1685 11427 --
NM_170697chr15--21751 1685 11427 --
NM_170706chr144293 3400 1310 767 1786 123 --
NM_170709chr832340 1842 591 21612 898 --1856
NM_170750chrX--1861 ----
NM_172027chr3------1425
NM_172028chr3------1425
NM_172058chr8----11496 --
NM_172059chr8----11496 --
NM_172060chr8----11496 --
NM_172071chr135331 970 132 1551 27171 2162 --
NM_172315chr1521068 466 21176 483 ----
NM_172316chr1521068 466 21176 483 ----
NM_173060chr541287 717 596 308 --21927 89 11461
NM_173061chr541287 717 596 308 --21927 89 11461
NM_173063chr541287 717 596 308 --21927 89 11461
NM_173078chrX--1441 ----
NM_173156chr141913 1906 1619 92 1176 11787 --
NM_173171chr231007 894 387 ------
NM_173173chr231007 894 387 ------
NM_173207chr181317 ------
NM_173208chr181317 ------
NM_173209chr181317 ------
NM_173210chr181317 ------
NM_173211chr181317 ------
NM_173214chr1675788 5690 2938 2873 2334 2268 976 --1539 --
NM_173354chr2172060 2054 1760 1341 884 856 111 146 ----
NM_173468chr452403 2008 1753 1291 490 14747 --12225
NM_173469chr1531530 373 333 ------
NM_173470chrX52866 2484 1914 669 397 ------
NM_173473chr1022610 973 32533 2319 34 22245 599 1156
NM_173500chr151121 ----1182
NM_173511chr222661 673 ------
NM_173519chr841974 1786 750 728 --11819 --
NM_173552chr3--12257 --12317
NM_173576chr1032211 1625 1512 --11996 --
NM_173595chr1254626 4102 520 450 228 1626 15098 15046
NM_173631chr191848 --11155 --
NM_173642chr159066 5999 5837 5781 3191 17517 29018 1699 --
NM_173694chrX42469 2331 1998 128 ------
NM_173797chr51839 11354 ----
NM_173807chr1122 ------
NM_173808chr144027 1087 958 383 23067 1643 ----
NM_173822chr221854 1376 1160 ----
NM_173825chr332217 942 657 ------
NM_173829chr535112 4401 1955 24766 95 23841 155 --
NM_173832chr8143504 3312 3232 3183 3142 3093 2969 2877 2765 2453 1438 1077 820 389 --33069 3044 3019 --
NM_173851chr853744 2579 1570 1154 265 1929 1288 1597
NM_173854chr132302 1725 457 ------
NM_174886chr181317 ------
NM_174887chr17--1378 ----
NM_174911chr842806 1541 1323 580 22793 617 12416 --
NM_174916chr1532279 1814 466 11533 ----
NM_174921chr421181 112 ------
NM_174963chr12895 49 2925 814 --2277 118
NM_174964chr12895 49 2925 814 --2277 118
NM_174965chr12914 68 2944 833 --2296 137
NM_174966chr12895 49 2925 814 --2277 118
NM_174967chr12914 68 2944 833 --2296 137
NM_174968chr12895 49 2925 814 --2277 118
NM_174969chr12895 49 2925 814 --2277 118
NM_174970chr12914 68 2944 833 --2296 137
NM_174971chr12895 49 2925 814 --2277 118
NM_175061chr722141 2114 11397 ----
NM_175607chr341499 1314 1154 43 --1368 --
NM_175612chr341499 1314 1154 43 --1368 --
NM_175624chr1287804 5840 5693 5120 2911 2478 1964 1421 --22469 2410 15490
NM_175625chr1287804 5840 5693 5120 2911 2478 1964 1421 --22469 2410 15490
NM_175629chr2130 41117 402 389 376 ----
NM_175733chr1131932 1902 87 --1446 11871
NM_175736chr1277350 7336 7310 6872 6226 5059 2569 17537 12467 --
NM_175863chr62880 496 ------
NM_176863chr17--11441 ----
NM_177422chr11198 ------
NM_177424chr111895 ------
NM_177947chrX2558 29 11700 ----
NM_177948chrX2558 29 11700 ----
NM_177985chr212307 ------
NM_177990chr20--21485 437 1320 --
NM_177996chr2053263 2426 1292 1231 90 2535 245 12359 --
NM_178140chr521113 166 12680 11786 --
NM_178151chrX97785 7769 7641 6240 6074 2543 1761 722 491 --37491 6482 241 --
NM_178152chrX97785 7769 7641 6240 6074 2543 1761 722 491 --37491 6482 241 --
NM_178153chrX97785 7769 7641 6240 6074 2543 1761 722 491 --37491 6482 241 --
NM_178161chr102219 107 ------
NM_178424chr51432 ------
NM_178426chr122248 44 --21455 274 --
NM_178438chr1--1267 ----
NM_178454chr13776 587 117 ------
NM_178517chr17----282 36 --
NM_178554chr353530 2945 2522 1004 464 13400 11292 --
NM_178565chr82351 125 ----1610
NM_178585chr473262 3234 3050 2398 2382 475 234 ------
NM_178586chr1431545 967 528 ----1129
NM_178587chr14--1106 ----
NM_178812chr8--170 ----
NM_178815chr102676 122 1237 181 --
NM_180989chr13--151 ----
NM_181302chr141556 ------
NM_181308chr141556 ------
NM_181332chrX42742 2342 2109 49 11901 ----
NM_181351chr11------1804
NM_181354chr8291 81 11560 2446 256 11152
NM_181356chr6141 128 ----
NM_181358chr143757 724 706 607 11122 ----
NM_181359chr162425 2080 937 561 192 45 ------
NM_181361chr311397 1134 ----
NM_181457chr22128 116 1101 ----
NM_181458chr22261 249 1234 ----
NM_181459chr2127 ------
NM_181460chr2274 62 147 ----
NM_181481chr1866975 5668 5565 5247 2038 1666 11061 15498 --
NM_181482chr1866975 5668 5565 5247 2038 1666 11061 15498 --
NM_181483chr1866975 5668 5565 5247 2038 1666 11061 15498 --
NM_181504chr564081 3407 2994 2594 1228 654 1512 ----
NM_181521chr1686864 5784 4773 4724 1746 1391 496 406 1311 11572 --
NM_181523chr564081 3407 2994 2594 1228 654 1512 ----
NM_181524chr564081 3407 2994 2594 1228 654 1512 ----
NM_181655chr171710 1795 --152
NM_181656chr173919 135 66 11004 124 1261
NM_181659chr2033251 747 677 1876 22423 181 --
NM_181659chr2033251 747 677 1876 22423 181 --
NM_181782chr62681 314 --11568 --
NM_181784chr22894 204 ----12359
NM_181794chr62117 89 --199 --
NM_181795chr62117 89 --199 --
NM_181836chr542544 2190 2117 691 --190 --
NM_181861chr1221836 517 --12547 --
NM_181868chr1221836 517 --12547 --
NM_181869chr1221921 602 --12632 --
NM_181897chr32644 147 --32180 2017 287 --
NM_182487chr943157 823 816 799 14423 133 --
NM_182492chr221301 ------
NM_182501chr262900 2691 2413 2043 870 428 11100 11288 --
NM_182515chr1945694 2412 2393 438 ------
NM_182526chr1453032 2814 1992 500 313 22743 89 42609 2293 428 206 22383 521
NM_182643chr822161 966 --1491 --
NM_182648chr141673 184 ----
NM_182664chr12198 131 --11854 --
NM_182666chr31222 ------
NM_182691chr7--21396 1362 11214 --
NM_182692chr7--21396 1362 11214 --
NM_182763chr122261 1816 1219 11095 --
NM_182767chr1261988 1725 560 506 391 97 11417 11932 --
NM_182789chr5--1247 ----
NM_182831chr16125 1455 3230 71 32 11678
NM_182835chr14176 ------
NM_182898chr766410 5213 5003 2328 1408 404 15279 15017 --
NM_182899chr766410 5213 5003 2328 1408 404 15279 15017 --
NM_182907chr6--1399 ----
NM_182911chr21102 ------
NM_182918chr211375 ------
NM_182920chr3156 ------
NM_182948chr112341 1175 12708 1582
NM_182964chr1123046 2687 ------
NM_182972chr122129 1080 ------
NM_182975chr111063 ------
NM_182977chr51843 ------
NM_183004chr1443825 3533 584 72 ------
NM_183043chr131724 --1920 --
NM_183044chr131724 --1920 --
NM_183078chr643882 2623 2606 711 --21526 552 --
NM_183227chr61507 ------
NM_183237chr3--1464 11095 --
NM_183323chr5--1247 ----
NM_183376chr15--22564 2069 1128 1416
NM_183380chr61827 ------
NM_183393chr31216 ------
NM_183394chr31216 ------
NM_183419chr81464 ------
NM_194071chr765268 2123 2066 2002 1844 549 14777 ----
NM_194247chr234003 1752 1239 11591 23836 3230 --
NM_194250chr2--1442 ----
NM_194278chr143913 878 153 --22571 2527 1451
NM_194285chr1121262 851 1465 ----
NM_194291chr822408 90 ----12690
NM_194328chr962365 2358 1159 899 876 727 1787 12378 --
NM_194329chr962365 2358 1159 899 876 727 1787 12378 --
NM_194330chr962365 2358 1159 899 876 727 1787 12378 --
NM_194332chr962365 2358 1159 899 876 727 1787 12378 --
NM_197941chr543012 2825 2424 1025 --12382 --
NM_197977chr91888 ------
NM_198066chr1422871 2818 ------
NM_198086chr1441509 1487 658 207 11611 ----
NM_198097chr71110 ------
NM_198120chr8160 1588 ----
NM_198123chr8--11638 ----
NM_198124chr8--11638 ----
NM_198128chr18--11769 ----
NM_198158chr322673 1943 32977 2777 2556 ----
NM_198159chr322673 1943 32977 2777 2556 ----
NM_198177chr322673 1943 32977 2777 2556 ----
NM_198178chr322673 1943 32977 2777 2556 ----
NM_198195chr3186 --1561 --
NM_198225chr10--11905 ----
NM_198240chr12160 ------
NM_198243chr151781 ------
NM_198261chr121542 ------
NM_198262chr121542 ------
NM_198267chr71616 ------
NM_198268chr143757 724 706 607 11122 ----
NM_198269chr143757 724 706 607 11122 ----
NM_198270chrX23393 760 ----12585
NM_198273chr542444 1099 865 460 ------
NM_198281chr432629 1368 1169 21066 984 ----
NM_198324chr1221316 532 ------
NM_198376chr171265 ------
NM_198377chr171265 ------
NM_198378chr171265 ------
NM_198379chr171265 ------
NM_198380chr171265 ------
NM_198382chr171265 ------
NM_198383chr171265 ------
NM_198384chr171265 ------
NM_198385chr171265 ------
NM_198386chr171265 ------
NM_198387chr171265 ------
NM_198388chr171265 ------
NM_198391chr2011181 --1570 --
NM_198395chr51832 ------
NM_198396chr171265 ------
NM_198402chr31326 ------
NM_198404chr131881 ----128
NM_198449chr51123 1442 ----
NM_198450chrX187 ------
NM_198467chr71129 ------
NM_198503chr121884 681 ------
NM_198507chr5--1147 ----
NM_198513chr811627 21410 388 ----
NM_198560chr323212 2546 --23756 2685 12948
NM_198567chr51532 ------
NM_198569chr662608 1668 1658 1074 219 97 ------
NM_198581chr267172 4657 2208 1170 1032 364 --1551 11269
NM_198597chr103828 735 80 --1314 --
NM_198679chr992321 2230 2188 2046 1996 681 340 215 49 --12244 --
NM_198793chr353395 3246 885 647 330 --1266 24089 1008
NM_198794chr1421468 1251 1293 ----
NM_198859chr345049 3592 3423 2049 ------
NM_198880chr31651 ------
NM_198900chr1277350 7336 7310 6872 6226 5059 2569 17537 12467 --
NM_198902chr15----1322 --
NM_198904chr5----12029 --
NM_198968chr1333767 1473 115 --1611 13350
NM_198995chr18--1409 ----
NM_199039chr411112 ------
NM_199051chr12279 138 ------
NM_199072chr7--12467 2692 514 --
NM_199169chr2063626 3601 3233 1186 519 392 198 ----
NM_199170chr2063626 3601 3233 1186 519 392 198 ----
NM_199171chr2063626 3601 3233 1186 519 392 198 ----
NM_199185chr5157 ------
NM_199245chr1261960 1781 844 626 313 187 12395 ----
NM_199246chr531202 884 455 ------
NM_199320chr442960 1992 632 534 12418 1514 11094
NM_199320chr442960 1992 632 534 12418 1514 11094
NM_199324chr433387 3018 613 12958 22715 1139 --
NM_199421chr1434268 3525 986 1573 11256 --
NM_199454chr143971 2982 2958 449 14792 ----
NM_199461chr1053525 2498 2205 826 278 --11361 --
NM_199462chr134690 3302 1468 14803 74376 4209 3657 3128 1994 951 360 --
NM_199478chrX11631 1129 ----
NM_199511chr3--1841 ----
NM_199512chr3--1841 ----
NM_201263chr151759 1356 844 803 514 ------
NM_201269chr111095 ------
NM_201413chr211144 --11014 --
NM_201414chr211144 --11014 --
NM_201521chr61418 ------
NM_201522chr61418 ------
NM_201523chr61418 ------
NM_201568chr141913 1906 1619 92 1176 11787 --
NM_201569chr141913 1906 1619 92 1176 11787 --
NM_201570chr1021261 150 ------
NM_201571chr1021261 150 ------
NM_201572chr1021261 150 ------
NM_201590chr1021261 150 ------
NM_201591chr42428 409 ------
NM_201592chr42428 409 ------
NM_201593chr1021261 150 ------
NM_201596chr1021261 150 ------
NM_201597chr1021261 150 ------
NM_201628chr173214 3208 2641 2294 2068 1202 892 13389 12286 12060
NM_201999chr41831 ------
NM_203301chr1431418 1236 495 11333 ----
NM_203327chr2043686 2944 1737 1654 24249 66 11249 13255
NM_203342chr143435 2835 2451 2228 12618 33079 2581 2432 13119
NM_203343chr143435 2835 2451 2228 12618 33079 2581 2432 13119
NM_203394chr1212267 12748 ----
NM_203403chr9--1276 ----
NM_203406chr532014 1985 467 ------
NM_203446chr2152096 822 536 368 174 1897 ----
NM_203458chr11217 1573 --11328
NM_203487chr1331204 1144 159 21804 1460 ----
NM_203499chr172639 59 ------
NM_203504chr422644 516 --21811 526 --
NM_203505chr422644 516 --21811 526 --
NM_205861chr11813 11975 1759 11745
NM_206594chr163666 3124 1116 923 768 699 1133 --11458
NM_206595chr163666 3124 1116 923 768 699 1133 --11458
NM_206852chr14----153 --
NM_206853chr643108 2546 888 566 24153 3207 13480 --
NM_206854chr644369 3807 2149 1827 25414 4468 14741 --
NM_206855chr635334 4772 185 26379 5433 15706 --
NM_206857chr14----153 --
NM_206866chr2142901 1027 318 53 23132 1050 22462 833 --
NM_206876chr222986 1325 23418 1245 22311 885 --
NM_206907chr542653 2588 2254 466 132 ----
NM_206909chr866580 6202 5541 3135 790 538 27193 6824 --28312 767
NM_207009chr102703 248 ------
NM_207012chr1053523 3280 2713 2555 285 --43257 2751 2595 1217 --
NM_207111chr772502 2491 1795 787 754 364 26 --22092 594 11899
NM_207116chr772502 2491 1795 787 754 364 26 --22092 594 11899
NM_207291chr19--1537 ----
NM_207304chr1322536 1934 2419 287 12512 --
NM_207317chr51386 1457 ----
NM_207371chr1011269 ------
NM_207406chr411768 25151 1999 34403 2211 558 13954
NM_207435chr1231105 728 284 ------
NM_207517chr1521766 1728 ----11422
NM_213589chr234748 3897 626 11850 ----
NM_213651chr11691 ----1132