TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-744-5p
miRNA Sequence: UGCGGGGCUAGGGCUAACAGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1251882 447 420 367 185 ------
NM_000037chr8102304 2282 2264 2240 2171 2019 1952 1865 1839 1613 12250 41818 1706 1697 1607 --
NM_000053chr131571 1564 1198 1144
NM_000068chr193586 452 50 2532 150 1605 --
NM_000076chr11272 26 ------
NM_000081chr111232 ----1249
NM_000084chrX36695 5377 4484 ------
NM_000088chr171533 ------
NM_000092chr233663 3033 2850 ------
NM_000109chrX--1112 ----
NM_000114chr20------1872
NM_000115chr132988 217 ------
NM_000125chr683705 2894 1453 1241 1193 1007 989 38 23338 1172 21458 1129 --
NM_000165chr61473 1304 ----
NM_000168chr713240 --1278 --
NM_000178chr201252 ------
NM_000188chr10----1218 --
NM_000216chrX1339 ------
NM_000238chr72275 89 --176 --
NM_000244chr114634 580 495 133 --2609 43 --
NM_000248chr312344 ------
NM_000259chr1545715 4964 3862 2406 ----15008
NM_000260chr111493 176 ----
NM_000264chr952068 1328 1122 306 110 ------
NM_000278chr10162010 1991 1812 1791 1736 1632 1599 603 586 444 431 348 328 307 257 60 21744 149 51843 1838 1804 813 240 31882 1849 900
NM_000287chr62281 26 --1321 --
NM_000314chr1022905 2662 ------
NM_000325chr4153 ------
NM_000330chrX51511 737 560 486 344 ------
NM_000332chr644987 790 348 326 ------
NM_000337chr546503 1994 1285 252 ----11630
NM_000347chr14--167 142 --
NM_000363chr19123 ------
NM_000368chr924695 1500 1232 ----
NM_000376chr1282689 2540 2395 995 795 681 514 98 --22647 406 --
NM_000378chr111216 --1189 --
NM_000398chr223122 95 49 --2326 34 --
NM_000399chr102289 40 ------
NM_000404chr3--2148 140 ----
NM_000411chr2122780 2158 22817 2269 ----
NM_000425chrX2591 111 ------
NM_000430chr1733042 2974 2404 --23056 3034 --
NM_000439chr5152 ------
NM_000445chr85872 849 636 376 21 --1198 --
NM_000461chr344380 3330 3219 3155 --11209 --
NM_000476chr971409 1240 1065 459 383 92 46 1334 297 36 --
NM_000480chr1111586 ------
NM_000523chr21101 ----1964
NM_000526chr172101 38 ------
NM_000530chr14418 283 254 113 --3293 288 219 --
NM_000537chr13161 137 39 1146 128 --
NM_000546chr172142 59 ------
NM_000555chrX47005 5751 4855 315 27666 7300 ----
NM_000599chr283760 3665 3563 3308 3140 1155 420 48 ------
NM_000609chr1032908 2380 86 ----1696
NM_000618chr1236350 5585 291 ------
NM_000618chr1236350 5585 291 ------
NM_000633chr1864237 3202 1956 1253 789 505 13219 ----
NM_000665chr72177 27 --132 --
NM_000671chr42418 90 ------
NM_000678chr204310 252 199 85 ------
NM_000682chr261739 1444 1387 723 104 54 21411 760 2690 66 --
NM_000704chr19--129 ----
NM_000719chr1276194 6071 562 310 286 267 223 --46548 665 424 399 --
NM_000722chr7143 --160 --
NM_000723chr1751615 1511 1426 1092 480 ------
NM_000725chr1231002 648 121 ----1806
NM_000738chr114758 648 224 155 1845 2867 91 --
NM_000757chr13845 630 245 --1667 --
NM_000795chr114808 726 217 44 1434 11011 2746 129
NM_000800chr511143 1180 --1433
NM_000811chr51540 ------
NM_000814chr15----13127 --
NM_000829chr1122135 63 ------
NM_000831chr165791 5537 4443 3915 3899 2178 184 --1328
NM_000832chr910802 729 723 680 562 555 256 239 163 142 1341 --1686
NM_000836chr193748 314 121 --1692 --
NM_000837chr84481 217 211 54 ------
NM_000842chr11150 ------
NM_000845chr71429 ------
NM_000875chr1596262 1927 1481 975 903 869 848 723 213 --1853 --
NM_000883chr73559 492 214 1180 1258 --
NM_000883chr73559 492 214 1180 1258 --
NM_000901chr41548 ------
NM_000909chr4124 ------
NM_000918chr173597 325 169 --188 --
NM_000924chr1231363 1341 1239 ------
NM_000935chr311077 ------
NM_000939chr2169 --174 --
NM_000942chr15145 ------
NM_000944chr411666 ------
NM_000960chr194534 493 260 32 ------
NM_000961chr2043030 1355 1258 123 ------
NM_000964chr1781304 1218 928 476 416 285 37 30 31274 1237 79 189 --
NM_000966chr1261052 816 320 202 194 22 --1216 --
NM_001001132chr2121281 1147 11035 ----
NM_001001323chr121652 ------
NM_001001331chr321045 43 1325 ----
NM_001001394chr2--1277 ----
NM_001001438chr213253 122 73 ------
NM_001001481chr8--22621 962 ----
NM_001001502chr54547 454 380 49 --2233 54 --
NM_001001521chr2--1107 ----
NM_001001522chr112103 61 ------
NM_001001549chr732153 974 339 --22230 825 12270
NM_001001550chr732153 974 339 --22230 825 12270
NM_001001555chr732153 974 339 --22230 825 12270
NM_001001557chr81700 ------
NM_001001560chr223546 184 171 --1178 --
NM_001001664chr224035 1214 --12616 --
NM_001001890chr2151361 465 226 218 101 --130 --
NM_001001971chr101960 ------
NM_001001974chr101539 ------
NM_001002031chr12133 --149 --
NM_001002259chr12----1217 --
NM_001002762chr1072833 2812 2095 620 408 252 81 22739 59 1954 --
NM_001002814chr843115 2635 1451 100 ------
NM_001003652chr1838665 5478 3408 --12321 --
NM_001003694chr32438 34 ------
NM_001003712chr1211386 ------
NM_001003800chr931420 1391 598 21467 400 21317 305 --
NM_001003845chr21581 ------
NM_001004051chrX2275 50 ------
NM_001004304chr1283039 2706 2549 2498 2405 2287 2084 860 12095 ----
NM_001004329chr121258 ------
NM_001004354chr96866 791 772 182 140 61 --5412 254 163 98 31 --
NM_001004356chr451419 1116 1104 1092 1051 ----11505
NM_001004358chr451419 1116 1104 1092 1051 ----11505
NM_001004722chr24452 262 249 179 ----1165
NM_001005158chr3161 ------
NM_001005159chr3161 ------
NM_001005271chr17--1357 135 --
NM_001005273chr17--1357 135 --
NM_001005291chr17150 ------
NM_001005377chr19125 ------
NM_001005415chr191460 2107 24 ----
NM_001005416chr191460 2107 24 ----
NM_001005473chr525973 2406 1356 --1776
NM_001005476chr21675 ------
NM_001005505chr351141 357 131 92 80 ------
NM_001005782chr21338 ------
NM_001005920chr161403 ------
NM_001006115chr392688 2606 2156 2149 2130 2071 1020 964 372 --22781 351 --
NM_001006623chr2----12036 --
NM_001006636chr21187 ------
NM_001006932chr6102500 864 691 573 255 207 153 125 65 31 --33205 2260 2255 --
NM_001006933chrX----152 --
NM_001006946chr2390 79 25 11626 2782 30 --
NM_001007026chr121382 1127 ----
NM_001007098chr11277 ------
NM_001007156chr152402 134 --11736 1473
NM_001007226chr17--11392 ----
NM_001007227chr17--11392 ----
NM_001007228chr17--11392 ----
NM_001007229chr17--11392 ----
NM_001007230chr17--11392 ----
NM_001007271chr102961 28 ------
NM_001007273chr10156 ------
NM_001007277chr112196 44 ------
NM_001007466chr621521 67 --14126 --
NM_001007559chr1821866 1701 ------
NM_001008220chr5113769 3713 3644 3532 3205 2508 892 623 502 477 308 --1371 --
NM_001008222chrX41128 1069 960 245 --11178 --
NM_001008407chr71230 1679 11709 --
NM_001008530chr142119 91 ------
NM_001008701chr1972606 2482 2385 2099 1087 634 523 2723 440 11205 1640
NM_001008711chr8149 ------
NM_001008925chr4----12949 --
NM_001008938chr111399 128 ----
NM_001009184chr84481 217 211 54 ------
NM_001009555chr41571 ------
NM_001009566chr141331 1091 168 123 1320 21131 272 --
NM_001009598chr1121 ------
NM_001009955chr11115 --1503 --
NM_001009955chr11115 --1503 --
NM_001010846chr1122 13882 ----
NM_001010854chr14----148 --
NM_001010924chr102997 777 1213 ----
NM_001010926chr14687 189 95 81 ------
NM_001010938chr35763 676 305 225 215 1197 2166 161 --
NM_001011513chr433792 3222 116 ------
NM_001011537chr31175 ----11467
NM_001011708chr222756 1111 ------
NM_001012264chr142663 377 ------
NM_001012329chr152097 1937 1813 317 122 --1127 --
NM_001012338chr15150 ------
NM_001012415chr94704 282 207 80 ------
NM_001012614chr45676 192 152 94 24 ------
NM_001012644chr202129 122 --1105 --
NM_001012661chr11--1160 ----
NM_001012732chr411015 1872 1806 --
NM_001012761chr52473 246 12237 1799 --
NM_001012968chrX1313 ------
NM_001012974chr6279 45 ------
NM_001012977chrX4517 212 162 85 1991 ----
NM_001012989chrX1253 ------
NM_001013251chr11--1160 ----
NM_001013415chr4150 163 ----
NM_001013622chr47927 481 419 358 172 111 49 --1759 --
NM_001013635chr121235 ------
NM_001013690chr12102404 1917 1850 574 454 435 337 250 55 46 ------
NM_001013693chr162674 2622 2548 2331 1131 1004 ------
NM_001013693chr162674 2622 2548 2331 1131 1004 ------
NM_001013839chr1751689 1619 1594 926 482 12025 1990 --
NM_001014283chr1321766 1755 11482 1368 --
NM_001014431chr142371 54 1172 ----
NM_001014432chr142371 54 1172 ----
NM_001014443chr12213 61 ------
NM_001014445chr175991 979 791 179 62 --2770 722 --
NM_001014794chr11195 --1232 --
NM_001014795chr11195 --1232 --
NM_001014797chr1022804 666 11810 17659 16707
NM_001014809chr41802 ------
NM_001014831chr194786 719 675 49 1593 2530 109 --
NM_001014832chr194786 719 675 49 1593 2530 109 --
NM_001014834chr194786 719 675 49 1593 2530 109 --
NM_001014835chr194786 719 675 49 1593 2530 109 --
NM_001014839chr13894 741 243 1321 1385 --
NM_001014841chr13894 741 243 1321 1385 --
NM_001015045chr421681 683 ----199
NM_001015877chrX1825 ------
NM_001017395chr362723 2449 2397 1097 1079 393 ------
NM_001017440chr787439 3131 2844 2757 2712 2077 901 572 1701 25221 1932 --
NM_001017535chr1282689 2540 2395 995 795 681 514 98 --22647 406 --
NM_001017926chr8--1525 ----
NM_001017963chr141874 ------
NM_001018025chrX1351 ------
NM_001018037chr921320 945 ------
NM_001018050chr2293109 3065 2436 2191 2137 1365 1290 1076 775 12768 32511 171 149 1864
NM_001018052chr2293109 3065 2436 2191 2137 1365 1290 1076 775 12768 32511 171 149 1864
NM_001018070chr11134 ------
NM_001018108chr1562148 2036 1771 796 729 124 ----11752
NM_001018111chr743227 2841 571 447 13002 ----
NM_001020658chr121052 32 --1230 --
NM_001020658chr121052 32 --1230 --
NM_001023587chr32742 148 ------
NM_001024024chr141159 ------
NM_001024071chr141127 ------
NM_001024226chr11467 ------
NM_001024227chr11467 ------
NM_001024228chr11467 ------
NM_001024401chr16102850 2252 1833 917 780 679 453 371 89 47 --11912 --
NM_001024455chrX31948 58 52 --12241 --
NM_001024649chr522270 832 149 --1979
NM_001024666chrX1544 --1478 --
NM_001024809chr1781304 1218 928 476 416 285 37 30 31274 1237 79 189 --
NM_001024845chr16997 944 322 103 94 38 1760 ----
NM_001024937chr171548 151 ----
NM_001024948chr112297 --1239 12640
NM_001025076chr1075555 4832 2303 2259 2227 120 23 21534 1349 ----
NM_001025077chr1056913 6190 1478 412 23 32892 2707 1131 ----
NM_001025079chr321123 378 ------
NM_001025108chr222972 623 12793 ----
NM_001025242chrX31294 969 187 1413 1143 --
NM_001025243chrX31294 969 187 1413 1143 --
NM_001025266chr363544 608 537 257 104 27 1700 23872 109 --
NM_001025389chr1111586 ------
NM_001025390chr1111586 ------
NM_001025579chr174932 879 253 45 1196 2244 175 --
NM_001025580chrX1386 ------
NM_001029882chr12501 128 1145 ----
NM_001029882chr12501 128 1145 ----
NM_001029891chrX2832 43 ------
NM_001030007chr16----1526 --
NM_001031680chr151706 410 81 73 23 31942 451 431 ----
NM_001031685chr11239 ------
NM_001031690chr741974 1173 842 364 --121 --
NM_001031695chr22105149 4596 4478 3594 1956 1896 1368 1308 1275 876 ------
NM_001031720chr4--1165 ----
NM_001031740chr12146 79 ----1136
NM_001031801chr222150 87 ------
NM_001032221chr981573 1498 1410 1385 1296 1283 307 114 ----2107 50
NM_001032280chr63219 76 46 ------
NM_001032288chr202586 394 1411 ----
NM_001032296chr1332510 1181 710 22747 2179 ----
NM_001032363chr141922 1765 534 73 ----11516
NM_001032363chr141922 1765 534 73 ----11516
NM_001033026chr193499 452 31 1422 1443 --
NM_001033117chr374165 3474 1936 1670 1544 807 789 1295 ----
NM_001033551chr1793744 3367 2555 2525 1331 1248 1025 51 40 23394 670 22979 364 --
NM_001033557chr2----1566 --
NM_001033561chr171343 ------
NM_001033602chr1382628 2564 2240 2204 162 148 92 28 ------
NM_001033677chr121388 1164 ----
NM_001033723chr842067 850 48 32 --12333 --
NM_001034954chr1031292 741 634 ------
NM_001034955chr1031292 741 634 ------
NM_001034956chr1031292 741 634 ------
NM_001034957chr1031292 741 634 ------
NM_001035003chr4----11338 --
NM_001035004chr4----11338 --
NM_001035256chr2169 --174 --
NM_001035267chr121206 ------
NM_001035521chr22750 186 ------
NM_001037324chr32242 191 ------
NM_001037331chr182253 50 --2928 267 --
NM_001037335chr2031041 855 78 ------
NM_001037553chr21133709 3671 3647 3615 3384 1629 638 588 456 395 279 254 32 11706 1509 23342 1069
NM_001037582chr43499 453 421 --1591 --
NM_001037872chr21613 ------
NM_001038493chr23406 227 25 --1320 --
NM_001039140chr204168 88 46 23 ------
NM_001039141chr2282325 2151 2119 2060 1836 1096 1040 447 1250 ----
NM_001039199chr2064738 4469 4236 3572 1630 704 --11038 --
NM_001039350chr741301 1286 1119 67 1225 11439 --
NM_001039459chr72188 147 ------
NM_001039467chr20126 1405 ----
NM_001039479chr142323 179 --22373 529 --
NM_001039550chr23759 710 259 ------
NM_001039574chr13993 986 909 ------
NM_001039577chr153878 1405 878 679 372 22776 1291 ----
NM_001039583chr221125 1140 1436 --
NM_001039584chr221125 1140 1436 --
NM_001039590chrX--11369 ----
NM_001039591chrX--11369 ----
NM_001039670chr121879 135 ----
NM_001039690chr1641943 816 664 534 --154 --
NM_001039711chr11104 3816 222 173 ----
NM_001039712chr11104 3816 222 173 ----
NM_001039775chr1127 ------
NM_001039802chr1------1120
NM_001039877chr194642 257 237 21 1799 183 --
NM_001040031chr194265 106 59 35 --229 24 --
NM_001040110chr721378 600 --11237 --
NM_001040144chr1641943 816 664 534 --154 --
NM_001040146chr1641943 816 664 534 --154 --
NM_001040152chr723526 854 --14462 --
NM_001040424chr2142674 2601 913 147 12023 12773 --
NM_001040439chr1671321 1125 555 435 398 378 58 11214 11268 11444
NM_001040451chr5------1473
NM_001040452chr5------1473
NM_001042403chr1211034 ------
NM_001042413chr9--1822 --1116
NM_001042425chr63219 76 46 ------
NM_001042472chr202469 83 1163 ----
NM_001042486chr2081553 1453 1426 1319 1262 1139 585 428 11234 --11145
NM_001042494chr1543278 1300 919 907 ------
NM_001042495chr1543278 1300 919 907 ------
NM_001042496chr1543278 1300 919 907 ------
NM_001042497chr1543278 1300 919 907 ------
NM_001042506chrX51329 517 212 162 85 1991 ----
NM_001042539chr1631012 962 763 11043 ----
NM_001042610chr1661189 1097 892 442 305 155 11242 1935 --
NM_001042632chr2042363 1666 384 233 22321 126 --2586 466
NM_001042633chr2042363 1666 384 233 22321 126 --2586 466
NM_001042663chr131335 1120 129 --31377 1325 335 --
NM_001042664chr131335 1120 129 --31377 1325 335 --
NM_001042665chr131335 1120 129 --31377 1325 335 --
NM_001042681chr122345 376 2272 208 ----
NM_001042682chr122345 376 2272 208 ----
NM_001042682chr122345 376 2272 208 ----
NM_001042728chr1261052 816 320 202 194 22 --1216 --
NM_001043318chr14123016 2861 2688 1339 721 630 579 493 228 104 33 21 21007 505 2920 426 1784
NM_001077628chr12125 51 ------
NM_001079874chr1--126 --1284
NM_001080418chr14429 242 215 124 --2220 94 --
NM_001087chr22110 54 ------
NM_001092chr1761901 1002 848 631 562 248 --1433 --
NM_001094chr171152 --1190 --
NM_001095chr1231276 622 86 11253 ----
NM_001100108chr136862 6160 2647 37864 2098 942 18038 18044
NM_001106chr3117440 6934 3081 2819 2190 1921 1168 842 824 502 334 18136 23143 1107 --
NM_001113490chrX21323 591 ------
NM_001116chr1692354 2347 1239 1145 1122 746 275 269 209 32823 2131 659 32240 631 586 12119
NM_001117chr18136 --1492 --
NM_001122631chr113650 67 21 ------
NM_001127chr223417 340 220 181 ----
NM_001128chr16----1526 --
NM_001131chr61333 1373 ----
NM_001140chr17----175 --
NM_001144chr16137 ------
NM_001148chr411723 ------
NM_001154chr4125 ------
NM_001163chr921022 815 ------
NM_001174chrX8910 757 554 530 458 183 157 28 --1420 1477
NM_001188chr64267 147 41 27 ------
NM_001189chr471037 734 231 177 46 40 34 --193 --
NM_001194chr196501 460 419 221 170 83 --3571 239 200 --
NM_001197chr222281 52 ------
NM_001199chr82258 189 ------
NM_001204chr2--1119 ----
NM_001206chr923074 2833 1156 --1438
NM_001222chr101168 21264 154 --11666
NM_001241chr21193 ------
NM_001241chr21193 ------
NM_001259chr736246 6082 1263 --46376 6346 6303 6255 --
NM_001265chr131250 ------
NM_001268chr13--144 ----
NM_001280chr193532 516 175 ------
NM_001292chr152987 817 --1846 --
NM_001313chr41802 ------
NM_001328chr45676 192 152 94 24 ------
NM_001331chr1152190 1104 980 934 749 ------
NM_001332chr5122 ------
NM_001343chr51281 ------
NM_001347chr4111555 1222 1176 509 464 290 251 245 127 103 45 11431 --11648
NM_001352chr19139 ------
NM_001356chrX4954 244 188 26 ------
NM_001365chr172552 269 2540 178 133 --
NM_001383chr174765 248 227 46 189 1680 --
NM_001387chr542972 2562 2434 806 ------
NM_001396chr2111731 ------
NM_001402chr621821 1430 ------
NM_001407chr321342 627 ------
NM_001408chr151489 1240 1194 619 578 --291 63 --
NM_001417chr1211490 --11831 --
NM_001418chr111719 ------
NM_001418chr111719 ------
NM_001419chr1964804 3727 3303 1941 528 501 ------
NM_001420chr1992744 2587 2560 2514 2157 1174 1140 211 138 22834 2534 ----
NM_001426chr22526 68 ------
NM_001430chr231830 1436 1271 2665 475 11306 21401 1367
NM_001438chr1----1584 --
NM_001447chr51537 ------
NM_001453chr61445 --11580 --
NM_001454chr173863 384 373 1296 2945 258 --
NM_001456chrX194 --260 43 --
NM_001457chr311485 ------
NM_001478chr122248 53 ------
NM_001493chrX123 --2674 553 --
NM_001495chr8----11174 11165
NM_001497chr922119 574 ------
NM_001500chr63135 117 108 145 ----
NM_001521chr22750 186 ------
NM_001555chrX--178 ----
NM_001569chrX31294 969 187 1413 1143 --
NM_001616chr212641 ----12723
NM_001619chr114868 260 155 66 --2918 723 1441
NM_001626chr1972548 2239 1097 787 366 236 176 22150 168 63486 2260 2250 1288 747 445 12688
NM_001658chr11467 ------
NM_001659chr1242573 149 106 60 ------
NM_001665chr112390 31 ------
NM_001670chr221524 --1127 1594
NM_001678chr1731269 371 61 ------
NM_001682chr121366 ------
NM_001683chr321045 43 1325 ----
NM_001693chr821147 1058 --123 --
NM_001695chr843316 3118 2734 339 ------
NM_001702chr8----152 --
NM_001703chr11251 ------
NM_001707chr72698 630 --132 --
NM_001709chr1121898 1150 --1783 --
NM_001746chr522270 832 149 --1979
NM_001753chr721217 1161 ------
NM_001754chr2151361 465 226 218 101 --130 --
NM_001760chr63899 858 65 2221 153 ----
NM_001774chr194265 106 59 35 --229 24 --
NM_001777chr321123 378 ------
NM_001783chr193325 238 29 --1243 --
NM_001789chr321385 1123 ------
NM_001791chr1------1120
NM_001800chr19134 ------
NM_001810chr202574 236 ------
NM_001823chr14----130 --
NM_001842chr93526 499 472 --1173 --
NM_001845chr131154 ------
NM_001859chr932612 619 145 ------
NM_001893chr171317 ------
NM_001895chr20----11164 --
NM_001896chr161319 ------
NM_001903chr51729 ------
NM_001907chr16149 ------
NM_001921chr411015 1872 1806 --
NM_001923chr11----150 --
NM_001935chr21810 ------
NM_001936chr741301 1286 1119 67 1225 11439 --
NM_001938chr1--148 ----
NM_001940chr121382 1127 ----
NM_001945chr521006 993 ------
NM_001949chr621298 734 1431 1222 --
NM_001954chr6--1824 1563 --
NM_001957chr412288 ----11513
NM_001958chr204217 80 69 47 --285 74 1106
NM_001961chr19294 30 ------
NM_001962chr52221 205 ------
NM_001964chr5----1388 1394
NM_001965chr22189 72 195 2176 122 --
NM_001970chr173582 460 172 --1557 --
NM_001981chr121960 876 1346 ----
NM_001986chr175457 447 240 43 23 ------
NM_002023chr141595 1569 1068 38 ------
NM_002035chr1843233 1380 1274 589 ------
NM_002045chr31330 ------
NM_002048chr93229 68 61 ------
NM_002055chr172489 167 --271 31 --
NM_002074chr111474 11487 11479 --
NM_002076chr12--135 ----
NM_002077chr9127 1156 ----
NM_002078chr3144 ------
NM_002079chr102452 57 ------
NM_002086chr1742028 1770 1415 739 12069 ----
NM_002088chr193147 117 74 181 ----
NM_002089chr4----151 --
NM_002094chr16--122 ----
NM_002103chr195449 358 235 83 23 --11012 1112
NM_002115chr5129 ------
NM_002119chr642453 2393 99 70 22206 41 ----
NM_002126chr1721003 414 23717 520 11008 --
NM_002141chr7164 ------
NM_002147chr17272 52 --1117 --
NM_002149chr23677 550 107 ----182
NM_002167chr11375 --1117 --
NM_002181chr23669 178 76 ------
NM_002196chr204862 224 140 112 --2387 106 170
NM_002196chr204862 224 140 112 --2387 106 170
NM_002226chr143870 668 645 1821 ----
NM_002227chr11388 ------
NM_002229chr194358 351 146 33 --1305 --
NM_002230chr174413 300 155 88 11017 ----
NM_002232chr12971 149 ------
NM_002251chr2061769 1558 1551 880 55 24 --11543 --
NM_002254chr252334 940 903 514 229 1887 ----
NM_002264chr3------14350
NM_002285chr222972 623 12793 ----
NM_002289chr12126 ------
NM_002293chr1--12500 ----
NM_002310chr531888 1363 322 ------
NM_002319chr77887 798 692 274 260 245 59 --3925 841 254 --
NM_002332chr122194 46 --2703 98 --
NM_002333chr1921103 71 --134 1328
NM_002334chr11122 --185 --
NM_002349chr22599 163 ------
NM_002356chr62870 45 ------
NM_002359chr17104188 3982 3930 3675 3313 3262 2908 674 516 66 1128 64193 3991 3816 2803 663 350 --
NM_002360chr792585 2092 1786 1665 858 813 546 529 477 2489 239 22579 2574 12058
NM_002373chr1531324 1289 1140 --11167 --
NM_002375chr372192 925 897 405 371 168 36 12210 2692 328 --
NM_002382chr1411104 --2385 354 --
NM_002383chr164835 785 586 321 1866 ----
NM_002387chr544444 875 518 267 ------
NM_002419chr113486 415 383 ------
NM_002429chr1221154 1039 ------
NM_002442chr1231405 618 161 1109 2251 166 --
NM_002479chr1196 ------
NM_002494chr4130 ------
NM_002501chr19224080 4059 3944 3787 3462 3424 3397 3222 3112 3020 3009 2958 1226 1218 994 968 940 841 789 564 367 205 33693 3387 3064 104074 4069 4064 3715 3642 3376 2522 2517 1015 973 23365 953
NM_002506chr1126 ------
NM_002509chr204794 773 686 73 ------
NM_002522chr17113193 2657 2452 2402 1528 1342 922 739 173 42 35 22501 119 21476 822 --
NM_002524chr11254 ------
NM_002530chr15150 ------
NM_002553chr71345 ------
NM_002556chr1122036 1519 ------
NM_002581chr914361 ------
NM_002586chr621414 525 --21079 445 --
NM_002599chr1131185 998 24 ------
NM_002607chr731093 963 899 11014 1354 --
NM_002608chr2241519 1345 478 393 1344 ----
NM_002609chr52574 43 31688 1630 443 125 --
NM_002613chr16114057 3676 1832 1812 1421 848 818 720 626 443 239 14674 51692 1318 481 374 304 --
NM_002628chr31451 11147 ----
NM_002632chr147793 670 637 564 292 262 115 2817 29 2334 127 --
NM_002634chr17248 25 ------
NM_002641chrX31895 603 570 ------
NM_002644chr131459 1371 94 125 ----
NM_002646chr151884 1742 1424 820 100 --11683 --
NM_002650chr22178 --283 67 --
NM_002651chr12840 215 ------
NM_002653chr56677 641 408 339 325 82 --3906 671 662 --
NM_002657chr2083052 2868 1465 1384 879 805 202 62 23044 2376 1446 --
NM_002660chr201255 1481 ----
NM_002673chr32150 52 --2532 157 --
NM_002698chr19142794 2779 2494 2456 816 757 748 722 335 113 101 68 53 43 11908 ----
NM_002699chr1101058 956 949 606 523 431 303 297 204 21 11071 1966 --
NM_002705chr163617 122 90 --1145 --
NM_002707chr21132 ------
NM_002714chr62852 280 --150 --
NM_002716chr1123561 3383 13513 ----
NM_002717chr81654 ------
NM_002718chr3--12573 ----
NM_002719chr142296 115 1224 ----
NM_002720chr16--143 ----
NM_002745chr2224405 209 11377 1353 --
NM_002746chr165585 524 250 218 61 ------
NM_002753chr41104 ------
NM_002823chr2----1227 --
NM_002824chr12195 ----1108
NM_002829chr91475 ------
NM_002833chr1541329 1178 648 327 11291 ----
NM_002850chr1961223 975 968 398 177 38 ------
NM_002854chr22140 ------
NM_002855chr1183465 3042 1236 354 297 202 128 63 153 1847 --
NM_002859chr124579 179 163 123 ------
NM_002868chr1241964 490 139 109 1959 ----
NM_002874chr911677 --1338 --
NM_002885chr15832 742 381 133 100 ------
NM_002906chr111956 ------
NM_002911chr1971581 1534 1510 1337 1309 447 178 --1255 --
NM_002918chr1971040 722 715 707 425 418 32 --41029 1002 314 248 --
NM_002939chr11269 40 ------
NM_002941chr31219 ------
NM_002956chr121113 1170 ----
NM_002968chr16184 --2317 89 --
NM_002971chr3--1276 ----
NM_002972chr223113 89 71 --1259 --
NM_002997chr2390 79 25 11626 2782 30 --
NM_003009chr191299 ------
NM_003011chr921363 117 --1682 --
NM_003012chr83150 65 33 ------
NM_003013chr43132 62 22 ------
NM_003015chr103576 524 498 --253 22 --
NM_003025chr195971 270 126 83 53 --21101 22 21107 409
NM_003028chr9103800 3202 3087 2445 1515 1225 481 471 462 310 --23497 486 --
NM_003030chr33209 116 60 --31293 67 35 --
NM_003045chr13123431 3420 3307 1784 1323 1154 1023 592 425 297 191 37 --14938 --
NM_003047chr131113 295 165 --3426 250 102 --
NM_003063chr11262 40 ------
NM_003072chr191178 ------
NM_003074chr32227 129 ------
NM_003076chr1271479 1409 1317 1076 1046 521 52 ------
NM_003077chr17129 1236 ----
NM_003085chr54547 454 380 49 --2233 54 --
NM_003091chr201202 ----133
NM_003098chr20124 --1451 --
NM_003108chr2145104 2920 2907 2879 2801 2778 2689 2569 2560 2552 2079 2020 1867 436 --32617 2590 2030 --
NM_003113chr21176 ------
NM_003131chr65805 460 428 267 211 --1587 --
NM_003137chr62265 45 ------
NM_003139chr111153 ------
NM_003150chr1752137 1647 1603 696 313 --12174 --
NM_003155chr81278 ------
NM_003161chr172875 239 ------
NM_003164chr112465 107 ------
NM_003165chr981672 1597 1509 1484 1395 1382 406 213 ----2206 149
NM_003170chr174556 534 200 73 ------
NM_003173chrX21331 394 --21287 99 --
NM_003174chr101152 ------
NM_003179chrX21211 238 1251 1174 --
NM_003183chr21705 ------
NM_003185chr203536 504 485 ------
NM_003186chr112103 61 ------
NM_003199chr1814398 ------
NM_003200chr19112044 1832 1808 1495 920 768 748 657 300 200 42 11765 22101 222 --
NM_003202chr5--2172 162 285 56 --
NM_003204chr1731591 1342 1207 ------
NM_003214chr641212 411 255 162 1528 1270 --
NM_003220chr63219 76 46 ------
NM_003223chr163245 239 184 ------
NM_003227chr73317 56 26 ------
NM_003239chr141121 ------
NM_003247chr6132 11972 ----
NM_003255chr1751691 747 517 491 293 ------
NM_003257chr151384 ------
NM_003269chr63830 251 174 ------
NM_003284chr2122 ------
NM_003300chr14181 ------
NM_003317chr141586 ------
NM_003319chr21327 ------
NM_003320chr1133070 1471 1197 11623 174 1751
NM_003325chr222264 167 ------
NM_003347chr2272141 2001 1622 742 666 460 44 2842 67 12028 --
NM_003349chr202586 394 1411 ----
NM_003352chr21338 ------
NM_003363chr33635 558 462 ------
NM_003367chr193559 446 206 ------
NM_003370chr194206 164 66 57 1781 ----
NM_003371chr92713 56 11983 ----
NM_003378chr74296 100 35 25 --2120 107 --
NM_003392chr3----21608 27 --
NM_003406chr811589 ------
NM_003412chr321164 82 1113 ----
NM_003427chr61607 --1168 --
NM_003458chr393439 3431 2557 1502 1235 1031 518 511 343 --23575 569 --
NM_003459chr24706 501 447 70 ------
NM_003468chr21113 ------
NM_003470chr1631707 1566 364 ----1379
NM_003482chr1242420 2414 2375 2204 1666 2466 372 --
NM_003483chr12----11903 --
NM_003485chr1441048 394 173 85 ------
NM_003502chr161269 ------
NM_003508chr71331 164 156 --
NM_003558chr9--170 ----
NM_003563chr17--11392 ----
NM_003564chr1124 ------
NM_003575chr7121437 1343 1244 1230 1177 1150 1089 635 625 379 329 279 11168 21457 443 --
NM_003576chr1332510 1181 710 22747 2179 ----
NM_003593chr173538 444 266 ------
NM_003603chr431372 349 72 ------
NM_003607chr193803 3785 2707 1362 832 744 81 40 33 1398 13918 --
NM_003617chr133256 3110 218 158 11659 --
NM_003624chr1981277 952 915 470 435 389 366 321 --1402 --
NM_003628chr21675 ------
NM_003629chr111200 ----11064
NM_003632chr172763 588 ------
NM_003635chr10136 ------
NM_003644chr17136326 5399 5379 4794 4420 2254 1458 1194 943 923 776 765 334 16486 35930 1178 207 11221
NM_003655chr174241 166 68 35 ------
NM_003660chr197757 731 648 602 579 546 239 --2486 85 1166
NM_003663chr321342 585 --1305 --
NM_003671chr943108 3095 2638 2445 11075 ----
NM_003685chr192769 128 --1609 --
NM_003693chr171604 ------
NM_003709chr21333 ----199
NM_003714chr542986 2789 1975 423 --1382 --
NM_003737chr116396 390 384 85 75 22 ------
NM_003745chr161137 ------
NM_003771chr17283 32 ------
NM_003791chr161241 ------
NM_003835chr171254 ------
NM_003873chr10----1821 --
NM_003893chr102466 180 ------
NM_003897chr61480 ------
NM_003908chr2021098 1006 ------
NM_003913chr6--1629 ----
NM_003924chr4----1276 1258
NM_003936chr261199 955 753 430 105 30 ------
NM_003938chr194918 731 59 30 --2280 275 --
NM_003947chr31168 126 ----
NM_003949chr1761883 1547 1442 1349 287 274 --1639 --
NM_003954chr1751411 977 218 202 69 --3982 286 192 1137
NM_003955chr1751207 1119 1084 547 500 1157 --11128
NM_003969chr194247 112 40 23 152 ----
NM_003971chr171484 ------
NM_003987chr10162010 1991 1812 1791 1736 1632 1599 603 586 444 431 348 328 307 257 60 21744 149 51843 1838 1804 813 240 31882 1849 900
NM_003988chr10172087 2068 1889 1868 1813 1709 1676 680 663 521 508 425 405 384 334 137 46 21821 226 71920 1915 1881 1444 890 317 40 21959 1926
NM_003989chr10151946 1927 1748 1727 1672 1568 1535 539 522 380 367 284 264 243 193 21680 85 51779 1774 1740 749 176 31818 1785 836
NM_003990chr10151946 1927 1748 1727 1672 1568 1535 539 522 380 367 284 264 243 193 21680 85 51779 1774 1740 749 176 31818 1785 836
NM_003993chr1--125 ----
NM_004006chrX--1112 ----
NM_004007chrX--1112 ----
NM_004009chrX--1112 ----
NM_004010chrX--1112 ----
NM_004011chrX--1112 ----
NM_004012chrX--1112 ----
NM_004013chrX--1112 ----
NM_004014chrX--1112 ----
NM_004015chrX--1112 ----
NM_004016chrX--126 ----
NM_004017chrX--1112 ----
NM_004018chrX--126 ----
NM_004020chrX--1112 ----
NM_004021chrX--126 ----
NM_004022chrX--126 ----
NM_004023chrX--126 ----
NM_004035chr1725054 1815 ------
NM_004036chr23282 258 69 --1168 --
NM_004050chr1431778 616 318 --12128 --
NM_004055chr1171942 1625 1482 734 362 177 168 --2644 295 --
NM_004059chr92347 24 ------
NM_004069chr193203 172 27 ------
NM_004077chr1221059 200 ------
NM_004078chr151013 958 922 277 26 --1104 --
NM_004082chr2----1119 --
NM_004090chr1752842 2211 1071 95 61 12563 --1472
NM_004093chr1321077 50 22572 420 ----
NM_004100chr632361 386 333 ------
NM_004104chr173735 276 66 2583 543 ----
NM_004112chr173494 106 88 131 ----
NM_004118chr20195 129 ----
NM_004132chr1031052 1030 772 ----11104
NM_004134chr51617 ------
NM_004157chr31628 ------
NM_004176chr17150 ------
NM_004185chr12225 172 ------
NM_004186chr33628 310 112 1119 ----
NM_004193chr101379 ------
NM_004200chr11132578 2172 2089 2006 1067 983 943 936 775 491 436 197 91 12945 43266 2235 2122 156 --
NM_004205chr11133 --144 --
NM_004227chr772676 2447 2012 1237 747 158 70 --32621 721 101 1195
NM_004228chr19----143 --
NM_004230chr1941824 1530 592 104 12365 1428 --
NM_004240chr192247 92 ------
NM_004254chr112271 25 ------
NM_004263chr251555 1190 492 400 373 --11258 --
NM_004274chr1422935 83 ------
NM_004276chr121388 1164 ----
NM_004283chr194887 708 186 40 ------
NM_004295chr1741197 471 176 87 ------
NM_004302chr1262386 2224 2217 578 378 119 --1282 12411
NM_004305chr21183 ----1415
NM_004309chr1761119 1061 706 427 394 306 --3886 455 361 --
NM_004311chr1032500 2259 686 12528 12364 --
NM_004316chr122436 24 ------
NM_004320chr161136 ------
NM_004321chr263500 3480 3197 2542 2182 422 --12293 --
NM_004339chr213640 353 23 ----151
NM_004350chr151706 410 81 73 23 31942 451 431 ----
NM_004359chr192495 99 ------
NM_004370chr6----11337 --
NM_004380chr1611629 ------
NM_004391chr351537 1449 1412 157 146 ------
NM_004393chr342096 1855 740 701 ------
NM_004395chr54594 520 306 125 --197 --
NM_004398chr111442 ------
NM_004405chr24408 345 322 245 --2269 146 --
NM_004409chr194744 535 117 102 --2582 33 --
NM_004416chr121185 --1968 --
NM_004420chr11112385 2322 2190 2080 1805 1509 968 586 520 444 297 --124 --
NM_004421chr13628 229 140 --125 --
NM_004423chr35891 678 592 527 236 --1694 --
NM_004427chr1--1799 1280 --
NM_004429chrX3320 234 150 --1309 --
NM_004430chr862188 938 734 354 212 103 ------
NM_004431chr13326 206 64 1122 2626 274 --
NM_004433chr12431 215 --1182 --
NM_004436chr1146 ------
NM_004437chr143603 2776 1383 539 --22763 1155 --
NM_004438chr243343 2669 2607 2153 ------
NM_004443chr33733 534 521 ------
NM_004444chr73718 553 82 1322 190 --
NM_004451chr11------1594
NM_004454chr342243 2036 1510 745 ------
NM_004459chr1721529 474 ------
NM_004468chr12447 91 ------
NM_004472chr51112 ------
NM_004474chr14762 423 352 290 ------
NM_004475chr173806 409 244 --21107 345 --
NM_004498chr151272 ------
NM_004500chr14--11929 1162 --
NM_004505chr17--11347 1801 --
NM_004514chr1782882 2715 2609 2533 372 273 91 66 ------
NM_004517chr11195 --1232 --
NM_004529chr91478 ------
NM_004530chr162999 300 1890 1286 --
NM_004560chr9----3184 149 39 1999
NM_004578chr11844 ------
NM_004579chr112103 30 1337 1110 --
NM_004583chr175644 542 528 37 28 ------
NM_004586chrX11590 ----13458
NM_004588chr1192807 1053 855 602 464 222 68 50 33 1159 ----
NM_004603chr78958 474 413 380 361 161 92 53 --1166 --
NM_004608chr163457 59 41 ------
NM_004609chr203443 436 363 ------
NM_004625chr32238 26 ------
NM_004630chr1121050 312 ----1225
NM_004634chr32438 34 ------
NM_004637chr311006 11256 ----
NM_004647chr191266 189 ----
NM_004651chrX2350 102 --174 --
NM_004655chr1721173 944 ------
NM_004658chr122333 69 ------
NM_004663chr151171 ------
NM_004690chr61622 ------
NM_004711chr22133366 3195 3183 3145 2653 1155 1146 1104 702 497 372 64 24 23378 2821 33566 2422 84 1210
NM_004714chr192337 59 ------
NM_004723chr11911 2425 242 124 --
NM_004729chrX42094 1970 1896 273 135 ----
NM_004730chr52603 90 ------
NM_004742chr3----195 --
NM_004750chr192238 29 ------
NM_004758chr1771065 847 827 821 764 311 247 --1877 --
NM_004762chr1781762 1576 1425 1319 762 717 498 341 2363 58 21380 108 --
NM_004774chr1722864 2294 ------
NM_004776chr2042987 2783 2399 945 12367 1262 --
NM_004781chr111719 --1187 --
NM_004781chr111719 --1187 --
NM_004783chr161247 187 1214 --
NM_004796chr14----1253 --
NM_004808chr10--12936 ----
NM_004815chr114147 ------
NM_004821chr53117 94 51 ------
NM_004822chr17143354 2933 2837 2475 1491 1472 784 778 772 750 553 351 243 185 22667 1036 ----
NM_004824chr621121 442 --1434 --
NM_004826chr2--138 192 --
NM_004839chr152583 576 --124 --
NM_004840chrX22329 150 --155 --
NM_004845chrX44131 4123 3372 3207 ------
NM_004856chr151400 ------
NM_004857chr1444381 3585 1722 1017 ------
NM_004883chr5123 --128 --
NM_004884chr153625 386 371 11126 ----
NM_004890chr171244 ------
NM_004898chr422793 2781 ------
NM_004902chr20--1619 ----
NM_004911chr7--1522 2476 43 --
NM_004922chr101984 ------
NM_004925chr9235 28 ------
NM_004926chr1421859 608 2534 47 ----
NM_004936chr93762 621 610 ------
NM_004947chr321036 790 12343 ----
NM_004953chr32381 342 ------
NM_004958chr11653 ------
NM_004959chr9111497 1452 1428 1406 1377 1370 1356 1251 1036 358 285 --31293 274 126 185
NM_004961chrX1559 ------
NM_004962chr101229 ------
NM_004977chr196554 424 397 227 69 48 --1595 --
NM_004978chr141656 1649 1572 401 ------
NM_004980chr11208 ------
NM_004985chr1211008 ------
NM_004991chr3----1123 --
NM_004992chrX138257 7315 6494 6360 5977 5701 3192 3155 2817 2657 1415 1164 329 15284 47705 6692 2401 417 25966 3173
NM_004992chrX138257 7315 6494 6360 5977 5701 3192 3155 2817 2657 1415 1164 329 15284 47705 6692 2401 417 25966 3173
NM_004995chr1461199 1041 438 339 180 96 1111 ----
NM_004996chr1661440 566 389 251 238 172 ------
NM_004998chr152973 332 1933 ----
NM_005011chr721378 600 --11237 --
NM_005027chr1921135 344 1981 1319 --
NM_005028chr1022157 1665 31907 747 604 11724 --
NM_005029chr103263 89 56 ------
NM_005045chr71926 ------
NM_005055chr112164 32 ------
NM_005073chr132249 46 ------
NM_005078chr1551156 343 285 133 81 --1159 --
NM_005096chrX4423 197 137 107 1360 ----
NM_005099chr131165 177 41 --2251 160 --
NM_005103chr11----124 --
NM_005104chr64511 287 114 59 ----134
NM_005110chr52729 710 ------
NM_005116chr2053815 3540 3028 1548 702 12795 11294 --
NM_005121chr171166 ------
NM_005124chr61164 --148 --
NM_005135chr1543278 1300 919 907 ------
NM_005156chr931907 177 171 ------
NM_005157chr941501 252 209 146 1193 21849 290 11517
NM_005161chr1121522 425 1214 1130 --
NM_005163chr142371 54 1172 ----
NM_005165chr172357 323 ------
NM_005169chr11247 22 ------
NM_005176chr12133 --149 --
NM_005178chr19148 ------
NM_005184chr1991342 1162 1150 1135 1091 476 394 225 82 ------
NM_005187chr1651575 1529 1364 1326 278 --21633 115 --
NM_005194chr205406 215 78 72 26 ------
NM_005197chr1433823 1698 806 ------
NM_005202chr1102207 1603 1422 737 605 533 326 291 243 26 1152 11409 --
NM_005219chr551631 627 420 345 233 ----158
NM_005220chr1741336 1257 988 474 ----1556
NM_005229chrX2810 442 ------
NM_005232chr7177 ------
NM_005238chr1132905 2549 29 ------
NM_005263chr1280 58 ------
NM_005273chr72231 124 --141 --
NM_005277chr41540 ------
NM_005311chr732153 974 339 --22230 825 12270
NM_005312chr962582 2348 2271 466 106 100 --1636 1618
NM_005318chr221796 ------
NM_005329chr1612190 ------
NM_005334chrX61389 510 251 108 83 44 21082 678 2642 317 --
NM_005336chr262109 1612 1583 875 869 647 ----2317 132
NM_005339chr42624 157 ------
NM_005348chr141874 ------
NM_005349chr41135 1147 ----
NM_005354chr197526 257 239 233 202 97 74 --1270 --
NM_005370chr191836 --2101 27 --
NM_005374chr1752270 2132 800 361 82 --1727 --
NM_005386chr203908 333 110 ------
NM_005392chr921678 551 --252 31 1246
NM_005397chr743227 2841 571 447 13002 ----
NM_005407chr1431387 506 83 ------
NM_005417chr2091941 1572 1370 1339 1263 608 465 351 230 1254 21668 449 --
NM_005426chr11239 ------
NM_005430chr126925 312 275 246 223 117 1827 ----
NM_005436chr1012580 ------
NM_005438chr11--124 ----
NM_005440chr1723322 59 ------
NM_005458chr92574 33 12235 ----
NM_005461chr2091904 1480 541 455 317 273 91 34 24 ------
NM_005465chr121759 139 ------
NM_005505chr125613 590 355 167 73 --1837 --
NM_005515chr75169 133 97 69 43 ------
NM_005526chr82308 300 1251 179 --
NM_005550chr163487 426 52 1453 2249 110 --
NM_005563chr1----1585 --
NM_005578chr314038 ------
NM_005581chr197438 427 403 341 332 114 85 --164 --
NM_005584chr13--192 ----
NM_005589chr14--2444 145 ----
NM_005596chr9--25035 343 --14990
NM_005599chr12117 33 ------
NM_005606chr142119 91 ------
NM_005614chr71711 ------
NM_005618chr6199 ------
NM_005619chr19--2276 44 ----
NM_005628chr19123 --128 --
NM_005630chr32399 331 1418 124 11846
NM_005632chr1631042 156 110 --3875 729 256 --
NM_005634chrX2541 53 --1546 159
NM_005637chr1821866 1701 ------
NM_005650chr222941 121 --4141 136 131 126 --
NM_005656chr213505 179 66 ------
NM_005657chr15132 ------
NM_005660chrX2197 32 ------
NM_005665chr121890 578 ------
NM_005677chr331398 999 409 --186 --
NM_005678chr152811 714 1949 ----
NM_005688chr32918 51 11184 ----
NM_005698chr1----127 --
NM_005704chr12736 703 11069 --1378
NM_005716chr192221 150 2523 494 1155 --
NM_005717chr1283 28 ----1924
NM_005719chr12135 ------
NM_005721chr21263 ------
NM_005736chr1041451 1003 411 148 11562 11502 11572
NM_005737chr232845 2514 1926 --1418 --
NM_005740chr22--128 1370 --
NM_005781chr35763 676 305 225 215 1197 2166 161 --
NM_005811chr12199 --157 --
NM_005814chr131172 84 52 --11179 1495
NM_005817chr19--1277 130 --
NM_005819chr122884 393 ------
NM_005822chr61729 --11793 --
NM_005840chrX22655 220 ------
NM_005851chr112351 305 ------
NM_005852chr17--1357 135 --
NM_005860chr1921272 1130 --11653 --
NM_005862chr3----1907 --
NM_005864chr144603 555 228 33 ------
NM_005871chr101761 ------
NM_005873chr20126 1405 ----
NM_005875chr3--184 ----
NM_005877chr223454 60 29 11734 ----
NM_005884chr194786 719 675 49 1593 2530 109 --
NM_005901chr1838665 5478 3408 --12321 --
NM_005906chr6135 ------
NM_005910chr1763449 2852 1224 1108 405 84 2877 109 23023 1626 --
NM_005911chr21431 ------
NM_005916chr7141 ------
NM_005920chr152562 1492 896 86 70 22806 601 12624 1373
NM_005933chr111813 12998 12677 --
NM_005934chr19122186 2047 1706 910 885 431 303 192 173 160 122 115 --2457 61 --
NM_005938chrX51326 1072 355 100 27 ------
NM_005941chr812672 12921 ----
NM_005943chr631485 639 534 --11286 --
NM_005955chr163800 3767 2086 1886 1704 1496 ------
NM_005967chr123560 459 222 ------
NM_005984chr227520 479 443 434 395 364 332 ------
NM_005994chr178905 848 812 794 382 138 55 24 1324 ----
NM_005997chr1138 ------
NM_006007chr923659 1760 ------
NM_006015chr1127 ------
NM_006030chr351141 357 131 92 80 ------
NM_006034chr11122346 2020 1850 1820 1808 1684 1570 839 233 163 97 58 21615 856 32422 102 25 --
NM_006037chr243300 3248 3238 3042 11279 13232 1287
NM_006038chr202847 351 --22069 878 --
NM_006040chr1621396 406 ------
NM_006047chr201927 ------
NM_006062chr241245 981 186 39 --127 --
NM_006077chr102165 159 3727 656 55 ----
NM_006078chr22184 ------
NM_006082chr12------124
NM_006085chr12901 291 ------
NM_006089chrX11339 ------
NM_006091chr1561105 506 404 229 210 127 11680 ----
NM_006096chr82350 78 21475 225 ----
NM_006106chr111998 13200 ----
NM_006113chr1--126 --1284
NM_006133chr11112126 1750 1700 982 934 840 577 494 316 74 49 --32209 1782 737 --
NM_006135chr1----1342 --
NM_006160chr1761321 1306 1241 1053 1042 536 1345 21047 185 --
NM_006161chr52162 74 ------
NM_006176chr114728 164 131 77 1303 3716 701 696 --
NM_006185chr11163 ------
NM_006186chr21226 ------
NM_006201chrX51120 1112 833 136 83 --1920 --
NM_006203chr525372 4329 14918 ----
NM_006224chr1732397 858 502 ----1508
NM_006237chr13----1865 --
NM_006243chr11159 ------
NM_006245chr65702 680 674 56 43 1393 ----
NM_006246chr1411100 ------
NM_006247chr19161 --3392 349 85 --
NM_006251chr51602 ------
NM_006265chr811391 ------
NM_006283chr844598 3321 741 170 --1146 --
NM_006285chr92280 116 ------
NM_006293chr151371 --171 --
NM_006301chr122603 520 ------
NM_006306chrX23693 24 14058 11115 --
NM_006328chr112533 243 ------
NM_006336chr951444 1378 1359 1244 460 --41076 1071 936 615 11040
NM_006338chr12175 155 --182 --
NM_006361chr1741900 1748 1379 1323 --11572 --
NM_006362chr11----1104 --
NM_006364chr141286 ------
NM_006369chr12362 290 ------
NM_006375chrX11593 ------
NM_006377chr92834 185 ------
NM_006378chr931245 1118 30 1360 ----
NM_006379chr7----11623 --
NM_006380chr1743523 3009 2811 2672 ------
NM_006390chr1221482 561 ------
NM_006405chr14149 ------
NM_006411chr63925 207 71 1719 1726 --
NM_006420chr201679 ------
NM_006434chr1031292 741 634 ------
NM_006454chr4112846 2809 2796 2666 2338 2143 2114 2096 1989 728 245 42676 2645 2626 209 12853 --
NM_006457chr433792 3222 116 ------
NM_006459chr1011809 1759 ----
NM_006464chr254057 3371 1729 1595 104 ------
NM_006465chr1561508 1435 734 695 679 386 ------
NM_006477chr221110 ------
NM_006480chr52409 77 ------
NM_006483chr192337 59 ------
NM_006484chr192337 59 ------
NM_006494chr193738 107 74 ----132
NM_006497chr176692 667 660 636 274 43 --1313 --
NM_006500chr115983 474 113 52 29 ----1174
NM_006516chr121395 343 ------
NM_006517chrX41958 1909 1759 56 ------
NM_006521chrX3521 485 289 --3526 101 68 21187 185
NM_006532chr1971696 1492 1447 458 204 184 149 1135 1723 11632
NM_006538chr223738 2934 1434 ----
NM_006539chr162492 428 ------
NM_006540chr81138 ------
NM_006548chr32230 157 --1223 --
NM_006549chr1222404 112 124 ----
NM_006561chr1075555 4832 2303 2259 2227 120 23 21534 1349 ----
NM_006562chr105235 224 217 107 28 ------
NM_006565chr161850 ------
NM_006578chr1511467 --21619 1558 --
NM_006599chr1637527 6798 5733 16304 ----
NM_006628chr1524028 3682 ------
NM_006650chr5113769 3713 3644 3532 3205 2508 892 623 502 477 308 --1371 --
NM_006651chr481495 1412 1392 1278 520 499 58 35 --71054 931 463 309 196 129 24 --
NM_006675chr12113210 3019 2135 1232 994 313 277 149 139 40 28 32813 854 101 42896 1261 372 33 --
NM_006690chr2072061 2054 1811 1579 1484 542 505 ------
NM_006693chr72760 21 1210 140 --
NM_006698chr2031265 1128 919 190 2544 97 --
NM_006711chr162309 154 ------
NM_006717chr91105 ------
NM_006722chr312344 ------
NM_006736chr251769 1720 1269 556 317 ------
NM_006749chr8--2985 507 ----
NM_006759chr2--1107 ----
NM_006761chr172549 135 ------
NM_006769chr1--1155 ----
NM_006772chr631564 1077 460 1269 ----
NM_006795chr1181386 598 584 569 543 488 280 114 --1556 --
NM_006805chr5----1683 --
NM_006813chr6----1253 --
NM_006823chr821112 292 ------
NM_006833chr71123 ------
NM_006839chr2184 ------
NM_006841chr34643 262 196 64 --144 --
NM_006852chr1722483 194 --1221 --
NM_006854chr721958 686 ------
NM_006856chr122290 203 ------
NM_006861chr1261731 1412 576 521 378 157 --1479 1636
NM_006876chr111212 ------
NM_006884chr33209 116 60 --31293 67 35 --
NM_006887chr2164 ------
NM_006896chr721100 879 11065 1284 --
NM_006897chr121632 ------
NM_006902chr1------163
NM_006906chr113681 236 94 --169 --
NM_006924chr171272 14031 ----
NM_006936chr211372 2408 36 ----
NM_006940chr1211183 ------
NM_006941chr225831 157 58 39 28 ------
NM_006943chr206966 600 513 381 363 103 1166 ----
NM_006946chr112442 239 ------
NM_006950chrX4724 369 284 52 ------
NM_006988chr212806 248 ------
NM_006990chr142399 1638 452 202 --1861 --
NM_007011chr1576616 6365 4556 4484 2250 934 559 11474 1464 --
NM_007014chr1681760 1393 1226 1187 512 110 97 56 ----2170 78
NM_007019chr201140 ------
NM_007030chr584453 1799 1790 1511 1013 855 388 240 162 25066 4285 --
NM_007032chr2282325 2151 2119 2060 1836 1096 1040 447 1250 ----
NM_007040chr1951053 371 80 61 34 ------
NM_007050chr2067689 7139 2015 374 136 106 1473 ----
NM_007067chr1731040 964 145 ------
NM_007073chr611556 ------
NM_007084chr133416 89 77 --1559 --
NM_007106chr1312521 ------
NM_007125chrY--1336 ----
NM_007144chr1731280 475 363 ------
NM_007159chr31425 ------
NM_007162chr61129 1452 1114 --
NM_007174chr1252216 1991 823 552 212 2574 226 1623 --
NM_007185chr14274 168 89 66 178 ----
NM_007192chr1421086 246 ------
NM_007202chr171688 ------
NM_007222chr8--1525 ----
NM_007232chr206811 793 771 726 288 149 1409 3222 107 67 11003
NM_007238chr2044577 4484 4272 305 --24548 3773 --
NM_007243chr63561 72 26 --1490 --
NM_007245chr164772 724 616 141 ------
NM_007249chr1346657 6029 740 617 ------
NM_007270chr721491 587 1544 11166 --
NM_007274chr12222 28 ------
NM_007275chr3133 1258 1354 --
NM_007282chr3----1798 --
NM_007292chr1725054 1815 ------
NM_007313chr941501 252 209 146 1193 21849 290 11517
NM_007322chr193470 435 389 --1402 --
NM_007326chr223122 95 49 --2326 34 --
NM_007327chr9111117 1044 1038 995 877 870 787 478 457 179 87 137 2823 190 11001
NM_007350chr121104 ----1110
NM_007353chr762291 2018 1183 804 745 114 ----1527
NM_007363chrX1116 --1354 --
NM_007365chr142026 246 212 199 1711 198 --
NM_007368chr132204 116 1185 1461 --
NM_007371chr92616 452 ------
NM_012074chr141744 ------
NM_012081chr5--1164 --1609
NM_012090chr111073 ------
NM_012095chr1032928 559 434 ------
NM_012102chr122345 376 2272 208 ----
NM_012104chr1151451 1147 955 435 289 ------
NM_012104chr1151451 1147 955 435 289 ------
NM_012154chr81262 --1632 --
NM_012156chr2063386 2733 1276 665 410 360 ------
NM_012166chr92114 81 11104 ----
NM_012175chr111129 ------
NM_012189chr181463 ------
NM_012193chr1185337 5301 5154 4947 4654 2175 2001 129 1337 ----
NM_012199chr131791 1095 248 --11100 1368
NM_012214chr211123 ------
NM_012232chr1761875 1419 625 461 197 33 1182 21922 1360 --
NM_012250chr1111157 ------
NM_012259chr61331 ------
NM_012261chr20--1469 ----
NM_012282chrX4838 279 209 154 1229 ----
NM_012284chr121296 1285 ----
NM_012288chr675488 5332 4471 2137 688 102 75 --1986 --
NM_012290chr211326 ------
NM_012297chr4----12160 --
NM_012301chr72611 32 11466 ----
NM_012309chr1144172 3978 428 318 123 21386 292 --
NM_012316chr165034 4487 1285 1071 416 119 13806 24104 145 --
NM_012317chrX4590 280 72 21 159 --138
NM_012333chr111445 --11689 --
NM_012334chr524749 4144 ------
NM_012396chr11171 ----1731
NM_012398chr19212946 2936 2922 2786 2536 2317 2291 2021 1984 1929 1123 921 645 630 590 477 437 346 186 75 46 1138 52791 2676 1918 595 108 --
NM_012399chr221718 11467 11512 --
NM_012402chr114959 926 346 196 ------
NM_012407chr221125 1140 1436 --
NM_012410chr162379 152 ------
NM_012448chr1752269 2060 1876 1830 844 ------
NM_012461chr142469 286 ------
NM_012475chr12213 61 ------
NM_012479chr732655 997 915 ------
NM_013235chr5------1829
NM_013246chr115671 211 154 65 40 --1835 --
NM_013261chr412784 ------
NM_013267chr12124 ------
NM_013275chr162245 90 ------
NM_013305chr183291 249 74 ------
NM_013334chr32172 29 ------
NM_013335chr21181 ------
NM_013341chr222756 1111 ------
NM_013365chr223546 184 171 --1178 --
NM_013373chr224878 832 678 630 ------
NM_013374chr312862 159 ----
NM_013377chr12171 ------
NM_013386chr11263 ------
NM_013390chr921452 461 1266 ----
NM_013392chr24389 340 281 22 ------
NM_013400chr74923 263 256 242 --1155 --
NM_013403chr194642 257 237 21 1799 183 --
NM_013423chrX3167 41 27 ------
NM_013427chrX3167 41 27 ------
NM_013433chr1981951 1720 1460 1349 716 674 144 89 11546 --11491
NM_013436chr22678 649 ------
NM_013446chr7----1362 --
NM_013449chr1252361 535 501 331 87 ------
NM_013981chr5123 --128 --
NM_013982chr5123 --128 --
NM_013983chr5123 --128 --
NM_013993chr6--1824 1563 --
NM_013994chr6--1824 1563 --
NM_013995chrX--1360 ----
NM_014001chr17121486 1367 1360 1304 1111 461 438 273 129 89 72 49 --1555 --
NM_014010chr91548 1587 ----
NM_014014chr23531 438 134 ------
NM_014015chr162138 52 ------
NM_014021chr122837 1244 ------
NM_014023chr1032212 1092 473 1847 11147 --
NM_014030chr1741131 448 293 145 1993 ----
NM_014071chr20--1135 ----
NM_014079chr32269 186 ------
NM_014106chr151412 1653 ----
NM_014109chr8--192 ----
NM_014112chr813922 --1641 --
NM_014117chr162935 526 ------
NM_014141chr754261 4207 3798 3524 74 14726 13803 --
NM_014155chr1146750 5647 1078 423 ------
NM_014157chr1623343 2480 1697 12614 --
NM_014159chr3--1137 ----
NM_014188chr1----1341 --
NM_014190chr481283 545 504 465 314 284 199 176 --2495 361 --
NM_014191chr121192 ----1760
NM_014232chr1731622 1186 426 --2445 22 --
NM_014232chr1731622 1186 426 --2445 22 --
NM_014233chr1731605 531 514 2539 445 --11793
NM_014234chr61175 ------
NM_014246chr2232042 805 743 --2861 356 --
NM_014248chr22159 ------
NM_014251chr71788 ------
NM_014271chrX1579 ------
NM_014272chr15275 68 ------
NM_014275chr54894 570 183 37 --197 --
NM_014284chr13894 741 243 1321 1385 --
NM_014292chr2271687 1581 1402 1300 603 552 217 21642 672 21390 593 --
NM_014299chr1962053 1972 1780 1383 605 131 --21546 185 11412
NM_014309chr22105139 4586 4468 3584 1946 1886 1358 1298 1265 866 ------
NM_014319chr12--11884 ----
NM_014325chr12----11490 --
NM_014351chr2221147 981 1310 ----
NM_014360chr141632 1106 ----
NM_014368chr921726 114 1103 ----
NM_014374chr74923 263 256 242 --1155 --
NM_014408chr11539 ------
NM_014415chr31440 ------
NM_014417chr192659 131 --1123 --
NM_014488chr113153 90 42 ------
NM_014494chr1622067 332 12078 --1694
NM_014507chr2231174 1079 290 --11201 --
NM_014515chr121873 --1785 --
NM_014516chr19152 137 169 --
NM_014520chr17130 ------
NM_014562chr25687 650 199 93 55 --2660 655 --
NM_014564chr92825 783 2965 23 1860 --
NM_014571chr142818 2461 1930 21 1692 1471 --
NM_014572chr13150 ------
NM_014575chr31410 ------
NM_014593chr181156 131 ----
NM_014612chr911389 1247 ----
NM_014613chr542212 984 671 633 --22924 1073 --
NM_014615chr1623495 1148 ------
NM_014620chr121186 --1789 --
NM_014621chr2284 31 ------
NM_014636chr943847 3387 1196 611 34155 984 670 1588 --
NM_014646chr1862553 2390 2094 1106 773 558 22804 565 2778 129 --
NM_014665chr8103310 3276 2939 1372 1234 1086 1043 473 224 156 33319 2488 188 52740 1050 675 655 254 136
NM_014667chr332301 2284 295 ----11688
NM_014670chr2----1468 --
NM_014674chr333597 3559 196 13510 ----
NM_014676chr121052 32 --1230 --
NM_014677chr821061 372 ------
NM_014686chr1932006 660 205 ------
NM_014689chr21125 ------
NM_014690chr741974 1173 842 364 --121 --
NM_014693chr32242 191 ------
NM_014712chr163465 191 51 ------
NM_014726chr1731134 907 96 11242 11207 --
NM_014727chr191198 ------
NM_014742chr204623 476 54 30 ------
NM_014747chr1145232 4211 4110 3961 3627 1414 1368 1229 1165 1026 923 911 650 578 --23953 3660 --
NM_014748chr22142 58 ------
NM_014751chr81659 11467 ----
NM_014755chr243512 1361 1200 446 ----13843
NM_014756chr111399 128 ----
NM_014762chr152315 809 728 639 223 1864 1496 --
NM_014767chr1073606 3559 3530 2349 663 418 104 --53587 3582 3548 2724 780 11387
NM_014770chr1241093 1031 463 106 --11144 --
NM_014771chr163771 385 120 ------
NM_014772chr18123559 3537 2738 1335 1315 927 907 892 281 258 90 45 2451 187 22957 2868 1371
NM_014776chr1242153 2147 420 327 --12440 --
NM_014790chr51345 ------
NM_014800chr72188 147 ------
NM_014802chr121199 ------
NM_014810chr111378 ------
NM_014826chr193803 3785 2707 1362 832 744 81 40 33 1398 13918 --
NM_014840chr1232592 647 219 --22485 2109 --
NM_014849chr15463 369 166 113 70 --175 --
NM_014850chr374165 3474 1936 1670 1544 807 789 1295 ----
NM_014851chr171684 1591 718 656 511 271 27 1206 ----
NM_014872chr91885 --22036 1875 --
NM_014877chr1756150 5986 5943 5599 5250 ------
NM_014883chr421681 683 ----199
NM_014897chr1722545 102 ------
NM_014901chr561992 1897 1434 1419 692 33 31410 174 161 ----
NM_014902chr2081553 1453 1426 1319 1262 1139 585 428 11234 --11145
NM_014903chr1222115 109 ------
NM_014917chr11376 ------
NM_014921chr1972606 2482 2385 2099 1087 634 523 2723 440 11205 1640
NM_014925chr121186 ------
NM_014935chr172727 1306 1159 596 324 218 111 1118 11061 --
NM_014939chr1811148 1115 ----
NM_014941chr22127 ------
NM_014944chr141331 1091 168 123 1320 21131 272 --
NM_014947chr142557 995 944 208 ------
NM_014952chr1531826 1498 1364 ----1597
NM_014974chr1031526 1456 1415 11660 ----
NM_014978chr102373 247 --1492 --
NM_015002chr1232178 446 196 ------
NM_015008chr362723 2449 2397 1097 1079 393 ------
NM_015009chr3164 ------
NM_015015chr1982044 1989 1831 1751 1677 620 599 56 --1653 --
NM_015017chr1149 ------
NM_015023chr1131724 1698 1678 1611 1296 1233 1143 688 607 557 213 52 29 --11811 21745 638
NM_015024chr81594 11034 1944 --
NM_015026chr1214745 ------
NM_015033chr9142779 2426 2415 2272 2159 1312 1283 1250 698 262 171 155 119 22 32701 2100 106 2163 81 --
NM_015035chr2086306 6038 5936 5374 5036 4950 4750 2418 1141 22448 1458 12239
NM_015037chr101200 ------
NM_015042chr1563926 3838 3268 2673 1617 382 --13689 --
NM_015045chr1021593 763 ------
NM_015064chr1282235 1459 1418 1269 670 371 350 321 --11017 --
NM_015068chr711563 --13314 --
NM_015069chr16--129 ----
NM_015074chr144752 3949 1671 1180 1593 13730 --
NM_015075chrX102005 1978 1853 1824 1752 1538 704 417 47 35 2831 570 31644 323 318 32060 1650 288
NM_015080chr116913 266 207 198 159 75 ------
NM_015092chr1611619 21844 163 ----
NM_015094chr22174109 3952 3904 3755 3707 3620 3449 3149 2929 2897 2869 1682 1128 443 385 247 112 --34270 3433 832 --
NM_015099chr173473 278 39 --3561 268 194 --
NM_015100chr111578 ------
NM_015101chr142379 1877 872 831 12832 12764 --
NM_015102chr1182 ----167
NM_015103chr33847 167 77 1992 2666 331 --
NM_015107chrX3851 321 89 --21505 935 --
NM_015125chr191507 ------
NM_015133chr1671321 1125 555 435 398 378 58 11214 11268 11444
NM_015138chr1511725 131 ----
NM_015144chr1613344 ------
NM_015150chr31326 ------
NM_015155chr1042889 890 817 472 1427 33145 3112 824 --
NM_015156chr1423304 287 ------
NM_015163chr142185 42 ------
NM_015170chr8--1339 ----
NM_015178chr882592 1695 979 833 811 261 177 27 11963 ----
NM_015185chrX32617 1098 675 ----1600
NM_015193chr8131489 1443 1394 1318 1108 1096 1023 578 508 483 425 127 99 1200 31176 998 946 11284
NM_015194chr1751978 1519 1474 444 351 1364 3309 228 125 --
NM_015213chr111266 147 ----
NM_015219chr1751689 1619 1594 926 482 12025 1990 --
NM_015229chr175982 946 936 286 134 --137 1167
NM_015233chr1382628 2564 2240 2204 162 148 92 28 ------
NM_015250chr92388 35 ------
NM_015252chr21644 ------
NM_015254chr862745 2546 2483 2056 570 69 2499 461 32442 2148 55 --
NM_015265chr222499 2052 ------
NM_015270chr122855 107 22196 1676 ----
NM_015272chr16--11856 ----
NM_015284chr121459 853 22106 1678 1785 --
NM_015288chr592495 1138 1120 660 628 401 254 231 215 22755 1101 43312 259 241 29 13750
NM_015296chr13----11208 --
NM_015299chr1463670 3045 1579 1300 455 30 13619 ----
NM_015305chr1451785 1446 742 390 238 ------
NM_015310chr857263 7227 6781 5651 580 47839 7562 2967 1465 --17110
NM_015313chr1121178 688 21627 939 ----
NM_015315chr582991 2750 2202 2111 1398 1183 1121 552 --31215 437 349 --
NM_015317chr21209 ------
NM_015318chr1941727 1662 1654 1421 ------
NM_015319chr122330 161 ------
NM_015326chr142700 1950 808 136 --12526 --
NM_015332chr7103550 3537 3482 2956 2237 1383 1110 614 331 26 22820 76 ----
NM_015335chr1212221 145 ----
NM_015338chr201406 ------
NM_015343chr172132 77 ------
NM_015356chr8----141 --
NM_015361chr2139 ------
NM_015365chrX1386 ------
NM_015374chr223965 595 56 --21408 1213 --
NM_015378chr162339 2327 2085 1203 965 282 --22457 2434 12333
NM_015385chr1031292 741 634 ------
NM_015388chr6--137 ----
NM_015393chr42600 108 22975 453 ----
NM_015443chr171250 ------
NM_015444chr32226 58 ------
NM_015457chr112281 184 ------
NM_015472chr31102 ------
NM_015472chr31102 ------
NM_015477chr151246 ------
NM_015481chr124805 754 218 211 --2799 759 --
NM_015483chr71281 ------
NM_015488chr241510 1334 538 379 3554 209 36 ----
NM_015493chr1942000 895 160 55 --1537 --
NM_015497chr151972 ------
NM_015503chr163186 168 151 ------
NM_015511chr2011103 --21006 906 --
NM_015526chr1941406 1264 1161 66 ------
NM_015545chr71104 1630 1308 1581
NM_015550chr71832 23128 2527 ----
NM_015557chr1193513 3468 3109 3103 3064 2803 2736 2662 1298 1234 1012 997 959 869 799 766 570 457 271 12221 1986 --
NM_015568chr2053790 1305 603 178 70 23994 667 --11446
NM_015609chr142698 2163 1905 1057 22934 2882 52723 2683 2678 2668 143 --
NM_015638chr20191 --2618 70 --
NM_015651chr91287 --1135 --
NM_015680chr2----188 --
NM_015686chrX72430 2244 1766 1720 955 322 311 --11818 1363
NM_015704chr22----124 --
NM_015716chr171548 151 ----
NM_015831chr75921 771 615 599 278 --2776 604 --
NM_015850chr86982 965 595 458 274 63 21934 394 ----
NM_015872chr131337 705 591 --3684 596 376 --
NM_015874chr41135 1147 ----
NM_015898chr19132121 2024 1788 1577 1537 826 633 616 604 524 447 377 230 42513 1748 327 221 ----
NM_015906chr1----13344 --
NM_015933chr3169 ------
NM_015964chr162101 40 --121 --
NM_016022chr12443 298 --1372 --
NM_016032chrX41128 1069 960 245 --11178 --
NM_016037chr111031 --1862 --
NM_016045chr20----1394 --
NM_016072chr1211763 ------
NM_016081chr411470 ------
NM_016083chr623154 2816 ----1745
NM_016084chr171175 ------
NM_016107chr51203 ------
NM_016131chr2139 1773 ----
NM_016140chr162101 40 --121 --
NM_016147chr114957 273 226 94 --1411 --
NM_016148chr19----2121 27 --
NM_016169chr1083080 2179 2135 696 597 356 263 203 22485 134 ----
NM_016194chr1511467 --21619 1558 --
NM_016216chr31113 ------
NM_016223chr11184 ------
NM_016235chr161205 1249 ----
NM_016257chr1--22890 181 12857 --
NM_016260chr227286 6537 ------
NM_016272chr222742 349 21745 495 1536 1164
NM_016281chr121192 168 ----
NM_016289chr222335 402 ------
NM_016290chr5------1106
NM_016316chr21613 ------
NM_016320chr112124 59 ------
NM_016329chr3161 ------
NM_016364chr10156 ------
NM_016376chr1773017 2939 2918 1720 1159 507 372 1869 11129 --
NM_016396chr1522053 107 ------
NM_016418chr2283467 2912 1134 955 623 470 441 35 --13452 --
NM_016423chr143465 376 40 ------
NM_016427chr181154 ------
NM_016429chr172193 25 ------
NM_016436chr2022256 786 --1529 --
NM_016453chr3--126 ----
NM_016472chr14--1485 ----
NM_016496chr191460 2107 24 ----
NM_016505chr1--1236 ----
NM_016507chr17--1689 ----
NM_016522chr1111342 11081 11324 --
NM_016530chr1512500 ------
NM_016531chr434096 3213 420 ------
NM_016547chr14527 258 239 228 --2210 177 1675
NM_016559chr311525 ----11003
NM_016574chr114808 726 217 44 1434 11011 2746 129
NM_016588chr62344 22 ------
NM_016604chr5------11177
NM_016605chr542193 262 245 116 ------
NM_016621chr11164141 4031 3629 3565 3320 3292 3265 3249 3142 2853 1444 1162 758 725 675 611 33730 3607 662 ----
NM_016631chr211747 ------
NM_016823chr171426 ------
NM_016834chr1763449 2852 1224 1108 405 84 2877 109 23023 1626 --
NM_016835chr1763449 2852 1224 1108 405 84 2877 109 23023 1626 --
NM_016841chr1763449 2852 1224 1108 405 84 2877 109 23023 1626 --
NM_016929chr633258 945 26 --1690 --
NM_016932chr24768 669 581 85 1894 2807 79 --
NM_016938chr112380 306 128 ----
NM_016952chr1173665 2854 2795 2769 677 546 520 12826 23831 3041 --
NM_017409chr12245 29 ------
NM_017413chrX42022 369 311 299 1107 11877 --
NM_017420chr14--12873 13259 --
NM_017447chr21----129 --
NM_017450chr1751474 1325 1294 1200 553 1299 11330 --
NM_017456chr1781762 1576 1425 1319 762 717 498 341 2363 58 21380 108 --
NM_017457chr19----143 --
NM_017514chrX8881 858 793 777 743 285 251 98 ----1187
NM_017548chr3--11906 ----
NM_017551chr101580 --12109 --
NM_017553chr1531158 999 815 1376 182 --
NM_017563chr334623 4039 1424 --11684 12221
NM_017575chr1741599 580 311 28 ------
NM_017582chr111743 ------
NM_017590chr2262179 1848 1647 628 163 137 --1208 --
NM_017602chrX2375 217 3255 239 160 --1902
NM_017607chr194477 345 90 66 --1394 --
NM_017633chr6----12429 --
NM_017634chr811917 ------
NM_017637chr947871 6961 6058 6052 27914 7111 --18491
NM_017649chr1041203 1125 59 45 1110 ----
NM_017662chr9----137 --
NM_017668chr162709 588 ------
NM_017670chr114785 700 236 177 1793 128 --
NM_017679chr172657 42 --164 --
NM_017715chr71484 ------
NM_017721chr192306 47 1318 1144 --
NM_017728chr1782857 2607 1891 1197 763 657 640 58 1340 12663 --
NM_017739chr13392 173 160 ------
NM_017741chr42336 111 ------
NM_017749chr113407 323 187 1710 ----
NM_017753chr91166 ------
NM_017758chr1731513 1089 602 ----1518
NM_017766chr1278 37 --126 --
NM_017778chr8--11195 ----
NM_017784chr3136 ------
NM_017789chr22824 664 ----1202
NM_017801chr3161 142 12074 --
NM_017811chr91281 --132 --
NM_017813chr825804 5379 ------
NM_017814chr193215 83 27 ------
NM_017848chrX24478 155 ------
NM_017849chr273135 2720 2622 552 503 394 169 ------
NM_017893chr1031454 563 413 --1468 1258
NM_017902chr1075444 5327 2004 1535 1327 1173 240 --13814 --
NM_017919chr934678 730 199 15009 ----
NM_017955chr143910 248 104 --11120 --
NM_017994chr71209 --12625 --
NM_018008chr31254 ------
NM_018027chr1021008 558 2238 197 ----
NM_018028chr194914 517 310 75 ------
NM_018047chr51856 ------
NM_018070chr11115 --1503 --
NM_018071chr14185 --1156 --
NM_018077chr72137 76 ------
NM_018096chr175991 979 791 179 62 --2770 722 --
NM_018110chr162966 880 --11236 --
NM_018111chr19126 ------
NM_018121chr101689 ------
NM_018133chr3----11836 --
NM_018155chr313284 ------
NM_018156chr162339 2327 2085 1203 965 282 --22457 2434 12333
NM_018178chr1132 ------
NM_018198chr181395 957 910 367 325 293 284 277 ------
NM_018203chr12673 29 ------
NM_018207chr141622 1444 339 270 --157 --
NM_018208chr13772 739 223 --1397 --
NM_018223chr122786 189 --1285 --
NM_018240chr12565 158 ------
NM_018243chr422876 2680 128 ----
NM_018244chr201243 182 ----
NM_018263chr252105 1791 732 709 625 1839 11796 --
NM_018275chr7164 1372 ----
NM_018299chr8--22621 962 ----
NM_018315chr4150 163 ----
NM_018322chr6--1931 ----
NM_018354chr20489 79 64 58 ------
NM_018362chr1123416 3246 ------
NM_018371chr81180 ------
NM_018383chr231324 193 102 ------
NM_018388chrX11483 ------
NM_018403chr313558 ----1629
NM_018416chr1222510 90 ------
NM_018419chr20150 242 27 ----
NM_018425chr1071702 1658 661 620 313 190 134 --12175 --
NM_018426chr63213 202 113 ------
NM_018440chr875718 5694 974 618 245 206 132 ------
NM_018469chr17--1172 ----
NM_018471chr21548 ------
NM_018476chrX144 ------
NM_018482chr831884 1824 194 ------
NM_018486chrX1433 ------
NM_018489chr11749 1876 ----
NM_018490chr11129 ------
NM_018534chr2282 59 ------
NM_018571chr21642 ------
NM_018584chr111159 ------
NM_018644chr1142094 2086 865 532 2392 305 --2640 355
NM_018652chr15130 ------
NM_018660chr822240 2068 --136 --
NM_018667chr1631994 1065 533 22262 398 11810 --
NM_018679chr6121 ------
NM_018715chr142141 1541 906 523 ----11998
NM_018718chr752138 1930 735 568 399 ------
NM_018837chr201207 1703 ----
NM_018841chr123348 24 ------
NM_018898chr54327 320 266 76 --1293 --
NM_018899chr54327 320 266 76 --1293 --
NM_018900chr54327 320 266 76 --1293 --
NM_018901chr54327 320 266 76 --1293 --
NM_018902chr54327 320 266 76 --1293 --
NM_018903chr54327 320 266 76 --1293 --
NM_018904chr54327 320 266 76 --1293 --
NM_018905chr54327 320 266 76 --1293 --
NM_018906chr54327 320 266 76 --1293 --
NM_018907chr54327 320 266 76 --1293 --
NM_018908chr54327 320 266 76 --1293 --
NM_018909chr54327 320 266 76 --1293 --
NM_018910chr54327 320 266 76 --1293 --
NM_018911chr54327 320 266 76 --1293 --
NM_018951chr71100 ------
NM_018952chr172217 157 ------
NM_018953chr123757 183 52 ----1257
NM_018976chr121119 ------
NM_018979chr1252082 641 454 385 178 11662 11977 --
NM_018999chr101308 --1526 --
NM_019046chr102633 362 ------
NM_019057chr5144 ------
NM_019064chr173777 600 564 ------
NM_019087chr5--21359 248 ----
NM_019096chr62221 137 --172 --
NM_019102chr72107 44 ------
NM_019102chr72107 44 ------
NM_019106chr2222196 1012 12144 ----
NM_019114chr922431 1859 ------
NM_019593chr2022081 2050 --12848 --
NM_019605chr1--1609 ----
NM_019606chr7140 ------
NM_019610chr111555 ------
NM_019613chr173926 904 505 --1287 --
NM_019843chr22160 ------
NM_019849chr19----1182 --
NM_019862chr1661440 566 389 251 238 172 ------
NM_019884chr19188 --1437 --
NM_019898chr1661440 566 389 251 238 172 ------
NM_019899chr1661440 566 389 251 238 172 ------
NM_019900chr1661440 566 389 251 238 172 ------
NM_020039chr1231276 622 86 11253 ----
NM_020063chr1277 45 ------
NM_020121chr13176 ------
NM_020130chr81207 1269 ----
NM_020132chr21133709 3671 3647 3615 3384 1629 638 588 456 395 279 254 32 11706 1509 23342 1069
NM_020142chr123575 530 510 172 1107 --
NM_020144chr7--1183 ----
NM_020145chr93225 219 128 124 2191 61 --
NM_020151chr231491 670 41 ------
NM_020163chr341682 1527 575 187 1466 --12092
NM_020178chr171862 ------
NM_020180chr1821343 1190 ------
NM_020182chr2083520 3363 2981 2296 1432 1036 738 55 23030 801 ----
NM_020184chr281834 1483 865 773 386 199 32 23 --21563 879 --
NM_020205chr123421 3365 ------
NM_020211chr1571386 1177 1068 1029 617 246 32 2352 258 1251 1110
NM_020214chr15189 ------
NM_020228chr1111759 11611 ----
NM_020248chr152097 1937 1813 317 122 --1127 --
NM_020309chr193703 343 84 1832 11086 --
NM_020310chr17102035 1928 1847 1837 1810 863 791 717 340 179 21970 799 2350 345 --
NM_020336chr2021142 1112 ------
NM_020338chr1092962 2922 2344 1322 479 408 400 333 139 22768 2332 11488 1100
NM_020342chr2--1172 ----
NM_020346chr11----11558 --
NM_020381chr62778 614 ------
NM_020416chr452585 799 526 162 24 ------
NM_020423chr11185 ------
NM_020429chr762569 2473 2244 2107 324 93 --12058 --
NM_020433chr2041649 419 299 263 1540 21472 109 --
NM_020441chr11134 ------
NM_020452chr141369 449 313 21 --21463 318 --
NM_020457chr161197 ------
NM_020465chr162688 419 11710 ----
NM_020473chrX31895 603 570 ------
NM_020475chr8102241 2219 2201 2177 2108 1956 1889 1802 1776 1550 12187 41755 1643 1634 1544 --
NM_020476chr8102241 2219 2201 2177 2108 1956 1889 1802 1776 1550 12187 41755 1643 1634 1544 --
NM_020477chr8102241 2219 2201 2177 2108 1956 1889 1802 1776 1550 12187 41755 1643 1634 1544 --
NM_020478chr8102304 2282 2264 2240 2171 2019 1952 1865 1839 1613 12250 41818 1706 1697 1607 --
NM_020480chr8102241 2219 2201 2177 2108 1956 1889 1802 1776 1550 12187 41755 1643 1634 1544 --
NM_020525chr122145 44 ------
NM_020631chr131335 1120 129 --31377 1325 335 --
NM_020689chr2031180 170 128 --11342 --
NM_020699chr155070 4933 3418 1329 960 --2175 170 --
NM_020703chr1----1235 --
NM_020706chr21----1103 --
NM_020708chr20121589 714 638 609 468 386 374 256 126 71 59 49 11848 2990 181 --
NM_020713chr20173109 3103 3092 2890 2871 2802 2615 2438 1185 895 865 786 660 634 555 108 70 --73097 3054 2876 2555 676 353 338 --
NM_020718chr1655489 5363 1870 996 58 ------
NM_020724chr432519 1897 122 ------
NM_020737chr62258 233 ------
NM_020742chrX31847 948 323 ------
NM_020750chr651051 1017 371 318 154 ------
NM_020753chr175759 709 516 211 71 --1266 --
NM_020765chr13257 111 88 ------
NM_020766chrX2953 552 ------
NM_020772chr1748366 7148 6128 1265 --21720 527 11949
NM_020782chr1233873 3570 3035 14621 ----
NM_020795chr1771852 1794 1241 553 547 277 147 ------
NM_020796chr532530 1855 82 ------
NM_020807chr1641439 1372 1360 341 --163 --
NM_020814chr251260 1184 1174 280 127 ------
NM_020825chr1683610 3558 2747 1464 699 591 424 301 21352 98 23565 3551 --
NM_020830chr213213 ------
NM_020831chr227979 946 884 769 413 215 119 --1795 --
NM_020832chr14450 444 438 189 1491 ----
NM_020836chr149663 618 593 499 203 155 98 87 38 1133 1771 --
NM_020841chr1211386 ------
NM_020845chr12122466 1887 1826 1699 1646 987 930 744 647 596 291 155 12476 5940 668 520 160 58 --
NM_020850chr1632738 2671 178 11233 161 --
NM_020856chr1911514 ------
NM_020858chr1511644 ------
NM_020870chr41488 ------
NM_020888chr162014 1799 1684 1399 305 297 ------
NM_020895chr19156 ------
NM_020898chr122313 143 1644 ----
NM_020899chr172499 80 12511 ----
NM_020940chr1012898 ------
NM_020946chr94356 237 175 74 1677 --1410
NM_020951chr1921871 1742 ------
NM_020956chr19214644 4413 4309 4262 4209 4134 3662 3647 1416 1352 1270 1138 1039 780 756 745 700 651 500 367 267 --21282 1046 --
NM_020962chr1551938 872 688 554 364 --1954 --
NM_020963chr11146 ------
NM_020967chr2021149 1083 ------
NM_020971chr193613 542 315 2739 536 --1619
NM_020972chr4--1171 ----
NM_020974chr11--1488 ----
NM_020977chr411723 ------
NM_020983chr122855 107 22196 1676 ----
NM_021005chr15----1859 --
NM_021012chr1792814 2335 2104 2072 1246 895 586 99 70 1844 33093 994 52 --
NM_021020chr8112720 2634 2546 2494 2462 2183 792 608 553 214 71 23233 2948 12482 1192
NM_021025chr54455 386 206 57 --2211 181 --
NM_021033chr1322597 1215 ----12385
NM_021035chr2041051 473 211 32 ------
NM_021064chr611401 1578 31237 446 418 --
NM_021069chr431372 349 72 ------
NM_021078chr17276 24 ------
NM_021097chr212175 ------
NM_021103chr22192 26 ------
NM_021104chr121206 ------
NM_021106chr96591 286 254 214 68 52 --1196 --
NM_021120chrX----1905 --
NM_021132chr1021266 166 ------
NM_021135chr6102500 864 691 573 255 207 153 125 65 31 --33205 2260 2255 --
NM_021149chr164993 436 177 160 ------
NM_021155chr1972868 2529 1923 1031 999 984 818 11174 12601 --
NM_021183chrX--12548 ----
NM_021189chr13310 104 38 1704 ----
NM_021195chr161551 --2584 24 --
NM_021200chr1131119 87 29 ------
NM_021253chr61904 1371 ----
NM_021255chr141733 12896 ----
NM_021259chr167915 797 468 446 402 181 82 1780 --11036
NM_021260chr1411317 2361 118 11343 --
NM_021267chr19141256 1059 943 911 436 361 339 296 240 222 180 132 62 21 1532 51277 972 387 327 203 --
NM_021569chr9111117 1044 1038 995 877 870 787 478 457 179 87 137 2823 190 11001
NM_021575chr193203 172 27 ------
NM_021622chr101539 ------
NM_021627chr31480 190 ----
NM_021638chr443445 900 415 334 23964 1353 --14057
NM_021738chr101152 ------
NM_021813chr664394 4011 1829 1448 1318 86 ------
NM_021814chr61217 ------
NM_021912chr15----13127 --
NM_021923chr451419 1116 1104 1092 1051 ----11505
NM_021926chr112224 216 --1157 --
NM_021943chr641886 1841 1453 755 12018 1749 --
NM_021945chr653337 3325 2870 2658 1240 ------
NM_021946chrX61310 1012 946 362 342 267 --11414 --
NM_021949chrX62687 1158 260 164 158 104 ----1857
NM_021960chr1----12112 --
NM_021961chr1166050 5160 1778 324 125 119 --25293 2760 --
NM_021962chr1761901 1002 848 631 562 248 --1433 --
NM_021963chrX121 ------
NM_021964chr3--16456 ----
NM_021967chr521255 437 --1998 --
NM_021971chr32172 29 ------
NM_021973chr41188 --195 --
NM_021984chrX1559 ------
NM_021987chrX1559 ------
NM_021988chr202586 394 1411 ----
NM_021990chrX1559 ------
NM_022003chr1161215 1191 1124 865 391 385 31058 921 806 ----
NM_022006chr194279 150 34 22 1295 ----
NM_022051chr11274 ------
NM_022060chr1431162 1074 919 ------
NM_022062chr1131223 1209 608 ----1356
NM_022073chr141108 ------
NM_022085chr621103 46 140 ----
NM_022119chr164314 229 90 75 --1250 --
NM_022123chr141428 --134 --
NM_022166chr1655453 4157 2090 1969 1016 1218 1569 11527
NM_022169chr1131462 1320 454 ----132
NM_022338chr111257 ------
NM_022343chr91843 --11173 --
NM_022442chr202586 394 1411 ----
NM_022458chr711947 12866 ----
NM_022459chr1326156 4258 ------
NM_022463chr1751205 1068 446 382 93 11575 21169 345 --
NM_022477chr2011461 ------
NM_022497chr32359 201 --2794 745 --
NM_022572chr241510 1334 538 379 3554 209 36 ----
NM_022574chr782124 2053 2042 2024 1984 1797 1601 1455 186 1455 --
NM_022640chr171186 ------
NM_022648chr2104408 4113 3838 3682 3039 1834 1243 1174 1037 874 ------
NM_022658chr1241321 1312 371 278 ------
NM_022737chr196404 359 213 138 108 96 --259 50 --
NM_022748chr742598 2576 2236 46 ----12258
NM_022755chr931912 514 253 --2965 932 --
NM_022756chr1----142 --
NM_022758chr653070 2583 2538 2163 1231 --33075 1223 542 --
NM_022780chr21322 ------
NM_022822chr113732 347 165 --6766 712 668 616 87 63 1674
NM_022841chr1512629 178 ----
NM_022842chr333179 2074 310 22410 889 --12549
NM_022843chr13------11133
NM_022893chr222978 1057 ------
NM_022898chr1473533 3428 3210 2981 903 706 102 196 --24447 24
NM_022910chr162688 419 11710 ----
NM_022912chr2--1682 ----
NM_022978chr521255 437 --1998 --
NM_023009chr1182 1294 1482 --
NM_023019chr2----1119 --
NM_023035chr191228 ----1169
NM_023067chr341114 422 413 62 --1522 --
NM_023076chr1652512 1060 815 765 741 --22599 154 --
NM_023079chr1741616 1234 505 140 11290 21749 1402 --
NM_023105chr86982 965 595 458 274 63 21934 394 ----
NM_023106chr86982 965 595 458 274 63 21934 394 ----
NM_023110chr86982 965 595 458 274 63 21934 394 ----
NM_023111chr86982 965 595 458 274 63 21934 394 ----
NM_023925chr12----1217 --
NM_023927chr531202 350 88 ------
NM_024003chrX2591 111 ------
NM_024007chr512963 ------
NM_024016chr176323 265 157 142 78 52 --199 --
NM_024019chr42100 81 ------
NM_024043chr1661189 1097 892 442 305 155 11242 1935 --
NM_024046chr341199 438 412 101 31324 1241 224 --1367
NM_024050chr194605 117 98 82 ------
NM_024056chr121639 ------
NM_024085chr21862 2410 312 2888 53 --
NM_024293chr22323 285 1688 ----
NM_024294chr653070 2583 2538 2163 1231 --33075 1223 542 --
NM_024297chr171235 ------
NM_024306chr166825 764 454 250 154 40 1840 --1125
NM_024423chr1811149 ------
NM_024424chr111216 --1189 --
NM_024425chr111216 --1189 --
NM_024426chr111216 --1189 --
NM_024494chr12225 172 ------
NM_024507chr16359 40 24 --1119 --
NM_024511chr422939 754 ------
NM_024522chr131433 516 126 --21749 31 --
NM_024551chr1252043 961 635 114 65 ------
NM_024551chr1252043 961 635 114 65 ------
NM_024567chr81265 ------
NM_024582chr4--1211 ----
NM_024607chr894021 3501 3219 3198 2982 1200 672 476 392 11612 1115 --
NM_024617chr91900 ----1870
NM_024652chr154809 460 449 404 ------
NM_024659chr21187 ------
NM_024676chr151149 948 386 368 218 1169 ----
NM_024689chrX21512 234 ------
NM_024698chr1161150 1128 1111 1061 269 254 --21155 947 --
NM_024704chr202204 57 ------
NM_024721chr81649 ------
NM_024742chr16161684 1586 1516 1362 1331 1257 768 738 710 587 535 507 406 145 88 74 --11212 --
NM_024751chr411797 1165 ----
NM_024757chr93439 352 154 --1449 --
NM_024770chr255689 4920 4580 1670 847 15662 ----
NM_024811chr1111906 11561 ----
NM_024830chr592121 1591 1412 309 262 245 229 137 35 --2290 84 --
NM_024874chr121273 112 --11090 --
NM_024877chr1951092 1046 1036 835 175 2821 37 31183 1101 1014 --
NM_024884chr1444473 4408 4064 1221 ------
NM_024887chr131453 865 778 --131 --
NM_024909chr661440 1339 565 526 469 462 ------
NM_024923chr33111 70 43 11280 ----
NM_024948chr101693 ------
NM_024954chr104494 244 137 57 --132 --
NM_024991chr1031292 741 634 ------
NM_025054chr812742 ------
NM_025073chr124507 1570 11801 ----
NM_025083chr1541858 1401 416 37 1254 ----
NM_025109chr17144 --1150 --
NM_025138chr131408 ------
NM_025140chr124415 245 175 22 ------
NM_025158chr5------1473
NM_025160chr1------1647
NM_025176chr201158 1133 ----
NM_025179chr123202 413 --43784 1920 1883 984 --
NM_025182chr92418 175 ------
NM_025184chrX--1832 ----
NM_025191chr111365 1252 ----
NM_025221chr4----11338 --
NM_025222chr352581 1225 931 773 646 21218 444 ----
NM_025224chr2092151 2046 2030 1627 934 737 688 655 609 --41769 553 154 34 --
NM_025236chr61183 1636 --144
NM_025237chr175405 323 147 43 37 --1253 --
NM_025248chr17123199 3192 3035 3021 2898 2761 2755 2133 567 372 121 107 12722 42814 2249 1213 24 11223
NM_025251chr8121189 1150 807 465 440 384 359 276 257 236 138 104 159 31168 1114 250 --
NM_030576chr17122460 2187 2016 1949 1880 1708 842 827 712 676 531 226 2492 178 --11886
NM_030594chr15173 ------
NM_030621chr1433287 2689 2606 --23437 1551 --
NM_030629chr1691286 1229 1197 639 618 440 414 185 102 11864 ----
NM_030647chr7181 ------
NM_030661chr71127 --11245 2269 133
NM_030665chr1761244 1101 505 446 182 140 ------
NM_030761chr132591 1088 513 ------
NM_030762chr12--1200 1501 --
NM_030795chr8--1472 171 --
NM_030798chr72688 115 --129 --
NM_030802chr172683 143 ------
NM_030805chr221217 506 2244 155 ----
NM_030808chr173846 793 167 1110 2158 89 --
NM_030809chr1221961 1549 ------
NM_030810chr621103 46 140 ----
NM_030815chr203569 541 97 ------
NM_030816chr123712 2512 ------
NM_030884chr372192 925 897 405 371 168 36 12210 2692 328 --
NM_030906chr11----1126 --
NM_030913chr15518 495 263 148 92 --1553 198
NM_030916chr11736 ------
NM_030920chr11814 ------
NM_030923chr21228 ------
NM_030935chr72144 90 ------
NM_030952chr13982 400 137 --1206 --
NM_030954chr81759 ------
NM_030957chr194582 152 79 42 1144 1525 155
NM_030964chr573541 2843 2806 2502 2412 629 374 --11352 --
NM_030981chr1171123 973 886 473 407 169 162 --11072 --
NM_030984chr7156 ------
NM_031205chr121388 1164 ----
NM_031216chr18--11752 ----
NM_031231chr204278 269 37 28 --1486 --
NM_031232chr204278 269 37 28 --1486 --
NM_031268chr16114057 3676 1832 1812 1421 848 818 720 626 443 239 14674 51692 1318 481 374 304 --
NM_031286chr1126 ----1343
NM_031297chr9----267 38 --
NM_031309chr892260 2230 1775 754 634 507 346 188 141 1791 2765 146 1640
NM_031314chr14--11929 1162 --
NM_031411chr54327 320 266 76 --1293 --
NM_031417chr1961030 961 518 224 175 32 ------
NM_031432chr941152 1090 749 32 ------
NM_031439chr831518 1509 32 21466 205 ----
NM_031444chr2271731 1613 719 624 576 284 72 21672 778 1610 --
NM_031445chr242666 732 147 33 22393 379 12497 --
NM_031453chr1011957 ----1212
NM_031455chr1021262 299 11670 ----
NM_031468chr787439 3131 2844 2757 2712 2077 901 572 1701 25221 1932 --
NM_031478chr16143 --1648 --
NM_031483chr2022412 2256 ------
NM_031492chr11----167 --
NM_031849chr54327 320 266 76 --1293 --
NM_031857chr54327 320 266 76 --1293 --
NM_031860chr54327 320 266 76 --1293 --
NM_031866chr102755 248 ------
NM_031890chr2242637 2209 2149 1894 --1552 --
NM_031892chrX1929 ------
NM_031911chr41285 ------
NM_032013chr2011461 ------
NM_032017chr171904 1308 850 618 459 443 80 --11331 --
NM_032042chr552795 2658 413 302 32 --1270 --
NM_032052chr221146 --2969 246 --
NM_032108chr192146 114 ------
NM_032109chr510490 465 410 318 301 223 195 135 54 42 11247 5119 102 97 92 26 --
NM_032147chr1211034 ------
NM_032153chr3----137 155
NM_032156chr12----1217 --
NM_032192chr172217 97 ------
NM_032193chr1151847 816 739 464 373 11839 11303 --
NM_032199chr1023425 1275 ------
NM_032207chr1981211 1078 983 968 802 438 293 208 ------
NM_032236chr11953 ------
NM_032268chr1632251 475 49 --1430 12097
NM_032281chr1992744 2587 2560 2514 2157 1174 1140 211 138 22834 2534 ----
NM_032288chr31175 ----11467
NM_032294chr1771391 1380 1275 455 394 120 45 186 1615 --
NM_032298chr193438 340 122 ------
NM_032353chr171426 ------
NM_032375chr1910795 718 711 619 571 231 200 151 57 22 1688 2135 39 --
NM_032389chr111993 11152 ----
NM_032420chr53762 745 623 ------
NM_032429chr103583 401 208 ------
NM_032430chr19------1130
NM_032431chr112241 48 ------
NM_032432chr481485 1422 1388 1042 1016 335 329 220 1153 ----
NM_032440chr101817 ------
NM_032444chr163759 369 52 1842 ----
NM_032452chr1411204 11315 ----
NM_032458chrX11155 ------
NM_032488chr19122 --196 --
NM_032499chr1531199 1191 95 ------
NM_032508chrX41335 1307 290 51 179 ----
NM_032514chr203370 281 42 --154 --
NM_032521chr2032224 1110 731 ------
NM_032538chr672642 1975 1100 520 299 260 237 21143 751 2205 171 --
NM_032547chr411117 ------
NM_032552chr991688 1649 1506 1450 1432 1412 1247 365 84 2445 345 31379 680 139 11696
NM_032569chr163746 678 662 ------
NM_032578chr1031336 1144 296 ------
NM_032580chr172413 201 ------
NM_032581chr731664 611 106 ------
NM_032582chr171120 11366 ----
NM_032595chr1761481 1223 614 513 402 110 --21079 992 1622
NM_032621chrX140 ------
NM_032638chr331244 1170 593 1193 ----
NM_032645chr112164 32 ------
NM_032682chr322578 1282 ------
NM_032687chr8----135 --
NM_032689chr1911470 ----1628
NM_032711chr17104188 3982 3930 3675 3313 3262 2908 674 516 66 1128 64193 3991 3816 2803 663 350 --
NM_032737chr1972292 2266 911 902 733 571 201 1656 32547 2369 346 --
NM_032741chr63925 207 71 1719 1726 --
NM_032777chr851446 441 413 325 52 11096 ----
NM_032781chr113681 236 94 --169 --
NM_032786chr121500 ----136
NM_032833chr131843 1677 185 12348 ----
NM_032836chr1951009 654 177 120 87 --123 --
NM_032840chr1241152 813 314 33 11029 1897 --
NM_032842chr72596 177 ------
NM_032846chr1431492 1474 412 ------
NM_032871chr113274 264 256 --51224 676 226 214 34 --
NM_032875chr171318 ------
NM_032926chrX----152 --
NM_032951chr74195 189 105 36 ------
NM_032953chr74195 189 105 36 ------
NM_032968chrX14026 ------
NM_032969chrX14026 ------
NM_032973chrY14018 ------
NM_032995chr241565 663 463 415 --2547 516 --
NM_032998chr11104 3816 222 173 ----
NM_033016chr2241519 1345 478 393 1344 ----
NM_033018chrX51120 1112 833 136 83 --1920 --
NM_033020chr1----13344 --
NM_033023chr731069 939 875 1990 1330 --
NM_033027chr32950 740 ------
NM_033036chr114671 293 157 120 --137 --
NM_033044chr111073 ------
NM_033081chr202434 395 ------
NM_033102chr121226 56 ------
NM_033102chr121226 56 ------
NM_033103chr192917 29 ------
NM_033116chr141228 ------
NM_033129chr20121630 1619 1560 1432 1335 500 338 301 103 88 79 48 11755 2824 493 --
NM_033136chr521324 164 1361 --1614
NM_033137chr521324 164 1361 --1614
NM_033143chr424372 100 ------
NM_033161chr931812 1622 1322 1810 --1517
NM_033181chr623154 2816 ----1745
NM_033221chr9--136 1984 --
NM_033224chr737942 5182 1673 ------
NM_033225chr8--12538 ----
NM_033226chr16197 187 ----
NM_033244chr1581139 858 344 166 120 105 90 75 --1274 1906
NM_033259chr35853 790 333 88 27 2321 264 1338 141
NM_033285chr81806 21093 832 ----
NM_033305chr921320 945 ------
NM_033309chr162414 158 11016 ----
NM_033315chr17111878 1736 1697 1489 1430 1383 1375 730 668 200 107 1123 2462 187 --
NM_033317chr19288 31 ------
NM_033326chr1121674 519 ------
NM_033331chr943108 3095 2638 2445 11075 ----
NM_033360chr1211129 ------
NM_033375chr1731419 1219 515 ------
NM_033389chr1754444 4227 3722 810 411 ------
NM_033396chr111361 --1388 --
NM_033401chr161159 ------
NM_033405chr2031041 855 78 ------
NM_033419chr1751427 1409 1392 1227 43 --148 --
NM_033420chr1961035 988 213 175 140 90 2958 443 4979 909 391 187 --
NM_033448chr12196 --122 --
NM_033455chr112365 331 ------
NM_033496chr10----1218 --
NM_033497chr10----1218 --
NM_033498chr10----1218 --
NM_033500chr10----1218 --
NM_033504chr1--144 ----
NM_033551chr582991 2750 2202 2111 1398 1183 1121 552 --31215 437 349 --
NM_033624chr1232178 446 196 ------
NM_033632chr4150 163 ----
NM_033656chr21----15036 --
NM_048368chr183562 531 66 ------
NM_052818chr1311846 ------
NM_052837chr1----127 --
NM_052840chr151589 1290 ----
NM_052845chr12113213 3174 3143 2899 2887 2824 2774 2631 2397 2069 204 --12915 --
NM_052867chr13------21007 343
NM_052876chr1992500 2401 2085 1912 1861 567 501 380 361 --22339 1669 --
NM_052880chr222158 113 ------
NM_052885chr12----178 --
NM_052892chr16150 ------
NM_052896chr152059 2041 484 417 157 12142 2162 41 --
NM_052897chr123846 206 69 ------
NM_052906chr22134866 4358 4273 4267 3559 3542 3293 1709 1690 997 650 642 610 1622 ----
NM_052910chr1371732 1351 565 314 303 279 98 --1415 --
NM_052925chr194776 352 141 135 1728 ----
NM_052933chr7124 --129 --
NM_052934chr12306 255 1166 ----
NM_052937chr811910 --1588 --
NM_052968chr111526 ------
NM_052970chr202912 131 --142 --
NM_052971chr52427 50 ------
NM_052998chr11149 ------
NM_053023chr1122588 443 ------
NM_053024chr3--11469 ----
NM_053025chr31634 ------
NM_053026chr31634 ------
NM_053027chr31634 ------
NM_053028chr31634 ------
NM_053031chr31634 ------
NM_053032chr31634 ------
NM_053041chr202583 37 --2113 30 --
NM_053046chr19282 55 ------
NM_054013chr54894 570 183 37 --197 --
NM_054016chr11594 ------
NM_054016chr11594 ------
NM_054016chr11594 ------
NM_054025chr1142094 2086 865 532 2392 305 --2640 355
NM_054027chr57857 821 669 582 487 359 250 1370 ----
NM_054035chr172692 343 1159 ----
NM_057169chr1242153 2147 420 327 --12440 --
NM_057170chr1242153 2147 420 327 --12440 --
NM_057175chr411838 ------
NM_058004chr22178 --283 67 --
NM_058170chr111114 ------
NM_058175chr212602 65 2858 312 1189 --
NM_058229chr8139 ------
NM_058240chr142148 95 ------
NM_058241chr2193 ------
NM_058241chr2193 ------
NM_058243chr191316 --1204 1282
NM_079421chr19134 ------
NM_079834chr1991665 1648 1429 1395 644 546 537 416 69 1502 1577 --
NM_080415chr176942 839 705 638 603 34 ----167
NM_080538chr331398 999 409 --186 --
NM_080539chr331398 999 409 --186 --
NM_080541chr331398 999 409 --186 --
NM_080546chr9--12154 ----
NM_080594chr162309 154 ------
NM_080611chr202129 122 --1105 --
NM_080621chr2051297 1194 480 191 97 ----179
NM_080645chr6----11337 --
NM_080647chr226431 161 140 69 43 23 --1377 --
NM_080669chr1763618 3429 1984 1589 1577 727 --11558 13446
NM_080670chr55792 677 578 322 98 ------
NM_080730chr121879 135 ----
NM_080731chr121879 135 ----
NM_080732chr19282 55 ------
NM_080738chr111505 ------
NM_080743chr6--12209 ----
NM_080744chr72716 174 1589 2503 498 --
NM_080881chr54594 520 306 125 --197 --
NM_130385chr1132985 2895 205 --128 --
NM_130436chr2111731 ------
NM_130438chr2122308 412 ------
NM_130442chr72188 147 ------
NM_130459chr951359 1325 630 256 174 21424 420 3479 202 72 --
NM_130466chr12----1467 --
NM_130795chr96591 286 254 214 68 52 --1196 --
NM_130797chr741301 1286 1119 67 1225 11439 --
NM_130799chr114634 580 495 133 --2609 43 --
NM_130800chr114634 580 495 133 --2609 43 --
NM_130801chr114634 580 495 133 --2609 43 --
NM_130802chr114634 580 495 133 --2609 43 --
NM_130803chr114634 580 495 133 --2609 43 --
NM_130804chr114634 580 495 133 --2609 43 --
NM_130808chr31171 ------
NM_133170chr2067689 7139 2015 374 136 106 1473 ----
NM_133177chr12736 703 11069 --1378
NM_133178chr12736 703 11069 --1378
NM_133264chr1733335 3093 964 1222 1248 --
NM_133265chrX21323 591 ------
NM_133266chr112278 24 2795 315 2283 69 --
NM_133328chr192821 622 1310 1577 --
NM_133334chr455664 5060 3954 635 326 25871 1582 ----
NM_133369chr53728 722 158 --1755 1331
NM_133378chr21327 ------
NM_133432chr21327 ------
NM_133437chr21327 ------
NM_133445chr91144 --23661 2477 11052
NM_133498chr192115 95 ------
NM_133499chrX3794 354 122 ------
NM_133631chr31219 ------
NM_133647chr1543278 1300 919 907 ------
NM_134268chr1741027 987 934 869 --1330 --
NM_134421chr23677 550 107 ----182
NM_134427chr96591 286 254 214 68 52 --1196 --
NM_138300chr141594 1522 1410 43 1466 1239 11600
NM_138338chr2293109 3065 2436 2191 2137 1365 1290 1076 775 12768 32511 171 149 1864
NM_138356chr154577 571 291 42 --1451 --
NM_138360chr142201 88 ----144
NM_138375chr181831 1852 1247 --
NM_138376chr141129 ------
NM_138391chr12229 32 ------
NM_138415chr224714 689 187 48 11461 1303 --
NM_138423chr1522272 492 ------
NM_138430chr132427 380 ------
NM_138437chrX2275 50 ------
NM_138473chr1223585 162 ------
NM_138555chr151400 ------
NM_138576chr1473533 3428 3210 2981 903 706 102 196 --24447 24
NM_138619chr17121486 1367 1360 1304 1111 461 438 273 129 89 72 49 --1555 --
NM_138621chr223738 2934 1434 ----
NM_138689chr11187 ------
NM_138693chr7158 ------
NM_138713chr1637527 6798 5733 16304 ----
NM_138714chr1637527 6798 5733 16304 ----
NM_138732chr116913 266 207 198 159 75 ------
NM_138734chr116913 266 207 198 159 75 ------
NM_138795chr161457 571 285 270 224 65 11145 1251 --
NM_138799chr231937 1402 276 ------
NM_138959chr155267 1309 737 629 346 --45126 1365 1026 302 1685
NM_138967chr1552510 2220 2077 925 231 --1566 --
NM_138970chr14----1253 --
NM_138971chr1151451 1147 955 435 289 ------
NM_138971chr1151451 1147 955 435 289 ------
NM_138972chr1151451 1147 955 435 289 ------
NM_138972chr1151451 1147 955 435 289 ------
NM_138973chr1151451 1147 955 435 289 ------
NM_138973chr1151451 1147 955 435 289 ------
NM_138981chr41104 ------
NM_138994chr161159 ------
NM_139062chr171399 ------
NM_139068chr51104 ------
NM_139069chr51104 ------
NM_139071chr1271479 1409 1317 1076 1046 521 52 ------
NM_139132chr112124 59 ------
NM_139135chr1127 ------
NM_139136chr122176 142 ------
NM_139159chr1951164 260 156 131 52 --1112 --
NM_139170chr162541 463 1525 2223 33 --
NM_139201chr122538 274 ------
NM_139211chr4160 ------
NM_139212chr4160 ------
NM_139239chr19--1265 ----
NM_139276chr1752137 1647 1603 696 313 --12174 --
NM_139278chr861323 1089 485 475 424 153 ------
NM_139280chr1761393 1153 968 343 143 21 21380 387 ----
NM_139343chr21183 ----1415
NM_139344chr21183 ----1415
NM_139345chr21183 ----1415
NM_139346chr21183 ----1415
NM_139347chr21183 ----1415
NM_139349chr21183 ----1415
NM_139350chr21183 ----1415
NM_139351chr21183 ----1415
NM_144488chr96591 286 254 214 68 52 --1196 --
NM_144489chr96591 286 254 214 68 52 --1196 --
NM_144564chr19246 22 ------
NM_144568chr141267 ------
NM_144582chr252287 2221 971 734 106 --1301 --
NM_144583chr221684 1675 --11726 --
NM_144586chr23947 431 48 ------
NM_144590chr1022865 402 ------
NM_144617chr195895 189 134 88 72 ------
NM_144629chr2129 ------
NM_144631chr22195 62 ------
NM_144632chr2----1943 --
NM_144691chr191260 ------
NM_144707chr21106 ------
NM_144723chr52600 239 1305 ----
NM_144732chr1951053 371 80 61 34 ------
NM_144976chr192483 440 ------
NM_144982chr12----1225 --
NM_145008chr112553 130 132 157 --
NM_145013chr1162715 2021 1941 651 98 25 --1761 --
NM_145025chr61214 ------
NM_145065chr114437 417 362 95 ----11121
NM_145112chr1411104 --2385 354 --
NM_145113chr1421376 256 --1626 --
NM_145159chr143870 668 645 1821 ----
NM_145173chr19132530 2524 1772 926 876 848 664 656 346 197 157 148 46 12546 32398 2365 710 --
NM_145178chr10249 42 --156 --
NM_145206chr1052803 2326 746 477 460 ------
NM_145239chr16192 6363 343 289 269 224 204 ----
NM_145253chr164528 207 114 38 1683 1554 --
NM_145260chr23646 586 193 --2285 165 --
NM_145307chr1021271 634 ------
NM_145313chr1021296 1061 21149 1138 2365 210 --
NM_145320chr71832 23128 2527 ----
NM_145321chr71832 23128 2527 ----
NM_145322chr71832 23128 2527 ----
NM_145349chr1751998 861 742 633 597 --1350 --
NM_145690chr811589 ------
NM_145716chr11115 --1503 --
NM_145725chr14181 ------
NM_145726chr14181 ------
NM_145730chr223417 340 220 181 ----
NM_145798chr174824 258 123 90 --2813 778 --
NM_145805chr151201 246 35 ----
NM_145861chr111505 ------
NM_145912chr22154257 3834 3778 3616 3585 2918 1711 1647 1440 1268 1152 1017 825 58 32 43576 1509 1203 414 43706 1576 1434 320 11214
NM_147147chr611556 ------
NM_147164chr93526 499 472 --1173 --
NM_147181chr4----11338 --
NM_147182chr4----11338 --
NM_147183chr4----11338 --
NM_147189chr822291 321 ------
NM_147190chr121612 ------
NM_147192chr18617 563 557 467 445 420 129 52 1459 2193 134 --
NM_147193chr12329 50 1265 ----
NM_147202chr952353 2005 759 404 279 11944 2284 102 --
NM_147223chr22579 560 --1554 --
NM_148177chr8139 ------
NM_148414chr162320 164 ------
NM_152222chr113274 264 256 --51224 676 226 214 34 --
NM_152237chr22161410 1400 1272 1229 692 665 534 496 490 465 454 398 383 292 187 54 --1363 11454
NM_152253chr2294087 4072 3778 3339 3172 2903 1724 1558 112 --23910 2970 --
NM_152263chr135801 4115 1067 1207 15642 --
NM_152264chr114910 273 119 25 133 31001 820 342 --
NM_152268chr13775 559 21 ------
NM_152296chr192253 35 ------
NM_152310chr101230 ------
NM_152342chr163212 75 42 ------
NM_152344chr17----21503 1301 --
NM_152345chr17101013 979 944 818 740 721 456 226 196 22 --1118 --
NM_152346chr1771011 1001 989 366 314 218 177 1742 1139 --
NM_152384chr2111708 1614 1565 1438 1390 1358 1263 799 716 627 473 --61631 1533 1455 1407 1346 1280 --
NM_152399chr42325 115 ------
NM_152410chr61358 ------
NM_152441chr124584 218 146 101 ------
NM_152557chr72454 25 11398 150 --
NM_152590chr121103 ------
NM_152600chr194306 291 138 22 --130 --
NM_152622chr51480 ------
NM_152629chr9--1822 --1116
NM_152653chr3--1597 267 23 --
NM_152686chr53451 275 259 ------
NM_152716chr1121216 1085 ------
NM_152733chr6216336 5642 5474 5399 5393 5206 4856 4639 4445 4213 2419 2399 2167 2103 2071 1791 1206 1190 1157 1116 450 ----35244 2138 2048
NM_152734chr645323 5256 4593 762 13513 1172 14599
NM_152735chr611013 1220 ----
NM_152754chr71315 12805 ----
NM_152769chr194878 788 295 120 1594 2926 125 --
NM_152787chrX1444 ------
NM_152838chr201927 ------
NM_152855chr221284 1259 ----
NM_152860chr1231441 1273 36 --1279 --
NM_152888chr8----1978 --
NM_152924chr1576616 6365 4556 4484 2250 934 559 11474 1464 --
NM_152989chr1211183 ------
NM_153029chr16103874 3568 3540 3418 3390 3060 2753 2624 943 689 23824 2702 ----
NM_153033chr71297 ------
NM_153035chr1122 1370 ----
NM_153040chr153245 238 84 ------
NM_153262chr122490 674 ------
NM_153273chr392688 2606 2156 2149 2130 2071 1020 964 372 --22781 351 --
NM_153330chr3----121 --
NM_153334chr223584 536 267 ------
NM_153350chr166403 333 288 174 105 82 --1188 --
NM_153367chr1093892 3799 3780 1350 1168 441 294 91 35 41213 1179 1107 110 43496 1434 1192 892 --
NM_153371chr1311973 --1549 --
NM_153426chr4153 ------
NM_153427chr4153 ------
NM_153487chr6104632 4554 4396 3549 3013 1784 1546 1002 183 79 14023 23066 910 --
NM_153499chr1232502 210 37 2122 53 ----
NM_153500chr1232502 210 37 2122 53 ----
NM_153616chr1511644 ------
NM_153617chr1511644 ------
NM_153618chr1511644 ------
NM_153619chr1522882 189 1373 ----
NM_153620chr71284 1183 1340 --
NM_153631chr71127 --11245 2269 133
NM_153632chr71127 --11245 2269 133
NM_153633chr121186 --1789 --
NM_153685chr1221058 308 --1322 --
NM_153715chr71100 ------
NM_153748chr122176 142 ------
NM_153756chr111916 --1423 --
NM_153809chr91600 ------
NM_153812chr141944 560 327 112 1225 ----
NM_153827chr171548 151 ----
NM_153836chr21701 1123 1113 --
NM_170606chr7----1384 --
NM_170663chr171548 151 ----
NM_170665chr1264283 3276 3147 2942 1449 586 --1591 12835
NM_170711chr192656 109 ------
NM_170719chr131408 ------
NM_170731chr1121898 1150 --1783 --
NM_170732chr1121898 1150 --1783 --
NM_170733chr1121898 1150 --1783 --
NM_170734chr1121898 1150 --1783 --
NM_170735chr1121898 1150 --1783 --
NM_170751chr621121 442 --1434 --
NM_170752chr621121 442 --1434 --
NM_170754chr122330 161 ------
NM_170769chr61183 1636 --144
NM_172016chr61904 1371 ----
NM_172057chr72275 89 --176 --
NM_172071chr116157 1167 --16579
NM_172103chr632361 386 333 ------
NM_172105chr632361 386 333 ------
NM_172169chr101168 21264 154 --11666
NM_172170chr101168 21264 154 --11666
NM_172171chr101168 21264 154 --11666
NM_172173chr101168 21264 154 --11666
NM_172198chr11208 ------
NM_172206chr1771391 1380 1275 455 394 120 45 186 1615 --
NM_172211chr13845 630 245 --1667 --
NM_172216chr1222404 112 124 ----
NM_172225chr18617 563 557 467 445 420 129 52 1459 2193 134 --
NM_172226chr1232502 210 37 2122 53 ----
NM_172230chr112241 48 ------
NM_173054chr71926 ------
NM_173156chr122071 1687 183 1553 11693
NM_173171chr21226 ------
NM_173172chr22534 38 ------
NM_173173chr21226 ------
NM_173214chr1637527 6798 5733 16304 ----
NM_173354chr2131366 733 724 11418 ----
NM_173470chrX32923 557 79 ------
NM_173475chr1611561 ----147
NM_173476chr1652022 1790 909 314 129 11804 1596 1238
NM_173511chr243731 2415 1181 153 ------
NM_173517chr71163 ------
NM_173547chr1741536 632 429 23 ------
NM_173582chr1125536 4137 ------
NM_173595chr12144985 4638 4325 4316 3730 2078 1513 1363 1223 821 423 370 131 24 35188 5172 447 --14783
NM_173618chr162112 50 1269 134 --
NM_173633chr19145 ------
NM_173674chr6166 146 ----
NM_173681chr752015 1439 1313 796 267 11305 1242 1742
NM_173683chr821564 1436 ------
NM_173814chr15160 ------
NM_173828chr53343 315 273 ------
NM_173832chr8163386 3280 3238 3189 3148 3099 2975 2926 2445 647 564 527 510 403 123 59 63257 3118 2994 2945 2815 2675 43317 78 44 30 --
NM_173833chr84250 185 107 95 ------
NM_173854chr112177 ------
NM_174911chr832889 834 259 ------
NM_174934chr1151041 925 612 579 68 1319 11013 --
NM_174955chr1751448 1027 451 201 24 --2119 71 --
NM_175610chr151384 ------
NM_175630chr2----1772 --
NM_175733chr113668 399 356 ------
NM_175736chr12107674 6407 6033 4871 2595 2539 1803 1287 434 425 15482 27126 2452 --
NM_175747chr62919 114 ------
NM_175767chr52449 180 ------
NM_175834chr12140 127 ----
NM_175854chr1322398 451 ------
NM_175898chr1591254 607 588 482 344 160 148 94 44 1433 51330 646 454 335 111 --
NM_175907chr1822119 920 ------
NM_175931chr1651575 1529 1364 1326 278 --21633 115 --
NM_176801chr481283 545 504 465 314 284 199 176 --2495 361 --
NM_176814chr71923 ------
NM_176871chr882970 2728 2644 2538 951 511 375 332 ------
NM_177438chr1433287 2689 2606 --23437 1551 --
NM_177559chr20----11164 --
NM_177560chr20----11164 --
NM_177972chr1133070 1471 1197 11623 174 1751
NM_177974chr1522272 492 ------
NM_177977chr1761883 1547 1442 1349 287 274 --1639 --
NM_177983chr21132 ------
NM_177991chr202129 122 --1105 --
NM_177996chr2063386 2733 1276 665 410 360 ------
NM_177999chr9123435 3289 3008 2886 2791 2715 2631 1491 1117 1000 546 417 1172 23226 495 --
NM_178010chr1211183 ------
NM_178013chr1452571 2483 1173 405 122 --1842 --
NM_178037chr1282235 1459 1418 1269 670 371 350 321 --11017 --
NM_178038chr1282235 1459 1418 1269 670 371 350 321 --11017 --
NM_178126chr1722226 844 ------
NM_178138chr92825 783 2965 23 1860 --
NM_178148chr61215 --1472 --
NM_178151chrX47005 5751 4855 315 27666 7300 ----
NM_178152chrX47005 5751 4855 315 27666 7300 ----
NM_178153chrX47005 5751 4855 315 27666 7300 ----
NM_178175chrX149 1486 ----
NM_178229chr1--183 ----
NM_178441chr1411317 2361 118 11343 --
NM_178450chr51158 ------
NM_178502chr125549 445 247 82 28 ------
NM_178557chr4101669 1298 1238 1136 693 680 590 377 221 38 --81570 622 510 502 497 446 384 301 --
NM_178562chr7--1867 1618 --
NM_178568chr1771651 1434 1198 1129 1119 506 148 11374 1380 1231
NM_178580chr20143 1356 ----
NM_178586chr142296 115 1224 ----
NM_178812chr81288 ------
NM_178831chr712923 ------
NM_178835chr41600 --174 --
NM_178860chr173368 307 158 ------
NM_178863chr162369 82 ------
NM_178864chr111477 --1507 1133
NM_180976chr65702 680 674 56 43 1393 ----
NM_180977chr65702 680 674 56 43 1393 ----
NM_181050chr161269 ------
NM_181093chr11185 ------
NM_181332chrX31847 948 323 ------
NM_181349chr762569 2473 2244 2107 324 93 --12058 --
NM_181358chr133224 3215 1699 --150 --
NM_181458chr2134 ------
NM_181492chr222879 59 --479 74 69 64 --
NM_181504chr51909 ------
NM_181505chr172217 97 ------
NM_181509chr203370 281 42 --154 --
NM_181523chr51909 ------
NM_181524chr51909 ------
NM_181534chr17140 ------
NM_181552chr72252 234 --1311 --
NM_181656chr171884 ------
NM_181670chr124292 76 50 24 ------
NM_181671chr172199 102 ------
NM_181689chr203908 333 110 ------
NM_181701chr96480 462 447 418 405 363 --256 51 11585
NM_181714chr61427 ------
NM_181715chr11289 ------
NM_181716chr17372 63 21 ------
NM_181724chr1281553 1472 1311 400 177 80 57 25 ------
NM_181782chr61651 ------
NM_181784chr23339 188 78 ------
NM_181802chr201140 ------
NM_181828chr2283467 2912 1134 955 623 470 441 35 --13452 --
NM_181829chr2283467 2912 1134 955 623 470 441 35 --13452 --
NM_181830chr2283467 2912 1134 955 623 470 441 35 --13452 --
NM_181839chr821112 292 ------
NM_181843chr11----1251 --
NM_181864chr12222 28 ------
NM_181865chr12222 28 ------
NM_181866chr12222 28 ------
NM_181874chr3----2346 28 --
NM_181876chr452585 799 526 162 24 ------
NM_181897chr3--12573 ----
NM_182314chrX11593 ------
NM_182509chr1481649 1520 1372 1043 576 364 161 99 ------
NM_182511chr18153 ------
NM_182526chr14102859 2689 1978 1254 1065 989 800 662 613 320 --32521 583 98 12644
NM_182528chr25356 349 140 129 49 --1145 --
NM_182546chr7--1119 ----
NM_182553chr113487 166 90 1386 163 --
NM_182557chr1151985 1917 1561 1432 504 3539 456 303 11901 --
NM_182580chr132430 2063 1683 12448 ----
NM_182641chr1721529 474 ------
NM_182687chr16152 ------
NM_182691chr711316 ------
NM_182692chr711316 ------
NM_182700chr761328 560 273 214 207 60 --1413 --
NM_182705chr1762352 769 720 668 60 38 1799 12411 --
NM_182706chr8----141 --
NM_182776chr7141 ------
NM_182779chr13628 229 140 --125 --
NM_182811chr201255 1481 ----
NM_182895chr223584 536 267 ------
NM_182917chr32381 342 ------
NM_182936chr142148 95 ------
NM_182943chr311077 ------
NM_182970chr20103129 3121 1725 1513 1455 1358 1306 1054 959 52 11537 1701 --
NM_183002chr142148 95 ------
NM_183006chr2081553 1453 1426 1319 1262 1139 585 428 11234 --11145
NM_183243chr73559 492 214 1180 1258 --
NM_183243chr73559 492 214 1180 1258 --
NM_183373chr64864 844 264 24 ------
NM_183377chr171152 --1190 --
NM_183381chr3----1798 --
NM_183383chr3----1798 --
NM_183384chr3----1798 --
NM_183415chr12----1467 --
NM_183425chr2071244 688 455 316 205 81 68 11449 1165 --
NM_184231chr3--126 ----
NM_184234chr20--1619 ----
NM_194071chr785203 1848 1699 1069 1010 525 499 344 34867 1833 157 24877 3855 --
NM_194247chr242920 1503 1399 331 12793 11517 --
NM_194248chr26957 894 684 629 404 215 1642 2389 235 --
NM_194272chr154836 689 299 66 ------
NM_194278chr14123016 2861 2688 1339 721 630 579 493 228 104 33 21 21007 505 2920 426 1784
NM_194282chr422778 1189 ------
NM_194285chr1112813 --1402 --
NM_194286chr1285325 3804 1901 1859 1720 1019 328 72 14513 35618 5569 1780 1788
NM_194313chr911729 190 --136
NM_194314chr1------14298
NM_194322chr26957 894 684 629 404 215 1642 2389 235 --
NM_197939chr1741005 821 442 128 ------
NM_197941chr522742 2094 ------
NM_198040chr1--1799 1280 --
NM_198074chr15483 469 459 446 320 ------
NM_198081chr641889 596 370 74 ------
NM_198158chr312344 ------
NM_198159chr312344 ------
NM_198177chr312344 ------
NM_198178chr312344 ------
NM_198186chr91548 1587 ----
NM_198187chr91548 1587 ----
NM_198216chr20129 ------
NM_198240chr121113 1170 ----
NM_198241chr32381 342 ------
NM_198242chr32381 342 ------
NM_198244chr32381 342 ------
NM_198268chr133224 3215 1699 --150 --
NM_198269chr133224 3215 1699 --150 --
NM_198270chrX1886 ------
NM_198291chr2091941 1572 1370 1339 1263 608 465 351 230 1254 21668 449 --
NM_198316chr122330 161 ------
NM_198324chr1221059 200 ------
NM_198334chr112858 330 ------
NM_198335chr112858 330 ------
NM_198390chr1691286 1229 1197 639 618 440 414 185 102 11864 ----
NM_198392chr661537 917 366 119 106 37 ------
NM_198468chr622950 350 ------
NM_198527chr15----1447 --
NM_198530chr171472 1327 1198 --
NM_198560chr3103732 3562 2927 2861 2492 1432 898 705 641 403 2305 128 1617 11539
NM_198563chr3--166 136 --
NM_198595chr443445 900 415 334 23964 1353 --14057
NM_198597chr101984 ------
NM_198679chr962582 2348 2271 466 106 100 --1636 1618
NM_198681chr131335 1120 129 --31377 1325 335 --
NM_198715chr114686 --16300 --
NM_198793chr321119 374 ------
NM_198834chr1721680 24 1254 ----
NM_198836chr1721680 24 1254 ----
NM_198837chr1721680 24 1254 ----
NM_198838chr1721680 24 1254 ----
NM_198839chr1721680 24 1254 ----
NM_198850chr19----3218 76 42 --
NM_198859chr345111 1764 849 690 13514 ----
NM_198867chr194341 152 44 26 --287 79 --
NM_198900chr12107674 6407 6033 4871 2595 2539 1803 1287 434 425 15482 27126 2452 --
NM_198956chr761328 560 273 214 207 60 --1413 --
NM_198963chr21104 ------
NM_199054chr1951697 1441 431 292 198 --31463 795 297 --
NM_199076chr1041203 1125 59 45 1110 ----
NM_199129chr202904 305 1289 1310 1443
NM_199131chr102944 585 --1767 --
NM_199144chr202586 394 1411 ----
NM_199160chr921667 55 144 ----
NM_199168chr101227 2498 179 ----
NM_199169chr2083520 3363 2981 2296 1432 1036 738 55 23030 801 ----
NM_199170chr2083520 3363 2981 2296 1432 1036 738 55 23030 801 ----
NM_199171chr2083520 3363 2981 2296 1432 1036 738 55 23030 801 ----
NM_199181chr202230 56 ------
NM_199203chr202586 394 1411 ----
NM_199245chr122645 50 1184 ----
NM_199262chr1741486 258 241 23 --1450 --
NM_199324chr412800 2969 242 ----
NM_199330chr152583 576 --124 --
NM_199331chr152583 576 --124 --
NM_199332chr152583 576 --124 --
NM_199334chr171181 ------
NM_199368chr20191 --2618 70 --
NM_199414chr15152 1778 ----
NM_199424chr1681760 1393 1226 1187 512 110 97 56 ----2170 78
NM_199437chr1111759 11611 ----
NM_199438chr1111759 11611 ----
NM_199439chr1111759 11611 ----
NM_199464chr131153 ------
NM_199487chr201243 182 ----
NM_201267chr2282 59 ------
NM_201378chr85872 849 636 376 21 --1198 --
NM_201379chr85872 849 636 376 21 --1198 --
NM_201380chr85872 849 636 376 21 --1198 --
NM_201381chr85872 849 636 376 21 --1198 --
NM_201382chr85872 849 636 376 21 --1198 --
NM_201383chr85872 849 636 376 21 --1198 --
NM_201384chr85872 849 636 376 21 --1198 --
NM_201432chr17136326 5399 5379 4794 4420 2254 1458 1194 943 923 776 765 334 16486 35930 1178 207 11221
NM_201433chr17136326 5399 5379 4794 4420 2254 1458 1194 943 923 776 765 334 16486 35930 1178 207 11221
NM_201434chr175644 542 528 37 28 ------
NM_201520chr1761413 1301 1142 514 508 161 1332 1490 1565
NM_201567chr321385 1123 ------
NM_201568chr122071 1687 183 1553 11693
NM_201569chr122071 1687 183 1553 11693
NM_201575chr162379 152 ------
NM_201591chr41540 ------
NM_201592chr41540 ------
NM_201599chrX4423 197 137 107 1360 ----
NM_201613chr121355 ------
NM_201624chr1149 ------
NM_201628chr133272 3158 1127 12634 1266 --
NM_201630chr12175 155 --182 --
NM_201632chr5--2172 162 285 56 --
NM_201634chr51108 2271 261 3184 155 76 --
NM_201998chr111686 ------
NM_202002chr124608 597 213 123 ------
NM_202467chr192221 150 2523 494 1155 --
NM_202468chr192221 150 2523 494 1155 --
NM_202469chr192221 150 2523 494 1155 --
NM_202470chr192221 150 2523 494 1155 --
NM_202494chr192221 150 2523 494 1155 --
NM_203283chr41135 1147 ----
NM_203284chr41135 1147 ----
NM_203307chr1911598 --11247 --
NM_203327chr2053815 3540 3028 1548 702 12795 11294 --
NM_203342chr143603 2776 1383 539 --22763 1155 --
NM_203343chr143603 2776 1383 539 --22763 1155 --
NM_203346chr262109 1612 1583 875 869 647 ----2317 132
NM_203347chr92124 23 ------
NM_203365chr21573 ------
NM_203383chr11269 40 ------
NM_203384chr11269 40 ------
NM_203385chr11269 40 ------
NM_203386chr11269 40 ------
NM_203387chr11269 40 ------
NM_203388chr11269 40 ------
NM_203389chr11269 40 ------
NM_203394chr123372 49 40 ----2851 597
NM_203399chr1----1585 --
NM_203401chr1----1585 --
NM_203403chr9159 ------
NM_203434chr931035 874 363 --134 --
NM_203504chr4----12160 --
NM_203505chr4----12160 --
NM_203506chr1742028 1770 1415 739 12069 ----
NM_205833chrX------148
NM_205842chr22678 649 ------
NM_205861chr131453 865 778 --131 --
NM_206594chr1----1584 --
NM_206595chr1----1584 --
NM_206900chr19--2276 44 ----
NM_206901chr19--2276 44 ----
NM_206907chr51602 ------
NM_206909chr857263 7227 6781 5651 580 47839 7562 2967 1465 --17110
NM_206914chr1222143 1557 1115 ----
NM_207012chr1032928 559 434 ------
NM_207042chr1146 ------
NM_207045chr1146 ------
NM_207046chr1146 ------
NM_207111chr772034 2010 1069 1053 921 906 313 1246 31029 911 779 12525
NM_207112chr164412 390 161 77 1118 195 --
NM_207116chr772034 2010 1069 1053 921 906 313 1246 31029 911 779 12525
NM_207171chr111578 ------
NM_207291chr193559 446 206 ------
NM_207299chr91166 ------
NM_207306chr154370 4118 4109 3532 49 ------
NM_207351chr3132 --1635 --
NM_207361chr1345859 5698 4691 40 ------
NM_207366chr72425 258 ------
NM_207371chr1021497 1084 ------
NM_207396chr12611 477 11567 1249 --
NM_207406chr436062 3999 2154 12314 ----
NM_207429chr113632 495 385 ------
NM_207442chr142907 341 --2361 327 1274
NM_207645chr113339 153 25 ------
NM_212551chr111130 ------
NM_213648chr5--2172 162 285 56 --
NM_213651chr11263 ------
NM_213662chr1752231 1741 1697 790 407 --12268 --