TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-759
miRNA Sequence: GCAGAGUGCAAACAAUUUUGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531186 969 854 ------
NM_000037chr842512 2466 723 622 12497 21713 78 --
NM_000038chr541353 752 193 162 --31981 1741 1409 --
NM_000044chrX2344 72 ------
NM_000051chr1193388 3239 2957 2776 2558 2296 1131 676 203 --1264 --
NM_000052chrX52824 808 557 416 72 1177 11337 --
NM_000063chr61265 ------
NM_000067chr82538 277 ------
NM_000081chr121847 34 1151 21325 695 --
NM_000084chrX115949 5483 5030 4927 2726 2444 2014 1745 782 685 392 --56712 5842 1795 1464 1366 --
NM_000088chr1731318 1115 128 ------
NM_000089chr71232 ------
NM_000090chr23901 704 272 ------
NM_000091chr262769 2586 2133 1080 1008 873 22125 993 ----
NM_000092chr2144595 4339 4304 3990 3408 3313 2987 2958 1839 1278 737 380 340 225 --11035 --
NM_000093chr962200 2075 1926 1795 848 687 --2528 256 --
NM_000103chr1511252 --125 --
NM_000108chr761701 1679 1542 1448 1172 158 1588 11247 --
NM_000109chrX32321 2245 1717 1501 11946 --
NM_000110chr141161 929 764 394 1789 ----
NM_000111chr71126 ------
NM_000115chr1331829 917 615 1371 1643 --
NM_000117chrX1287 ------
NM_000125chr6114062 3660 3618 3596 2855 2593 684 386 320 79 67 ----24227 2720
NM_000134chr41346 11081 ----
NM_000138chr1542389 370 345 189 --12594 12192
NM_000141chr1011250 --11361 --
NM_000161chr1442001 1823 1810 452 21602 1364 1481 11402
NM_000163chr532283 2093 1813 11912 11536 --
NM_000165chr631545 682 396 11374 --1506
NM_000167chrX41428 714 359 66 1101 11667 --
NM_000168chr732731 1091 66 1165 ----
NM_000170chr91208 ------
NM_000176chr553356 3053 2935 2888 198 ------
NM_000188chr101735 --2593 225 --
NM_000204chr4124 ------
NM_000210chr262314 1723 1475 950 766 43 11869 ----
NM_000214chr2041628 1415 1138 584 21148 523 ----
NM_000217chr12105332 5219 4803 4174 3798 1779 1773 1573 1497 654 --22094 2013 --
NM_000222chr431741 313 142 --11339 1248
NM_000227chr183345 303 85 1140 1161 --
NM_000237chr871851 1670 1654 1329 417 381 43 ------
NM_000245chr762052 1945 1461 1397 437 264 --31412 548 36 --
NM_000248chr352698 2025 1043 693 560 1659 ----
NM_000252chrX11380 ------
NM_000259chr1596168 5272 5132 4543 4455 1990 1702 1586 703 26039 1390 21079 164 11602
NM_000264chr953173 3089 2730 2293 1031 1712 ----
NM_000266chrX5877 753 374 174 122 ------
NM_000267chr1753309 3004 2742 2459 368 22498 912 ----
NM_000268chr2213743 1935 21045 587 --
NM_000271chr182463 251 ------
NM_000276chrX72150 2068 1783 1485 1404 420 359 22029 345 --2737 480
NM_000277chr122625 246 ----1695
NM_000278chr1022233 1676 ------
NM_000291chrX5898 869 750 241 194 ------
NM_000297chr422053 138 --1426 --
NM_000301chr62212 168 1225 ----
NM_000304chr172787 201 130 ----
NM_000314chr10103298 3137 3114 2747 2637 2422 1200 549 480 278 13093 12547 --
NM_000321chr131344 --11400 --
NM_000332chr6176901 6396 5427 5226 5201 4725 4363 2758 2529 2438 2358 1391 1271 1190 1141 1044 454 11762 12876 25115 1400
NM_000333chr351024 746 447 333 40 --173 --
NM_000337chr596230 5788 5060 4363 4159 1977 1937 1472 1085 24229 467 ----
NM_000338chr1521138 808 ------
NM_000340chr331450 1436 270 --1948 --
NM_000346chr173694 546 376 ------
NM_000358chr51104 ------
NM_000361chr2021806 556 --1429 --
NM_000362chr2243613 2957 2590 1065 11191 ----
NM_000367chr631926 1511 675 --11614 --
NM_000368chr9114481 4426 4410 3808 3734 3706 3125 1602 1156 596 366 2993 537 ----
NM_000378chr111430 --11254 --
NM_000386chr173803 757 226 ------
NM_000389chr62514 56 ----21156 476
NM_000390chrX42078 1146 710 32 142 21278 341 --
NM_000393chr241905 1642 1505 808 167 ----
NM_000396chr12532 171 --169 --
NM_000399chr102464 187 1743 ----
NM_000408chr263006 2775 2769 2406 2118 289 23280 656 --183
NM_000411chr2163111 2999 2575 2241 2021 183 3900 821 646 ----
NM_000416chr62416 168 126 ----
NM_000421chr171269 ------
NM_000426chr61216 ------
NM_000428chr1431775 1628 571 --12343 --
NM_000430chr1782944 2876 2799 2651 1298 742 116 79 ----23500 50
NM_000434chr6242 28 ------
NM_000439chr542123 810 639 615 --11853 --
NM_000441chr752074 2018 1524 495 92 1865 11670 --
NM_000442chr1711235 1302 ----
NM_000447chr13350 186 72 ------
NM_000449chr161312 1127 939 532 112 45 ------
NM_000459chr9--1175 2895 582 --
NM_000461chr384499 4196 3111 3042 1635 1426 813 512 21165 219 13278 11031
NM_000462chr1531643 406 334 11859 ----
NM_000474chr73575 189 90 ----1269
NM_000480chr1121179 153 2602 466 ----
NM_000484chr2131110 744 716 ------
NM_000489chrX22809 382 --13133 --
NM_000495chrX1712 1889 ----
NM_000503chr841777 1628 1292 36 1638 ----
NM_000508chr43870 774 211 --129 --
NM_000516chr201239 ------
NM_000522chr72869 824 ------
NM_000523chr221166 183 ----1344
NM_000527chr1922430 821 --22170 1636 --
NM_000530chr1----21079 860 --
NM_000533chrX21518 1239 --1468 --
NM_000555chrX167842 7826 7543 7333 6349 5922 5619 5494 3044 2534 2180 1624 1496 1233 552 507 17506 ----
NM_000560chr11700 ------
NM_000572chr12884 72 --1647 --
NM_000575chr24921 814 808 140 1981 ----
NM_000578chr231802 1265 234 ------
NM_000583chr4--126 ----
NM_000598chr741307 1065 344 204 --11383 --
NM_000609chr1022391 646 33096 2776 47 22534 134 12808
NM_000610chr1142886 2372 633 134 22922 2572 ----
NM_000611chr11116838 5136 5083 2818 1908 1784 1468 1249 765 154 71 35439 4869 165 ----
NM_000615chr11113000 2957 2787 2395 2370 1842 1015 750 712 683 492 --53007 2882 1831 954 531 --
NM_000618chr12125817 5649 5161 4219 2283 1923 1716 1613 1565 887 78 55 46434 6358 6084 699 14083 --
NM_000618chr12125817 5649 5161 4219 2283 1923 1716 1613 1565 887 78 55 46434 6358 6084 699 14083 --
NM_000620chr1251976 1904 1793 1428 240 --193 --
NM_000627chr23882 873 34 ------
NM_000633chr18135089 3888 3847 3801 3760 3476 3375 3298 1762 1751 1709 1399 846 24712 3837 25185 4474 11937
NM_000635chr1941477 311 277 218 1118 154 --
NM_000663chr1652827 2778 656 458 409 1489 ----
NM_000681chr1061307 1250 889 222 131 106 ------
NM_000684chr1031277 827 340 ------
NM_000701chr1----143 --
NM_000719chr12146223 5427 5295 5022 4914 2520 2333 1847 857 724 701 516 387 359 --32365 2006 1997 --
NM_000721chr142701 2088 806 317 --11072 12364
NM_000726chr2--11160 --11446
NM_000739chr7198 ------
NM_000756chr82354 68 ------
NM_000757chr11881 ------
NM_000782chr2031109 363 79 ------
NM_000788chr411040 21408 499 ----
NM_000792chr15964 869 749 680 341 --1294 1386
NM_000793chr1464337 4011 3987 3219 1788 1627 45146 3776 3462 1365 1282 --
NM_000794chr53692 661 58 198 ----
NM_000795chr1121066 891 11105 1177 1877
NM_000801chr201451 --1119 --
NM_000806chr531842 712 558 1203 ----
NM_000809chr4179240 9077 6228 3439 3408 3196 2998 2641 2621 2172 2063 1782 1552 1390 1255 854 103 88460 8454 8373 8052 3465 3067 2929 2104 --1957
NM_000813chr554858 4353 2126 1738 1147 24923 1196 14324 --
NM_000814chr1593730 3716 2617 1257 978 926 738 454 56 43588 3364 2873 2762 ----
NM_000816chr51454 1188 ----
NM_000817chr22994 314 ------
NM_000818chr102214 188 --1121 --
NM_000824chr41358 2671 313 ----
NM_000826chr432486 2025 1698 ------
NM_000827chr582350 2260 1890 1839 1672 1611 973 502 12381 ----
NM_000828chrX4768 581 331 85 --1657 1186
NM_000829chr1121488 557 --1910 --
NM_000831chr196188 5953 5771 4950 4290 1591 1108 906 771 35326 3809 1824 23879 1019 --
NM_000833chr1651540 1378 1203 1141 1007 ------
NM_000838chr642546 2388 2246 704 32556 826 258 ----
NM_000839chr31393 ------
NM_000844chr331114 1078 1066 --1406 --
NM_000855chr111357 ------
NM_000861chr362595 2573 2230 1964 1797 631 1203 11971 --
NM_000864chr11341 --1752 21085 990
NM_000866chr321412 464 11883 ----
NM_000868chrX41035 467 460 453 1739 1779 --
NM_000875chr15127082 7031 6952 6916 5733 5379 4991 4667 2630 2153 1213 1108 --1302 15006
NM_000876chr621285 1215 1397 1574 --
NM_000883chr72654 53 ------
NM_000883chr72654 53 ------
NM_000885chr2102015 1939 1903 1635 1608 1396 851 747 507 168 1824 ----
NM_000891chr1783549 3297 3248 3236 3225 1139 1048 369 1810 23542 3431 --
NM_000898chrX2654 28 1137 ----
NM_000899chr12104424 3615 3234 3227 2852 2833 2822 1438 1134 97 ------
NM_000901chr432318 1919 25 32226 1773 284 --12118
NM_000917chr102161 37 1951 --1824
NM_000919chr53432 404 128 ------
NM_000921chr12--1539 ----
NM_000922chr1151015 802 279 178 150 ------
NM_000926chr11139463 7932 7257 6710 5981 5944 5824 3432 2825 1447 1376 1330 817 38796 3096 2245 16257 --
NM_000933chr2041675 1504 1374 420 ------
NM_000935chr3--1188 1126 --
NM_000944chr472293 904 508 404 388 367 122 --12055 --
NM_000945chr261778 1654 1525 787 199 30 --1779 --
NM_000950chrX83335 2872 2690 2589 2374 545 65 23 1478 1909 --
NM_000958chr51147 11277 ----
NM_000961chr20103515 3093 2888 2866 2779 2731 1520 828 330 268 23871 652 22816 1283 --
NM_000965chr341211 848 352 330 ------
NM_000984chr17--125 ----
NM_001001323chr1222783 2162 ----22920 286
NM_001001331chr332524 1833 344 1940 22606 1670 --
NM_001001344chrX32188 1964 511 ------
NM_001001389chr1142886 2372 633 134 22922 2572 ----
NM_001001390chr1142886 2372 633 134 22922 2572 ----
NM_001001391chr1142886 2372 633 134 22922 2572 ----
NM_001001392chr1142932 2418 679 180 22968 2618 ----
NM_001001394chr2------1570
NM_001001395chr1252806 2763 950 693 43 ------
NM_001001396chr152907 1511 1434 626 600 23220 1595 --1774
NM_001001419chr575203 5127 3689 1929 1568 854 395 21776 63 21968 1333 --
NM_001001420chr575203 5127 3689 1929 1568 854 395 21776 63 21968 1333 --
NM_001001436chr161800 ----186
NM_001001481chr842737 2696 2399 1274 --2885 154 159
NM_001001484chr1022083 1708 --12263 --
NM_001001502chr5136 ----1119
NM_001001521chr21257 ----1297
NM_001001549chr742481 2368 394 92 12101 12768 --
NM_001001550chr742481 2368 394 92 12101 12768 --
NM_001001555chr742481 2368 394 92 12101 12768 --
NM_001001664chr283949 3617 3090 2609 1271 1111 845 771 23487 2533 11067 --
NM_001001877chrY140 ------
NM_001001890chr2153806 3740 3694 3653 2850 13143 ----
NM_001001928chr22127943 7099 7060 6995 6980 6220 3143 2111 1607 861 422 102 1405 31976 1031 627 12529
NM_001001933chr12624 167 1436 1126 1601
NM_001001971chr1041165 881 107 26 ------
NM_001001974chr1082412 2206 2063 2016 1870 412 355 128 12249 11954 --
NM_001001977chr201164 ------
NM_001001994chrX2452 33 ------
NM_001001995chrX61665 1207 629 498 255 65 142 --1233
NM_001001996chrX2452 33 ------
NM_001002033chr172318 113 ------
NM_001002233chr862043 1441 1366 738 651 44 ------
NM_001002244chr171115 ------
NM_001002245chr171150 ------
NM_001002246chr171150 ------
NM_001002247chr171150 ------
NM_001002248chr171150 ------
NM_001002249chr171150 ------
NM_001002255chr62276 62 ----1100
NM_001002257chr263281 3185 2997 1434 1271 1142 22991 2606 21254 851 32937 2652 673
NM_001002265chr104745 583 548 213 ------
NM_001002266chr104745 583 548 213 ------
NM_001002295chr10----1146 1218
NM_001002296chr851373 1064 268 220 146 --1195 --
NM_001002811chr121616 1023 --1444 --
NM_001002812chr121616 1023 --1444 --
NM_001002812chr121616 1023 --1444 --
NM_001002814chr8113429 3133 2825 2530 1441 1366 1323 932 738 651 44 12805 11047 --
NM_001002838chrX61880 1482 1205 583 400 319 --1170 11682
NM_001002843chr1521266 127 ------
NM_001002860chr1484475 4175 3815 3542 3431 1610 1545 262 --1752 11818
NM_001002909chr1722099 1828 --11743 --
NM_001002919chr22486 378 ------
NM_001003407chr1095095 3776 3524 1928 1626 1585 1452 1144 563 22013 1691 14263 --
NM_001003408chr1095095 3776 3524 1928 1626 1585 1452 1144 563 22013 1691 14263 --
NM_001003652chr18168629 8263 8022 6350 5536 5509 5465 5254 3093 2550 2340 1430 1403 833 645 203 37741 7542 2515 36889 3471 1446 --
NM_001003674chr18146345 6116 5575 5306 4520 4471 2762 1883 1602 1369 1090 901 893 343 26183 2738 11723 --
NM_001003675chr18146345 6116 5575 5306 4520 4471 2762 1883 1602 1369 1090 901 893 343 26183 2738 11723 --
NM_001003678chr11----1106 --
NM_001003681chr2232008 858 176 11467 --1734
NM_001003688chr461028 829 814 353 266 224 21235 900 ----
NM_001003712chr1243762 3478 3039 2701 13001 11009 --
NM_001003786chr173295 116 24 ------
NM_001003787chr173295 116 24 ------
NM_001003788chr173295 116 24 ------
NM_001003792chr32803 777 ------
NM_001003793chr32803 777 ------
NM_001003800chr993342 3262 2891 2759 2615 2444 2368 613 266 ----11149
NM_001003940chr1553618 3386 3340 3325 1208 1273 13736 --
NM_001003942chr1553618 3386 3340 3325 1208 1273 13736 --
NM_001003943chr1553622 3390 3344 3329 1212 1277 13740 --
NM_001004051chrX1121 ------
NM_001004065chr973879 3346 3286 3210 3105 940 188 --13323 --
NM_001004196chr341206 849 343 85 ------
NM_001004304chr1263155 2783 2014 1230 596 174 ------
NM_001004308chrX71481 1230 585 276 222 103 23 21549 1513 ----
NM_001004317chr684479 3864 3615 3524 1618 757 688 149 21294 1261 34440 3178 2933 --
NM_001004323chr7139 ------
NM_001004329chr1231045 145 107 1263 --11211
NM_001004330chr1241876 673 584 377 1194 ----
NM_001004354chr911029 ------
NM_001004360chr231628 1386 422 11265 ----
NM_001004419chr1244330 4273 4150 675 1819 14486 14428
NM_001004720chr21806 ------
NM_001004722chr21975 ------
NM_001005158chr33383 132 96 --1356 --
NM_001005159chr33383 132 96 --1356 --
NM_001005266chr152569 474 1243 ----
NM_001005267chr152569 474 1243 ----
NM_001005268chr152569 474 1243 ----
NM_001005269chr152569 474 1243 ----
NM_001005291chr173475 379 107 --144 --
NM_001005335chr192293 227 ------
NM_001005360chr19----2813 233 --
NM_001005361chr19----2813 233 --
NM_001005362chr19----2813 233 --
NM_001005366chr123941 617 255 1951 ----
NM_001005375chrY21674 1571 1171 11633 --
NM_001005386chr272184 2005 956 699 297 232 135 1669 11752 --
NM_001005404chr1783618 3581 3390 3327 3209 1638 539 57 21191 716 14382 --
NM_001005408chr17--2459 55 ----
NM_001005463chr1052230 795 607 348 138 1639 12340 --
NM_001005473chr595328 5128 5033 4582 4216 2626 385 257 171 21333 826 --24135 77
NM_001005474chr311321 1298 ----
NM_001005476chr22627 228 ------
NM_001005505chr321773 487 --11238 --
NM_001005732chr212208 33 ------
NM_001005733chr212208 33 ------
NM_001005739chr22326 241 ------
NM_001005743chr1431146 97 79 ------
NM_001005744chr1431146 97 79 ------
NM_001005745chr1431146 97 79 ------
NM_001005746chr2--11160 --11446
NM_001005747chr2--11160 --11446
NM_001005753chr272041 1726 905 866 545 498 128 --11584 --
NM_001005781chr2--1459 ----
NM_001005782chr2--1908 ----
NM_001005845chr811291 1749 ----
NM_001005849chr173530 59 33 ------
NM_001005861chr35788 654 282 265 197 ------
NM_001005862chr17--1230 1586 --
NM_001006115chr362623 1900 956 782 433 403 1224 42049 1923 1762 1041 --
NM_001006600chr572303 2092 2041 1717 1688 1681 539 12432 ----
NM_001006617chr93470 441 412 11406 --11274
NM_001006619chr93470 441 412 11406 --11274
NM_001006620chr93470 441 412 11406 --11274
NM_001006621chr93470 441 412 11406 --11274
NM_001006623chr271833 855 687 669 504 129 71 1139 11742 --
NM_001006626chr7198 ------
NM_001006627chr7198 ------
NM_001006628chr7198 ------
NM_001006629chr7198 ------
NM_001006630chr7198 ------
NM_001006631chr7198 ------
NM_001006632chr7198 ------
NM_001006641chr911475 1711 174 --
NM_001006642chr911475 1711 174 --
NM_001006643chr911475 1711 174 --
NM_001006657chr262431 2390 2335 1037 1014 638 ----13203
NM_001007023chr1464337 4011 3987 3219 1788 1627 45146 3776 3462 1365 1282 --
NM_001007024chr1754138 4097 3193 3126 141 --34292 4026 2904 --
NM_001007025chr1754138 4097 3193 3126 141 --34292 4026 2904 --
NM_001007027chr111226 ------
NM_001007067chr841040 960 813 150 ------
NM_001007068chr841040 960 813 150 ------
NM_001007069chr841040 960 813 150 ------
NM_001007070chr841040 960 813 150 ------
NM_001007097chr974930 4325 3644 3397 1276 1248 495 21420 983 1580 --
NM_001007102chr641409 1224 1194 529 --133 --
NM_001007156chr1561967 1873 1543 605 396 324 ------
NM_001007237chr172654 2593 1861 811 470 347 89 1920 1616 --
NM_001007245chr71632 1647 ----
NM_001007246chr211701 21338 232 11821 --
NM_001007257chr131231 1184 1021 ------
NM_001007277chr111848 --2418 223 --
NM_001007466chr674498 4229 3918 3759 1961 1140 1052 --1782 --
NM_001007553chr14429 374 360 354 1467 1301 --
NM_001007559chr1852045 774 398 215 195 ------
NM_001007794chr11631 ------
NM_001008220chr553814 2862 2734 2634 508 2449 88 13675 --
NM_001008222chrX21254 1181 --2874 344 --
NM_001008225chr73599 591 32 ------
NM_001008239chr1873014 2954 2387 1514 1484 1265 293 ------
NM_001008388chr4126 1185 ----
NM_001008391chr112146 46 --1451 --
NM_001008392chr353375 2873 2764 2372 728 23351 608 136 --
NM_001008405chr741810 1667 419 314 1678 --11460
NM_001008408chr7196101 5854 5833 5578 5539 5480 5410 5326 5052 5029 5006 4451 2029 1885 885 869 632 599 220 --56444 6079 5668 1137 978 --
NM_001008495chr822084 244 11603 12029 --
NM_001008541chr1042024 1696 1470 577 12333 ----
NM_001008541chr1042024 1696 1470 577 12333 ----
NM_001008564chr132127 47 --1546 --
NM_001008566chr221478 1387 ----
NM_001008567chr92275 46 ------
NM_001008660chr1151593 1535 1381 1264 1244 ------
NM_001008701chr1962861 2310 2147 1925 108 63 12253 ----
NM_001008738chr572760 2421 2129 1833 710 151 132 ------
NM_001008744chr1441544 1515 206 132 ------
NM_001008860chr151810 1801 ----
NM_001008892chr151810 1801 ----
NM_001008894chr151810 1801 ----
NM_001008895chr1331482 1284 238 51436 579 400 255 86 ----
NM_001008925chr453424 2847 2299 2169 1061 21416 1313 ----
NM_001008938chr112417 165 ------
NM_001009554chr4154655 4633 4435 4059 3983 3943 3809 3490 3269 1033 750 733 559 518 129 32997 1317 327 11719 --
NM_001009554chr4154655 4633 4435 4059 3983 3943 3809 3490 3269 1033 750 733 559 518 129 32997 1317 327 11719 --
NM_001009555chr441443 1367 1243 1087 11687 ----
NM_001009566chr131348 192 43 1579 11199 --
NM_001009571chr731682 641 272 21311 549 ----
NM_001009880chr22114203 3556 3499 3376 3227 3080 3053 1605 1294 1275 451 1745 44573 1457 1353 519 --
NM_001009909chr1173679 2461 2410 1502 670 560 376 11299 ----
NM_001009923chr202259 92 --1790 1606
NM_001009958chr72568 485 ------
NM_001009959chr282637 2395 1970 638 557 489 466 370 11020 ----
NM_001009993chr253092 1655 1638 204 179 23504 272 22960 1723 --
NM_001010000chr1833015 2171 107 43005 2269 1192 529 1622 --
NM_001010853chr621043 236 1879 1540 --
NM_001010861chr172655 2573 974 861 617 500 297 21925 449 ----
NM_001010862chrX52774 752 587 486 316 12117 ----
NM_001010867chr1106651 6130 5603 5546 5171 4638 2637 2013 1717 886 11270 24401 356 --
NM_001010888chrX64012 3959 3639 1726 1573 1202 --24002 444 --
NM_001010895chr92706 388 --11959 --
NM_001010908chr101511 129 ----
NM_001010917chr1052167 2054 709 664 98 1657 ----
NM_001010924chr1041208 1061 342 195 11260 ----
NM_001010926chr13638 162 127 ------
NM_001010927chr6------1232
NM_001010934chr741151 843 396 25 ------
NM_001010935chr12881 188 124 ----
NM_001010938chr32615 282 --1204 --
NM_001010942chr125340 274 175 166 78 21165 25 ----
NM_001010971chr1173 ------
NM_001010980chr172314 2252 2232 2218 650 230 71 1796 1741 --
NM_001010986chrX62537 2288 1008 274 219 76 ----1821
NM_001010989chr161531 1216 ----
NM_001010990chr161531 1216 ----
NM_001011513chr453815 2923 853 817 798 --21175 561 --
NM_001011537chr31360 22345 37 ----
NM_001011538chr421079 866 --1798 --
NM_001011546chr201341 ------
NM_001011553chr72776 345 --1929 --
NM_001011645chrX2344 72 ------
NM_001011666chr7136275 5565 4953 4683 4269 4111 1734 1629 1329 1281 1253 623 301 24795 1644 --25580 4296
NM_001011713chr1421381 478 --1158 --
NM_001011885chr1531793 1461 1262 --11624 --
NM_001012270chr1721426 569 ------
NM_001012271chr1721529 672 ------
NM_001012338chr15130 ------
NM_001012393chr1184994 4919 4669 3370 2016 1583 1255 613 23932 3201 ----
NM_001012398chr164924 422 45 31 ------
NM_001012420chr1572216 2063 981 796 752 657 504 --21164 202 --
NM_001012423chr1572216 2063 981 796 752 657 504 --21164 202 --
NM_001012426chr663418 3082 2571 2093 439 408 --13169 --
NM_001012427chr663418 3082 2571 2093 439 408 --13169 --
NM_001012507chr6139 ------
NM_001012512chr181116 ------
NM_001012514chr23970 449 96 ------
NM_001012516chr23970 449 96 ------
NM_001012643chr191392 ------
NM_001012732chr421250 1239 ------
NM_001012751chr1021667 272 --11248 --
NM_001012753chr1931241 822 32 --2774 336 --
NM_001012754chr1352048 1952 1855 1412 864 1749 ----
NM_001012755chrX74566 4353 3517 1997 1212 1021 349 44875 4157 3136 653 14886 1343
NM_001012761chr542267 1072 641 271 21916 634 ----
NM_001012968chrX82685 2599 824 584 558 548 542 178 12808 ----
NM_001012971chr20172 ------
NM_001012980chrX1227 ------
NM_001012989chrX1582 ------
NM_001013031chr10113369 2971 2562 2202 1410 1338 1176 885 543 505 463 33547 3061 172 ----
NM_001013398chr741307 1065 344 204 --11383 --
NM_001013406chr731554 1499 1178 --21744 125 --
NM_001013415chr441355 633 360 239 11258 ----
NM_001013438chr32892 261 21008 329 ----
NM_001013439chr32738 107 2854 175 ----
NM_001013620chr12146947 6728 6412 5673 5465 5433 5244 2854 2467 2109 1587 1418 887 253 12241 17499 12732
NM_001013635chr1251138 982 482 337 168 1352 ----
NM_001013642chr14877 357 283 172 21088 327 1978 --
NM_001013659chr1963374 3312 1035 899 141 119 --54569 4272 3558 2162 69 --
NM_001013674chr11320 2503 288 ----
NM_001013690chr12112476 2287 2255 2142 1900 1734 866 619 393 384 370 11692 ----
NM_001013699chr12250 38 ------
NM_001013843chr152747 335 ------
NM_001014336chr12178 ------
NM_001014434chr11805 ------
NM_001014443chr11250 ------
NM_001014796chr11177 ------
NM_001014796chr11177 ------
NM_001014797chr10128148 7727 7022 6154 3184 2939 2174 1880 1428 1368 1142 937 38129 8087 2901 1775 --
NM_001014809chr42994 37 ------
NM_001014812chr152463 307 ----1399
NM_001015045chr462445 2342 1826 519 386 72 ------
NM_001015048chr1442949 2782 2291 2137 13204 ----
NM_001015049chr1442949 2782 2291 2137 13204 ----
NM_001015053chr1731489 412 322 --1256 --
NM_001015508chr81613 ------
NM_001015877chrX42534 2006 1955 318 1498 ----
NM_001015881chrX31277 1197 1190 ------
NM_001017368chr1762819 2014 1773 1092 908 688 22576 1951 ----
NM_001017369chr421065 841 ----11094
NM_001017371chr221300 152 ------
NM_001017395chr383649 3015 2726 2623 1399 1378 715 576 180 --12365
NM_001017405chr41141 ------
NM_001017406chr1----158 --
NM_001017415chr12658 600 ------
NM_001017416chr12658 600 ------
NM_001017420chr82369 270 11161 --1249
NM_001017423chr103779 238 78 ------
NM_001017424chr131282 208 175 1164 ----
NM_001017425chr131282 208 175 1164 ----
NM_001017440chr777673 6335 6271 3106 1184 845 395 --13023 --
NM_001017523chr1211247 11186 ----
NM_001017923chr1441570 1061 324 300 ------
NM_001017926chr811701 2736 428 11546 1291
NM_001017928chr31221 1181 ----
NM_001017930chrX1951 ----1258
NM_001017962chr102161 37 1951 --1824
NM_001017979chr42190 114 1693 --1206
NM_001017995chr564669 4347 4186 1629 113 83 11357 ----
NM_001017999chr131886 639 603 --21444 457 --
NM_001017999chr131886 639 603 --21444 457 --
NM_001018000chr131886 639 603 --21444 457 --
NM_001018000chr131886 639 603 --21444 457 --
NM_001018001chr131886 639 603 --21444 457 --
NM_001018004chr152611 27 --1226 --
NM_001018006chr152611 27 --1226 --
NM_001018007chr152611 27 --1226 --
NM_001018009chr331093 403 106 ------
NM_001018020chr152611 27 --1226 --
NM_001018054chr121243 229 --156 --
NM_001018056chr91190 ----1394
NM_001018064chr941922 1521 488 346 ----1110
NM_001018065chr9125903 5507 5319 5293 4461 3704 2346 1498 1385 614 223 104 55604 2103 1209 1186 785 21521 1069 --
NM_001018066chr9125903 5507 5319 5293 4461 3704 2346 1498 1385 614 223 104 55604 2103 1209 1186 785 21521 1069 --
NM_001018067chr1105276 5168 4943 4886 4071 3998 3957 1367 1120 261 35022 1611 484 12074 --
NM_001018068chr1105276 5168 4943 4886 4071 3998 3957 1367 1120 261 35022 1611 484 12074 --
NM_001018069chr1105276 5168 4943 4886 4071 3998 3957 1367 1120 261 35022 1611 484 12074 --
NM_001018072chr1211247 11186 ----
NM_001018074chr553356 3053 2935 2888 198 ------
NM_001018075chr553356 3053 2935 2888 198 ------
NM_001018076chr553356 3053 2935 2888 198 ------
NM_001018077chr553356 3053 2935 2888 198 ------
NM_001018089chr1543100 2811 2667 431 --1814 --
NM_001018091chr1562958 2359 2091 1845 800 421 1110 ----
NM_001018100chr154699 318 43 21 2811 133 --1599
NM_001018108chr1542121 1460 683 593 --12302 --
NM_001018115chr33658 590 583 1612 ----
NM_001020825chr53528 410 363 ------
NM_001023567chr156989 799 755 660 507 309 --1202 --
NM_001023587chr341065 961 954 737 ------
NM_001024094chr553356 3053 2935 2888 198 ------
NM_001024218chr143796 591 199 ------
NM_001024226chr1146 --1823 --
NM_001024227chr1146 --1823 --
NM_001024228chr1146 --1823 --
NM_001024372chr842268 2089 1454 511 --11686 --
NM_001024401chr1642833 2002 1984 1099 --1465 --
NM_001024455chrX52674 2094 2025 1024 243 --32234 1891 925 --
NM_001024457chr23866 419 87 ----1564
NM_001024460chr621031 392 ------
NM_001024601chr1134 ------
NM_001024649chr572886 2867 2228 2178 1919 1124 311 22610 1101 ----
NM_001024660chr32425 80 11244 --1211
NM_001024668chr122739 688 ------
NM_001024680chr261537 1519 1118 669 358 165 --11592 --
NM_001024808chr123534 181 70 21754 1125 ----
NM_001024847chr372403 1907 978 809 521 274 183 --12284 --
NM_001024855chr331211 1186 153 11913 ----
NM_001024858chr1452596 2431 1065 569 555 1839 12259 --
NM_001024912chr1941317 498 383 254 148 11365 --
NM_001024934chr6182 1629 ----
NM_001024935chr6182 1629 ----
NM_001024936chr6182 1629 ----
NM_001024937chr172641 500 ------
NM_001024948chr1103430 3370 2652 2553 2533 2266 1210 771 534 182 1388 ----
NM_001024956chr11135704 5601 4172 4154 3714 3678 2273 2209 1714 1077 979 862 612 1530 34578 4054 1276 --
NM_001024959chr32831 272 ------
NM_001024960chr32831 272 ------
NM_001025068chr331744 720 253 1682 11201 --
NM_001025069chr331744 720 253 1682 11201 --
NM_001025072chr362930 2625 2356 2047 1973 1082 1860 12429 --
NM_001025073chr362930 2625 2356 2047 1973 1082 1860 12429 --
NM_001025076chr10126255 6110 4402 4178 2116 1858 1569 1334 608 578 390 232 14947 ----
NM_001025077chr10197613 7468 5760 5536 5111 5058 5050 4973 4871 2927 2692 1966 1936 1748 1590 1384 1368 1208 201 26305 396 ----
NM_001025079chr373939 3686 2791 2705 2540 862 605 13404 12943 --
NM_001025100chr1893394 1521 1396 1279 926 665 429 298 247 23718 2443 12871 1997
NM_001025105chr551077 576 493 443 157 ------
NM_001025108chr254008 3397 2750 354 31 11260 ----
NM_001025232chr12265 40 1317 1133 --
NM_001025252chr853159 3082 2690 2099 2041 21110 436 12728 1774
NM_001025253chr853159 3082 2690 2099 2041 21110 436 12728 1774
NM_001025266chr3154901 4786 4749 3817 3795 3193 3090 3004 1546 1511 1345 1243 1090 803 180 11529 ----
NM_001025356chr1252788 1195 678 613 26 --193 --
NM_001025366chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025366chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025367chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025367chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025368chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025368chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025369chr641660 1496 575 186 21934 1638 1200 --
NM_001025369chr641660 1496 575 186 21934 1638 1200 --
NM_001025370chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025370chr641644 1480 559 170 31918 1622 760 1184 --
NM_001025389chr1121179 153 2602 466 ----
NM_001025390chr1121179 153 2602 466 ----
NM_001025579chr173981 328 261 11116 1419 --
NM_001025580chrX73048 2869 2642 1468 994 746 538 33945 2802 2755 1563 --
NM_001025595chr411431 ------
NM_001025596chr11--1499 ----
NM_001025603chr161312 1127 939 532 112 45 ------
NM_001025616chr461562 1203 536 506 54 33 1674 ----
NM_001025780chr921209 52 1561 ----
NM_001029858chr683011 2105 1296 1182 956 718 425 407 13261 21224 1093 --
NM_001029860chr81303 ------
NM_001029863chr683059 2929 2757 1006 787 633 354 342 ------
NM_001029875chr532994 2589 2183 --1558 --
NM_001029882chr11582 --1482 --
NM_001029882chr11582 --1482 --
NM_001029998chr421302 911 2413 65 11121 --
NM_001030002chr173350 246 76 --1319 --
NM_001030006chr1752565 2537 1808 674 401 ------
NM_001030007chr16133980 3580 3516 3400 3339 3295 990 782 473 229 223 50 23 22680 1412 1366 --
NM_001030047chr193365 335 224 --1938 --
NM_001030055chr1494707 4301 4139 3968 3479 1600 1450 1058 753 --1438 --
NM_001030287chr11249 11082 1169 --
NM_001031665chr19----1354 --
NM_001031679chr1253497 3200 2644 2304 263 --22401 711 --
NM_001031684chr231208 955 441 1414 ----
NM_001031690chr792690 2011 1114 978 730 442 425 392 179 11949 --12415
NM_001031694chr14614 337 233 50 ------
NM_001031694chr14614 337 233 50 ------
NM_001031695chr2285346 4757 4015 3670 1977 1808 763 517 --21328 1185 --
NM_001031709chr10--1363 ----
NM_001031710chr721035 719 1854 ----
NM_001031716chr2165 1927 ----
NM_001031732chr483630 3556 2409 1424 1094 901 532 222 11030 13208 --
NM_001031738chr2198 --1441 --
NM_001031743chr6----1178 --
NM_001031746chr1041389 1011 366 359 1252 1136 11064
NM_001031801chr222459 169 ------
NM_001031804chr1663778 3757 3251 1459 907 876 34028 3689 3386 11319 --
NM_001031812chr551565 941 555 159 105 ------
NM_001032221chr921203 139 --11798 --
NM_001032279chr111398 --1269 --
NM_001032280chr621243 208 ------
NM_001032282chr831100 1073 34 ------
NM_001032283chr122235 185 --21021 206 --
NM_001032284chr122235 185 --21021 206 --
NM_001032290chr15545 508 447 434 97 ------
NM_001032291chr15545 508 447 434 97 ------
NM_001032296chr1352276 1852 950 853 597 --21121 413 --
NM_001032363chr141599 1509 667 90 --12041 --
NM_001032363chr141599 1509 667 90 --12041 --
NM_001032367chr15176 ------
NM_001032380chr103690 136 58 --11417 11238
NM_001032393chrX2609 134 1127 ----
NM_001032394chr652806 2718 2530 2314 2223 --1888 --
NM_001032395chr652673 2585 2397 2181 2090 --1755 --
NM_001032999chr2075285 4696 4212 4097 3253 1329 199 15260 24282 1394 11969
NM_001033044chr11385 21610 557 ----
NM_001033045chr284043 4032 4004 3997 3949 1387 698 383 13519 23094 1228 --
NM_001033047chr442172 975 940 530 1510 ----
NM_001033049chr2162194 1973 1600 1528 434 353 11841 ----
NM_001033056chr11385 21610 557 ----
NM_001033057chr341830 1429 704 661 --12068 --
NM_001033059chr651780 1749 1713 462 231 ------
NM_001033081chr151482 1431 1402 553 165 1295 1373 --
NM_001033082chr151482 1431 1402 553 165 1295 1373 --
NM_001033087chr2052515 2080 280 128 35 11121 ----
NM_001033117chr384549 4374 4109 3645 3468 1455 1267 329 34866 4651 3513 ----
NM_001033507chr13718 688 274 --21748 651 --
NM_001033518chr772605 2279 1774 1136 781 337 59 182 1586 --
NM_001033519chr772605 2279 1774 1136 781 337 59 182 1586 --
NM_001033520chr772605 2279 1774 1136 781 337 59 182 1586 --
NM_001033521chr201123 1507 ----
NM_001033522chr201123 1507 ----
NM_001033557chr211370 ------
NM_001033566chr172795 352 ----154
NM_001033568chr172795 352 ----154
NM_001033602chr1321891 593 ----11046
NM_001033723chr852559 2047 1977 1104 794 12279 1541 11095
NM_001033756chr641578 1414 493 104 31852 1556 694 1118 --
NM_001033756chr641578 1414 493 104 31852 1556 694 1118 --
NM_001033925chr1011872 1259 --161
NM_001034025chr122912 837 179 ----
NM_001034837chr51823 --1124 --
NM_001034838chr51823 --1124 --
NM_001034841chr1665173 4816 3823 1258 679 282 14856 12154 15492
NM_001034845chr451401 1022 535 460 447 1389 ----
NM_001034850chr531373 1076 577 11459 ----
NM_001034852chr1431915 1324 133 --1441 --
NM_001034954chr1062740 1219 1123 960 771 749 23078 2947 ----
NM_001034955chr1062740 1219 1123 960 771 749 23078 2947 ----
NM_001034956chr1062740 1219 1123 960 771 749 23078 2947 ----
NM_001034957chr1062740 1219 1123 960 771 749 23078 2947 ----
NM_001035chr141037 825 239 138 1184 1256 11323
NM_001035003chr431306 234 75 ----11041
NM_001035004chr431306 234 75 ----11041
NM_001035260chr1021076 310 1346 --11404
NM_001035511chr171907 1854 1775 1725 1475 247 143 --11516 --
NM_001035512chr182014 1961 1882 1832 1582 354 250 69 --11623 --
NM_001035513chr182014 1961 1882 1832 1582 354 250 69 --11623 --
NM_001035521chr21154 ------
NM_001035534chr93179 158 70 --11074 --
NM_001037132chr72615 372 --2898 874 --
NM_001037133chr72615 372 --2898 874 --
NM_001037164chr731666 786 148 22069 1645 11404 --
NM_001037172chr341213 1082 528 307 11180 ----
NM_001037174chr211415 11578 ----
NM_001037225chr112113 47 ------
NM_001037317chr172655 2573 974 861 617 500 297 21925 449 ----
NM_001037331chr183797 196 114 ------
NM_001037334chr1841865 1779 706 659 21753 1523 2410 146 --
NM_001037339chr141854 663 568 30 21487 247 1298 --
NM_001037340chr141854 663 568 30 21487 247 1298 --
NM_001037341chr141854 663 568 30 21487 247 1298 --
NM_001037341chr141854 663 568 30 21487 247 1298 --
NM_001037535chrX31246 314 225 11116 --11140
NM_001037536chrX31246 314 225 11116 --11140
NM_001037540chrX31246 314 225 11116 --11140
NM_001037582chr41612 11219 2540 235 11605
NM_001037872chr2--1667 ----
NM_001037954chr1152912 2433 2402 1374 189 21386 259 22697 1087 --
NM_001038493chr251544 1165 1059 578 357 --1629 --
NM_001038640chr154822 727 395 40 ------
NM_001038702chr562687 2187 2062 2022 852 785 183 32546 2390 683 --
NM_001038707chr152181 2017 1690 1438 525 22044 1775 21868 44 --
NM_001038707chr152181 2017 1690 1438 525 22044 1775 21868 44 --
NM_001039091chrX31292 894 468 2302 36 --11417
NM_001039111chr31410 ------
NM_001039348chr2--11061 ----
NM_001039349chr2--11061 ----
NM_001039350chr731724 1224 715 11530 ----
NM_001039372chr72669 422 140 ----
NM_001039395chr942461 2231 1661 85 ------
NM_001039457chr12202 33 ------
NM_001039459chr71194 ------
NM_001039465chr142477 83 ------
NM_001039479chr1441924 902 675 625 --2234 203 --
NM_001039538chr293512 2638 2598 2290 1403 664 370 248 86 166 22330 1480 1330
NM_001039547chr3117831 7191 6813 6198 5752 2645 2052 1726 1647 1231 648 25281 2384 67412 6437 5515 5074 2093 1749 --
NM_001039548chr11----163 --
NM_001039550chr22720 175 ------
NM_001039569chr232824 1076 851 --32926 1304 1168 --
NM_001039570chr2294475 3906 3682 3418 1729 1625 1034 484 346 24522 3258 11389 --
NM_001039571chr2294475 3906 3682 3418 1729 1625 1034 484 346 24522 3258 11389 --
NM_001039573chr173432 397 139 ------
NM_001039574chr12246 63 ------
NM_001039585chr184050 3956 3679 2858 1267 853 685 39 12898 1642 13667
NM_001039590chrX23833 3471 1607 21567 357 1627
NM_001039591chrX23833 3471 1607 21567 357 1627
NM_001039618chr1155710 4850 4834 4108 324 24458 2310 12208 --
NM_001039709chr2075285 4696 4212 4097 3253 1329 199 15260 24282 1394 11969
NM_001039711chr13967 777 326 1441 122 --
NM_001039712chr13967 777 326 1441 122 --
NM_001039715chr15964 869 749 680 341 --1294 1386
NM_001039716chr151028 933 813 744 405 --1358 1450
NM_001039762chr1021675 182 --2896 825 --
NM_001039771chr141299 ----1869
NM_001039802chr121393 333 --1380 --
NM_001039840chrX145204 4574 4109 3936 1663 1555 1463 1165 815 622 442 381 202 132 25631 3878 34410 4076 506 --
NM_001039888chr14557 536 190 164 ------
NM_001039937chr13173476 3466 3256 3035 2841 1380 1140 1083 1035 1013 823 769 529 495 372 348 206 1936 ----
NM_001040001chr661964 1686 1449 1405 1307 480 1688 123 --
NM_001040033chr11700 ------
NM_001040057chr73989 421 223 ------
NM_001040101chr431299 622 222 2213 55 11600 --
NM_001040102chr1052710 1931 1755 601 124 --21087 134 --
NM_001040103chr1052710 1931 1755 601 124 --21087 134 --
NM_001040107chr122244 140 ------
NM_001040110chr741836 1356 177 97 --11853 --
NM_001040113chr163971 708 272 ------
NM_001040114chr163830 567 131 ------
NM_001040142chr242066 1862 1665 420 ------
NM_001040143chr242066 1862 1665 420 ------
NM_001040151chr1194510 4380 4106 3448 3344 1303 392 333 220 21477 1382 44132 3035 1030 519 --
NM_001040152chr755085 4317 501 339 135 1424 11303 --
NM_001040153chr132260 199 ------
NM_001040158chr51407 ------
NM_001040159chr431272 582 291 ------
NM_001040181chr3----1422 --
NM_001040182chr3----1422 --
NM_001040183chr3----1422 --
NM_001040199chr3----1422 --
NM_001040200chr3----1422 --
NM_001040214chr631485 947 412 12335 ----
NM_001040272chr922338 1943 1761 ----
NM_001040284chr16125542 5310 5117 5020 3732 2188 1554 1425 1302 1200 1048 920 22261 1900 14884 --
NM_001040402chr492773 2610 2009 1266 1137 843 801 756 156 12732 ----
NM_001040429chr1332619 2309 363 --13118 --
NM_001040441chr185496 5423 5179 5069 1146 815 624 173 1533 45043 4490 2168 1669 1167
NM_001040446chr552507 2227 2054 987 952 --1622 --
NM_001040450chr1542682 2070 710 181 22521 1947 12083 --
NM_001040453chr1542682 2070 710 181 22521 1947 12083 --
NM_001040619chr1--11532 1619 --
NM_001040624chr832128 2035 1839 12047 12167 --
NM_001040625chr832128 2035 1839 12047 12167 --
NM_001040626chr832128 2035 1839 12047 12167 --
NM_001040627chr832128 2035 1839 12047 12167 --
NM_001040628chr832128 2035 1839 12047 12167 --
NM_001040629chr832128 2035 1839 12047 12167 --
NM_001040630chr832128 2035 1839 12047 12167 --
NM_001040665chr784941 4890 3995 3554 2013 1963 1557 1223 23878 923 ----
NM_001040666chr72643 592 ------
NM_001040708chr83447 302 112 --1270 --
NM_001040709chr142191 1943 787 774 1341 1109 --
NM_001040712chr983313 3006 3000 2200 1442 1234 805 410 --12702 --
NM_001040876chr43715 187 102 1668 ----
NM_001042355chr16145273 4980 4491 3842 3603 3578 1986 1528 1335 1329 1159 642 457 198 24644 1614 --15321
NM_001042361chr1071436 1136 1086 570 424 409 25 ------
NM_001042364chr1071436 1136 1086 570 424 409 25 ------
NM_001042365chr1071436 1136 1086 570 424 409 25 ------
NM_001042383chr363305 2940 2630 1373 1347 1038 12930 22437 227 --
NM_001042387chr1071436 1136 1086 570 424 409 25 ------
NM_001042388chr182898 790 1748 ----
NM_001042393chr1071436 1136 1086 570 424 409 25 ------
NM_001042396chr1071436 1136 1086 570 424 409 25 ------
NM_001042397chr1071436 1136 1086 570 424 409 25 ------
NM_001042403chr124983 958 643 386 ------
NM_001042404chr171846 1835 778 755 579 500 432 --21613 536 --
NM_001042406chr61827 186 ----
NM_001042412chr16145273 4980 4491 3842 3603 3578 1986 1528 1335 1329 1159 642 457 198 24644 1614 --15321
NM_001042413chr973645 3590 3304 1557 1449 264 69 --33470 1415 935 --
NM_001042425chr621243 208 ------
NM_001042430chr14----1176 --
NM_001042437chr22372 159 294 40 ----
NM_001042453chrX2656 360 ------
NM_001042459chr32277 104 ------
NM_001042473chr1011535 1715 22047 532 --
NM_001042476chr1662105 1989 1954 855 81 45 11620 ----
NM_001042481chr1472446 2032 1802 881 780 475 167 ----12368
NM_001042486chr202449 99 ----1433
NM_001042492chr1753309 3004 2742 2459 368 22498 912 ----
NM_001042494chr1563847 3437 2866 2536 1106 1072 --21394 679 11281
NM_001042495chr1563847 3437 2866 2536 1106 1072 --21394 679 11281
NM_001042496chr1563847 3437 2866 2536 1106 1072 --21394 679 11281
NM_001042497chr1563847 3437 2866 2536 1106 1072 --21394 679 11281
NM_001042506chrX2446 318 ------
NM_001042510chr842108 1382 345 172 2307 195 ----
NM_001042511chr842108 1382 345 172 2307 195 ----
NM_001042517chr132947 655 1769 ----
NM_001042537chrX42077 1860 1839 1531 12112 1204 --
NM_001042555chr12154770 4639 4609 3830 3720 3487 1816 1286 1269 1260 1221 1208 1088 729 293 ------
NM_001042599chr287400 6976 6905 5378 5240 2903 638 312 46703 6623 1919 667 26286 5604 --
NM_001042601chr373211 3078 3039 2980 2468 2441 861 --22508 632 --
NM_001042603chr12125370 5322 4957 4913 4703 3730 3633 1981 1479 456 173 160 1697 ----
NM_001042604chr363341 1317 682 313 189 149 ----11022
NM_001042616chr42561 168 1198 ----
NM_001042632chr2031651 990 314 21700 61 1322 --
NM_001042633chr2031651 990 314 21700 61 1322 --
NM_001042646chr341377 574 260 170 11617 ----
NM_001042669chr461562 1203 536 506 54 33 1674 ----
NM_001042681chr142229 914 839 792 12028 ----
NM_001042682chr142229 914 839 792 12028 ----
NM_001042682chr142229 914 839 792 12028 ----
NM_001042724chr19--1844 ----
NM_001042749chrX61822 1800 1722 520 482 86 ------
NM_001042750chrX61822 1800 1722 520 482 86 ------
NM_001042751chrX61822 1800 1722 520 482 86 ------
NM_001042762chr721125 913 --1795 --
NM_001043318chr1443765 2941 1092 774 11390 32637 1468 870 --
NM_001043351chr131979 1425 381 12057 12101 --
NM_001044305chr631451 1366 1255 ------
NM_001044385chr233868 2954 2616 23306 1242 ----
NM_001044387chr1973880 3421 2943 2704 2654 2563 967 11010 43555 3345 3040 643 --
NM_001044388chr1973880 3421 2943 2704 2654 2563 967 11010 43555 3345 3040 643 --
NM_001044722chr551565 941 555 159 105 ------
NM_001044723chr551565 941 555 159 105 ------
NM_001046chr562885 2818 1132 781 435 399 11110 --12835
NM_001048183chr123349 976 --42967 1202 762 199 1139
NM_001049chr1472218 1911 1763 678 609 535 258 124 --1385
NM_001071775chr1371743 1677 1399 1274 576 214 38 2671 281 ----
NM_001079874chr172067 1988 1777 1737 1696 548 365 --12124 --
NM_001080418chr11146 ------
NM_001083620chr432484 2023 1697 ------
NM_001092chr1731754 486 358 1552 ----
NM_001095chr1281921 1607 1545 1266 1198 548 298 181 --1340 --
NM_001096chr173816 792 242 ------
NM_001099678chr336055 5559 5129 --25304 4771 --
NM_001106chr3149665 9220 9077 8454 7581 7223 7199 7069 3806 3263 3214 2957 2757 951 36436 3877 3871 17045 --
NM_001109977chr44769 299 278 244 ------
NM_001113490chrX43286 2312 2259 687 23191 1025 33645 3594 2338 --
NM_001116chr1652770 1242 612 178 32 11084 ----
NM_001117chr184814 601 542 198 12480 ----
NM_001119chr441409 444 74 45 --1371 --
NM_001121chr1051560 1507 710 581 231 ------
NM_001122631chr113492 436 191 ------
NM_001122679chr531186 969 854 ------
NM_001123chr104834 639 571 288 ------
NM_001126chr11169 ----1417
NM_001127chr2231100 978 208 ------
NM_001128chr16133980 3580 3516 3400 3339 3295 990 782 473 229 223 50 23 22680 1412 1366 --
NM_001140chr171165 ------
NM_001143chrY2108 39 ------
NM_001146chr822015 786 21464 688 ----
NM_001148chr431881 1851 397 ----1860
NM_001149chr1021234 220 ------
NM_001152chrX168 ------
NM_001153chr24773 593 373 283 1793 1943 2908 42
NM_001156chr102505 257 ------
NM_001160chr122470 278 ------
NM_001163chr91154 --1986 --
NM_001167chrX106415 6406 5590 4930 4887 4390 4292 1233 831 503 16358 ----
NM_001169chr16----1413 --
NM_001172chr143797 563 124 1659 ----
NM_001173chr1494707 4301 4139 3968 3479 1600 1450 1058 753 --1438 --
NM_001177chr1242377 2287 1529 485 12401 ----
NM_001179chr41201 ------
NM_001191chr203517 450 22 ------
NM_001198chr652348 1828 1650 474 92 ------
NM_001200chr2041166 465 331 98 ------
NM_001204chr2107575 6302 6020 5811 5209 1600 1529 1042 593 212 12179 14860 --
NM_001206chr992746 2501 2124 1968 1216 1105 796 539 449 23113 140 ----
NM_001215chr11369 1150 ----
NM_001219chr752258 1948 1842 1520 345 --1231 --
NM_001222chr1031796 1461 64 1431 ----
NM_001227chr10--1529 11242 --
NM_001237chr41270 1399 ----
NM_001237chr41270 1399 ----
NM_001241chr262403 1910 1902 1537 918 714 --12411 1246
NM_001241chr262403 1910 1902 1537 918 714 --12411 1246
NM_001248chr33958 888 183 ------
NM_001253chr62217 53 ------
NM_001256chr1782525 2170 1150 1039 757 617 134 84 ------
NM_001257chr1631136 542 438 ------
NM_001259chr7105106 5048 3998 2409 1488 1402 1269 722 458 137 --12514 --
NM_001262chr12354 307 1224 ----
NM_001265chr132188 61 ------
NM_001270chr55980 936 926 729 444 1373 ----
NM_001271chr1512776 1179 32846 2823 204 2462 247
NM_001273chr12151 ------
NM_001278chr10185 21082 861 11208 --
NM_001280chr191109 ------
NM_001282chr1752565 2537 1808 674 401 ------
NM_001283chr71186 ----1542
NM_001293chr11128 --169 --
NM_001299chr191481 --1195 --
NM_001304chr1753048 2723 981 238 186 ------
NM_001310chr1242540 2286 2018 902 21089 43 22767 2278 --
NM_001313chr42994 37 ------
NM_001319chr191199 ------
NM_001324chr201123 1507 ----
NM_001332chr531098 981 405 --11321 --
NM_001343chr521696 173 --1552 --
NM_001346chr34964 619 436 115 12810 22127 178 --
NM_001351chr32670 110 183 11606 21592 1463
NM_001356chrX21642 625 12457 ----
NM_001358chr4------1149
NM_001362chr143691 287 188 ------
NM_001364chr11124046 3827 3675 3119 3107 2963 1708 1630 1554 1135 954 852 33691 3644 1417 --1423
NM_001379chr19----1200 --
NM_001380chr1041031 969 382 297 2347 269 1747 --
NM_001386chr832421 1873 770 --1648 159
NM_001387chr593096 2215 2195 2054 2046 1961 1267 1256 921 ------
NM_001389chr211573 ------
NM_001392chr18--149 ----
NM_001396chr2131960 1825 889 --11012 --
NM_001400chr13928 388 33 ------
NM_001401chr931540 345 269 ------
NM_001408chr11302 --1223 --
NM_001412chrX73384 3193 3041 2868 1455 1422 1316 12640 1201 --
NM_001416chr171130 1498 ----
NM_001417chr1221739 462 1536 ----
NM_001419chr1984873 4235 3684 3019 1945 881 535 145 23989 758 ----
NM_001421chrX61675 1632 1626 1537 1266 544 1583 ----
NM_001423chr1241956 1762 1462 548 22074 210 ----
NM_001426chr21227 ------
NM_001427chr741752 1456 628 323 --1451 --
NM_001429chr2231052 970 421 ------
NM_001430chr23768 175 57 12032 11507 --
NM_001431chr64417 299 176 36 ----1333
NM_001432chr453654 3035 1354 677 598 13468 33642 3420 3394 11281
NM_001438chr163685 3600 2358 1073 356 305 11260 12304 --
NM_001443chr2159 ------
NM_001447chr52891 377 ------
NM_001448chrX71723 1537 1496 285 151 80 59 11477 ----
NM_001449chrX21221 502 --11265 --
NM_001451chr1631034 929 332 ------
NM_001452chr6129 --1637 --
NM_001453chr621775 1593 --1225 --
NM_001461chr13250 211 138 ------
NM_001463chr21702 ------
NM_001466chr171112 ------
NM_001478chr124284 255 127 93 ------
NM_001482chr152195 67 ------
NM_001491chr632410 1102 805 21788 905 22172 209 --
NM_001494chr101776 --1206 --
NM_001495chr841198 354 282 240 --1417 --
NM_001497chr972622 2501 2242 2147 1980 468 205 ------
NM_001498chr631144 888 274 1860 ----
NM_001514chr1141 --1146 --
NM_001521chr21154 ------
NM_001527chr6104569 3653 3002 1591 1583 1349 969 610 426 101 24890 675 24085 3709 --
NM_001530chr141904 --2965 754 --
NM_001533chr192293 227 ------
NM_001542chr172654 2593 1861 811 470 347 89 1920 1616 --
NM_001546chr651233 1110 361 208 183 21359 1014 ----
NM_001550chr71632 1647 ----
NM_001554chr13486 215 132 ------
NM_001560chrX112146 2065 1903 1699 1657 1620 839 787 761 208 55 ------
NM_001564chr41144 ------
NM_001584chr1131147 872 74 ------
NM_001587chrX72150 2068 1783 1485 1404 420 359 22029 345 --2737 480
NM_001609chr10114175 4156 3237 1721 1130 1054 808 575 297 287 204 11666 ----
NM_001614chr171573 ------
NM_001614chr171573 ------
NM_001616chr243354 2620 1072 154 140 ----
NM_001617chr231288 1062 1017 --1490 --
NM_001620chr111770 ------
NM_001621chr752531 2475 927 576 265 1373 ----
NM_001621chr752531 2475 927 576 265 1373 ----
NM_001622chr3--1305 ----
NM_001634chr651780 1749 1713 462 231 ------
NM_001635chr7174 ------
NM_001642chr112889 170 ------
NM_001650chr1883908 3579 3463 2954 1552 1543 1040 940 --21204 888 --
NM_001654chrX1445 ------
NM_001655chr1131745 863 184 --1385 11777
NM_001656chr561691 1678 1340 240 155 48 ------
NM_001658chr1146 --1823 --
NM_001659chr1272199 2174 2038 1737 1017 857 741 --1814 --
NM_001662chr72310 100 ------
NM_001663chr1451970 1048 826 115 91 2882 237 21766 855 --
NM_001664chr32740 380 --1855 --
NM_001668chr141766 923 589 155 22166 381 --12142
NM_001674chr11249 11082 1169 --
NM_001676chr131169 ------
NM_001677chr11358 --1772 --
NM_001678chr1751575 1243 678 464 302 21567 529 21263 1169 --
NM_001679chr3175 ------
NM_001681chr121279 --1137 --
NM_001682chr1222497 1876 ----12634
NM_001683chr332524 1833 344 1940 22606 1670 --
NM_001684chr162624 1528 1228 1151 343 317 22937 1312 --1491
NM_001690chr352215 928 591 414 355 22489 1637 1250 --
NM_001693chr841185 912 70 28 ----1814
NM_001699chr1951851 1815 1317 1216 78 1734 11452 --
NM_001701chr941321 1292 1267 459 ----11246
NM_001703chr11278 --2299 65 --
NM_001704chr63486 448 386 1543 ----
NM_001706chr32389 70 --1962 --
NM_001707chr71828 --151 --
NM_001709chr113854 790 645 ------
NM_001718chr6--1106 132 11238
NM_001731chr122804 233 ------
NM_001742chr71388 1463 ----
NM_001743chr22516 225 ------
NM_001744chr52100 50 ------
NM_001746chr572886 2867 2228 2178 1919 1124 311 22610 1101 ----
NM_001748chr13374 294 277 --178 --
NM_001753chr751527 1491 1427 588 137 11553 ----
NM_001754chr2153806 3740 3694 3653 2850 13143 ----
NM_001755chr165851 845 684 493 353 ------
NM_001759chr12105060 4717 4535 4048 3861 3847 1963 1593 1084 110 ----21222 976
NM_001769chr12----1126 --
NM_001777chr373939 3686 2791 2705 2540 862 605 13404 12943 --
NM_001781chr124800 285 102 74 ------
NM_001786chr101183 ------
NM_001788chr72776 345 --1929 --
NM_001791chr121393 333 --1380 --
NM_001792chr18188 ------
NM_001794chr20----1237 --
NM_001796chr16----139 --
NM_001797chr16--1708 ----
NM_001798chr122858 145 ------
NM_001799chr51224 ------
NM_001800chr192465 71 ------
NM_001802chr162943 744 181 ----
NM_001806chr1932985 1182 523 --12845 --
NM_001826chr1------1103
NM_001829chr411008 ------
NM_001830chrX43076 3000 1244 492 23914 3473 13987 --
NM_001833chr9--1260 ----
NM_001839chr13696 560 266 ------
NM_001842chr91114 ------
NM_001844chr123373 83 74 ------
NM_001854chr11334 1485 ----
NM_001855chr91225 1633 1300 --
NM_001858chr673775 3707 3507 1187 877 782 670 --13158 --
NM_001859chr953568 3496 3059 1307 1080 12734 33596 2445 546 1990
NM_001873chr41190 ----1683
NM_001880chr21292 ------
NM_001881chr102381 374 ------
NM_001882chr52519 175 ------
NM_001890chr43369 145 21 ------
NM_001892chr551077 576 493 443 157 ------
NM_001893chr17151 ------
NM_001894chr2221182 1142 1888 --1491
NM_001895chr2021198 398 ------
NM_001896chr16140 ------
NM_001901chr63901 797 420 1988 ----
NM_001904chr32784 57 1147 ----
NM_001908chr8--21814 818 32229 1919 563 --
NM_001921chr421250 1239 ------
NM_001924chr11170 ------
NM_001931chr1131247 223 47 11050 ----
NM_001933chr1431332 538 459 ------
NM_001935chr21982 ------
NM_001936chr731724 1224 715 11530 ----
NM_001938chr121898 744 ------
NM_001939chrX93846 3518 3502 3303 1159 1101 794 443 130 13803 1664 --
NM_001942chr1861886 1828 1556 1318 321 311 ------
NM_001945chr541425 1135 1097 889 ------
NM_001946chr125983 885 444 234 183 ------
NM_001949chr61685 1881 ----
NM_001951chr83553 514 247 2181 117 ----
NM_001955chr6266 60 1753 ----
NM_001957chr442260 923 474 218 ----11778
NM_001964chr521105 443 ------
NM_001965chr23471 372 75 ------
NM_001967chr31625 ------
NM_001968chr42656 376 --2851 272 --
NM_001969chr1453460 2990 780 393 116 1323 13035 12467
NM_001977chr41293 21618 1386 ----
NM_001981chr112075 1371 1859 --
NM_001982chr1241283 1270 301 195 --1830 --
NM_001987chr1284093 4020 3906 3253 2723 1053 622 204 ------
NM_001991chr1732213 2099 735 ------
NM_001993chr14903 868 831 405 --1160 1188
NM_001995chr441212 388 351 220 ------
NM_001999chr521519 172 1135 2945 348 --
NM_002006chr485738 4093 3851 3788 2186 873 660 588 45249 5089 2237 785 35542 1953 1514 --
NM_002010chr132452 116 ------
NM_002015chr1352834 2187 2046 833 416 13195 31074 958 523 --
NM_002019chr133911 760 675 2811 607 ----
NM_002023chr151424 1153 504 425 206 ------
NM_002024chrX41548 465 338 69 12098 ----
NM_002025chrX269167 8512 8495 7762 7241 7206 6959 6230 6065 5991 3428 3388 2973 2661 2585 2439 2069 1881 1762 1703 1697 1583 847 590 423 40 56689 6396 5801 3030 2023 ----
NM_002035chr1873781 3687 3671 3407 2760 1266 395 12546 23163 612 --
NM_002037chr61356 1127 ----
NM_002039chr44665 616 286 86 ------
NM_002040chr2133053 2296 146 1172 ----
NM_002045chr31344 ----183
NM_002048chr941191 972 547 173 ------
NM_002051chr10----1146 1218
NM_002052chr821386 1086 11189 ----
NM_002054chr2--197 ----
NM_002056chr21778 1206 ----
NM_002061chr141872 621 526 180 --21737 1263 --
NM_002063chrX31156 805 387 ----183
NM_002065chr11385 21610 557 ----
NM_002069chr711863 ------
NM_002074chr151633 1539 1167 1145 345 11292 ----
NM_002076chr12103263 3199 3188 2971 2605 2179 2120 1023 614 187 ----12255
NM_002077chr942134 1888 627 41 --1198 11990
NM_002086chr1742232 2094 2041 1552 --2669 140 --
NM_002087chr172303 21 ----1111
NM_002091chr181116 ------
NM_002092chr444909 4109 3281 695 1409 24181 3553 --
NM_002094chr16------1374
NM_002103chr193850 749 288 ------
NM_002106chr4143 --1342 --
NM_002107chr1131 ------
NM_002112chr15277 47 ------
NM_002126chr1751121 1086 1017 375 97 34173 2869 1229 23529 2718 13218
NM_002128chr1342441 2280 1949 1648 11929 1381 1430
NM_002130chr541408 1311 611 247 21711 395 ----
NM_002135chr122437 36 1464 ----
NM_002137chr742020 1971 1792 768 ------
NM_002140chr921013 43 1870 ----
NM_002146chr1731238 942 59 ------
NM_002148chr23699 160 111 ------
NM_002154chr5158 1510 ----
NM_002156chr21318 ------
NM_002158chr22480 26 11422 ----
NM_002176chr9150 ------
NM_002182chr352203 2173 1993 306 156 ------
NM_002192chr72634 448 ------
NM_002193chr221831 539 --1109 1391
NM_002196chr204979 868 206 176 ------
NM_002196chr204979 868 206 176 ------
NM_002199chr41758 ------
NM_002202chr51924 166 ----
NM_002203chr574105 3014 2602 1555 948 350 280 ----11493
NM_002205chr122982 56 ------
NM_002207chr34746 482 225 131 1219 ----
NM_002210chr242905 2571 1357 934 12525 13321 13376
NM_002211chr1031121 1086 216 11007 ----
NM_002214chr7154812 4689 4488 4056 3949 3557 2216 2188 1192 948 766 641 517 305 237 25568 4682 25694 3848 --
NM_002222chr31152 ------
NM_002223chr1293651 3231 2816 2454 1306 1295 669 599 442 22642 1426 --12767
NM_002227chr131304 1284 497 --21296 828 --
NM_002232chr12196 137 ------
NM_002233chr111463 ------
NM_002239chr231178 342 302 1930 ----
NM_002240chr21163 ------
NM_002241chr132227 1188 632 1730 1449 --
NM_002245chr12560 107 ------
NM_002247chr1052114 1797 840 794 231 1372 ----
NM_002252chr2--1144 1296 --
NM_002253chr441361 1087 1015 564 ------
NM_002254chr292184 2175 1976 931 656 538 531 440 205 11467 ----
NM_002264chr3124899 4593 4461 4357 4297 3556 3282 1869 1836 1062 584 227 33323 3150 1527 --24892 679
NM_002265chr172919 794 ------
NM_002267chr1332313 1640 740 --2381 151 --
NM_002268chr361706 1460 1445 1238 732 341 11733 ----
NM_002269chr61403 ------
NM_002270chr575500 4206 4058 3850 3795 2184 1824 14810 1882 --
NM_002271chr1362415 2307 1668 840 379 119 22029 1896 42119 1909 1797 525 --
NM_002285chr254008 3397 2750 354 31 11260 ----
NM_002293chr142673 1709 392 245 --12152 --
NM_002294chrX----179 --
NM_002298chr1351435 514 501 179 106 ------
NM_002309chr2283196 2851 2803 2567 2440 2401 2075 2064 12432 32045 305 157 --
NM_002310chr586405 5414 5120 4142 2630 1499 261 79 26297 644 ----
NM_002313chr1095095 3776 3524 1928 1626 1585 1452 1144 563 22013 1691 14263 --
NM_002314chr7----11027 11084
NM_002317chr5--1361 ----
NM_002334chr1111941 --21790 377 --
NM_002335chr111162 ------
NM_002336chr1274881 4348 4321 4197 4124 1785 1638 --1600 --
NM_002351chrX21319 1260 1542 11640 --
NM_002355chr125987 906 528 496 439 ------
NM_002356chr632178 1136 318 --22577 207 --
NM_002359chr1743061 890 485 431 1491 13401 --
NM_002372chr52123 115 ------
NM_002374chr293512 2638 2598 2290 1403 664 370 248 86 166 22330 1480 1330
NM_002375chr312288 ------
NM_002376chr141592 ------
NM_002381chr23948 700 62 1908 ----
NM_002382chr1421216 427 1451 ----
NM_002387chr5185167 5089 4828 4628 4603 4154 3976 3647 3475 3268 3187 1987 944 829 741 731 290 206 15177 ----
NM_002389chr161505 1251 762 581 196 184 11585 ----
NM_002395chr631075 455 229 11446 1191 --
NM_002397chr51127 ------
NM_002398chr22414 401 ------
NM_002399chr152524 277 1389 ----
NM_002401chr1752303 2263 1865 739 544 1792 12340 --
NM_002402chr71125 51186 1051 267 211 173 1334 --
NM_002408chr146779 751 584 324 316 308 ------
NM_002409chr2252626 2420 1238 1209 456 22296 1104 12305 13146
NM_002422chr11134 ------
NM_002429chr1221075 196 --11498 --
NM_002430chr2262411 1999 1970 1723 1641 780 --12136 --
NM_002442chr1211110 ------
NM_002444chrX41620 1404 1299 712 --11762 --
NM_002448chr44542 225 202 151 ------
NM_002451chr983853 2904 2806 2688 1028 459 269 36 ------
NM_002455chr1137 ------
NM_002467chr81158 ------
NM_002469chr121411 ------
NM_002474chr163830 567 131 ------
NM_002478chr111440 ------
NM_002480chr12--11239 ----
NM_002481chr1188009 7911 7543 7235 6932 6690 5455 5003 4988 4907 2424 1635 801 543 321 264 169 151 21621 957 32555 970 824 --
NM_002482chr13575 501 62 1521 ----
NM_002486chr962505 2338 2242 1924 465 438 12172 11688 --
NM_002492chr3166 ------
NM_002499chr1542494 2200 1920 234 1571 21971 307 1611
NM_002501chr1931276 1244 307 1424 13488 --
NM_002505chr651267 1086 625 538 200 --196 --
NM_002506chr1140 ------
NM_002508chr141789 1627 1548 48 1501 ----
NM_002514chr821091 299 ------
NM_002515chr1441960 658 219 73 ------
NM_002518chr23817 384 230 --1992 --
NM_002519chr1141299 614 126 104 1361 ----
NM_002522chr1753868 3761 1545 805 440 11112 23181 2648 --
NM_002524chr131064 914 39 ------
NM_002526chr661464 1349 1206 1080 657 538 11732 21741 1172 --
NM_002527chr12----1232 --
NM_002530chr15130 ------
NM_002536chrX51482 229 195 155 46 ------
NM_002538chr53475 401 75 ------
NM_002539chr21213 ------
NM_002541chr751027 812 752 297 206 ----1958
NM_002543chr1231451 1007 48 --11395 --
NM_002544chr17--1134 ----
NM_002545chr1184994 4919 4669 3370 2016 1583 1255 613 23932 3201 ----
NM_002546chr81518 1733 ----
NM_002547chrX83810 3584 2880 1655 1131 279 203 129 1378 1551 --
NM_002553chr72386 330 1156 ----
NM_002563chr321023 832 ------
NM_002568chr8--1133 ----
NM_002569chr152474 48 ------
NM_002570chr154997 363 275 259 11263 ----
NM_002572chr111389 --192 --
NM_002577chr3104035 3596 3118 3079 2834 873 307 298 75 25 11137 33630 2518 539 --
NM_002581chr921298 966 34840 2089 1283 11544 24781 525
NM_002582chr162857 706 ------
NM_002586chr641447 420 392 367 ------
NM_002588chr521744 1158 ------
NM_002590chr131485 1231 ----
NM_002594chr2042003 1553 656 182 1723 --1919
NM_002595chr1241868 1474 724 526 11616 ----
NM_002599chr1141162 297 254 201 --21078 819 --
NM_002600chr141854 663 568 30 21487 247 1298 --
NM_002601chr22435 153 ------
NM_002605chr152960 920 1822 ----
NM_002610chr272715 2656 2443 2399 1173 930 877 1553 1258 --
NM_002612chr741465 833 703 22 21957 532 ----
NM_002613chr1685064 4608 4390 4364 4211 3647 3548 602 13491 11322 --
NM_002627chr10179 ------
NM_002628chr341058 959 781 437 --21152 261 1358
NM_002635chr121126 ------
NM_002643chr2137 ------
NM_002645chr1112903 1290 11237 --
NM_002646chr13853 172 132 11764 11842 --
NM_002648chr641122 1028 879 232 1269 ----
NM_002655chr865110 4987 4882 3633 1342 664 1557 13307 --
NM_002656chr62849 31 ------
NM_002657chr2093690 3356 2568 1542 1365 1305 941 825 36 13428 13749 --
NM_002663chr171523 ------
NM_002670chr351602 1299 577 466 295 164 ----
NM_002674chr122188 177 ------
NM_002687chr146997 845 342 282 155 30 11188 ----
NM_002698chr1922530 74 ----12546
NM_002699chr121459 476 ------
NM_002706chr21653 ------
NM_002707chr25376 363 349 304 280 ------
NM_002709chr252358 2335 2247 724 196 11177 ----
NM_002710chr122979 971 1387 ----
NM_002711chr72701 561 1692 ----
NM_002714chr62262 53 1394 1992 --
NM_002715chr52834 185 --1903 --
NM_002716chr1173492 3320 3215 3140 2318 1330 866 11021 ----
NM_002717chr83441 225 163 ------
NM_002718chr392685 2197 639 626 586 420 259 252 134 22354 97 11961 11893
NM_002719chr1452275 2188 1504 740 52 1714 --1587
NM_002721chr9----196 --
NM_002729chr101120 ------
NM_002731chr152888 2236 987 575 227 --2157 47 --
NM_002734chr1761937 1731 1509 1415 851 223 1664 ----
NM_002736chr771911 1751 1448 595 429 229 181 11832 11735 --
NM_002738chr163737 716 381 11035 --11083
NM_002739chr195668 502 257 125 96 ------
NM_002740chr341998 1841 905 628 12822 1375 12168
NM_002742chr141679 ------
NM_002745chr2254034 3623 2830 451 419 --34440 1767 719 1112
NM_002750chr10174 1199 ----
NM_002752chr5----1368 --
NM_002755chr152305 148 ------
NM_002765chrX31292 894 468 2302 36 --11417
NM_002767chr171522 ------
NM_002776chr1942004 1980 339 192 11406 11653 --
NM_002779chr103574 438 221 ------
NM_002786chr11--182 ----
NM_002794chr1183 ------
NM_002813chr122272 180 11168 ----
NM_002819chr19166 ------
NM_002822chr1241581 688 479 127 ----1592
NM_002825chr71440 --1589 --
NM_002827chr2051758 1511 1451 1190 713 --11112 21594 209
NM_002829chr921229 134 ------
NM_002830chr22391 147 1124 ----
NM_002835chr72299 23 ------
NM_002836chr20157 ------
NM_002837chr1274513 4246 3737 3348 3151 3078 3054 54636 4388 3729 1710 1226 ----
NM_002839chr983313 3006 3000 2200 1442 1234 805 410 --12702 --
NM_002840chr121325 1258 --1469 --
NM_002841chr31697 ------
NM_002843chr1133030 2282 242 11341 ----
NM_002848chr1261223 938 861 827 514 257 11053 --11281
NM_002849chr1221073 684 3793 212 108 ----
NM_002851chr73671 625 134 ------
NM_002858chr111213 ------
NM_002860chr103779 238 78 ------
NM_002861chr177535 521 175 125 104 72 37 ------
NM_002867chr14252 236 90 79 --1685 --
NM_002868chr1262274 970 842 719 211 151 11886 1271 --
NM_002869chr113888 767 57 ------
NM_002874chr992368 2307 2000 1980 1839 871 839 544 297 --11605 --
NM_002880chr3161 ------
NM_002884chr12881 188 124 ----
NM_002886chr364656 3414 1849 1573 1001 205 21932 627 34850 101 29 14249
NM_002890chr53397 150 101 ------
NM_002892chr1461652 1637 1177 1116 611 394 ------
NM_002893chrX2332 139 ------
NM_002894chr181191 ------
NM_002895chr204962 276 62 32 ------
NM_002896chr112414 100 ------
NM_002900chr102303 122 ------
NM_002902chr15195 ------
NM_002906chr1141985 1826 1561 408 ------
NM_002912chr6----1208 --
NM_002923chr1140 ----2629 257
NM_002924chr11502 --151 --
NM_002930chr18129 --170 --
NM_002938chr431447 581 528 ----11511
NM_002940chr43715 187 102 1668 ----
NM_002941chr31598 ------
NM_002942chr331323 326 315 132 ----
NM_002950chr31288 1351 144 --
NM_002956chr1211082 ------
NM_002958chr35788 654 282 265 197 ------
NM_002959chr1124460 4399 4056 3809 3477 2848 1457 1135 567 430 189 111 23082 206 ----
NM_002968chr1641006 882 232 141 ----1442
NM_002970chrX3345 267 32 ------
NM_002971chr32900 457 ------
NM_002973chr121536 ------
NM_002977chr222700 213 1134 12645 --
NM_002993chr441042 756 737 441 3868 695 134 ----
NM_002994chr471674 770 674 557 524 462 432 1722 --1159
NM_002998chr841981 1597 377 117 --2549 110 --
NM_003001chr182014 1961 1882 1832 1582 354 250 69 --11623 --
NM_003010chr1732217 787 536 12018 11985 --
NM_003011chr951516 1427 1133 644 284 --1318 --
NM_003020chr151167 ------
NM_003026chr941000 962 551 136 ------
NM_003027chr151153 ------
NM_003029chr13972 430 131 ------
NM_003035chr11764 --196 --
NM_003036chr131240 288 274 --1978 --
NM_003042chr341388 512 399 30 --1671 1712
NM_003043chr363955 3461 3378 3199 1201 757 ------
NM_003048chr211762 --22819 1099 161
NM_003051chr121903 604 ------
NM_003071chr321690 245 ------
NM_003074chr351997 1948 1476 750 170 ------
NM_003076chr1221177 424 ------
NM_003085chr5136 ----1119
NM_003105chr11------187
NM_003107chr652195 2105 2068 2022 1682 --1229 --
NM_003108chr296572 6540 5525 5473 5084 4436 998 519 21 ----25039 4486
NM_003110chr1741063 758 185 146 ------
NM_003111chr221300 152 ------
NM_003112chr762935 2375 2154 989 369 111 --12408 12623
NM_003118chr571922 1480 603 574 378 301 177 ------
NM_003128chr262592 2075 825 398 176 82 ------
NM_003131chr642286 2123 915 466 ------
NM_003137chr651896 1558 1492 823 222 11635 11803 --
NM_003145chr12438 125 ------
NM_003149chr341508 1163 1038 38 ------
NM_003150chr1761935 1798 869 454 164 105 12103 2630 56 --
NM_003152chr1711216 ------
NM_003153chr1221071 61 2862 249 --1394
NM_003154chr41104 ------
NM_003155chr832549 1064 783 1604 2218 175 --
NM_003161chr1723006 1066 12846 ----
NM_003162chr24851 790 749 697 ------
NM_003164chr11----125 --
NM_003174chr103780 737 638 ------
NM_003178chr312089 11614 ----
NM_003185chr2031097 488 196 ------
NM_003188chr61719 --1236 --
NM_003189chr153213 2408 2064 922 138 195 ----
NM_003194chr61564 ------
NM_003198chr1--1204 ----
NM_003199chr1875295 4991 3823 1640 1465 1044 843 34897 4075 2214 15040 --
NM_003200chr19149 --2377 260 --
NM_003203chr231781 825 189 ------
NM_003205chr1531965 1840 1608 ------
NM_003206chr61139 1359 ----
NM_003211chr124652 286 104 21 11163 ----
NM_003217chr1241941 1902 1580 123 11362 ----
NM_003220chr621243 208 ------
NM_003221chr683955 3573 3536 3241 3193 3093 1120 983 ------
NM_003223chr162862 579 ------
NM_003236chr242570 1174 392 157 13331 ----
NM_003242chr372403 1907 978 809 521 274 183 --12284 --
NM_003246chr1552021 1643 1457 1274 783 --1300 --
NM_003247chr611670 1124 ----
NM_003253chr2151241 590 160 102 54 ------
NM_003255chr1742642 2490 1967 135 170 ----
NM_003257chr152970 66 11088 11356 --
NM_003262chr364360 3699 1925 1523 729 96 1498 34439 4323 3478 --
NM_003269chr621102 396 --1293 --
NM_003274chr2132847 2512 47 22999 2880 ----
NM_003275chr95573 456 408 375 61 --11510 --
NM_003291chr13----1805 --
NM_003298chr375587 5135 4517 3832 1846 620 421 23870 1697 36030 4300 1303 --
NM_003300chr14--1437 ----
NM_003304chr341517 1081 634 121 ------
NM_003318chr63288 246 59 ----1103
NM_003319chr2234 23 --1619 --
NM_003320chr1174486 4478 3741 3496 3134 2795 2720 --23074 1308 13337
NM_003321chr16--1177 ----
NM_003326chr121823 877 ----11739
NM_003336chrX11097 ------
NM_003337chr561171 660 650 527 435 102 31674 1645 1409 11368 --
NM_003338chr1041894 560 410 395 ------
NM_003339chr521588 1338 150 ----
NM_003340chr42430 301 ------
NM_003341chr31533 ------
NM_003342chr1762992 2375 2273 1076 952 78 ------
NM_003347chr2261917 1873 1807 1479 381 80 12120 11946 --
NM_003348chr1231587 1571 687 ------
NM_003352chr2--1908 ----
NM_003366chr16----1171 --
NM_003368chr12658 600 ------
NM_003369chr1162593 2521 2001 407 134 39 ------
NM_003372chrX2677 349 2872 84 ----
NM_003373chr1041788 690 386 165 --1322 1184
NM_003374chr5----1302 --
NM_003376chr641644 1480 559 170 31918 1622 760 1184 --
NM_003376chr641644 1480 559 170 31918 1622 760 1184 --
NM_003379chr62976 913 --1144 --
NM_003383chr91190 ----1394
NM_003385chr231018 878 862 ------
NM_003390chr11--1699 --11145
NM_003392chr384079 2775 1508 1142 801 624 154 67 13711 ----
NM_003394chr123540 160 91 171 ----
NM_003400chr21790 ------
NM_003403chr143703 338 210 ------
NM_003404chr2021881 1254 --138 --
NM_003406chr871820 1796 1516 1417 1389 568 31 ------
NM_003409chr1821101 970 --124 --
NM_003410chrX32382 722 326 1370 12918 --
NM_003411chrY31347 311 136 ------
NM_003412chr362717 2363 2109 955 592 402 22432 2146 ----
NM_003413chrX3703 544 278 ------
NM_003439chr773032 2775 2691 2613 1418 415 311 --23579 2278 --
NM_003442chr112253 158 1794 ----
NM_003455chr113563 462 425 21568 1153 ----
NM_003458chr374027 3971 3082 2473 1024 95 88 12952 ----
NM_003463chr633124 2584 499 --22609 618 1727
NM_003466chr241973 1919 1722 536 11534 12468 12397
NM_003468chr253346 3257 1557 1256 276 --11443 --
NM_003470chr1661869 1417 1266 706 498 66 11657 ----
NM_003471chr332324 2163 198 ----11520
NM_003474chr1042158 1637 335 168 1129 --11520
NM_003477chr111504 ------
NM_003478chr1131105 457 199 32730 941 98 ----
NM_003482chr1222235 1115 ----22701 587
NM_003483chr1232486 104 81 12849 ----
NM_003488chr172774 665 ------
NM_003489chr2143290 3162 1260 522 --12478 --
NM_003505chr731788 1630 1362 --1235 11402
NM_003506chr831313 290 89 11299 21221 486 --
NM_003507chr232027 1988 1499 ------
NM_003543chr6121 ------
NM_003557chr141589 1234 315 35 ------
NM_003558chr91511 ------
NM_003559chr1793390 2521 2497 1443 1422 1302 1044 1018 567 ------
NM_003565chr122481 55 ------
NM_003566chr1263309 2964 2753 1235 486 277 --23176 2874 --
NM_003569chr62589 120 ------
NM_003576chr1352276 1852 950 853 597 --21121 413 --
NM_003581chr21806 ------
NM_003583chr1283547 3344 3281 2688 1294 1019 613 515 12556 11120 1607
NM_003589chr1331482 1284 238 51436 579 400 255 86 ----
NM_003590chr233555 929 40 23209 461 23088 394 --
NM_003592chr7------1346
NM_003595chr221478 1387 ----
NM_003597chr262153 2109 1973 1883 1838 813 22261 2192 ----
NM_003601chr41157 ------
NM_003603chr441976 1668 1608 1402 12036 ----
NM_003607chr184374 3861 3727 2651 993 945 60 29 13129 ----
NM_003613chr153716 251 144 ------
NM_003615chr363080 2485 1000 400 343 226 --1811 --
NM_003618chr221181 112 ------
NM_003622chr1232343 2271 837 1164 1909 --
NM_003624chr1911213 ------
NM_003626chr111917 11080 ----
NM_003628chr22627 228 ------
NM_003629chr183359 3241 3212 2856 2308 848 401 75 ------
NM_003630chr61729 ------
NM_003631chr101246 --1946 --
NM_003633chr552477 2212 2170 1974 580 ----12239
NM_003637chr141349 1031 501 415 --1576 --
NM_003659chr221240 826 --1140 --
NM_003660chr191271 ------
NM_003663chr343357 2629 1091 1045 ------
NM_003670chr31378 ------
NM_003671chr953513 2691 1056 908 529 22347 169 ----
NM_003672chr11585 11875 ----
NM_003679chr183313 2802 2727 2397 2308 2268 409 233 --1684 --
NM_003684chr12945 102 1839 1236 --
NM_003685chr192890 175 ------
NM_003690chr24603 518 215 187 1631 ----
NM_003702chr82812 521 1612 ----
NM_003705chr22597 258 ------
NM_003710chr15176 ------
NM_003713chr141218 697 455 449 ------
NM_003716chr31230 --1376 --
NM_003718chr71514 ------
NM_003722chr332287 2133 1774 21002 178 ----
NM_003728chr41172 ------
NM_003735chr521744 1158 ------
NM_003736chr521744 1158 ------
NM_003737chr11----1424 165
NM_003743chr242165 1827 528 104 --11507 --
NM_003744chr1431146 97 79 ------
NM_003749chr1322307 146 1684 ----
NM_003758chr1511391 1582 ----
NM_003758chr1511391 1582 ----
NM_003759chr494067 4024 3919 3848 2620 1620 1304 391 268 ------
NM_003760chr12699 690 ----1797
NM_003762chr111311 1928 1434 --
NM_003766chr173527 495 140 ------
NM_003768chr131435 656 250 --1159 --
NM_003769chr12----1318 --
NM_003772chr1131229 333 243 ------
NM_003778chr32675 299 ------
NM_003783chr131210 805 228 11116 ----
NM_003787chr1821450 538 1179 ----
NM_003796chr194561 443 226 115 ------
NM_003797chr111157 ------
NM_003800chr632273 1979 455 --1711 --
NM_003811chr19--1191 ----
NM_003812chr2144 ------
NM_003816chr81499 1363 ----
NM_003822chr121080 22 192 ----
NM_003825chr1551388 1327 1006 185 96 ------
NM_003831chr1831804 1335 1302 11770 ----
NM_003846chr14732 276 261 91 ----1632
NM_003850chr132605 540 ------
NM_003861chr1452277 1853 1830 1097 280 12544 12661 --
NM_003872chr212748 12060 ----
NM_003876chr17----176 --
NM_003877chr123778 632 84 1915 ----
NM_003884chr351652 1182 746 659 126 1422 ----
NM_003885chr173420 167 159 --1239 --
NM_003887chr282300 2200 2056 2037 1881 840 588 127 1438 1675 --
NM_003895chr2112058 --12180 --
NM_003896chr22372 159 294 40 ----
NM_003899chr1332330 1743 150 2306 207 2259 234 --
NM_003901chr1072624 2490 2437 2399 1822 896 443 2320 81 ----
NM_003902chr11317 ------
NM_003913chr684267 4029 3616 3555 3149 3019 1575 1056 24136 893 23412 3118 --
NM_003916chrX31092 935 478 ------
NM_003922chr151142 ------
NM_003924chr421207 324 ------
NM_003927chr1831019 864 443 ------
NM_003931chr6182 1629 ----
NM_003939chr1043735 3141 1526 867 --23059 1167 --
NM_003941chr752029 1979 818 411 71 1768 1929 --
NM_003947chr331354 1230 470 ------
NM_003955chr1731564 1339 111 --21451 1211 --
NM_003958chr6133945 3903 3890 3357 2986 2931 2796 1434 1325 1299 931 657 246 23418 94 12875 --
NM_003968chr33140 128 46 ------
NM_003971chr172568 527 ------
NM_003972chr10----1320 --
NM_003980chr661101 1067 1054 1021 279 214 --1554 --
NM_003983chr16114248 3893 3731 3170 1613 1432 1391 1114 747 143 68 1652 ----
NM_003987chr1022233 1676 ------
NM_003988chr1022310 1753 ------
NM_003994chr12104424 3615 3234 3227 2852 2833 2822 1438 1134 97 ------
NM_004004chr134535 517 508 179 1110 ----
NM_004006chrX32321 2245 1717 1501 11946 --
NM_004007chrX32321 2245 1717 1501 11946 --
NM_004009chrX32321 2245 1717 1501 11946 --
NM_004010chrX32321 2245 1717 1501 11946 --
NM_004011chrX32321 2245 1717 1501 11946 --
NM_004012chrX32321 2245 1717 1501 11946 --
NM_004013chrX32321 2245 1717 1501 11946 --
NM_004014chrX32321 2245 1717 1501 11946 --
NM_004015chrX32321 2245 1717 1501 11946 --
NM_004016chrX32235 2159 1631 1415 11860 --
NM_004017chrX32321 2245 1717 1501 11946 --
NM_004018chrX32235 2159 1631 1415 11860 --
NM_004020chrX32321 2245 1717 1501 11946 --
NM_004021chrX32235 2159 1631 1415 11860 --
NM_004022chrX32235 2159 1631 1415 11860 --
NM_004023chrX32235 2159 1631 1415 11860 --
NM_004028chr1883908 3579 3463 2954 1552 1543 1040 940 --21204 888 --
NM_004034chr102505 257 ------
NM_004036chr21644 1156 ----
NM_004040chr211142 ----1924
NM_004047chr12202 33 ------
NM_004050chr1432498 2023 674 22133 799 ----
NM_004056chr81875 ------
NM_004061chr52557 206 --2434 131 1518
NM_004067chr741531 1086 1004 396 ------
NM_004073chr12232 43 ------
NM_004075chr122433 427 1520 ----
NM_004077chr121410 --1358 --
NM_004079chr15741 686 585 416 45 22481 764 22705 876 12418
NM_004081chrY21674 1571 1171 11633 --
NM_004085chrX2803 111 ------
NM_004087chr341425 582 449 339 1397 ----
NM_004089chrX31277 1197 1190 ------
NM_004093chr1322721 524 --22070 832 --
NM_004094chr1432597 2481 2214 ----22928 202
NM_004096chr1051966 1637 737 700 601 1290 11603 --
NM_004100chr632396 695 216 ------
NM_004103chr84826 784 693 197 --1127 --
NM_004105chr2--11061 ----
NM_004109chr1162302 1480 872 734 728 157 ------
NM_004113chr332026 1727 135 --21651 494 --
NM_004114chrX3497 277 26 ------
NM_004116chr26478 423 406 155 136 61 ------
NM_004117chr642208 1811 693 116 ------
NM_004124chr1492790 2720 2644 1180 1057 733 511 251 185 21202 1128 12516 --
NM_004132chr103455 122 32 11226 ----
NM_004134chr5----1662 --
NM_004136chr1553004 2571 2297 2030 517 22517 898 23120 593 --
NM_004157chr31352 --2873 198 --
NM_004161chr241637 1390 516 403 ------
NM_004170chr951908 1478 1276 433 369 --21359 166 --
NM_004172chr542024 1983 1891 21 --11745 --
NM_004176chr173475 379 107 --144 --
NM_004180chr22573 226 --1176 --
NM_004186chr33952 853 655 1752 --1685
NM_004187chrX41412 1004 921 415 1158 --1973
NM_004193chr10----2357 350 --
NM_004200chr1152549 2376 1292 211 62 --12805 --
NM_004202chrY135 ------
NM_004203chr16125 ------
NM_004206chr31229 136 ----
NM_004209chr1621106 1058 --1314 --
NM_004219chr5150 ------
NM_004225chr851373 1272 1203 931 536 --1964 --
NM_004226chr22193 109 ------
NM_004227chr762731 2565 2404 2292 2068 1941 1558 ----
NM_004229chrX51900 1574 1476 846 268 ------
NM_004232chr1843719 3520 1558 593 12382 130 --
NM_004235chr9--1555 ----
NM_004240chr19178 ------
NM_004264chr123288 159 58 --21281 1110 --
NM_004268chr112159 144 142 1411 --
NM_004270chr51210 1278 ----
NM_004272chr52628 71 --2639 617 --
NM_004274chr1452816 2479 2185 662 345 --12098 --
NM_004277chr63472 273 141 ------
NM_004280chr6159 ------
NM_004286chr2242645 2465 1918 278 ------
NM_004293chr9103871 3752 3720 3703 3508 3375 2380 2354 1087 184 ----12496
NM_004301chr31274 ------
NM_004302chr1262855 2789 2727 2631 830 811 2463 221 --12109
NM_004311chr1062991 2560 2168 1945 942 609 1881 12825 --
NM_004316chr12140 ------
NM_004323chr972251 2165 2015 1788 555 129 52 --21050 974 --
NM_004329chr1051191 398 308 196 156 ------
NM_004330chr152971 261 ------
NM_004331chr862612 1985 1761 596 368 164 21000 984 12636 --
NM_004337chr851968 1929 1582 1557 256 ----1759
NM_004338chr18146345 6116 5575 5306 4520 4471 2762 1883 1602 1369 1090 901 893 343 26183 2738 11723 --
NM_004342chr73464 416 273 --169 --
NM_004349chr81920 --1865 --
NM_004356chr112432 108 ------
NM_004370chr622002 1586 ------
NM_004374chr81137 ------
NM_004379chr241427 1376 1220 482 --21547 636 --
NM_004380chr1651841 791 688 506 468 ------
NM_004384chr551565 941 555 159 105 ------
NM_004386chr1982095 1736 1729 1649 1639 1632 239 222 11903 ----
NM_004389chr21240 --1581 --
NM_004392chr1362398 2030 1031 1018 361 43 ------
NM_004393chr342274 1877 891 194 2666 281 22371 1530 --
NM_004397chr1194208 3852 3698 3385 2806 1668 1389 1160 993 33011 2702 1340 13430 13326
NM_004403chr72640 169 1665 ----
NM_004407chr42943 252 ----1677
NM_004411chr71275 ------
NM_004415chr64672 535 111 56 ------
NM_004423chr352152 1970 368 180 83 --22569 1737 --
NM_004426chr124714 643 78 40 ------
NM_004427chr13283 272 23 ------
NM_004428chr12546 81 --1650 --
NM_004429chrX--11439 --11156
NM_004430chr872370 2290 1847 1831 1095 906 26 ----1707
NM_004432chr952358 2255 2048 1622 245 1732 ----
NM_004438chr263015 2956 1104 832 76 57 33138 2907 2332 --22817 2389
NM_004439chr4138 --145 --
NM_004440chr63782 611 450 21635 686 ----
NM_004441chr331233 403 305 ------
NM_004446chr1139 ------
NM_004448chr17--1230 1586 --
NM_004449chr2131474 1403 1285 ------
NM_004450chr141112 --1103 --
NM_004454chr372283 1795 1699 1500 1486 722 610 2396 237 ----
NM_004457chr221392 1142 ------
NM_004458chrX31686 250 106 2927 697 ----
NM_004459chr1751873 1628 723 685 256 ------
NM_004463chrX2119 39 ------
NM_004464chr473767 1138 948 918 584 269 31 13587 13436 --
NM_004472chr52665 181 ------
NM_004475chr175775 326 217 205 94 ------
NM_004480chr144699 631 266 125 191 ----
NM_004481chr132673 2596 1013 --1954 --
NM_004482chr23898 708 165 ------
NM_004487chr32925 451 ------
NM_004491chr1954033 2894 1522 562 527 33508 2791 386 23224 770 11238
NM_004492chr151265 ------
NM_004494chr12349 131 21291 1251 2962 362 --
NM_004496chr1441099 851 456 331 ----1890
NM_004499chr51148 ------
NM_004501chr1114144 3644 3625 3600 2991 2686 1541 1403 1169 1066 461 33653 2693 744 13382 --
NM_004504chr252913 2821 1164 486 386 ------
NM_004506chr61160 ------
NM_004514chr1772816 2612 1902 848 622 264 37 12477 22329 2256 1873
NM_004516chr19--21160 1015 1952 --
NM_004519chr8262 45 ------
NM_004520chr51155 1814 ----
NM_004525chr241313 1015 448 39 11492 ----
NM_004529chr951173 1120 954 549 230 ------
NM_004535chr2031528 1098 523 ----11798
NM_004537chr1221522 1360 ------
NM_004560chr92685 278 ------
NM_004566chr1072225 2185 2037 1828 814 788 242 11845 11595 --
NM_004571chr2163235 3168 2617 2572 2163 104 ------
NM_004575chr431037 77 45 --1400 --
NM_004576chr51435 ------
NM_004580chr152539 448 1728 11826 --
NM_004583chr172222 64 1638 ----
NM_004586chrX74450 4248 4145 4103 1756 823 726 13947 --14371
NM_004588chr1153902 828 206 177 79 11524 23153 1165 --
NM_004593chr32860 764 1323 1167 --
NM_004598chr573349 3068 2720 2351 2085 1314 935 43233 1151 313 164 --12458
NM_004602chr2021451 1219 1967 ----
NM_004612chr974720 3932 3100 1073 976 413 308 51661 1634 815 457 426 13449 31778 1453 1326
NM_004622chr242159 1738 725 156 11974 11818 --
NM_004630chr1121074 1031 ------
NM_004631chr121243 229 --156 --
NM_004635chr32949 91 --1765 --
NM_004637chr321307 1041 ----1315
NM_004642chr121595 1137 ----
NM_004654chrY21085 988 11039 ----
NM_004655chr171243 --11049 --
NM_004657chr23404 339 195 ------
NM_004660chrY42318 936 653 621 22328 339 ----
NM_004661chr53921 384 310 1487 --11032
NM_004663chr1581591 1544 1526 1269 600 499 408 87 ------
NM_004667chr15--1452 ----
NM_004671chr183266 210 21 ------
NM_004673chr1138 ------
NM_004685chr1333009 1178 679 32806 1966 716 ----
NM_004687chr1741965 839 683 477 --11842 --
NM_004694chr172235 103 ------
NM_004703chr1762492 1921 946 792 720 710 12426 22323 33 --
NM_004707chr551663 1657 1266 662 125 21639 62 11028 --
NM_004709chrX51340 1295 1142 714 596 1352 ----
NM_004710chr173699 641 224 --1839 --
NM_004717chr731515 992 968 ------
NM_004719chr1262860 2457 1079 705 599 380 1735 1807 --
NM_004721chr3179 --1305 --
NM_004722chr7--2218 94 ----
NM_004726chrX95732 4962 4913 4569 4289 3835 2208 1861 1365 35024 4342 3580 --24218 1310
NM_004730chr552119 1746 1447 576 472 21623 1351 2236 181 --
NM_004731chr1241653 1423 1258 247 1319 ----
NM_004733chr3122 ------
NM_004734chr1332725 2398 993 1154 ----
NM_004736chr132142 1950 42 11870 ----
NM_004740chr17192 --170 --
NM_004745chr8156917 6691 6489 6202 6103 6065 5997 5170 5040 4533 2631 2110 2031 1573 1241 1248 11549 12156
NM_004748chr154674 564 327 235 1364 --1172
NM_004755chr1451139 879 754 452 206 ------
NM_004756chr1931436 1298 529 --11069 --
NM_004757chr41107 ----1489
NM_004760chr74752 678 308 131 --2842 433 --
NM_004762chr1722034 1621 --21583 493 --
NM_004768chr131097 856 243 21176 109 ----
NM_004772chr541462 1110 647 467 2601 119 --1184
NM_004774chr1763077 2395 1231 506 460 196 12537 ----
NM_004776chr2063257 2425 941 907 897 473 12521 1776 12703
NM_004779chr52537 355 2406 196 11164 --
NM_004786chr181193 ------
NM_004788chr1152462 2276 1987 964 900 1978 ----
NM_004789chr91339 1442 ----
NM_004792chr2----129 --
NM_004796chr1452297 1887 1684 720 131 11925 1283 --
NM_004798chr2053301 3098 2976 882 794 43326 3121 2878 838 ----
NM_004799chr12426 71 ------
NM_004801chr221543 248 --11079 --
NM_004805chr22903 91 ------
NM_004808chr1073310 3226 2482 2387 2371 2104 245 2634 28 32941 800 751 --
NM_004815chr174907 4811 4425 4094 3018 1587 220 24305 1004 ----
NM_004821chr53582 318 87 ------
NM_004822chr1723362 1599 --1193 --
NM_004827chr481454 1331 1251 760 675 668 472 284 --11646 153
NM_004830chr62752 300 ------
NM_004831chr1931043 326 165 ------
NM_004834chr243097 822 342 184 --12611 --
NM_004840chrX42306 2186 715 394 --22010 829 --
NM_004841chr12918 45 ------
NM_004844chr331093 403 106 ------
NM_004845chrX94171 4145 4111 4065 2936 428 248 167 130 --22544 1136 --
NM_004849chr671424 1109 687 680 643 446 176 1566 ----
NM_004850chr231330 526 491 --11545 --
NM_004856chr153568 550 463 ------
NM_004857chr1454752 3499 3259 1583 382 --33419 1511 670 --
NM_004859chr1742884 2747 2336 2023 12058 22356 315 --
NM_004863chr1474931 1763 1118 806 707 274 144 11229 44693 3622 1551 230 --
NM_004866chr5135068 4974 4477 4054 3243 1950 1476 1470 1243 1099 879 869 696 13665 14133 --
NM_004867chrX3699 525 108 ------
NM_004869chr1821684 405 --1642 --
NM_004871chr1754138 4097 3193 3126 141 --34292 4026 2904 --
NM_004873chr1442949 2782 2291 2137 13204 ----
NM_004879chr111726 --2296 101 --
NM_004884chr1541265 708 411 47 --11743 --
NM_004887chr52165 61 --1849 --
NM_004888chr93385 136 82 ------
NM_004891chr2--124 ----
NM_004893chr51407 ------
NM_004896chr102991 225 1261 --11319
NM_004898chr451989 1085 1075 760 728 22029 660 ----
NM_004904chr7136275 5565 4953 4683 4269 4111 1734 1629 1329 1281 1253 623 301 24795 1644 --25580 4296
NM_004905chr11176 --1217 --
NM_004906chr61643 1228 ----
NM_004912chr731554 1499 1178 --21744 125 --
NM_004921chr121803 528 2754 50 ----
NM_004922chr102988 212 --1171 1766
NM_004924chr191100 21021 355 181 --
NM_004926chr1421375 389 ------
NM_004929chr851346 1148 998 393 141 ------
NM_004932chr541614 1308 591 166 11341 ----
NM_004945chr19----2813 233 --
NM_004947chr322218 727 --22348 338 12122
NM_004948chr1841304 1065 362 315 11159 ----
NM_004952chr13956 812 231 ------
NM_004953chr31324 ------
NM_004956chr784476 3471 3123 972 885 684 215 176 --13890 14275
NM_004958chr12752 99 ------
NM_004966chr101396 --1824 --
NM_004969chr10180 ------
NM_004973chr611666 --11486 --
NM_004975chr204990 321 289 93 ------
NM_004976chr11104477 3816 1853 1628 1370 1129 1069 908 646 282 --12035 --
NM_004979chrX31082 979 283 ------
NM_004984chr123175 158 33 ------
NM_004985chr1294420 3891 3619 3504 1782 1374 928 579 361 23287 1553 11150 --
NM_004992chrX137834 7685 7403 7236 5766 2946 2532 1572 1433 1361 746 649 248 21026 81 37615 6014 5187 --
NM_004992chrX137834 7685 7403 7236 5766 2946 2532 1572 1433 1361 746 649 248 21026 81 37615 6014 5187 --
NM_004993chr1411358 --175 --
NM_004995chr144479 423 310 41 1408 ----
NM_004996chr1611678 ------
NM_005010chr72615 372 --2898 874 --
NM_005011chr741836 1356 177 97 --11853 --
NM_005016chr121129 ------
NM_005020chr73222 69 50 ------
NM_005026chr152018 1500 1334 744 510 --21833 1685 --
NM_005028chr1042219 1919 616 210 ------
NM_005032chrX41046 998 310 252 11054 ----
NM_005036chr22127943 7099 7060 6995 6980 6220 3143 2111 1607 861 422 102 1405 31976 1031 627 12529
NM_005037chr3--155 ----
NM_005044chrX94586 4246 4074 3637 2861 2811 1821 1203 119 14228 23506 828 --
NM_005045chr74967 363 151 56 1935 ----
NM_005054chr231334 1301 463 11702 11341 11600
NM_005056chr12125614 5566 5201 5157 4947 3974 3877 2225 1723 700 417 404 1941 ----
NM_005063chr103966 245 167 23835 1162 13102 --
NM_005065chr1474326 3485 1970 1832 936 857 763 25230 4447 ----
NM_005068chr61451 11119 11401 --
NM_005076chr194197 3703 3536 3462 1599 1271 1198 971 167 --1866 --
NM_005077chr91363 1138 ----
NM_005079chr853159 3082 2690 2099 2041 21110 436 12728 1774
NM_005087chr32738 107 2854 175 ----
NM_005093chr2075285 4696 4212 4097 3253 1329 199 15260 24282 1394 11969
NM_005095chr142201 1649 392 373 ------
NM_005096chrX41095 445 321 300 ----198
NM_005103chr111306 ------
NM_005109chr352543 1966 1906 722 308 --11894 --
NM_005112chr4------1990
NM_005113chr142436 419 ------
NM_005116chr20124569 4337 4132 3908 3079 2800 1797 1767 999 850 504 140 --1106 --
NM_005119chr121216 1040 2500 94 ----
NM_005121chr1743627 3310 1288 1165 ------
NM_005124chr64961 413 396 72 ------
NM_005133chr111398 --1269 --
NM_005134chr182898 790 1748 ----
NM_005135chr1563847 3437 2866 2536 1106 1072 --21394 679 11281
NM_005151chr1841865 1779 706 659 21753 1523 2410 146 --
NM_005156chr985409 4545 4237 4133 3845 1697 1611 1517 24673 111 ----
NM_005159chr1541603 1491 1446 880 12126 ----
NM_005168chr2----11483 2374 311
NM_005180chr103468 361 299 ------
NM_005188chr11158122 7507 6645 6182 5810 5719 5690 5424 3264 3125 2776 2615 1619 1597 1406 12663 25761 3109 --
NM_005189chr1711736 11724 22387 170 --
NM_005191chr331448 351 197 ------
NM_005194chr202570 103 ------
NM_005197chr14116153 6093 5535 4747 4697 4522 4144 1671 1646 1619 750 25729 1600 14253 --
NM_005201chr331140 883 239 1406 ----
NM_005203chr10172 ------
NM_005204chr10----1293 --
NM_005206chr1721091 1066 --41221 1105 510 247 --
NM_005207chr2283401 3058 2830 2680 1464 1119 461 328 ------
NM_005210chr2121 ------
NM_005211chr5290 27 1129 1637 --
NM_005215chr18143 --1712 --
NM_005219chr511426 11590 11231 --
NM_005221chr72311 22 ------
NM_005222chr74944 829 756 140 ------
NM_005225chr2071125 1071 1008 963 409 393 145 1461 --1988
NM_005229chrX1350 1107 ----
NM_005230chr121119 ------
NM_005233chr331826 977 81 12037 ----
NM_005235chr287400 6976 6905 5378 5240 2903 638 312 46703 6623 1919 667 26286 5604 --
NM_005238chr1183068 2857 2431 1222 741 687 509 269 168 42983 2968 2876 1154 --
NM_005239chr2122036 796 11409 ----
NM_005240chr12631 595 ------
NM_005244chr203509 473 219 ------
NM_005249chr141698 ------
NM_005254chr1541333 1182 899 204 1144 ----
NM_005256chr11--1738 ----
NM_005257chr1831354 1005 973 ----11026
NM_005259chr211006 ------
NM_005261chr82883 857 1368 ----
NM_005263chr121104 917 1932 172 11167
NM_005264chr104812 804 731 617 ------
NM_005271chr1051206 993 837 287 123 1960 11024 --
NM_005276chr1251547 1494 1464 1307 703 --11704 --
NM_005276chr1251547 1494 1464 1307 703 --11704 --
NM_005277chr431954 1788 1282 ------
NM_005278chrX2452 33 ------
NM_005281chr11330 ------
NM_005284chr63356 177 111 184 ----
NM_005296chrX1853 1290 ----
NM_005308chr10183 1401 ----
NM_005310chr173350 246 76 --1319 --
NM_005311chr742481 2368 394 92 12101 12768 --
NM_005313chr152932 412 --123 --
NM_005316chr112371 61 ------
NM_005324chr1741723 700 50 38 ----1814
NM_005328chr81243 --1153 --
NM_005329chr1652040 932 873 223 172 21687 899 ----
NM_005336chr252217 2019 1823 1493 110 --1294 --
NM_005339chr4104249 4110 3423 3358 1209 1017 763 161 103 76 24128 2760 ----
NM_005342chrX62848 2702 2158 2010 533 256 --3594 283 274 --
NM_005349chr41564 ------
NM_005358chr1341657 1648 1431 417 31403 1328 522 11448 --
NM_005359chr18156534 5612 5175 5151 4480 4459 1853 1454 1363 1202 883 505 351 238 89 15299 15656 --
NM_005370chr1941271 1072 910 188 ------
NM_005374chr1742256 1822 1771 1750 --130 --
NM_005375chr63841 441 386 ------
NM_005378chr22690 126 --135 1867
NM_005380chr131079 1051 57 ------
NM_005381chr22435 47 ------
NM_005382chr81117 ------
NM_005384chr9----1183 --
NM_005386chr201694 ----1297
NM_005392chr931833 330 272 --11270 --
NM_005398chr1051462 1430 1369 1040 519 1389 21234 935 --
NM_005399chr1114183 3885 3743 3381 3030 2950 1399 1281 1105 574 142 44371 4217 3145 648 43090 2809 873 734 --
NM_005400chr2112894 2828 2775 2275 881 723 688 571 379 194 23 --12123 --
NM_005402chr731729 1520 438 --1637 --
NM_005406chr1821469 360 ------
NM_005407chr1431422 1140 212 ------
NM_005410chr51615 ------
NM_005414chr31113 179 ----
NM_005415chr22721 492 ------
NM_005417chr2072004 1922 1399 1393 1327 272 218 --2483 78 --
NM_005433chr1892579 2472 2148 2012 1919 1903 965 151 97 22739 1705 ----
NM_005435chr74551 543 215 203 ------
NM_005436chr1084032 3286 2830 2723 2565 1241 1181 321 32916 2797 1108 22554 1159 --
NM_005437chr1031453 1365 343 11136 ----
NM_005442chr3--1539 1466 --
NM_005455chr141887 1685 463 376 11745 176 --
NM_005458chr972185 1880 1555 960 896 666 85 --3991 747 470 --
NM_005461chr202447 363 ------
NM_005465chr111729 11796 ----
NM_005474chr1731489 412 322 --1256 --
NM_005475chr1262602 2368 896 530 508 286 12335 ----
NM_005476chr951217 1054 307 138 117 --1434 --
NM_005483chr19----191 --
NM_005487chr2232008 858 176 11467 --1734
NM_005493chr62618 66 ------
NM_005494chr71660 --1242 --
NM_005497chr1796117 5832 3959 1778 1387 438 278 142 92 11471 35504 5162 4260 --
NM_005499chr193665 410 118 ------
NM_005502chr953085 1261 566 550 308 ----12871
NM_005509chr52391 75 ------
NM_005512chr1161758 1283 754 726 296 101 --1181 --
NM_005517chr11536 1284 11284 --
NM_005520chr51236 1686 ----
NM_005522chr72524 165 11055 ----
NM_005523chr721562 259 1207 ----
NM_005524chr31119 ------
NM_005527chr62261 121 ------
NM_005530chr1531397 451 34 1254 ----
NM_005542chr741865 1548 1307 523 123 1239 11542
NM_005544chr221005 347 ------
NM_005552chr14----1526 --
NM_005561chr134795 392 340 84 ------
NM_005570chr1821193 952 --1899 --
NM_005573chr5----2558 190 --
NM_005574chr113752 477 74 --185 --
NM_005575chr53305 115 59 1264 ----
NM_005576chr152242 193 ------
NM_005578chr344133 1213 455 307 23639 1115 ----
NM_005584chr13----2517 318 --
NM_005587chr15----1886 --
NM_005593chr122553 143 ------
NM_005595chr11301 ------
NM_005596chr975243 4929 2521 2433 2064 1438 1283 --12093 1585
NM_005598chr121454 1048 --11290 --
NM_005599chr1--1329 ----
NM_005603chr1891978 1841 1740 1618 1420 1248 479 242 71 --21579 542 --
NM_005604chr642477 1710 726 674 ------
NM_005607chr8--11038 1947 1171
NM_005609chr112253 46 ------
NM_005610chr11895 ------
NM_005613chr151604 879 573 376 47 11374 ----
NM_005625chr841040 960 813 150 ------
NM_005626chr11531 --1429 --
NM_005627chr61174 ------
NM_005632chr162352 59 1966 ----
NM_005637chr1852045 774 398 215 195 ------
NM_005638chrX41296 542 357 126 ------
NM_005639chr1231450 725 209 11833 ----
NM_005644chr11375 ------
NM_005646chr11186 179 ----
NM_005647chrX103384 3324 2279 2136 1223 1178 692 525 510 312 1116 43251 3104 905 678 --
NM_005651chr41358 1122 ----
NM_005652chr1621088 189 --1117 --
NM_005655chr831100 1073 34 --1813 --
NM_005656chr2131226 144 80 --1155 --
NM_005665chr153958 3561 3087 1921 1614 24344 3698 --1320
NM_005668chr574530 4143 2823 1744 1738 1061 761 21758 485 24550 689 --
NM_005669chr552274 1668 1588 743 186 21943 416 ----
NM_005688chr35950 480 317 231 150 --11286 --
NM_005707chr153309 151 37 --1923 --
NM_005708chr13173 ------
NM_005715chr64878 718 614 183 ------
NM_005717chr121060 819 --1998 --
NM_005718chr32831 272 ------
NM_005721chr21777 1400 ----
NM_005722chr272184 2005 956 699 297 232 135 1669 11752 --
NM_005734chr112747 152 1134 1322 --
NM_005736chr1021220 45 ----1645
NM_005737chr232220 603 218 ----12292
NM_005738chr731666 786 148 22069 1645 11404 --
NM_005746chr752301 1854 1101 990 629 12219 --12263
NM_005748chr1233279 2648 278 --12710 --
NM_005749chr171208 ------
NM_005751chr71345 ------
NM_005752chr1641010 995 813 334 11254 21180 468 --
NM_005754chr531107 1044 279 --1912 --
NM_005759chr294743 4302 4166 3129 1113 969 558 552 122 --11808 1670
NM_005761chr12----1114 --
NM_005765chrX1785 --1257 --
NM_005768chr121666 ------
NM_005779chr563671 3451 2760 2643 1396 1011 22617 1342 ----
NM_005781chr32615 282 --1204 --
NM_005782chr17--1180 ----
NM_005783chr22599 417 --1464 --
NM_005789chr1741690 1391 300 27 11652 --1541
NM_005797chr1141750 724 441 423 --11445 --
NM_005802chr92606 205 ------
NM_005808chr353375 2873 2764 2372 728 23351 608 136 --
NM_005811chr12193 ------
NM_005813chr232190 644 273 22071 653 1795 --
NM_005814chr131268 1198 47 ------
NM_005822chr632086 962 636 1412 12016 --
NM_005826chr12225 59 ------
NM_005828chr1795074 4728 1825 1803 1640 1066 920 528 478 34664 3293 696 35024 1513 750 13889
NM_005832chr331392 562 58 ------
NM_005839chr15993 865 779 671 190 --1663 --
NM_005840chrX187707 6715 6269 5957 5527 5236 4970 3014 2992 2395 2077 1591 1508 998 845 736 539 513 25854 356 1367 15716
NM_005841chr41211 1993 ----
NM_005843chr231507 616 521 --1336 --
NM_005848chr15163 ------
NM_005853chr163476 430 238 ------
NM_005859chr521426 221 11227 ----
NM_005862chr3189 ------
NM_005870chr1341487 1232 1056 60 --1224 --
NM_005871chr101369 ------
NM_005877chr2292345 2307 2158 2113 2013 879 749 211 116 ------
NM_005880chr1621601 1506 ------
NM_005882chr41141 ------
NM_005885chr541256 449 315 158 ----11222
NM_005888chr121126 ------
NM_005896chr22680 277 ------
NM_005898chr1143028 935 687 197 --12395 --
NM_005899chr173519 194 54 --11141 --
NM_005900chr461028 829 814 353 266 224 21235 900 ----
NM_005901chr18168629 8263 8022 6350 5536 5509 5465 5254 3093 2550 2340 1430 1403 833 645 203 37741 7542 2515 36889 3471 1446 --
NM_005902chr1564469 4002 3993 3954 3405 252 44386 4234 3084 917 --2719 227
NM_005903chr575203 5127 3689 1929 1568 854 395 21776 63 21968 1333 --
NM_005904chr1851172 920 561 176 56 --11373 --
NM_005906chr671693 1468 1382 1364 1355 619 489 41703 1252 1234 544 1391 --
NM_005907chr6124 31411 1055 91 ----
NM_005909chr543244 2708 540 37 13572 13117 1845
NM_005910chr1743300 3061 2698 1355 34160 4020 350 1978 --
NM_005911chr241112 961 187 129 163 ----
NM_005917chr21186 ------
NM_005920chr143601 3222 2466 449 --1293 --
NM_005923chr62686 104 ------
NM_005924chr7126 11053 ----
NM_005930chr142585 85 1291 ----
NM_005933chr1172712 2397 2267 2216 2193 1941 1203 ------
NM_005934chr1972293 2168 1717 1040 275 167 143 1971 12328 --
NM_005935chr464820 4289 4021 3772 3750 560 41428 874 687 363 11545 --
NM_005937chr1764017 3856 3293 936 667 447 --13797 --
NM_005941chr833300 3096 2698 11432 ----
NM_005943chr641600 1519 1255 125 ----11196
NM_005944chr341206 849 343 85 ------
NM_005955chr184835 3841 3586 3501 1951 1620 668 260 ------
NM_005962chr1042024 1696 1470 577 12333 ----
NM_005962chr1042024 1696 1470 577 12333 ----
NM_005966chr232334 1727 411 ------
NM_005967chr123299 247 65 ------
NM_005968chr19--1237 ----
NM_005977chr131281 ------
NM_005985chr203675 643 191 1149 ----
NM_005986chr1382415 2315 576 500 374 348 113 25 ------
NM_005990chr552429 1933 1765 627 59 --1961 --
NM_005994chr171897 ------
NM_005996chr1241232 1003 452 213 --156 --
NM_006005chr42308 186 ----1196
NM_006007chr933731 3313 30 23226 1801 23080 594 --
NM_006010chr31198 ------
NM_006011chr15104178 4143 3923 3384 3170 3115 1207 1128 716 323 23892 3275 21156 1149 --
NM_006015chr11265 1439 ----
NM_006016chr621538 207 ------
NM_006022chr13--1929 1844 --
NM_006023chr101168 ------
NM_006030chr321773 487 --11238 --
NM_006035chr141999 --1108 --
NM_006037chr2104867 4775 4305 4258 3574 3557 3492 3353 3175 692 14162 34371 3372 275 --
NM_006040chr1641064 963 378 257 --1468 --
NM_006041chr171143 1444 ----
NM_006043chr164695 678 637 252 ------
NM_006047chr2083349 2492 2212 2197 2175 1208 850 398 32697 1331 681 ----
NM_006051chr53276 51 33 ------
NM_006055chr242847 1284 1252 988 1704 --1879
NM_006060chr763811 2796 2706 1546 1308 609 --14124 --
NM_006063chr2167 ------
NM_006068chr41293 --1274 --
NM_006076chr772731 2622 2442 1084 591 479 62 ----11039
NM_006079chr64588 297 177 91 ------
NM_006080chr742457 2082 2027 236 ------
NM_006084chr142311 68 ------
NM_006089chrX51600 1287 1203 509 156 21611 1562 --11214
NM_006090chr11631 ------
NM_006094chr872281 1775 1631 927 906 405 318 2827 694 ----
NM_006095chr473565 3094 2944 1602 778 452 27 14013 12861 13054
NM_006096chr841701 1230 265 138 133 ----
NM_006106chr1133147 2971 662 ------
NM_006107chr172543 418 1353 ----
NM_006108chr1131791 414 31 1305 ----
NM_006113chr172067 1988 1777 1737 1696 548 365 --12124 --
NM_006116chr2231608 1349 126 ----11486
NM_006133chr1142357 2342 1642 927 --31551 1526 305 --
NM_006134chr2171598 1371 1193 623 572 313 40 --1363 --
NM_006135chr131039 378 260 ------
NM_006136chr721256 403 168 ----
NM_006139chr262295 2200 1953 795 303 63 2600 175 22630 862 --
NM_006141chr1682724 2586 2499 2153 2061 1981 306 221 1831 1998 --
NM_006145chr192721 442 11004 1708 --
NM_006148chr1752668 2263 522 463 74 12921 12063 --
NM_006154chr15102905 2590 2422 2010 1161 1016 787 637 573 174 12960 ----
NM_006156chr14165 ------
NM_006158chr841397 1348 1239 693 2588 127 ----
NM_006161chr52511 247 ------
NM_006162chr1821220 1180 --11300 --
NM_006164chr22420 191 ------
NM_006166chr1231689 253 55 22467 160 12070 22491 2098
NM_006180chr941922 1521 488 346 ----1110
NM_006182chr11177 ------
NM_006186chr211147 ----11072
NM_006190chr21442 1326 ----
NM_006191chr123308 181 66 ----1400
NM_006194chr1431189 1077 881 ------
NM_006195chr91212 11292 ----
NM_006197chr882241 2217 1771 1490 855 684 173 28 ------
NM_006201chrX3815 785 90 ------
NM_006202chr1941544 784 697 517 11360 --11938
NM_006203chr594863 4589 3571 1826 1799 1614 1442 904 888 33620 2095 1926 15349 --
NM_006206chr462763 2235 1925 284 184 67 --12220 --
NM_006212chr175277 4695 3428 716 495 435 319 31872 1776 808 --15313
NM_006216chr2141 ------
NM_006218chr3--1269 132 --
NM_006224chr17102419 2315 1945 1861 1760 847 683 582 114 24 1547 12459 1727
NM_006226chr251010 325 310 57 45 1202 ----
NM_006237chr1351854 1637 874 153 135 --11797 --
NM_006241chr362401 2304 2250 1874 910 663 ------
NM_006246chr141218 ----11146
NM_006247chr191117 ------
NM_006251chr552735 2413 948 908 811 11154 1525 --
NM_006252chr197296 7181 5988 5809 2905 2729 2719 2637 1348 35364 2680 2423 14897 --
NM_006253chr1241285 376 323 106 1978 1866 --
NM_006255chr1431026 788 135 1331 2753 716 --
NM_006256chr1102562 2466 2362 2280 1922 1034 863 441 316 154 --12208 --
NM_006258chr1011474 1293 ----
NM_006264chr4----1572 --
NM_006265chr821213 480 ------
NM_006267chr22561 147 21781 1657 ----
NM_006275chr203836 59 39 22449 218 ----
NM_006278chr113371 363 37 ------
NM_006281chr83903 192 32 ------
NM_006281chr83903 192 32 ------
NM_006282chr2084009 3389 2991 1666 758 679 94 53 --13066 --
NM_006283chr8124492 4412 4254 4118 4057 3524 3331 3277 3059 889 510 483 13763 ----
NM_006290chr631821 1682 1262 1615 ----
NM_006292chr111174 ------
NM_006304chr7152 ------
NM_006305chr151212 ------
NM_006306chrX95010 1570 1462 1433 1390 846 813 598 203 24568 704 24436 3686 --
NM_006310chr172899 307 ------
NM_006313chr122495 33 --11434 --
NM_006315chr424356 3878 12756 21813 1118 --
NM_006317chr52637 601 --1791 --
NM_006320chr41823 --1851 --
NM_006321chr361899 1556 1418 1392 174 80 ------
NM_006322chr132677 321 ------
NM_006323chr42719 272 --1124 --
NM_006328chr112179 81 ------
NM_006330chr841686 1145 1047 641 ------
NM_006333chr23659 592 74 ------
NM_006334chr91291 ------
NM_006335chr12386 138 ------
NM_006336chr921513 283 --132 --
NM_006352chr131943 1287 134 ----1171
NM_006353chr6123 11051 1296 --
NM_006357chr22180 115 ------
NM_006359chrX42077 1860 1839 1531 12112 1204 --
NM_006364chr1421023 478 ------
NM_006366chr63330 272 123 11311 ----
NM_006370chr14--137 ----
NM_006372chr61384 1456 ----
NM_006375chrX21446 1347 ------
NM_006379chr742189 2041 1997 44 ------
NM_006380chr1784370 4288 3469 3268 2921 1620 556 358 1685 ----
NM_006386chr2241902 1845 1754 1655 11629 1623 --
NM_006389chr1121358 377 1527 11075 --
NM_006393chr10124270 4051 3469 2793 1713 1379 1186 982 939 709 633 394 24450 903 23255 363 --
NM_006400chr122377 51 ------
NM_006401chr91504 ------
NM_006403chr621802 1586 2633 439 ----
NM_006409chr71214 ------
NM_006411chr62389 223 ------
NM_006416chr61695 ------
NM_006421chr821180 962 21065 474 ----
NM_006425chr551444 1136 361 289 46 ------
NM_006430chr21410 --1213 --
NM_006434chr1062740 1219 1123 960 771 749 23078 2947 ----
NM_006439chr43191 83 62 ------
NM_006451chr541038 837 729 703 11078 ----
NM_006457chr453815 2923 853 817 798 --21175 561 --
NM_006464chr281777 1521 1489 1429 1329 1036 509 400 23190 575 2437 236 13986
NM_006467chr541952 416 324 234 --11490 2193 149
NM_006469chr161497 1434 1426 1119 425 219 21351 653 ----
NM_006471chr18--153 143 --
NM_006472chr151184 802 471 388 69 --11200 --
NM_006475chr132540 271 1131 ----
NM_006482chr1283547 3344 3281 2688 1294 1019 613 515 12556 11120 1607
NM_006489chr1441960 658 219 73 ------
NM_006494chr193886 818 231 --1287 --
NM_006496chr141903 321 296 132 ------
NM_006504chr1052648 2471 2187 819 402 22943 2853 --22919 2531
NM_006516chr121077 489 ------
NM_006517chrX61982 1818 929 776 621 287 --11474 --
NM_006519chr63283 109 90 1223 ----
NM_006529chr421531 679 21306 333 ----
NM_006534chr2083281 2859 2214 1204 720 533 317 274 1500 11303 1928
NM_006536chr11849 2748 378 1193 --
NM_006537chr152503 96 ------
NM_006538chr284129 3946 3833 1502 1493 1266 738 231 1936 --11219
NM_006544chr1495371 5351 4876 2253 2039 1305 1223 1209 236 55853 5227 2264 1649 1380 36045 5451 382 --
NM_006546chr1786438 5814 5559 5168 5110 4112 1464 248 16456 24057 754 --
NM_006547chr731935 1587 267 ------
NM_006549chr1262799 2649 2273 2240 1926 769 ------
NM_006557chr921726 617 ------
NM_006558chr81140 ------
NM_006559chr13923 162 154 --21094 169 --
NM_006560chr11--1499 ----
NM_006561chr10126255 6110 4402 4178 2116 1858 1569 1334 608 578 390 232 14947 ----
NM_006562chr101247 ------
NM_006565chr1611097 ------
NM_006566chr181376 1125 1880 --
NM_006571chr82110 78 ------
NM_006574chr3--1298 ----
NM_006575chr1431449 1329 423 --1439 --
NM_006577chr221185 405 ------
NM_006584chr17150 ----187
NM_006587chr451218 1112 291 242 98 1673 ----
NM_006593chr22249 218 ------
NM_006595chr1141802 809 363 73 ------
NM_006597chr112176 75 ------
NM_006599chr16147455 7421 7326 7264 6378 6347 6288 5819 5447 1874 946 885 578 543 36337 5982 136 17986 13188
NM_006601chr121857 --11063 --
NM_006603chrX61822 1800 1722 520 482 86 ------
NM_006609chr252030 797 287 271 71 ------
NM_006618chr171491 1463 1303 1007 518 441 196 --21429 479 --
NM_006620chr694840 3755 3359 3253 847 841 758 254 222 24093 1057 21598 1511 --
NM_006621chr171875 1490 652 240 215 121 44 11276 ----
NM_006622chr51183 ------
NM_006624chr1041822 1408 121 37 12103 12082 --
NM_006625chr141021 968 200 94 ------
NM_006625chr141021 968 200 94 ------
NM_006625chr141021 968 200 94 ------
NM_006626chr951946 1679 431 195 136 32221 1827 1082 --12338
NM_006628chr15124376 3981 3954 3467 2858 1645 1336 1248 1139 830 706 353 1481 24287 574 --
NM_006629chr1842231 1873 1861 1001 22701 552 1105 --
NM_006633chr53544 256 28 1244 ----
NM_006644chr131649 ------
NM_006646chr1393074 2489 2141 980 838 572 323 303 145 12342 ----
NM_006650chr553814 2862 2734 2634 508 2449 88 13675 --
NM_006654chr12154770 4639 4609 3830 3720 3487 1816 1286 1269 1260 1221 1208 1088 729 293 ------
NM_006656chr114924 219 120 99 1392 ----
NM_006667chrX3947 795 480 --163 --
NM_006670chr6281 33 1112 ----
NM_006675chr1273336 3156 3099 1135 997 525 83 --22398 335 --
NM_006682chr782267 2253 2225 1040 768 702 599 64 --1363 1739
NM_006690chr2051765 1754 855 824 76 ------
NM_006695chr17----146 --
NM_006699chr13911 449 24 1164 ----
NM_006703chr61461 ------
NM_006704chr132337 70 ------
NM_006706chr52788 719 --1155 --
NM_006710chr24988 915 838 345 --1747 --
NM_006711chr165793 608 328 106 62 1578 ----
NM_006713chr52531 202 ------
NM_006717chr963344 3143 3031 2345 603 329 --12294 --
NM_006718chr62849 31 ------
NM_006720chr1095095 3776 3524 1928 1626 1585 1452 1144 563 22013 1691 14263 --
NM_006721chr104834 639 571 288 ------
NM_006722chr352698 2025 1043 693 560 1659 ----
NM_006726chr431005 62 25 11069 ----
NM_006729chrX115318 5224 5157 5143 4810 3798 3590 3506 3415 1047 891 25326 1638 23977 1065 --
NM_006732chr1961964 1878 1710 563 307 236 1701 --1833
NM_006734chr641562 626 494 258 21176 465 ----
NM_006735chr71295 ------
NM_006736chr241730 1185 540 324 ----1491
NM_006738chr1573809 3501 3054 2950 1811 1237 196 11042 21726 767 --
NM_006742chr161276 1723 11680 --
NM_006745chr421065 841 ----11094
NM_006746chrX31246 314 225 11116 --11140
NM_006747chr111162 ------
NM_006749chr811052 ------
NM_006750chr1677969 7456 6805 5770 5236 2947 200 27697 4942 17475 16202
NM_006751chr21795 --184 --
NM_006754chr72997 129 11100 ----
NM_006755chr111164 ------
NM_006756chr851491 1288 352 345 124 --11246 --
NM_006759chr21257 ----1297
NM_006761chr172625 610 ------
NM_006763chr141955 1704 1680 732 12051 11782 --
NM_006764chr32323 97 ------
NM_006766chr842683 2530 1801 1744 32302 1810 969 ----
NM_006772chr61573 ------
NM_006773chr2133 ------
NM_006775chr643102 3095 2980 2538 12439 ----
NM_006777chrX82496 2157 2128 1841 1784 669 653 372 12138 --22087 1863
NM_006783chr13------1240
NM_006788chr1861721 1697 1489 1407 556 450 --21798 97 --
NM_006793chr104616 300 155 131 ------
NM_006800chrX5597 215 159 125 33 1196 150 --
NM_006805chr531413 399 354 ------
NM_006806chr212270 173 ------
NM_006807chr1741314 1209 1138 377 1996 1243 --
NM_006811chr202865 304 ------
NM_006815chr122537 379 ------
NM_006822chr171235 1264 ----
NM_006823chr811171 ----11219
NM_006826chr21418 ------
NM_006827chr1463108 3020 2896 2196 1298 377 ------
NM_006828chr61413 1478 ----
NM_006833chr72334 134 ------
NM_006838chr1231465 649 473 ------
NM_006852chr1712761 22079 264 ----
NM_006854chr741824 1553 1337 135 2816 631 ----
NM_006856chr121866 ------
NM_006861chr1242057 1546 491 332 --21564 600 --
NM_006870chr201341 ------
NM_006873chr243342 3112 1116 952 --12475 --
NM_006874chr431070 815 464 --1315 --
NM_006875chrX3620 596 239 1327 --1306
NM_006877chr61335 ------
NM_006885chr1674167 2746 2650 1090 1063 732 189 --1523 --
NM_006886chr201164 ------
NM_006887chr23560 237 157 ------
NM_006888chr1453066 2835 2592 1338 1192 --1108 --
NM_006892chr2031264 1195 447 ------
NM_006892chr2031264 1195 447 ------
NM_006896chr731005 288 152 ------
NM_006902chr182594 2555 2320 2215 2170 2140 221 37 ------
NM_006908chr73371 292 223 ------
NM_006909chr52316 141 ------
NM_006910chr161382 ------
NM_006912chr152460 1663 906 716 342 22322 1559 21700 899 --
NM_006915chrX31740 549 73 ------
NM_006918chr11135704 5601 4172 4154 3714 3678 2273 2209 1714 1077 979 862 612 1530 34578 4054 1276 --
NM_006920chr251516 1444 1292 331 178 ------
NM_006922chr272392 1791 837 791 698 331 172 ------
NM_006924chr1764241 3381 3260 2839 235 125 ------
NM_006925chr142477 83 ------
NM_006930chr541760 757 419 117 ------
NM_006931chr1232144 1943 277 12173 21743 1490 --
NM_006937chr173530 59 33 ------
NM_006939chr141272 ------
NM_006940chr1211633 ------
NM_006947chr431717 1195 395 11232 ----
NM_006948chr215742 719 595 285 220 ------
NM_006950chrX169 1914 ----
NM_006981chr942160 1915 789 290 ------
NM_006982chr12148 ------
NM_006983chr1121 ------
NM_006990chr122431 2420 12204 22465 2198 --
NM_006991chr3197 ----1178
NM_006996chr131874 1261 39 11197 11541 --
NM_006997chr10198 ------
NM_006999chr522092 1266 1826 21617 132 --
NM_007005chr9----147 --
NM_007006chr1622538 396 1803 ----
NM_007007chr1294721 4020 3665 3344 1691 1550 1244 721 682 14203 14146 1391
NM_007010chr1731404 1256 318 11451 1567 --
NM_007011chr15126551 6502 6488 6244 6111 5866 4252 4222 1952 1249 940 905 26568 2430 35418 5330 4271 26234 1480
NM_007013chr83890 883 792 1742 190 --
NM_007017chr51313 ------
NM_007023chr22894 205 ------
NM_007026chr173495 464 74 ------
NM_007027chr31112 ------
NM_007030chr554955 4668 1379 633 52 25001 1865 14659 --
NM_007034chr1185 ------
NM_007035chr122646 305 ------
NM_007038chr21105960 5577 5392 4867 4621 4512 2179 1849 416 398 ----11893
NM_007039chr1462252 1750 856 482 438 333 ------
NM_007040chr192732 360 ------
NM_007042chr362289 2202 780 334 210 38 --1920 --
NM_007045chr61589 ------
NM_007050chr20137764 7604 7590 6813 6351 3152 2646 2591 2389 2248 1344 461 155 36373 1217 93 25420 607 --
NM_007052chrX2546 88 ------
NM_007054chr573017 2871 2671 959 944 502 227 --11203 1817
NM_007064chr32425 80 11244 --1211
NM_007073chr684136 3984 1258 1178 670 629 92 69 31626 1274 1057 33258 1162 598 --
NM_007076chr121106 ------
NM_007078chr1042938 1044 799 658 12241 42562 2472 1899 377 --
NM_007084chr133631 586 406 1549 11542 --
NM_007096chr9--1260 ----
NM_007106chr1362572 2050 1929 1759 1063 690 ----22043 188
NM_007107chr332319 2008 1541 1866 ----
NM_007114chr362667 2570 2410 2344 2174 855 1418 11234 --
NM_007118chr5126 1568 1203 --
NM_007124chr621433 391 ------
NM_007125chrY1362 11301 ----
NM_007126chr92145 111 ------
NM_007137chrX95066 4924 4868 4670 4528 4343 3914 2207 1393 25147 795 1616 --
NM_007139chr721116 473 ------
NM_007144chr173929 351 53 11045 ----
NM_007145chr1911195 ------
NM_007146chr17122738 2533 2395 2117 1919 1808 1155 1136 864 614 351 199 1584 ----
NM_007157chrX72858 2573 2358 2146 1873 276 65 1151 12649 --
NM_007158chr14429 374 360 354 1467 1301 --
NM_007159chr311775 4676 347 340 262 ----
NM_007166chr1151593 1535 1381 1264 1244 ------
NM_007167chr11856 ------
NM_007172chr2292717 2153 1323 1167 1155 989 626 184 94 32469 2316 525 13001 12188
NM_007173chr1132366 1544 690 41695 1596 508 317 ----
NM_007174chr1242400 608 252 69 --2955 245 --
NM_007175chr873427 2836 2797 2578 913 748 514 12227 22317 611 --
NM_007187chr133892 748 714 ------
NM_007191chr121153 ------
NM_007192chr1441053 922 270 30 ------
NM_007197chr12----1927 --
NM_007200chr1573809 3501 3054 2950 1811 1237 196 11042 21726 767 --
NM_007202chr172749 679 1720 ----
NM_007203chr973879 3346 3286 3210 3105 940 188 --13323 --
NM_007207chr14838 356 141 67 ------
NM_007212chr142266 869 708 619 1404 ----
NM_007214chr641325 548 462 122 ------
NM_007218chr82709 350 1612 1672 --
NM_007222chr811701 2736 428 11546 1291
NM_007229chr222344 288 ------
NM_007236chr153817 790 465 1928 31506 688 261 --
NM_007238chr2094774 4716 3800 3321 3083 895 567 335 266 --34311 1521 1299 --
NM_007246chr431030 675 104 11069 1840 --
NM_007249chr13209450 9257 8999 8788 8385 7277 7161 7066 6996 6948 6876 6504 3756 3689 3474 3001 2554 1591 682 592 23289 1906 49426 3696 3268 607 11840
NM_007269chr11617 ------
NM_007271chr681695 1608 1558 1398 590 488 394 70 ------
NM_007275chr351109 785 372 241 117 ------
NM_007276chr721053 355 1184 ----
NM_007278chr17136 ------
NM_007280chr151415 ------
NM_007282chr311022 ------
NM_007285chr161330 ------
NM_007286chr552122 2095 486 323 126 ----11329
NM_007324chr12426 71 ------
NM_007325chrX4768 581 331 85 --1657 1186
NM_007331chr472602 2315 1092 933 723 504 191 12162 --11108
NM_007332chr821346 1272 1234 --1585
NM_007345chr1831770 1477 488 ------
NM_007347chr1583187 2551 2137 2060 1984 1190 686 329 11231 ----
NM_007350chr1294330 4319 4279 4187 3274 1172 1152 1012 510 1546 13635 --
NM_007363chrX3376 186 128 ------
NM_007372chr172854 302 2840 590 ----
NM_007373chr1031150 529 172 ------
NM_007375chr162791 2176 2105 704 602 369 ------
NM_012064chr121995 ----1748
NM_012074chr143819 396 49 --11053 --
NM_012081chr553770 3296 1495 154 94 --13262 23483 2990
NM_012083chr10--172 1111 --
NM_012084chrX2354 123 ------
NM_012090chr121164 826 173 --137
NM_012095chr1042915 2840 1230 591 --23033 2248 --
NM_012096chr383599 3334 3021 2949 1284 1112 1038 695 --12497 --
NM_012097chr211415 11578 ----
NM_012098chr921147 128 ------
NM_012102chr142229 914 839 792 12028 ----
NM_012104chr1163805 3438 1016 992 268 236 --33352 220 59 --
NM_012104chr1163805 3438 1016 992 268 236 --33352 220 59 --
NM_012105chr213927 760 227 ------
NM_012110chr4--1248 ----
NM_012129chr732260 900 614 11651 ----
NM_012137chr152733 2194 2131 494 57 42626 1172 463 334 22835 2219 --
NM_012141chr13173476 3466 3256 3035 2841 1380 1140 1083 1035 1013 823 769 529 495 372 348 206 1936 ----
NM_012156chr2063121 2432 2179 1341 1094 1007 --173 --
NM_012158chr1351794 1787 1683 711 686 21628 1282 --11864
NM_012161chr441134 926 792 61 --11090 --
NM_012164chr9237487 7461 6985 6919 5498 5383 5369 5218 4826 2766 2576 2236 2166 2109 2098 2009 1927 1652 1364 781 593 567 31 --11307 --
NM_012174chr123867 765 742 ------
NM_012176chr51279 ------
NM_012180chr42749 281 2552 471 ----
NM_012183chr14610 532 444 119 1416 ----
NM_012193chr11165183 5158 4519 4415 3958 3887 3681 3655 3602 1799 1114 993 820 553 262 192 14326 24872 1748 --
NM_012197chr92228 77 11224 2518 220 --
NM_012199chr194656 4427 4415 4121 3994 1499 1137 1004 358 --12975 --
NM_012207chr10--1191 ----
NM_012214chr295727 5282 2356 2181 2150 1974 1648 1150 298 24786 2208 36090 5612 1295 24329 3960
NM_012215chr1041855 1219 602 537 11364 --2767 157
NM_012218chr1973053 1910 1892 1155 841 597 233 --22742 792 --
NM_012223chr221117 379 --2925 451 --
NM_012224chr41484 1325 1444 --
NM_012229chr1051451 915 536 287 183 --11026 --
NM_012234chr3143743 3699 3488 3118 2959 2703 2627 1436 1427 1170 1147 930 195 186 --12318 --
NM_012236chr14614 337 233 50 ------
NM_012238chr101427 ------
NM_012243chr12379 299 ------
NM_012244chr1441443 417 130 24 --11265 --
NM_012245chr141414 1168 174 --
NM_012249chr2103435 3278 3219 2890 2876 2532 2430 2342 1194 798 --1866 --
NM_012250chr1151325 1250 1144 988 382 11135 ----
NM_012252chr775303 4056 3952 3387 1254 245 67 ------
NM_012255chr202107 37 ------
NM_012257chr72860 831 1924 ----
NM_012259chr621406 546 ------
NM_012261chr20169 --1512 --
NM_012262chr144344 3842 460 326 --14411 11375
NM_012266chr91905 ----11085
NM_012281chr752144 717 229 213 88 ------
NM_012286chrX2480 48 ------
NM_012288chr6165534 5265 5182 5113 5082 5065 4928 4328 4174 4094 2122 1671 1629 1204 316 195 --45251 3944 1394 747 --
NM_012293chr232093 2049 1877 --12270 --
NM_012294chr783011 1430 1018 901 441 396 239 202 21633 579 22684 616 140
NM_012297chr432014 1684 57 1490 ----
NM_012300chr572554 2210 2154 1944 1675 476 402 32022 1704 509 1377 --
NM_012302chr161169 1083 472 259 183 86 ------
NM_012304chr592485 2099 1999 806 654 614 502 475 295 12202 22356 528 --
NM_012306chr1253061 2594 2344 971 556 11437 23201 469 --
NM_012307chr181924 ------
NM_012308chr1132125 2039 468 31874 778 89 1854 --
NM_012309chr1194945 4249 4221 4076 3544 3366 1498 950 367 --24637 1179 24516 982
NM_012316chr1115242 4069 3730 1939 1909 1453 1361 1330 1003 752 398 1519 24962 4649 --
NM_012320chr1621390 1374 11353 ----
NM_012322chr7175 1384 ----
NM_012325chr2041664 1449 1310 1127 --1142 --
NM_012326chr22819 735 ------
NM_012327chr182629 238 ------
NM_012328chr751418 1219 1093 946 105 ------
NM_012329chr1711615 21558 235 ----
NM_012330chr1031786 1397 1141 11591 ----
NM_012333chr11373 21048 556 3515 262 130 --
NM_012337chr1146 ------
NM_012342chr10172 ------
NM_012343chr511113 1380 ----
NM_012382chr594339 3307 2913 2901 2746 1559 1486 1307 75 42928 615 591 217 --1562
NM_012383chr9159 1430 ----
NM_012388chr1573017 2426 2178 775 721 546 429 22760 2357 ----
NM_012399chr2221690 1272 21230 612 ----
NM_012402chr111296 --11165 --
NM_012405chr173781 3660 3553 2669 2528 362 118 13178 21304 1192 --
NM_012408chr20194 1790 ----
NM_012416chr91452 1989 ----
NM_012417chr171406 ------
NM_012419chr62507 237 ------
NM_012420chr1052327 1951 1584 438 368 1463 ----
NM_012428chr151380 ------
NM_012434chr631121 384 87 ------
NM_012448chr1762474 2142 1923 1879 309 53 1378 21992 453 --
NM_012454chr6------1232
NM_012461chr146760 667 644 536 244 36 ------
NM_012463chr1231773 471 132 ------
NM_012464chr442654 2608 624 437 22618 1934 --12163
NM_012465chr1031080 639 300 32306 1086 791 ----
NM_012471chrX21318 151 --1339 11953
NM_012475chr11250 ------
NM_012479chr752216 2041 1717 433 388 --1970 --
NM_012482chr11164 2638 591 ----
NM_012486chr13350 186 72 ------
NM_013229chr122470 278 ------
NM_013230chrY51687 1458 1324 584 527 ------
NM_013231chr14134372 4312 3299 3234 3117 2797 2742 1453 1406 1312 1080 689 129 11392 34352 1734 341 --
NM_013233chr211403 --1927 --
NM_013236chr222411 375 ------
NM_013238chr1341704 1165 717 422 --11332 --
NM_013246chr11----150 --
NM_013254chr121687 1291 ----
NM_013255chr7278781 8636 8537 8454 8038 7101 6451 6127 6042 5460 3030 2798 2542 2268 2126 1948 1922 1915 1482 1476 1432 1106 891 802 626 506 179 25791 744 1447 --
NM_013261chr453328 2771 1062 633 113 ------
NM_013262chr671460 1440 1241 1047 562 426 220 ------
NM_013263chr16147 ------
NM_013269chr1244257 4200 4077 602 1746 14413 14355
NM_013272chr152147 24 1258 ----
NM_013277chr123697 104 63 --2912 202 1749
NM_013279chr1161818 1614 901 686 358 105 22258 2252 ----
NM_013281chr2021241 295 --1415 --
NM_013282chr1921308 192 ------
NM_013283chr53887 323 58 ------
NM_013286chr373822 3076 2661 1524 1455 953 441 --185 --
NM_013293chr73179 137 115 166 ----
NM_013309chr1532588 838 184 22546 728 ----
NM_013314chr10141 ------
NM_013316chr71868 --146 1853
NM_013323chr1751070 1003 962 934 257 --31056 985 445 --
NM_013330chr1177 ------
NM_013348chr1941260 894 866 252 ------
NM_013351chr172730 505 ------
NM_013354chr831365 898 432 --1385 --
NM_013357chr82620 286 ----1280
NM_013363chr3132 1100 ----
NM_013372chr1552157 1180 833 608 326 --12583 --
NM_013374chr362796 2308 2165 1992 824 103 --185 --
NM_013381chr121899 --1187 --
NM_013382chr1452108 1721 871 137 114 11949 ----
NM_013386chr121730 603 11616 ----
NM_013390chr931385 1106 255 ------
NM_013396chr2131583 550 288 ------
NM_013401chr111723 131 ----
NM_013433chr1912037 ------
NM_013435chr1831877 1516 489 ------
NM_013436chr21742 ------
NM_013437chr831299 1111 921 ------
NM_013438chr991602 1404 1313 1183 697 582 412 376 98 ------
NM_013444chrX1352 ------
NM_013446chr761440 1372 1364 1290 1133 1012 ------
NM_013447chr1953714 3576 3124 3010 88 12319 1887 1258
NM_013449chr1242702 1981 1944 1152 --2423 366 --
NM_013450chr221221 391 ------
NM_013951chr241973 1919 1722 536 11534 12468 12397
NM_013952chr242050 1996 1799 613 11611 12545 12474
NM_013953chr242050 1996 1799 613 11611 12545 12474
NM_013958chr81315 1168 ----
NM_013959chr81315 1168 ----
NM_013961chr81315 1168 ----
NM_013962chr81315 1168 ----
NM_013989chr1464337 4011 3987 3219 1788 1627 45146 3776 3462 1365 1282 --
NM_013992chr242050 1996 1799 613 11611 12545 12474
NM_013999chr172265 44 --31518 1281 977 --
NM_014000chr1041788 690 386 165 --1322 1184
NM_014007chr941147 1125 904 514 ------
NM_014011chr231016 619 286 ------
NM_014023chr1052614 1842 939 732 515 --1970 --
NM_014034chr651337 1257 1028 966 454 21385 1313 ----
NM_014038chr7143 --1360 --
NM_014043chr32566 400 ------
NM_014048chr1664964 4681 4151 3231 371 338 1797 24324 3590 --
NM_014056chr362040 1675 1621 1503 448 437 11749 22109 2003 --
NM_014089chr132127 47 --1546 --
NM_014109chr851171 985 905 342 206 ------
NM_014112chr895186 4791 4730 4307 3478 3328 1609 1037 228 --34624 3360 1996 14900
NM_014117chr1621846 557 32048 2020 831 21085 648 --
NM_014141chr7115232 4613 4392 3850 1891 1639 1526 1475 1091 426 84 ----11505
NM_014145chr202259 92 --1790 1606
NM_014154chr321349 1036 21060 593 ----
NM_014155chr11127300 5031 4866 4595 2200 2104 1920 1543 1351 1237 866 139 12735 11279 --
NM_014157chr16113989 3796 3613 3555 3389 1487 1474 1425 421 410 217 13429 12857 --
NM_014171chr22303 264 2726 654 ----
NM_014181chr242855 2686 2483 2115 11175 ----
NM_014182chr122506 239 ------
NM_014189chr441409 444 74 45 --1371 --
NM_014190chr441761 1180 426 397 --1723 --
NM_014191chr1231007 425 387 11033 ----
NM_014212chr12--1276 11001 --
NM_014217chr131282 208 175 1164 ----
NM_014230chr17--134 ----
NM_014231chr1252004 1697 1544 633 257 12199 2761 160 --
NM_014232chr1731656 649 420 1535 ----
NM_014232chr1731656 649 420 1535 ----
NM_014233chr1751972 1885 1570 185 114 21873 623 ----
NM_014234chr6124 --144 --
NM_014240chr363104 1433 1148 739 681 656 14011 23290 1591 13711
NM_014241chr10184 ------
NM_014243chr451848 599 377 269 150 11862 ----
NM_014245chr331115 736 435 ------
NM_014248chr222173 146 ------
NM_014249chr152519 71 --134 --
NM_014250chr2232008 858 176 11467 --1734
NM_014253chrX52451 1591 926 276 91 11893 ----
NM_014263chr1061326 1176 1087 523 312 92 ----11239
NM_014264chr42594 217 1146 ----
NM_014267chr111161 ------
NM_014271chrX3712 648 219 ------
NM_014278chr41105 ------
NM_014279chr93959 877 813 1129 ----
NM_014282chr91134 --11232 --
NM_014283chr121228 441 ------
NM_014288chr11266 ------
NM_014289chrX11047 ------
NM_014292chr22157 ------
NM_014293chr2244155 3813 1142 764 13575 33535 1456 42 --
NM_014299chr1941641 1479 415 349 1632 --1497
NM_014300chr152466 369 ------
NM_014305chr132488 94 ------
NM_014309chr2285336 4747 4005 3660 1967 1798 753 507 --21318 1175 --
NM_014316chr1662105 1989 1954 855 81 45 11620 ----
NM_014317chr101211 --171 --
NM_014319chr1211468 ------
NM_014323chr2251086 827 358 199 159 ------
NM_014325chr1251484 1449 892 690 463 2330 305 ----
NM_014331chr497713 6931 6394 6235 5361 2818 1725 297 96 46005 5883 979 427 27251 1382 1565
NM_014333chr1162537 2520 967 781 575 293 --1184 --
NM_014344chr114777 579 342 223 ------
NM_014345chr62776 350 --2826 281 --
NM_014346chr221428 1408 ----
NM_014350chr53994 867 193 11034 ----
NM_014351chr22196 1562 1479 --
NM_014360chr143578 89 37 --149 --
NM_014363chr132268 132 1486 ----
NM_014372chr132044 1579 623 1846 ----
NM_014382chr31431 1186 ----
NM_014388chr165045 4971 793 765 642 481 2238 75 24662 1946 --
NM_014390chr71444 --2489 475 --
NM_014392chr431299 622 222 2213 55 11600 --
NM_014393chr892174 1902 1769 1518 648 487 443 329 77 11554 1307 --
NM_014399chr75963 954 297 144 48 ------
NM_014400chr195557 398 362 340 190 ------
NM_014408chr12616 133 ------
NM_014415chr32424 73 11188 ----
NM_014421chr442090 1653 1581 1542 1793 ----
NM_014423chr5115318 4565 4213 3639 3521 3505 3490 3464 1309 639 377 11028 ----
NM_014426chr201530 ------
NM_014429chr33643 156 101 1504 ----
NM_014445chr382292 1616 1483 934 435 427 329 29 ------
NM_014447chr411430 ------
NM_014452chr62341 333 --2859 22 --
NM_014454chr661032 1025 982 896 670 28 ------
NM_014458chr171307 1117 1079 896 305 180 41 ------
NM_014488chr113536 525 93 ------
NM_014491chr71761 ------
NM_014494chr163795 491 201 --2628 126 2738 700
NM_014503chr122423 45 --1123 --
NM_014515chr121865 --2969 842 --
NM_014517chr341933 1230 269 233 ------
NM_014521chr241437 573 255 28 --1450 --
NM_014522chrX3692 590 457 ------
NM_014547chr15--1181 ----
NM_014547chr15--1181 ----
NM_014554chr1272246 2027 1783 1426 786 527 201 ----12098
NM_014570chr22--1163 ----
NM_014572chr1331172 168 135 21198 318 1458 11715
NM_014574chr142979 365 ------
NM_014575chr3----1516 --
NM_014577chr223807 702 252 2719 85 1789 --
NM_014584chr1421063 639 ------
NM_014585chr251172 1138 1115 385 99 ------
NM_014586chr2174426 4128 4091 3767 2939 1714 1576 13410 11846 --
NM_014587chr1611317 ------
NM_014588chr205709 581 217 187 91 ------
NM_014592chr51823 --1124 --
NM_014600chr281475 1430 1293 1201 608 554 260 130 1370 11528 --
NM_014612chr921132 122 11298 ----
NM_014613chr542927 2061 729 359 ------
NM_014614chr21221 ------
NM_014615chr1663383 3242 2938 2666 2370 680 12532 13504 12981
NM_014623chr6----1209 --
NM_014629chr831228 1048 276 ------
NM_014630chr1552815 2456 1050 486 86 1203 13269 --
NM_014635chr231570 1264 427 11680 11309 --
NM_014636chr994121 4057 3451 3107 2943 2923 2863 1334 674 24374 1390 22781 215 --
NM_014646chr18103191 3075 3034 2898 2655 2146 1285 995 926 792 ------
NM_014647chr1652234 2222 1545 662 49 ------
NM_014653chr1212004 11548 2297 197 --
NM_014655chr132153 1516 483 1151 11646 11716
NM_014661chr1063886 3332 3099 1460 1308 785 --41473 997 350 56 --
NM_014663chr12817 713 --150 --
NM_014666chr521134 432 ------
NM_014667chr352382 1775 1534 987 962 1539 12149 12343
NM_014670chr251601 1389 1287 387 315 11534 ----
NM_014671chr731288 1219 1052 21552 980 1125 --
NM_014674chr333811 1431 1364 12638 1335 --
NM_014677chr821023 548 ------
NM_014679chr1121332 465 1555 1269 --
NM_014680chr172127 40 ------
NM_014682chr832120 1669 260 ------
NM_014683chr17--11367 ----
NM_014685chr161531 1216 ----
NM_014686chr1912248 22373 291 ----
NM_014690chr792690 2011 1114 978 730 442 425 392 179 11949 --12415
NM_014701chr1533209 1050 380 ------
NM_014702chr633182 2174 1284 1383 --164
NM_014705chr762094 1610 1362 280 86 31 ------
NM_014706chr121398 --31063 217 40 1897
NM_014709chr23605 460 245 ------
NM_014711chr1631934 1808 477 22034 1534 --11733
NM_014720chr1071504 1480 1432 1285 403 389 238 --151 11144
NM_014721chr6117025 6990 6651 6444 6229 5149 5046 2180 2057 1765 562 ------
NM_014723chr2042881 2420 2132 1152 13250 23000 1040 --
NM_014727chr191258 ------
NM_014729chr84866 737 433 277 12169 1151 --
NM_014730chr1254988 4752 4600 3764 1692 33658 1404 319 15319 14894
NM_014730chr1254988 4752 4600 3764 1692 33658 1404 319 15319 14894
NM_014732chr16115759 5181 5175 5101 5087 4395 2228 2202 2044 1497 48 12114 15308 11854
NM_014739chr6104086 3092 3075 2939 2808 1401 1346 679 310 276 1359 ----
NM_014743chr42442 57 12887 --12841
NM_014746chr2114281 4076 3996 3326 3194 2884 1615 1419 1002 623 391 11263 1435 --
NM_014747chr1145745 5114 5095 4868 4619 4536 3812 2220 2098 1581 1195 840 492 475 14334 ----
NM_014751chr82381 76 ------
NM_014752chr1131340 1334 143 1189 ----
NM_014755chr273713 3364 3245 1381 569 196 185 12661 ----
NM_014756chr112417 165 ------
NM_014757chr532332 2021 79 ------
NM_014758chr1131801 653 490 21652 987 ----
NM_014761chr1641169 740 167 99 1915 ----
NM_014762chr151862 922 843 250 90 --1892 1814
NM_014764chr121149 2383 348 ----
NM_014765chr192267 2027 2002 971 716 381 210 138 71 21905 869 --12547
NM_014767chr1021408 514 31475 919 49 13126 11269
NM_014772chr1842994 2901 2428 685 13098 --11415
NM_014774chr163147 2240 707 389 350 116 12046 ----
NM_014779chr381095 1067 979 888 772 384 140 75 ------
NM_014781chr83430 418 25 ------
NM_014787chr142042 1864 867 283 31080 683 64 ----
NM_014795chr221273 308 ------
NM_014798chr1721869 473 ----125
NM_014800chr71194 ------
NM_014810chr193437 3401 2785 2633 2555 1446 1263 393 378 --1503 1773
NM_014812chr171846 1835 778 755 579 500 432 --21613 536 --
NM_014820chr381964 1899 1595 1410 1385 623 604 551 ------
NM_014824chr1111739 ------
NM_014826chr184374 3861 3727 2651 993 945 60 29 13129 ----
NM_014827chr131386 606 21 ------
NM_014828chr1442064 1931 1624 1580 --1944 --
NM_014829chr552342 2284 1772 445 350 1661 --12190
NM_014830chr1283302 3153 2828 1382 1260 1089 246 114 12845 --1821
NM_014832chr1311699 ------
NM_014835chr203872 548 313 11782 1183 11424
NM_014836chr103690 136 58 --11417 11238
NM_014838chr224539 342 126 114 11108 22068 79 1820
NM_014839chr161739 1599 663 615 332 124 11908 ----
NM_014841chr61200 1845 ----
NM_014848chr1582369 1969 1801 1064 1015 919 691 123 21879 539 12499 --
NM_014849chr131232 412 248 ------
NM_014850chr384549 4374 4109 3645 3468 1455 1267 329 34866 4651 3513 ----
NM_014853chr1751498 1005 576 410 255 ------
NM_014859chr172267 247 --1361 --
NM_014860chr252472 2432 2409 1994 1837 1336 1849 --
NM_014864chr183043 1633 1089 764 758 741 332 239 14387 31208 516 400 --
NM_014869chr3182 --31040 523 285 --
NM_014871chr121210 ------
NM_014872chr931998 958 601 --1570 --
NM_014873chr1104152 4009 3962 3692 3374 1232 730 559 312 231 ------
NM_014874chr131781 1504 222 ------
NM_014876chr2252068 1639 1373 601 377 ------
NM_014877chr17167654 7580 7552 6615 6391 5590 4977 3004 2551 2513 2501 1918 1860 1479 632 553 1207 36883 5935 2422 25381 2967
NM_014883chr462445 2342 1826 519 386 72 ------
NM_014884chr19----158 --
NM_014890chr32277 104 ------
NM_014892chr6189 ------
NM_014893chrY3915 598 569 21844 944 ----
NM_014897chr1752802 2346 2213 1979 550 ------
NM_014899chr562882 2737 1139 706 584 216 --11055 --
NM_014900chr22878 312 11076 ----
NM_014902chr202449 99 ----1433
NM_014903chr1232465 1842 31 12003 ----
NM_014906chr1774031 3885 3606 3511 3462 2940 1609 23843 3616 ----
NM_014909chr14103939 3909 3866 3838 2857 2800 997 747 185 34 --13402 --
NM_014910chr192836 137 ------
NM_014912chr1062272 1168 1158 776 728 309 11055 --1231
NM_014913chr1831440 1287 121 ------
NM_014917chr12953 348 ------
NM_014918chr1551183 1108 653 541 354 1224 1611 --
NM_014920chr652950 2528 1359 302 113 --31446 623 584 --
NM_014921chr1962861 2310 2147 1925 108 63 12253 ----
NM_014923chr1322192 169 --1917 --
NM_014924chr14113150 2749 2714 2598 1139 1057 922 907 580 386 60 21003 728 ----
NM_014925chr123753 289 232 ------
NM_014926chr341076 1019 948 823 1295 ----
NM_014931chr193572 550 120 ------
NM_014932chr331682 1621 136 ------
NM_014935chr123838 1288 23272 3215 --23361 61
NM_014936chr62526 139 196 ----
NM_014937chr1041284 1224 190 106 21269 1122 3869 269 234 --
NM_014938chr1262434 2166 2042 680 453 118 1508 22528 2355 --
NM_014939chr1841334 542 484 181 2342 126 11289 --
NM_014944chr131348 192 43 1579 11199 --
NM_014945chr521887 223 ------
NM_014946chr252620 1918 724 474 269 33001 2736 853 ----
NM_014947chr142504 2304 2124 103 --12715 --
NM_014949chr12984 77 ------
NM_014950chr1421665 1251 --2191 180 --
NM_014951chr1052596 2559 2082 705 528 --11008 21685 1646
NM_014952chr1521958 1709 1492 11739 --
NM_014953chr1394313 3929 3853 3830 3816 3675 2720 1332 1292 1335 ----
NM_014961chr43504 316 285 41923 243 124 89 ----
NM_014962chr2022625 1788 --12582 11082
NM_014969chr11908 ------
NM_014974chr1021275 218 --11391 --
NM_014977chr141483 ------
NM_014978chr1051573 477 369 255 164 ------
NM_014982chr14135213 5119 4769 4711 4662 4007 3636 3426 3284 1861 1764 913 888 35316 4513 1669 14180 199
NM_014988chr482702 2525 2401 2162 1141 1131 636 380 --11928 --
NM_014989chr631594 1380 789 --21306 341 --
NM_014991chr472796 2775 2587 2282 2127 1082 238 ------
NM_014994chr1552304 753 676 628 389 --11618 --
NM_014996chr34978 391 362 41 ------
NM_014997chr722910 176 1333 1803 --
NM_015000chr1253086 2216 2200 2128 972 12607 1302 --
NM_015001chr12796 44 --1408 --
NM_015002chr1252116 2079 1425 760 322 --1281 --
NM_015005chr1411775 ------
NM_015008chr383649 3015 2726 2623 1399 1378 715 576 180 --12365
NM_015009chr31144 ------
NM_015020chr16113634 3496 2842 2618 2475 1493 1470 881 785 484 209 11326 170 --
NM_015023chr17670 646 630 430 288 181 74 ------
NM_015024chr821121 476 ------
NM_015025chr282709 2669 2603 2019 1930 1017 875 762 11867 ----
NM_015026chr1264700 4574 4462 3227 3062 1216 24216 1287 14707 --
NM_015027chr161377 11939 ----
NM_015032chr132842 138 --12613 --
NM_015035chr2086415 6350 4976 4740 2560 742 719 386 34888 4422 1406 25302 5010 --
NM_015037chr101273 ------
NM_015039chr1133980 3752 3697 3324 3116 2968 2680 1659 424 410 385 346 307 1912 1332 --
NM_015040chr223329 2231 32685 2488 490 21106 180 12262
NM_015042chr15104273 3902 3830 3715 3520 3409 3166 1379 481 335 34206 4085 3121 ----
NM_015045chr1042013 439 309 268 ------
NM_015049chr253258 2904 2210 2006 1271 --12264 --
NM_015050chr651307 900 521 366 334 1921 ----
NM_015051chr943040 2754 386 240 2703 569 1436 --
NM_015057chr132439 76 ------
NM_015061chr91731 ------
NM_015064chr1293436 2716 2696 2674 2413 2305 665 536 295 13336 11044 --
NM_015068chr723937 3169 --1155 --
NM_015071chr5136246 6115 5878 5663 5592 4940 4546 1150 807 730 455 149 112 ----11252
NM_015073chr1921502 607 ------
NM_015074chr1134732 4625 4563 3701 3567 1344 1020 758 474 349 178 172 138 34892 649 308 14554 --
NM_015075chrX11798 --11408 --
NM_015076chr644557 4002 3533 2768 1732 ----
NM_015077chr17104534 4504 3641 3599 3378 1588 1250 1044 914 168 1423 23332 523 11341
NM_015086chr1251191 1130 553 517 63 1984 ----
NM_015090chr1116068 5615 5582 4664 4439 4047 3927 2426 1899 1781 1164 26201 807 25463 31 --
NM_015091chr141736 ------
NM_015092chr1674633 4256 3565 2851 1872 1787 720 1120 11549 --
NM_015093chr61503 --1543 --
NM_015094chr2294128 3336 3239 3230 3156 1818 1219 1015 748 ------
NM_015100chr141988 1837 810 560 11765 ----
NM_015107chrX2398 182 --1448 --
NM_015115chr492773 2610 2009 1266 1137 843 801 756 156 12732 ----
NM_015116chr1351658 1551 1501 171 32 ------
NM_015122chr191225 ------
NM_015124chr2262464 2225 2162 1656 1015 385 --1829 11727
NM_015125chr19----1423 --
NM_015130chr431058 486 199 ----11128
NM_015132chr741728 737 298 158 ------
NM_015137chr882509 2332 2299 2174 1919 1640 703 264 --1679 --
NM_015138chr1541021 829 808 651 --22313 309 12202
NM_015141chr362351 2285 2188 2147 1804 704 1504 22012 232 12243
NM_015143chr421377 258 1486 ----
NM_015144chr16113951 3919 3804 3252 3146 3109 1344 1164 898 440 255 ------
NM_015149chr152085 1749 1418 655 386 1433 1601 --
NM_015151chr2121030 331 --1657 --
NM_015155chr1062471 1317 1210 828 366 58 1321 32395 861 748 --
NM_015156chr14103983 3690 3227 3195 1367 1312 1150 399 370 270 21522 985 32855 1094 222 --
NM_015158chr93793 720 217 1278 ----
NM_015170chr842323 2273 2147 776 1420 ----
NM_015172chr121479 1252 ------
NM_015176chr12199 151 11688 ----
NM_015180chr141300 --1291 --
NM_015184chr31247 ------
NM_015185chrX62949 2904 2590 1003 927 665 12887 ----
NM_015191chr1132743 2617 2527 22638 914 ----
NM_015192chr2032325 1994 351 22776 430 --12009
NM_015194chr1731896 1553 468 --2684 398 --
NM_015196chr41108 ------
NM_015197chr143686 345 187 --22616 1018 --
NM_015199chr322874 296 11020 12277 170
NM_015200chr451766 924 779 228 121 ------
NM_015205chr1354531 4048 1363 1126 63 --21843 380 --
NM_015206chr1573749 3369 2809 947 866 541 162 11318 1605 21551 209
NM_015208chr1833335 1125 315 1978 13839 --
NM_015209chr131886 639 603 --21444 457 --
NM_015213chr111195 154 ----
NM_015215chr12800 205 ------
NM_015225chr983192 2865 2853 2609 2005 290 157 119 --1100 22602 2409
NM_015226chr1643371 2316 1122 665 11110 2189 96 --
NM_015231chr112848 320 --1132 --
NM_015233chr1321891 593 ----11046
NM_015236chr411254 ------
NM_015239chr92526 207 ------
NM_015245chr622307 1962 193 --12639
NM_015247chr16145273 4980 4491 3842 3603 3578 1986 1528 1335 1329 1159 642 457 198 24644 1614 --15321
NM_015250chr951644 1564 746 670 349 ------
NM_015252chr21824 ------
NM_015263chr15169 ------
NM_015264chr22114203 3556 3499 3376 3227 3080 3053 1605 1294 1275 451 1745 44573 1457 1353 519 --
NM_015265chr252136 935 469 307 257 --12177 11752
NM_015267chr1252164 2085 1915 203 61 --1676 --
NM_015268chr3----1190 --
NM_015270chr1231691 565 57 1841 21778 879 --
NM_015271chr484263 4087 2705 1627 1251 521 476 458 1561 --11224
NM_015272chr1641655 1584 673 82 21774 822 ----
NM_015277chr1831281 470 53 2590 518 ----
NM_015278chr633213 1286 1252 ------
NM_015282chr292968 2769 2748 2724 2664 1928 871 399 322 12805 ----
NM_015285chr1872295 2205 1038 506 293 211 64 --11796 --
NM_015288chr563758 3387 3293 2775 683 653 11186 33412 2787 1364 1838
NM_015289chr1571922 1833 1750 1721 1590 761 614 1148 1470 --
NM_015291chr143398 3389 2660 1189 2783 460 ----
NM_015293chr62575 296 1236 ----
NM_015294chr1731149 1081 925 ------
NM_015296chr132943 374 --21225 839 --
NM_015299chr14123828 3319 3298 2835 2525 1250 1038 891 787 727 388 228 --23407 138 191
NM_015305chr1441669 1249 672 513 --11735 --
NM_015308chr113798 645 153 ------
NM_015310chr8157980 6810 6665 6531 6070 5845 5268 3374 3082 2818 1829 1439 1298 1173 906 37087 6482 2588 11214 11501
NM_015313chr11104847 4680 4494 4366 3983 3681 3401 1591 1532 223 ------
NM_015315chr522518 478 --21187 340 --
NM_015317chr232694 2226 1881 --12140 11052
NM_015320chr221000 853 ------
NM_015321chr1974783 4303 4176 4125 4032 3496 3096 24389 104 ----
NM_015326chr132279 2017 625 12570 12134 --
NM_015328chr742830 2676 2605 1236 --12066 --
NM_015332chr7103608 2807 2686 2491 1396 1204 683 493 445 363 ------
NM_015335chr1242660 2281 158 109 22573 1867 21831 75 --
NM_015336chr1232608 1030 151 1655 ----
NM_015338chr205652 428 341 115 98 --1778 --
NM_015339chr202819 406 148 ----
NM_015344chr842152 1914 326 136 ------
NM_015346chr1441665 1308 359 107 11317 --1380
NM_015347chr12122933 2768 2730 2514 2443 2273 1921 1903 1154 818 691 353 21998 466 --12177
NM_015349chr632780 1096 1042 12762 ----
NM_015354chr91378 --1355 --
NM_015355chr172357 193 21558 515 1217 --
NM_015358chr2131189 483 230 ------
NM_015359chr842974 1968 850 248 ----1877
NM_015361chr23748 698 675 ------
NM_015365chrX73048 2869 2642 1468 994 746 538 33945 2802 2755 1563 --
NM_015375chr1114992 4934 4821 4168 3894 3784 3618 3043 964 380 26 11619 23964 728 --
NM_015385chr1062740 1219 1123 960 771 749 23078 2947 ----
NM_015387chr22490 425 11621 ----
NM_015393chr483243 2930 2845 1379 1257 1195 713 192 13662 --1300
NM_015396chr3----1306 --
NM_015397chr961416 1183 344 290 156 43 ------
NM_015409chr1242695 1966 1820 1018 32488 2384 2041 1855 --
NM_015412chr362930 2625 2356 2047 1973 1082 1860 12429 --
NM_015416chr122739 688 ------
NM_015419chrX2435 213 1265 ----
NM_015429chr321133 384 ----11047
NM_015435chr831337 458 442 ----1572
NM_015436chr443243 2666 2118 880 21235 1132 ----
NM_015443chr1751484 949 452 412 138 11300 ----
NM_015446chr1--11324 --1437
NM_015448chr10------1178
NM_015455chr583974 3049 2648 1641 1526 1484 624 384 23859 179 23386 3171 1839
NM_015457chr11--11105 ----
NM_015458chr8124689 4582 3563 3447 1757 1690 1176 1106 565 339 325 79 14552 23941 213 23378 419
NM_015460chr321424 201 ------
NM_015461chr182722 63 ------
NM_015463chr23790 548 339 ------
NM_015465chr52788 496 --188 --
NM_015470chr221199 864 ------
NM_015475chr22981 153 ------
NM_015477chr152933 740 ----1369
NM_015481chr122684 403 ------
NM_015483chr721015 745 ------
NM_015488chr281398 1301 1187 1172 1128 620 515 499 --11622 --
NM_015497chr1521152 1077 1254 ----
NM_015508chr351022 497 249 189 112 ------
NM_015509chr1221385 1374 --11309 --
NM_015514chr142419 194 --171 --
NM_015516chr1131397 1287 1204 ------
NM_015520chr342528 2127 1940 1875 --22766 320 11778
NM_015530chr22869 849 --1719 --
NM_015531chr111120 ------
NM_015534chr12990 153 ------
NM_015535chr283758 3245 3209 3066 2813 981 639 221 34083 3332 1587 13686 --
NM_015548chr62182 115 1382 ----
NM_015549chr14----1466 --
NM_015550chr783418 2918 2750 2508 1166 928 505 94 ----11427
NM_015554chr1542801 1029 293 57 22329 2206 1247 12454
NM_015564chr541154 983 975 546 13115 ----
NM_015567chr132362 216 ------
NM_015568chr2064076 3955 3838 3522 1623 111 11666 1247 --
NM_015569chr1114724 4452 4393 4100 4069 3810 1112 1005 924 430 260 --1409 1872
NM_015570chr72725 461 ------
NM_015575chr272356 2296 2255 1039 556 361 89 11430 22729 100 --
NM_015576chr362955 2465 2010 474 192 77 191 ----
NM_015577chr521751 1279 21403 1205 ----
NM_015578chr1921284 650 11744 11940 --
NM_015601chr102730 366 ------
NM_015602chr151836 1341 269 208 54 ------
NM_015605chr1071436 1136 1086 570 424 409 25 ------
NM_015609chr152892 2702 1863 789 692 22521 1044 ----
NM_015610chr772605 2279 1774 1136 781 337 59 182 1586 --
NM_015622chr71224 --141 --
NM_015626chr1721091 379 ------
NM_015630chr21398 --179 --
NM_015640chr1105276 5168 4943 4886 4071 3998 3957 1367 1120 261 35022 1611 484 12074 --
NM_015641chr721299 939 ------
NM_015646chr125340 274 175 166 78 21165 25 ----
NM_015652chr101214 ------
NM_015668chr82149 67 ------
NM_015678chr1351196 1093 680 429 163 21487 318 11371 --
NM_015686chrX1948 --11850 --
NM_015695chr641835 1757 768 457 ------
NM_015711chr191811 1619 1287 --
NM_015713chr873315 3128 2353 927 888 791 497 ------
NM_015716chr172641 500 ------
NM_015726chr181602 1296 1249 639 592 571 564 421 11714 31829 1305 100 --
NM_015832chr181160 ------
NM_015833chr2162194 1973 1600 1528 434 353 11841 ----
NM_015855chr113905 841 644 ------
NM_015866chr131231 1184 1021 ------
NM_015869chr3--155 ----
NM_015872chr121371 1306 --21243 1214 --
NM_015874chr41564 ------
NM_015878chr842222 1891 1376 588 22182 1841 11428 --
NM_015879chr18218284 7866 7272 6764 6538 6224 6136 5746 5689 3429 2842 2807 2585 2498 2372 2152 1969 1539 1343 727 339 57988 2996 2089 626 415 22977 1418 --
NM_015886chr8135623 5048 4696 4532 4521 4166 4001 3624 3585 2171 2084 1880 1034 11740 1737 --
NM_015888chr132365 1097 592 23274 633 ----
NM_015891chr631999 1418 458 21590 725 ----
NM_015902chr82799 632 ------
NM_015906chr154763 3966 1876 1400 181 --1967 --
NM_015907chr41259 --129 --
NM_015912chr872488 2422 2206 1830 1799 1747 205 ------
NM_015954chr121234 ------
NM_015955chr2244 36 1103 ----
NM_015975chrX3722 267 252 --11185 --
NM_015981chr522787 2600 12462 149 --
NM_015994chr142454 234 --1501 --
NM_015995chr1585451 4992 4185 1183 1136 950 881 306 34300 4292 568 53774 2044 1863 1050 326 --
NM_015999chr12184 147 1270 ----
NM_016003chr772605 2279 1774 1136 781 337 59 182 1586 --
NM_016009chr194587 4569 4160 3937 3227 3165 1650 1381 38 24105 3139 13392 21361 900
NM_016018chr852305 2048 1838 729 428 ------
NM_016019chr73889 416 394 ------
NM_016022chr13366 286 91 ------
NM_016023chr81850 22049 1541 21517 290 --
NM_016025chr1651744 807 509 238 109 ------
NM_016032chrX21254 1181 --2874 344 --
NM_016037chr11883 1296 2804 28 --
NM_016038chr72658 260 ------
NM_016041chr172128 92 ------
NM_016045chr2031185 670 341 ------
NM_016057chr1261293 1086 915 807 309 185 --21168 132 --
NM_016059chr62789 376 1292 ----
NM_016061chr221144 550 ------
NM_016063chr61559 1306 ----
NM_016072chr1231773 774 632 11737 ----
NM_016075chr1353169 2583 2336 2155 1960 12351 11220 --
NM_016076chr1103164 2876 2706 2574 2341 2171 1164 719 262 189 32886 2648 706 --1607
NM_016078chr172989 968 ------
NM_016079chr272041 1726 905 866 545 498 128 --11584 --
NM_016081chr462183 1686 1485 441 216 107 21587 624 ----
NM_016083chr683764 3388 3258 2617 1412 1181 557 185 --13114 23058 2611
NM_016089chr351879 1503 1336 785 365 --1391 --
NM_016096chr842108 1382 345 172 2307 195 ----
NM_016099chr851373 1064 268 220 146 --1195 --
NM_016100chr20272 31 ------
NM_016107chr541253 1014 428 364 ------
NM_016120chrX176 ----1471
NM_016123chr121896 --21100 476 1319
NM_016124chr131456 356 164 --11277 --
NM_016127chr83617 500 56 1510 ----
NM_016129chr42378 289 ------
NM_016131chr232324 2158 324 --171 --
NM_016132chr1522837 1262 12857 11347 --
NM_016133chr231602 1267 1130 ----11375
NM_016141chr3127 ------
NM_016147chr1131140 162 37 ------
NM_016151chr16145 ------
NM_016152chr341211 848 352 330 ------
NM_016156chr11102399 2081 1935 948 883 511 468 399 115 38 --22132 349 --
NM_016162chr122824 314 ------
NM_016166chr15389 75 68 ------
NM_016169chr1072681 1156 978 613 540 302 284 32731 2492 2287 11086 --
NM_016185chr172318 113 ------
NM_016195chr105826 818 730 702 651 --1104 --
NM_016200chr7--157 ----
NM_016205chr441340 1262 932 497 1909 --1143
NM_016206chr3208575 8381 8343 8234 7816 7419 7084 6735 6332 6278 5688 2970 2654 2341 1976 1820 1810 1645 567 359 48949 6819 2939 2389 11837 15892
NM_016216chr32598 60 1869 1613 --
NM_016217chr693561 3023 2927 2509 2430 2396 1102 239 118 22634 950 177 --
NM_016221chr552013 1465 609 557 326 ----11912
NM_016224chr641712 1702 1689 819 ------
NM_016226chr12194 1389 ----
NM_016227chr121228 441 ------
NM_016231chr1721678 69 --11690 --
NM_016235chr1631369 478 397 ------
NM_016248chr13103717 3536 3527 3349 3264 2640 1439 1332 1279 306 53880 3500 3117 2959 1454 22434 669 --
NM_016252chr23859 765 381 --1906 --
NM_016255chr683313 3181 2740 2681 2653 2420 2303 1145 1134 ----
NM_016260chr2177615 7476 7466 7259 5868 5057 5035 4939 2982 2681 2459 1725 1274 1116 948 398 164 25497 331 11556 25960 5536
NM_016261chr174775 753 658 521 --1330 --
NM_016272chr2232096 900 114 11113 ----
NM_016275chr33859 572 196 32798 2612 2588 ----
NM_016277chr661356 1224 599 373 141 97 ------
NM_016279chr5171 ------
NM_016281chr1251103 1032 289 124 108 ------
NM_016282chr931715 1556 1323 ------
NM_016283chr5284 31 ------
NM_016287chr121908 1628 ------
NM_016289chr232028 1921 69 --11955 --
NM_016293chr12--1458 ----
NM_016300chr31128 ------
NM_016306chr3122 ------
NM_016315chr221763 650 1392 ----
NM_016316chr2--1667 ----
NM_016320chr112748 89 --1327 --
NM_016322chr953169 2033 1046 929 125 11140 22486 691 --
NM_016329chr33383 132 96 --1356 --
NM_016337chr141194 ------
NM_016338chr511035 1955 ----
NM_016339chr1741587 1352 1130 599 --2212 59 --
NM_016357chr123422 183 125 1969 11213 --
NM_016374chr12153 52 11600 125 --
NM_016374chr12153 52 11600 125 --
NM_016376chr17104251 3154 2955 1522 1184 798 782 708 441 57 11361 43380 1569 751 286 --
NM_016395chr1551883 685 451 407 216 --11350 --
NM_016396chr1562784 2725 2205 2156 399 282 ----12124
NM_016401chr11--131 ----
NM_016403chr113618 608 192 ----152
NM_016422chr1173029 2699 2689 2584 803 341 113 1132 1981 --
NM_016424chr1752048 1923 1474 538 468 11858 11232 158
NM_016436chr201553 --12184 1184
NM_016441chr262258 2249 1677 671 182 147 1418 ----
NM_016442chr542112 734 568 558 ------
NM_016447chr71217 ------
NM_016448chr141474 276 248 102 21873 1356 ----
NM_016451chr11177 ------
NM_016470chr202173 160 --184 --
NM_016472chr1431517 1401 427 21304 194 --1380
NM_016475chr1441174 1119 194 185 ------
NM_016476chr171150 ------
NM_016485chr662264 2075 614 484 380 59 ------
NM_016488chr1251710 1481 1357 425 376 --11571 --
NM_016499chr111523 ------
NM_016505chr12657 507 ------
NM_016507chr1753063 2730 845 719 591 ----1664
NM_016513chr652950 2528 1359 302 113 --31446 623 584 --
NM_016516chr22326 241 ------
NM_016522chr1121298 165 1640 31337 452 367 --
NM_016526chr1132447 2234 2185 1544 ----
NM_016530chr15103761 3264 2883 2604 1487 890 772 653 352 292 12892 --13609
NM_016531chr494243 4058 3640 3354 2887 2768 527 407 223 13872 ----
NM_016538chr17----133 --
NM_016542chrX2656 360 ------
NM_016545chr11592 ------
NM_016569chr1241232 1003 452 213 --156 --
NM_016574chr1121066 891 11105 1177 1877
NM_016577chr344377 4005 517 181 24107 583 ----
NM_016578chr11--1174 ----
NM_016582chr11285 33 ------
NM_016587chr721053 355 1184 ----
NM_016598chr351470 1461 962 323 105 ------
NM_016603chr532136 2067 321 1864 ----
NM_016604chr551259 886 508 296 141 ------
NM_016605chr562656 2355 2202 2041 636 600 ------
NM_016607chrX----21663 679 --
NM_016618chr2184 1548 ----
NM_016621chr1194014 3847 3823 3391 3189 1771 1649 279 184 24220 3179 22958 667 12847
NM_016623chr8145 ----1194
NM_016625chr3184 ------
NM_016626chr1831597 495 369 ------
NM_016628chr102665 92 1600 ----
NM_016631chr213949 670 221 ------
NM_016639chr16155 ------
NM_016644chr52550 70 1373 ----
NM_016652chr2051678 1155 541 389 280 ------
NM_016654chr1541333 1182 899 204 1144 ----
NM_016823chr172961 936 --41091 975 380 117 1509
NM_016824chr1051560 1507 710 581 231 ------
NM_016830chr122366 59 1561 ----
NM_016834chr1743300 3061 2698 1355 34160 4020 350 1978 --
NM_016835chr1743300 3061 2698 1355 34160 4020 350 1978 --
NM_016841chr1743300 3061 2698 1355 34160 4020 350 1978 --
NM_016929chr684164 3988 3791 1776 1361 1350 601 102 13873 1552 --
NM_016931chr11--160 ----
NM_016932chr22820 269 1636 ----
NM_016938chr111399 --1360 --
NM_016950chr431272 582 291 ------
NM_016952chr1174110 3764 3012 2867 2750 1290 854 13338 --1753
NM_016953chr295784 5281 5215 4966 4356 1578 1484 264 226 21439 320 16012 --
NM_016954chrX2636 495 ------
NM_017409chr122755 540 --1306 --
NM_017412chr831072 1063 450 --1368 --
NM_017413chrX52504 2131 1597 567 252 ------
NM_017415chr574347 3881 3704 3103 590 201 124 32911 1593 57 21748 1173 --
NM_017420chr1453439 3309 2931 1289 98 31460 948 618 --11339
NM_017423chr482201 1929 1903 1373 686 279 216 98 ------
NM_017437chr1451546 824 790 564 182 166 ----
NM_017440chr122655 591 2489 108 ----
NM_017443chr91976 1246 11120 --
NM_017447chr2174374 3830 2829 1285 451 444 167 22673 62 1964 --
NM_017452chr2021451 1219 1967 ----
NM_017453chr2021451 1219 1967 ----
NM_017454chr2021451 1219 1967 ----
NM_017455chr151380 ------
NM_017456chr1722034 1621 --21583 493 --
NM_017483chr231288 1062 1017 --1490 --
NM_017488chr231623 1397 1352 ------
NM_017489chr811280 11177 ----
NM_017491chr4------1990
NM_017516chr1141108 365 246 239 ------
NM_017519chr61277 ------
NM_017522chr121243 229 --156 --
NM_017544chrX3903 671 153 ------
NM_017545chr201373 1453 ----
NM_017548chr332178 559 246 1674 ----
NM_017551chr1062629 2404 2194 2164 1056 239 ----1290
NM_017553chr152342 160 1352 ----
NM_017563chr3136323 5939 4996 4797 4610 3895 2185 2176 1479 419 365 356 31 45138 4177 1557 213 11705 --
NM_017567chr21120 ------
NM_017580chr1062268 2036 1972 1593 757 436 --12293 11725
NM_017582chr151499 1312 1265 256 125 ------
NM_017588chr961944 1917 1443 1399 1338 443 ------
NM_017590chr2242579 2096 1926 1884 --22717 1015 --
NM_017593chr42503 321 ------
NM_017594chr983296 3044 3002 2869 1340 1175 689 493 22096 1033 32741 1012 181 --
NM_017596chr1104360 3956 3295 3185 3096 2926 1404 884 671 35 --23407 503 --
NM_017610chr1521901 123 22123 781 ----
NM_017612chr122370 38 ------
NM_017628chr4144984 4726 3797 3605 3467 3272 3240 2119 1745 1730 1407 1210 1120 424 14623 24311 4213 --
NM_017629chr161609 1469 1446 1348 496 146 ------
NM_017632chr41131 ------
NM_017633chr643792 3704 2573 1365 --23202 1558 12647
NM_017634chr851870 1236 768 703 56 1187 11658 --
NM_017635chr111618 1220 --11286
NM_017637chr9169321 8475 7827 7785 7577 6865 5949 3775 3488 3091 2700 2531 1393 999 821 132 22772 2441 --27341 6856
NM_017640chr61851 1824 ----
NM_017641chr1241067 285 243 46 ------
NM_017643chr1763086 2420 2050 973 641 85 32199 1912 829 1598 --
NM_017644chr3104880 4307 3770 3697 3472 1934 1461 1361 1117 442 ----11744
NM_017649chr1031215 1107 410 --11052 --
NM_017650chr795936 3674 2285 1889 1679 1496 1406 560 172 --32160 946 604 --
NM_017658chr14114442 3964 3708 3422 3389 1252 1154 839 256 250 236 24406 1348 12919 --
NM_017660chr1943118 2720 2356 1240 13427 ----
NM_017661chr1521266 127 ------
NM_017664chr133943 410 234 ------
NM_017666chrX31897 1682 1405 21935 850 ----
NM_017667chr73575 360 107 ------
NM_017668chr163881 743 731 1233 ----
NM_017672chr152285 62 ------
NM_017676chr52220 102 1119 ----
NM_017680chr9--1915 1311 --
NM_017686chr12959 755 ----1187
NM_017693chr13--21167 569 ----
NM_017694chr222026 1907 ------
NM_017709chr1103864 3581 3551 3339 1724 1353 1347 1321 1192 310 22772 114 1991 11263
NM_017715chr73566 539 288 ------
NM_017719chr341970 806 413 183 2618 403 ----
NM_017721chr191326 ------
NM_017730chr33707 214 156 --1684 --
NM_017737chr142139 2079 1361 358 --1554 --
NM_017741chr472578 1891 969 950 813 692 547 --1207 --
NM_017742chr183520 506 419 11894 1459 --
NM_017744chr152143 2053 1661 1521 879 --1954 --
NM_017745chrX--1649 ----
NM_017752chrX5817 683 647 343 180 --11772 --
NM_017753chr91352 --1876 --
NM_017754chr694731 4414 4153 3716 1918 1469 1373 927 566 25021 3865 11849 --
NM_017769chr1472622 2528 1121 909 787 478 260 ----188
NM_017772chr621589 544 ------
NM_017779chr182501 2419 2211 1931 1738 502 479 324 22600 41 ----
NM_017780chr83831 757 265 ------
NM_017784chr31935 --31213 359 167 --
NM_017786chr8195 ------
NM_017798chr201326 2410 41 --1466
NM_017799chr1421539 193 150 ----
NM_017810chr16191 ------
NM_017811chr992683 2446 2207 1985 1024 695 603 555 223 22970 676 12397 --
NM_017813chr875815 5249 5022 2257 1970 1092 794 11901 24797 963 13646
NM_017816chr41173 --133 --
NM_017819chr32217 204 ------
NM_017824chr1052670 2357 2002 874 623 ------
NM_017826chr132279 26 ------
NM_017831chr1854682 4344 1472 1176 311 24117 3080 43559 1693 1278 570 14029
NM_017842chr122697 63 ------
NM_017845chr43779 750 566 1681 --1847
NM_017848chrX84264 4254 4244 3772 3282 3188 1682 1181 ----23267 1633
NM_017849chr2122965 2864 1999 1274 853 822 789 521 442 210 142 46 11225 12305 --
NM_017851chr152898 209 ------
NM_017860chr11618 ------
NM_017870chr111224 ------
NM_017873chr951046 614 571 489 182 --21112 740 --
NM_017880chr23436 428 152 ------
NM_017887chr1152 ------
NM_017893chr1041168 1091 549 369 11222 ----
NM_017899chr12----134 --
NM_017901chr12152 ------
NM_017910chr21264 ------
NM_017913chr93335 92 75 ------
NM_017915chr1231040 979 780 1770 ----
NM_017919chr995772 4495 2300 2075 2008 1850 1843 1393 1180 52027 1944 1749 1731 295 ----
NM_017922chr142594 502 ------
NM_017923chr43683 322 135 ------
NM_017926chr142873 61 ------
NM_017938chrX52068 1975 1487 323 215 ------
NM_017943chr1421016 96 ------
NM_017944chr1162974 2733 2237 2084 2062 608 13106 22560 822 --
NM_017945chr331267 1033 998 ----181
NM_017953chr151141 971 942 476 55 ------
NM_017954chr731682 641 272 21311 549 ----
NM_017964chr24946 379 95 70 ------
NM_017969chr22173 32 --1229 --
NM_017972chr142873 61 ------
NM_017974chr241042 1028 829 454 1273 ----
NM_017987chr1062026 1901 1380 888 364 319 ------
NM_017988chr121725 ----1789
NM_017994chr762693 2345 1202 791 635 83 21985 1109 ----
NM_018011chr132145 45 1541 ----
NM_018017chr1042153 898 86 77 32805 2009 638 11033 --
NM_018027chr1043164 754 314 220 1784 1277 1145
NM_018028chr1921248 128 --1544 --
NM_018045chr172830 2614 2441 2119 1049 119 70 11920 22755 202 --
NM_018046chr511385 --11876 --
NM_018051chr71115 ------
NM_018060chr11360 --1398 --
NM_018061chr131412 661 512 31582 1117 432 11256 --
NM_018072chr1125 ------
NM_018078chr411079 ------
NM_018079chr22218 136 1541 ----
NM_018084chr232324 2310 2224 11309 ----
NM_018085chr1118125 7682 7625 6873 6002 2404 1869 1018 520 483 82 26968 2927 56373 6136 5245 2695 1205 --
NM_018086chr221497 1342 --1321 --
NM_018087chr1172 ------
NM_018092chr1641089 1072 353 196 ------
NM_018094chrX168 ------
NM_018098chr311210 2847 460 ----
NM_018107chr144957 801 194 61 ------
NM_018110chr1631408 1239 259 ----2915 471
NM_018112chr91228 ------
NM_018119chr161281 ------
NM_018121chr1032150 2082 796 --12315 11944
NM_018128chr171224 --21421 1172 --
NM_018131chr102777 577 --1690 --
NM_018133chr32620 267 1733 --1688
NM_018137chr131179 948 157 11398 ----
NM_018144chr10------147
NM_018154chr19186 1232 ----
NM_018155chr373415 3236 2680 1279 1200 1115 858 12730 ----
NM_018157chr1242586 2467 575 506 12546 --1755
NM_018159chrX51377 316 304 188 175 ------
NM_018168chr1451128 998 542 235 53 188 1106 --
NM_018181chr1841947 1761 1644 229 ------
NM_018182chr1732204 2179 109 1462 ----
NM_018184chr331778 1508 629 --1324 --
NM_018191chr1352108 2075 1943 87 35 ------
NM_018193chr152647 29 ------
NM_018195chr1132173 1488 805 ------
NM_018199chr1431226 879 262 11068 ----
NM_018200chr1532045 421 243 --11892 --
NM_018202chr12276 253 ------
NM_018203chr1148 1231 1840 --
NM_018208chr151137 793 261 216 147 --1154 --
NM_018211chr11666 1299 11576 --
NM_018222chr1131457 1202 383 31346 559 389 ----
NM_018227chr452915 1282 1254 1057 705 22238 229 12586 11192
NM_018229chr1451020 977 966 960 868 --1891 --
NM_018237chr101250 ------
NM_018240chr13310 248 176 ------
NM_018241chr44816 401 379 329 ------
NM_018243chr473745 3648 2934 1513 985 219 204 ----12609
NM_018246chr83774 371 336 1316 32804 1888 941 11918
NM_018247chr673131 1920 1054 1017 931 868 240 ------
NM_018257chr2042562 2169 2017 1037 1292 ----
NM_018265chr141799 1599 530 362 --1355 --
NM_018287chr103955 853 114 1252 ----
NM_018293chr362884 2559 1818 1098 774 703 ------
NM_018299chr842737 2696 2399 1274 --2885 154 159
NM_018307chr172795 352 ----154
NM_018312chr1121772 59 21387 372 1107 --
NM_018313chr342460 720 531 152 ------
NM_018314chr111712 1152 ----
NM_018315chr441355 633 360 239 11258 ----
NM_018317chr4293 70 ------
NM_018319chr1441544 1515 206 132 ------
NM_018323chr431389 607 294 ------
NM_018325chr951256 1117 562 396 101 ------
NM_018328chr21408 ------
NM_018330chr1041695 1583 1278 349 --1302 --
NM_018332chr1621331 227 1935 ----
NM_018334chr71441 ------
NM_018339chr921410 99 1724 1438 --
NM_018361chr893978 3449 3351 2515 1110 1016 540 352 245 1702 1911 --
NM_018362chr1193561 3195 2572 978 597 412 325 222 181 34037 3899 531 12964 --
NM_018364chr153729 1487 1015 769 583 11455 ----
NM_018370chr1232313 645 312 21976 544 11596 --
NM_018371chr82635 31 ------
NM_018374chr755215 1803 1501 1231 55 --21122 170 --
NM_018383chr221268 547 31713 676 654 21423 566 --
NM_018387chr92513 452 ------
NM_018388chrX31176 355 287 ------
NM_018400chr1194510 4380 4106 3448 3344 1303 392 333 220 21477 1382 44132 3035 1030 519 --
NM_018403chr383950 3866 3229 2995 680 469 332 156 23372 2692 1901 1863
NM_018416chr1262147 1760 1633 806 550 187 ------
NM_018419chr201372 --180 --
NM_018423chr122775 276 ------
NM_018424chr931726 511 196 2708 675 ----
NM_018425chr1062235 2091 2050 1955 985 340 12479 ----
NM_018429chr522300 873 12286 22139 775 1190
NM_018433chr21128 172 ----
NM_018440chr8178044 7947 7891 7531 7506 6916 6864 6774 6652 5881 5729 3101 2784 1932 1674 1514 1164 26550 2192 16173 17698
NM_018445chr153467 202 21 ------
NM_018448chr122825 113 21293 1018 ----
NM_018466chrX2568 21 ------
NM_018469chr172485 415 ------
NM_018471chr22171 112 ------
NM_018477chr143858 159 129 --3380 307 119 --
NM_018482chr82513 361 11642 ----
NM_018488chr17171 2641 587 ----
NM_018489chr121906 1515 --21944 1788 --
NM_018490chr11--11326 ----
NM_018509chr1731463 1439 1191 --1656 --
NM_018534chr22141 71 ------
NM_018557chr241525 1160 487 366 ------
NM_018566chr153501 1607 1278 1025 54 31408 1169 531 23652 1145 --
NM_018571chr23600 239 40 --1142 --
NM_018584chr141186 1128 420 194 1984 --187
NM_018593chr61209 1547 ----
NM_018602chr1551705 1549 655 292 124 ----11468
NM_018638chr12155667 4502 3836 3497 3470 2159 2152 1894 1754 1712 1338 480 420 315 91 --12218 --
NM_018640chr1252806 2763 950 693 43 ------
NM_018650chr132105 1807 1699 1741 1373 --
NM_018652chr154822 727 395 40 ------
NM_018657chr33846 652 628 ------
NM_018660chr862346 776 739 306 123 22 22473 835 ----
NM_018667chr16102463 2401 1962 1093 850 770 711 317 233 157 ------
NM_018685chr731076 834 380 1310 --11018
NM_018686chr12----1233 --
NM_018689chr1542286 2237 2103 239 1583 1343 --
NM_018695chr572303 2092 2041 1717 1688 1681 539 12432 ----
NM_018703chr161382 ------
NM_018704chr151982 1770 1657 868 421 2794 482 21318 831 --
NM_018710chr84537 281 128 60 --1100 --
NM_018712chr1111571 --31270 524 366 1450
NM_018713chr11117 --142 --
NM_018717chr462820 2687 2529 2446 663 511 11119 --12783
NM_018719chr731129 933 235 --11412 --
NM_018728chr1561548 1331 1115 608 226 24 ------
NM_018834chr52236 108 ------
NM_018837chr202153 132 --1675 --
NM_018846chr71719 1854 ----
NM_018847chr91347 11428 --1168
NM_018890chr73371 292 223 ------
NM_018898chr552265 2090 2056 1461 783 --1216 --
NM_018899chr552265 2090 2056 1461 783 --1216 --
NM_018900chr552265 2090 2056 1461 783 --1216 --
NM_018901chr552265 2090 2056 1461 783 --1216 --
NM_018902chr552265 2090 2056 1461 783 --1216 --
NM_018903chr552265 2090 2056 1461 783 --1216 --
NM_018904chr552265 2090 2056 1461 783 --1216 --
NM_018905chr552265 2090 2056 1461 783 --1216 --
NM_018906chr552265 2090 2056 1461 783 --1216 --
NM_018907chr552265 2090 2056 1461 783 --1216 --
NM_018908chr552265 2090 2056 1461 783 --1216 --
NM_018909chr552265 2090 2056 1461 783 --1216 --
NM_018910chr552265 2090 2056 1461 783 --1216 --
NM_018911chr552265 2090 2056 1461 783 --1216 --
NM_018912chr521744 1158 ------
NM_018913chr521744 1158 ------
NM_018914chr521744 1158 ------
NM_018915chr521744 1158 ------
NM_018916chr521744 1158 ------
NM_018917chr521744 1158 ------
NM_018918chr521744 1158 ------
NM_018919chr521744 1158 ------
NM_018920chr521744 1158 ------
NM_018921chr521744 1158 ------
NM_018922chr521744 1158 ------
NM_018923chr521744 1158 ------
NM_018924chr521744 1158 ------
NM_018925chr521744 1158 ------
NM_018926chr521744 1158 ------
NM_018927chr521744 1158 ------
NM_018928chr521744 1158 ------
NM_018929chr521744 1158 ------
NM_018940chr52424 106 1788 ----
NM_018944chr211720 --125 --
NM_018945chr663435 2268 1217 760 565 95 --32860 2811 641 --
NM_018947chr744581 3300 1624 664 24486 1535 44166 3740 3356 3248 14004
NM_018948chr12566 181 ------
NM_018951chr721161 69 ------
NM_018953chr121814 ------
NM_018955chr17145 ------
NM_018958chr1563991 3643 2859 2634 1458 1128 23284 3091 ----
NM_018963chr211176 2952 187 169 --
NM_018970chr742217 635 529 305 --1130 12003
NM_018975chr162814 132 1509 1776 --
NM_018976chr1272780 1961 1063 960 769 758 474 ------
NM_018979chr1262558 2513 1898 789 766 656 ----12412
NM_018983chr4----1228 --
NM_018999chr1054735 4292 4136 3990 3532 54656 4563 4356 3693 1718 1668 --
NM_019000chr531373 1076 577 11459 ----
NM_019001chr363341 1317 682 313 189 149 ----11022
NM_019004chr772336 2306 2049 936 885 413 286 178 ----
NM_019005chr73379 286 125 1325 ----
NM_019018chr53715 620 230 ------
NM_019