TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-764
miRNA Sequence: GCAGGUGCUCACUUGUCCUCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51289 ------
NM_000020chr1241960 1925 357 224 --22392 124 --
NM_000032chrX244 33 ------
NM_000037chr872274 2186 1882 878 577 540 441 1910 ----
NM_000038chr531855 1808 1407 1691 ----
NM_000051chr1143486 3328 262 248 23551 1168 1398 --
NM_000052chrX32916 2346 968 --13334 --
NM_000074chrX1897 ------
NM_000081chr12138 33 ------
NM_000084chrX166732 6542 6200 6078 5789 5721 5616 5046 4707 2665 2198 1839 1757 1438 1376 1091 --14730 --
NM_000088chr1731323 1133 288 ------
NM_000089chr73761 318 240 ------
NM_000092chr274542 4327 4018 3150 2976 1574 979 --11094 --
NM_000103chr153811 444 169 11132 1428 --
NM_000109chrX22001 824 11981 ----
NM_000115chr133934 252 231 ------
NM_000118chr93659 618 359 1687 ----
NM_000125chr644224 4206 3760 385 --14258 --
NM_000138chr1542357 2006 1956 412 ------
NM_000141chr1041144 482 249 97 ------
NM_000142chr431597 457 190 ----1549
NM_000163chr51676 ------
NM_000165chr62659 503 ------
NM_000167chrX1121 ------
NM_000176chr5102920 2593 1383 1174 938 851 702 664 304 115 ------
NM_000178chr201121 1141 ----
NM_000188chr102212 38 ------
NM_000194chrX3447 89 33 ------
NM_000210chr242081 736 542 531 ------
NM_000213chr171240 ------
NM_000214chr2041684 1455 1186 186 ------
NM_000216chrX63690 3238 3003 2854 828 580 1844 1163 --
NM_000217chr1294958 4441 4173 3651 3270 2092 2058 1139 601 13553 ----
NM_000222chr451832 1677 1323 681 479 1342 21366 668 --
NM_000227chr183344 313 61 ------
NM_000245chr722179 2040 1297 ----
NM_000248chr342961 2656 2329 989 171 ----
NM_000253chr41105 ------
NM_000255chr61348 197 ----
NM_000259chr1531077 1063 766 --34189 3986 1194 --
NM_000264chr921260 837 13270 ----
NM_000266chrX1891 ------
NM_000267chr1743048 2764 2650 102 22235 644 11331 --
NM_000280chr111863 ------
NM_000291chrX3155 69 62 ------
NM_000293chr162739 627 2768 726 ----
NM_000297chr452052 1862 1443 717 137 ------
NM_000304chr171822 1396 ----
NM_000314chr1063014 1154 1017 965 277 177 --1420 --
NM_000329chr13845 806 328 ------
NM_000330chrX22174 1461 --123 --
NM_000332chr6116813 6459 5797 5551 4635 4419 2744 2008 1721 1390 1155 35071 2100 1378 24861 2451 --
NM_000335chr332193 1914 1587 1532 ----
NM_000337chr596533 5945 5906 5734 5568 5059 2492 2165 1276 22273 292 11250 14592
NM_000345chr411046 --1155 --
NM_000346chr1751913 1611 1585 1243 225 ------
NM_000359chr141159 ------
NM_000361chr2051754 610 470 407 76 1597 22134 1905 --
NM_000362chr2242895 2307 746 227 11232 1119 12260
NM_000368chr943801 3743 872 549 24133 3529 14187 23957 854
NM_000376chr1273163 1999 934 924 592 419 381 12042 1774 --
NM_000382chr1741884 1538 731 675 ------
NM_000389chr631153 473 340 ------
NM_000396chr13579 531 67 ------
NM_000399chr101463 ------
NM_000408chr223005 2502 12296 1259 --
NM_000430chr1733236 2875 2868 ------
NM_000436chr511557 11109 ----
NM_000439chr541757 836 757 122 ------
NM_000441chr711668 12188 11797 --
NM_000448chr1143056 2270 731 691 ------
NM_000449chr151505 1149 568 470 230 --2155 72 --
NM_000452chr1311756 ------
NM_000461chr343212 2880 1679 1269 ----1865
NM_000462chr1521642 283 ------
NM_000476chr941412 438 232 83 11356 ----
NM_000484chr211715 ------
NM_000486chr1262453 2324 2236 2091 1027 701 12725 13084 12161
NM_000489chrX13010 12969 ----
NM_000492chr721529 252 ------
NM_000494chr10154 --1825 --
NM_000495chrX2993 169 ------
NM_000522chr71403 --11222 --
NM_000525chr1121526 1202 --2442 141 --
NM_000527chr1962168 1634 1620 820 546 127 21801 1659 ----
NM_000530chr12700 413 1449 ----
NM_000533chrX41784 745 306 188 11669 1699 --
NM_000555chrX47570 5344 1331 373 1777 26824 1703 --
NM_000572chr14645 631 241 112 1674 1766 --
NM_000575chr23938 913 26 ------
NM_000578chr241713 1264 233 189 --41608 1421 307 254 --
NM_000598chr71195 ------
NM_000599chr273556 3317 2988 1297 1243 620 64 24455 1421 ----
NM_000609chr1083128 2989 2611 2307 1100 789 616 404 22339 771 11977 --
NM_000610chr1153022 2206 2042 990 253 ------
NM_000612chr1173725 3439 3179 3128 2568 1536 207 23693 2884 13513 --
NM_000615chr1142334 1033 378 232 12823 11043 --
NM_000618chr12106394 4150 2630 2492 1284 1206 591 426 186 68 ------
NM_000618chr12106394 4150 2630 2492 1284 1206 591 426 186 68 ------
NM_000619chr121458 ------
NM_000621chr1311210 21379 1239 ----
NM_000633chr18125183 4764 4581 4525 4358 3344 1823 1368 780 609 490 341 23173 402 ----
NM_000671chr42523 73 --1550 --
NM_000675chr221254 --1294 --
NM_000684chr101301 --11228 --
NM_000689chr9145 ------
NM_000719chr1285923 5385 4415 4175 4143 2484 569 282 56552 5981 4253 2321 2020 1243 24955 1067
NM_000723chr1761633 1320 1231 1184 305 203 174 11452 --
NM_000724chr1022015 456 21922 274 11769 21777 414
NM_000725chr121255 ------
NM_000739chr72184 97 ------
NM_000750chr153598 297 51 1669 ----
NM_000782chr2031276 169 111 --1199 --
NM_000793chr141637 2344 308 ----
NM_000794chr51660 ------
NM_000801chr202939 131 ------
NM_000806chr5178 1719 ----
NM_000809chr466683 6539 5737 2736 1908 775 38681 7889 1729 12908 --
NM_000813chr535444 2038 1819 --1827 --
NM_000814chr1593895 3522 3393 3326 3318 775 723 644 78 13646 ----
NM_000816chr51586 ------
NM_000817chr2--1464 1977 --
NM_000824chr41144 ------
NM_000826chr422435 2012 2487 407 21756 1668 --
NM_000827chr532089 990 654 --22459 903 --
NM_000829chr1112189 12052 ----
NM_000831chr1135668 5517 5025 4347 4242 4194 4167 2287 1700 435 281 146 113 35806 4320 4137 15181 --
NM_000834chr1221110 444 1879 ----
NM_000839chr31474 ------
NM_000840chr71104 --1477 --
NM_000844chr32424 404 1414 ----
NM_000860chr411059 11393 1122 --
NM_000861chr322149 1767 --193 --
NM_000868chrX31793 960 520 12099 ----
NM_000875chr1576610 6483 5799 5533 2217 1490 103 1453 16103 22687 282
NM_000876chr641227 286 230 50 --11078 --
NM_000885chr221349 850 1857 ----
NM_000891chr1763481 2586 1379 1271 1258 850 ------
NM_000901chr421972 107 ------
NM_000912chr882591 2399 2343 2318 2269 1242 313 210 1559 23563 795 --
NM_000922chr111177 ------
NM_000924chr123878 193 83 2174 123 ----
NM_000933chr20--1661 ----
NM_000944chr422053 896 --11478 --
NM_000945chr231604 1477 198 ------
NM_000949chr51141 ------
NM_000950chrX73334 3201 3044 725 359 129 64 13136 ----
NM_000956chr142940 169 11113 138 --
NM_000964chr1721160 98 --21358 882 --
NM_000965chr32929 37 ------
NM_000971chr8----152 --
NM_001001323chr1232917 1036 410 ------
NM_001001331chr352684 2532 2046 1991 1668 12091 ----
NM_001001389chr1153022 2206 2042 990 253 ------
NM_001001390chr1153022 2206 2042 990 253 ------
NM_001001391chr1153022 2206 2042 990 253 ------
NM_001001392chr1153068 2252 2088 1036 299 ------
NM_001001394chr21567 ------
NM_001001395chr1262708 2673 2365 1980 692 261 --1153 --
NM_001001396chr174507 3786 3512 3440 1788 1356 546 21175 423 ----
NM_001001419chr574982 4192 3592 1331 1317 941 853 43629 3472 3415 1493 13481 --
NM_001001420chr574982 4192 3592 1331 1317 941 853 43629 3472 3415 1493 13481 --
NM_001001433chr2073115 2589 2540 2226 2104 1126 420 ------
NM_001001481chr833066 2435 56 ------
NM_001001483chr11----1418 --
NM_001001522chr11194 --1148 --
NM_001001549chr752613 2581 1853 908 865 22590 2256 21050 98 --
NM_001001550chr752613 2581 1853 908 865 22590 2256 21050 98 --
NM_001001555chr752613 2581 1853 908 865 22590 2256 21050 98 --
NM_001001556chr1531638 1162 40 ------
NM_001001557chr82477 186 ------
NM_001001664chr233616 2971 844 33923 1457 1081 1443 --
NM_001001668chr19104252 4205 3616 3569 1554 1297 716 595 89 34 33596 515 217 ----
NM_001001740chr1148 ------
NM_001001740chr1148 ------
NM_001001787chr11340 ------
NM_001001877chrY1260 ----129
NM_001001890chr2173217 1722 1521 1422 503 475 250 23350 1225 ----
NM_001001928chr2297031 6873 6684 5564 5479 1974 1624 625 421 36229 5248 2003 11708 --
NM_001001933chr11404 ------
NM_001001938chr943501 3420 2871 528 --44047 3907 3834 2607 13230
NM_001001971chr102321 106 ------
NM_001001974chr101231 12229 ----
NM_001002033chr172514 112 ------
NM_001002233chr832226 2042 50 1400 21719 1418 --
NM_001002243chr2172 ------
NM_001002257chr242490 2333 608 139 23371 2927 13414 --
NM_001002259chr121250 ------
NM_001002295chr101201 --2962 327 --
NM_001002296chr83500 262 163 ------
NM_001002762chr1062953 2841 2384 721 715 673 22404 1158 12463 --
NM_001002814chr852907 2816 2777 1045 50 21074 400 11418 --
NM_001002837chr222205 65 --1103 --
NM_001002843chr152377 132 ------
NM_001002860chr14114547 4310 4191 3647 3459 1815 1648 1087 859 847 261 --33387 301 199 --
NM_001002909chr1761990 1922 1815 657 553 420 21938 1793 1405 --
NM_001002926chr712686 1961 ----
NM_001003406chr2282809 2531 2003 1236 1210 947 818 95 --33244 2818 1158 12549
NM_001003407chr1055042 3505 3343 1430 182 ------
NM_001003408chr1055042 3505 3343 1430 182 ------
NM_001003652chr18118651 8613 2692 2610 1764 1612 1512 1345 1218 433 142 11980 --1120
NM_001003665chr123504 436 --1160 --
NM_001003674chr1876908 5461 5288 2520 2444 654 197 26933 6094 15595 14906
NM_001003675chr1876908 5461 5288 2520 2444 654 197 26933 6094 15595 14906
NM_001003681chr2251974 1548 1415 414 334 ------
NM_001003688chr41352 1755 ----
NM_001003698chr621507 576 ----11538
NM_001003699chr621507 576 ----11538
NM_001003712chr1223873 3437 23786 308 1750 --
NM_001003760chr633101 1268 1216 21260 364 ----
NM_001003800chr983452 2852 1275 1133 1010 293 159 36 --1486 12468
NM_001003943chr1543460 3262 1273 726 2552 509 1581 --
NM_001004304chr1232108 676 543 ----1749
NM_001004317chr694402 4128 4058 3419 2808 2791 1648 1484 645 14332 14044 --
NM_001004360chr23581 431 375 ------
NM_001004419chr1254221 1805 928 265 241 ------
NM_001004439chr1511149 --1146 1120
NM_001005207chr17------128
NM_001005271chr171270 ------
NM_001005273chr171270 ------
NM_001005290chr1----2446 23 --
NM_001005360chr191231 ------
NM_001005361chr191231 ------
NM_001005362chr191231 ------
NM_001005366chr121237 ------
NM_001005404chr1753580 3208 1562 1071 87 ------
NM_001005463chr1042510 2447 2423 942 ------
NM_001005473chr536062 4215 2341 --11942 --
NM_001005474chr311049 1234 ----
NM_001005476chr2--1513 ----
NM_001005502chr1263614 1658 1107 1087 444 35 43783 3643 1749 1345 44942 3739 983 558 --
NM_001005611chrX1489 ------
NM_001005619chr171240 ------
NM_001005739chr21713 2657 32 ----
NM_001005782chr21120 ------
NM_001005845chr821290 362 21273 386 ----
NM_001005861chr31862 2994 54 ----
NM_001005920chr161114 1739 1685 --
NM_001006115chr322057 2047 --42406 660 635 618 --
NM_001006600chr531747 1716 1535 ------
NM_001006610chr163743 242 69 ------
NM_001006612chrX1141 ------
NM_001006613chrX1141 ------
NM_001006614chrX1141 ------
NM_001006626chr72184 97 ------
NM_001006627chr72184 97 ------
NM_001006628chr72184 97 ------
NM_001006629chr72184 97 ------
NM_001006630chr72184 97 ------
NM_001006631chr72184 97 ------
NM_001006632chr72184 97 ------
NM_001006634chr16----1266 --
NM_001006636chr21149 178 ----
NM_001006641chr941628 1261 1192 394 ----1605
NM_001006642chr941628 1261 1192 394 ----1605
NM_001006643chr941628 1261 1192 394 ----1605
NM_001006665chr13791 689 671 ------
NM_001006684chrX2536 137 197 ----
NM_001006939chr103666 590 188 --1706 --
NM_001007023chr141637 2344 308 ----
NM_001007024chr17124290 4024 4010 2870 1753 1330 1256 1095 919 840 800 727 24127 600 ----
NM_001007025chr17124290 4024 4010 2870 1753 1330 1256 1095 919 840 800 727 24127 600 ----
NM_001007027chr11163 ------
NM_001007094chr1034412 4086 374 64205 3953 3591 1512 1377 361 13276 13101
NM_001007097chr974882 4047 3692 1753 1235 903 236 24594 1635 14366 13859
NM_001007098chr11128 ------
NM_001007102chr631542 1223 665 ------
NM_001007156chr1541864 1625 506 303 ------
NM_001007226chr1741131 987 578 310 --11281 2976 321
NM_001007227chr1741131 987 578 310 --11281 2976 321
NM_001007228chr1741131 987 578 310 --11281 2976 321
NM_001007229chr1741131 987 578 310 --11281 2976 321
NM_001007230chr1741131 987 578 310 --11281 2976 321
NM_001007246chr2131819 1746 1630 ------
NM_001007271chr104753 371 176 160 ------
NM_001007464chr6----145 --
NM_001007466chr674906 4549 4037 3825 3817 1601 87 --1353 --
NM_001007471chr94860 630 227 91 --1357 --
NM_001007527chr5167 --1225 --
NM_001007553chr13910 359 233 1942 ----
NM_001008220chr573542 2892 2706 797 605 188 31 1985 ----
NM_001008222chrX41191 872 564 556 --11324 --
NM_001008225chr72598 590 ------
NM_001008239chr1833128 2386 472 --23563 888 1754
NM_001008272chr31311 ------
NM_001008273chr31311 ------
NM_001008392chr372972 2347 2182 1148 335 141 27 ------
NM_001008408chr736005 752 410 12200 ----
NM_001008495chr841637 356 243 206 --11612 --
NM_001008536chr1--1168 1264 1523
NM_001008540chr22469 398 ------
NM_001008564chr134660 544 530 436 2704 573 11506 --
NM_001008701chr1921242 1208 1977 ----
NM_001008726chr144568 527 424 239 1415 ----
NM_001008738chr542910 2045 1795 577 1107 12140 --
NM_001008783chr63814 368 23 1192 1163 --
NM_001008860chr151641 ------
NM_001008892chr151641 ------
NM_001008894chr151641 ------
NM_001008895chr13166 --1965 --
NM_001008925chr443038 2535 1386 548 ------
NM_001009552chr8143 ------
NM_001009554chr484536 1786 1533 911 774 749 548 146 11730 175 --
NM_001009554chr484536 1786 1533 911 774 749 548 146 11730 175 --
NM_001009555chr41319 143 1266 --
NM_001009566chr121197 262 ------
NM_001009881chr1179 ------
NM_001009882chr1179 ------
NM_001009899chr3125879 5230 5205 4439 4424 4388 4039 2132 1950 1570 1485 444 25237 1258 14858 --
NM_001009955chr11109 ------
NM_001009955chr11109 ------
NM_001009960chr71910 12842 11830 154
NM_001009992chr121291 1224 21356 562 11549 --
NM_001009993chr2114010 3746 3469 3341 3235 3211 3081 3041 3008 334 80 21752 1212 33377 3167 1333 1478
NM_001010000chr1843112 2810 2722 2583 13133 ----
NM_001010846chr163716 3488 659 650 68 36 1221 ----
NM_001010853chr622110 1215 32973 2783 116 1751 --
NM_001010854chr142734 24 1272 ----
NM_001010861chr132165 801 214 ------
NM_001010862chrX42851 2646 600 175 --21062 328 --
NM_001010888chrX43189 3088 1696 1224 12813 11750 --
NM_001010891chr5106716 6176 5033 4854 4559 2743 1732 1509 1488 849 1632 25226 905 --
NM_001010895chr921813 164 --12049 11670
NM_001010908chr102149 102 1139 ----
NM_001010922chr164006 3191 2866 1310 1075 97 1850 ----
NM_001010942chr12--11288 ----
NM_001010984chr121785 973 --11701 --
NM_001011513chr463325 2922 1173 1159 559 545 1723 23268 680 --
NM_001011537chr33417 246 199 --12024 --
NM_001011538chr43865 796 323 2896 831 ----
NM_001011553chr72721 219 ------
NM_001011663chr10157 --1179 --
NM_001011666chr786025 5547 5231 4682 2600 1252 590 561 15115 ----
NM_001011708chr222296 996 22840 2193 1485 148
NM_001011713chr1441126 493 156 116 11010 ----
NM_001011718chr201248 --1825 --
NM_001011885chr1531724 159 102 ------
NM_001012329chr172254 2243 2004 1542 735 672 315 --1766 --
NM_001012393chr1173907 3239 1429 1055 881 634 32 25109 1465 --44223 1652 1624 1318
NM_001012398chr162421 30 ------
NM_001012751chr1041246 627 527 144 ------
NM_001012755chrX84682 3500 3302 3168 3154 1508 1045 109 ------
NM_001012761chr541817 762 397 270 1513 ----
NM_001012974chr6152 ----1196
NM_001012977chrX--11338 ----
NM_001012993chr931249 1053 306 ------
NM_001013031chr1073503 2538 2424 2381 2334 1325 1110 13493 12514 --
NM_001013398chr71195 ------
NM_001013399chr6133 ------
NM_001013415chr4----1458 --
NM_001013438chr32706 260 ------
NM_001013439chr32552 106 ------
NM_001013615chr11798 ----1880
NM_001013620chr1235976 3068 1829 16681 ----
NM_001013622chr471180 1113 957 868 409 285 162 11094 6813 476 353 229 106 44 1292
NM_001013626chr82168 82 ----1195
NM_001013635chr123843 401 98 ------
NM_001013693chr142596 2392 1824 597 12094 22567 1992 1153
NM_001013693chr142596 2392 1824 597 12094 22567 1992 1153
NM_001013703chr152511 142 ------
NM_001013717chr521369 1179 2483 114 ----
NM_001013843chr153946 746 645 ------
NM_001014283chr1351758 1356 1339 874 304 21637 600 ----
NM_001014431chr14------1776
NM_001014432chr14------1776
NM_001014434chr11161 --1151 --
NM_001014435chr162523 453 178 ----
NM_001014443chr1----122 --
NM_001014797chr10158155 7939 7709 7581 7193 6737 6285 5581 3170 2512 1687 1302 893 669 658 22857 1007 ----
NM_001014809chr41993 --1662 --
NM_001014839chr12785 61 1753 --1761
NM_001014841chr12785 61 1753 --1761
NM_001015045chr441825 802 701 545 --1604 --
NM_001015508chr81188 ------
NM_001015877chrX42042 2005 1227 1148 ------
NM_001015881chrX2425 152 1395 ----
NM_001015887chr311268 ------
NM_001017369chr411091 ------
NM_001017371chr221259 1053 ------
NM_001017395chr363648 3540 3509 2634 2434 714 --12613 --
NM_001017396chr25635 589 486 298 61 --31869 786 498 --
NM_001017406chr1156 185 1176 --
NM_001017415chr11277 ------
NM_001017416chr11277 ------
NM_001017423chr10----1124 --
NM_001017424chr11174 ------
NM_001017425chr11174 ------
NM_001017440chr7127213 7098 6390 5938 5352 2100 1926 1052 986 792 750 167 --1673 --
NM_001017535chr1273163 1999 934 924 592 419 381 12042 1774 --
NM_001017923chr1431569 1230 280 21463 332 ----
NM_001017969chr91267 ------
NM_001017977chr12349 23 ------
NM_001018008chr151461 ------
NM_001018025chrX2331 221 ------
NM_001018037chr921108 247 ------
NM_001018050chr2252140 1134 973 798 202 --22772 2329 --
NM_001018052chr2252140 1134 973 798 202 --22772 2329 --
NM_001018054chr121044 324 ------
NM_001018056chr91391 ------
NM_001018074chr5102920 2593 1383 1174 938 851 702 664 304 115 ------
NM_001018075chr5102920 2593 1383 1174 938 851 702 664 304 115 ------
NM_001018076chr5102920 2593 1383 1174 938 851 702 664 304 115 ------
NM_001018077chr5102920 2593 1383 1174 938 851 702 664 304 115 ------
NM_001018108chr1532076 1906 39 11618 1285 --
NM_001020825chr52395 68 ------
NM_001023567chr1532387 955 694 --11769 --
NM_001023587chr331101 805 392 ------
NM_001024024chr14------147
NM_001024070chr14------143
NM_001024094chr5102920 2593 1383 1174 938 851 702 664 304 115 ------
NM_001024226chr11755 1445 1303 --
NM_001024227chr11755 1445 1303 --
NM_001024228chr11755 1445 1303 --
NM_001024455chrX41987 753 199 75 ----1695
NM_001024463chr153465 275 73 ------
NM_001024593chr102320 22 1909 ----
NM_001024647chr12116853 6719 6332 6308 6106 5169 5105 2833 2122 1649 1400 34960 2785 799 17453 --
NM_001024680chr241590 1576 1291 164 ------
NM_001024808chr1252599 1914 1021 817 599 11892 ----
NM_001024809chr1721160 98 --21358 882 --
NM_001024847chr372429 2061 2047 917 608 273 224 11013 1574 --
NM_001024937chr171499 --1663 --
NM_001024948chr142552 2339 1209 181 ------
NM_001025068chr351798 1714 1625 1483 719 21653 592 1184 --
NM_001025069chr351798 1714 1625 1483 719 21653 592 1184 --
NM_001025076chr1085531 4007 2382 2152 1965 1946 1772 1537 14150 26022 4967 --
NM_001025077chr1066889 5365 2895 934 529 344 15508 27380 6325 --
NM_001025079chr3113345 3216 2617 2563 1332 1306 1254 1217 772 554 60 ------
NM_001025081chr1831188 1176 71 --21232 1074 --
NM_001025090chr1831188 1176 71 --21232 1074 --
NM_001025092chr1831188 1176 71 --21232 1074 --
NM_001025100chr1873584 3014 2804 1395 1218 1187 989 12900 ----
NM_001025101chr1831188 1176 71 --21232 1074 --
NM_001025105chr51608 ------
NM_001025107chr142503 2071 1690 643 --32282 1913 287 --
NM_001025107chr142503 2071 1690 643 --32282 1913 287 --
NM_001025108chr222566 186 23759 652 21105 843 --
NM_001025109chr11792 --1468 159
NM_001025232chr122338 101 ------
NM_001025266chr374768 4511 3157 1737 657 510 51 1983 34125 691 235 --
NM_001025356chr1232020 399 25 --12423 --
NM_001025366chr62585 182 ------
NM_001025366chr62585 182 ------
NM_001025367chr62585 182 ------
NM_001025367chr62585 182 ------
NM_001025368chr62585 182 ------
NM_001025368chr62585 182 ------
NM_001025369chr62601 198 ------
NM_001025369chr62601 198 ------
NM_001025370chr62585 182 ------
NM_001025370chr62585 182 ------
NM_001025579chr173774 400 327 ------
NM_001025580chrX54014 3600 3393 1372 1320 24086 492 ----
NM_001025596chr11--1356 ----
NM_001025603chr151505 1149 568 470 230 --2155 72 --
NM_001025616chr431676 357 91 ------
NM_001025777chr231327 396 203 ------
NM_001029858chr61547 22451 192 11337 --
NM_001029859chr1162418 2025 916 455 362 70 31934 904 762 1931 --
NM_001029863chr63807 102 39 12101 ----
NM_001029864chr2021603 344 11834 ----
NM_001029875chr512993 32917 166 35 12021 --
NM_001029884chr652683 2653 1979 924 642 12180 ----
NM_001029998chr42910 296 ------
NM_001030006chr1751807 1642 544 400 228 ------
NM_001030007chr1662912 2476 1004 482 472 253 --12698 --
NM_001030055chr1444300 3850 3447 564 23784 542 --13337
NM_001030287chr14354 296 205 97 ------
NM_001031679chr1262625 2237 1219 1191 709 695 12288 1829 --
NM_001031684chr2----21460 1086 --
NM_001031690chr733065 2689 1113 138 ----
NM_001031694chr16945 890 734 613 381 87 ------
NM_001031694chr16945 890 734 613 381 87 ------
NM_001031695chr2265019 4075 3716 3522 1468 1183 14865 --1380
NM_001031700chr4--2680 260 ----
NM_001031711chr541551 1334 1191 506 ------
NM_001031712chr62316 56 ------
NM_001031716chr2164 1789 ----
NM_001031717chr34661 311 204 52 ------
NM_001031732chr433183 1423 1269 23138 1008 12230 --
NM_001031740chr151738 1446 313 260 245 --21567 284 --
NM_001031804chr1633455 3062 2999 --11165 13733
NM_001031806chr1741940 1594 787 731 ------
NM_001031812chr52500 46 ------
NM_001032221chr9----11552 11813
NM_001032283chr1241019 1005 274 73 ------
NM_001032284chr1241019 1005 274 73 ------
NM_001032296chr1342797 2337 936 687 11963 22717 1061 --
NM_001032363chr1112158 2039 2025 1839 1665 1585 701 509 490 473 315 1812 1133 --
NM_001032363chr1112158 2039 2025 1839 1665 1585 701 509 490 473 315 1812 1133 --
NM_001033044chr131659 1490 1245 --1295 --
NM_001033045chr2103211 3092 3078 2883 2823 1461 1226 1212 1099 367 1410 ----
NM_001033049chr2161972 569 468 231 225 153 21810 72 ----
NM_001033056chr131659 1490 1245 --1295 --
NM_001033057chr31831 2761 105 21820 1341 198
NM_001033059chr631730 1418 293 ------
NM_001033087chr2053232 1044 665 514 234 12419 --12875
NM_001033112chr51323 1579 ----
NM_001033117chr364548 3585 3048 1677 1266 435 ------
NM_001033564chr641453 232 94 60 ------
NM_001033576chr1732484 1853 487 12210 ----
NM_001033602chr1372506 1798 1709 846 567 245 174 12306 22477 2051 --
NM_001033723chr892605 2513 2118 1861 1103 1053 839 801 548 --1829 --
NM_001033756chr62519 116 ------
NM_001033756chr62519 116 ------
NM_001033925chr1011839 ------
NM_001034025chr121692 1309 ----
NM_001034841chr16115489 5001 4787 4642 4529 4309 2152 2138 1686 1486 678 33722 2180 23 24517 840 1735
NM_001034845chr4----163 1169
NM_001034850chr521466 441 21630 1251 ----
NM_001034852chr1451995 1646 1403 627 132 --11955 --
NM_001034954chr1032756 2528 760 ----1593
NM_001034955chr1032756 2528 760 ----1593
NM_001034956chr1032756 2528 760 ----1593
NM_001034957chr1032756 2528 760 ----1593
NM_001035chr121049 424 ------
NM_001035005chr182600 59 1129 ----
NM_001035254chr941748 683 517 398 ------
NM_001035260chr1041401 1309 656 578 --21470 65 --
NM_001037131chr231308 1162 425 --133 --
NM_001037132chr721914 1666 --156 --
NM_001037133chr721914 1666 --156 --
NM_001037164chr721402 785 1793 ----
NM_001037172chr321279 1081 --11039 --
NM_001037317chr132165 801 214 ------
NM_001037332chr51121 --12536 --
NM_001037333chr51121 --12536 --
NM_001037334chr181597 ------
NM_001037339chr141635 450 376 110 ------
NM_001037340chr141635 450 376 110 ------
NM_001037341chr141635 450 376 110 ------
NM_001037341chr141635 450 376 110 ------
NM_001037535chrX21359 1012 11509 ----
NM_001037536chrX21359 1012 11509 ----
NM_001037540chrX21359 1012 11509 ----
NM_001037582chr441602 1421 1276 293 ------
NM_001037631chr21277 ------
NM_001037872chr2--1583 ----
NM_001037954chr1183093 2822 2695 2470 2283 1307 887 216 ------
NM_001037967chrX244 33 ------
NM_001037969chrX244 33 ------
NM_001038640chr1511001 ------
NM_001038707chr142189 1689 816 345 1787 ----
NM_001038707chr142189 1689 816 345 1787 ----
NM_001039366chr222445 417 ------
NM_001039459chr71174 ------
NM_001039479chr1441936 1923 624 171 ------
NM_001039538chr252978 2925 2820 753 663 11429 ----
NM_001039547chr3107410 7210 7126 6046 6036 5513 5499 5357 2410 2091 47312 6509 5542 1977 17713 --
NM_001039569chr272924 2910 2522 1302 1166 1152 756 22952 1195 ----
NM_001039573chr172463 166 ------
NM_001039574chr131045 755 167 --1399 --
NM_001039590chrX43962 3832 1086 175 12444 ----
NM_001039591chrX43962 3832 1086 175 12444 ----
NM_001039690chr161251 --1927 --
NM_001039711chr11966 ------
NM_001039712chr11966 ------
NM_001039802chr121019 123 ------
NM_001039840chrX96037 5994 5881 4595 3784 2214 2082 504 32 23872 913 14797 1827
NM_001039888chr11263 1801 ----
NM_001039937chr1333861 2761 494 1637 --12580
NM_001040001chr622056 1634 ------
NM_001040020chr741402 1227 499 34 ------
NM_001040057chr71471 ------
NM_001040101chr42628 34 ----11482
NM_001040142chr231680 1664 380 1335 ----
NM_001040143chr231680 1664 380 1335 ----
NM_001040144chr161251 --1927 --
NM_001040146chr161251 --1927 --
NM_001040151chr11104304 3869 3602 3504 3358 1155 790 546 356 158 139 --11506
NM_001040152chr7124336 1468 1155 1042 982 924 914 890 752 633 605 68 24507 1258 11029 --
NM_001040153chr133767 759 169 ----1267
NM_001040157chr4----1426 --
NM_001040159chr41457 ------
NM_001040167chr711071 --21002 415 --
NM_001040202chr421008 521 1250 ----
NM_001040260chr461088 912 901 138 104 28 ----1111
NM_001040261chr461088 912 901 138 104 28 ----1111
NM_001040272chr922337 927 ------
NM_001040273chr1062089 2080 1999 1993 1685 657 126 ----
NM_001040280chr651591 1524 597 388 135 ------
NM_001040284chr1655815 4882 4868 3974 1438 ------
NM_001040402chr462711 2552 2535 2493 915 714 11148 ----
NM_001040409chr231031 296 172 ------
NM_001040429chr1322967 2201 2568 135 ----
NM_001040446chr52692 550 --31933 904 198 --
NM_001040450chr1511053 22709 1096 22801 252 --
NM_001040453chr1511053 22709 1096 22801 252 --
NM_001040458chr531402 397 262 11800 ----
NM_001040619chr12655 547 ------
NM_001040665chr743526 881 864 475 13315 ----
NM_001040709chr141593 847 773 40 ----1931
NM_001040712chr933075 3005 2199 ----2236 81
NM_001040876chr421450 375 ------
NM_001042355chr1674055 3972 3598 2016 1710 1328 55 35129 985 255 13299 --
NM_001042357chr10150 127 ----
NM_001042358chr10150 127 ----
NM_001042360chr10150 127 ----
NM_001042361chr10181 158 ----
NM_001042363chr10150 127 ----
NM_001042364chr10181 158 ----
NM_001042365chr10181 158 ----
NM_001042387chr10181 158 ----
NM_001042388chr181780 ------
NM_001042389chr10150 127 ----
NM_001042390chr10150 127 ----
NM_001042392chr10150 127 ----
NM_001042393chr10181 158 ----
NM_001042395chr10150 127 ----
NM_001042396chr10181 158 ----
NM_001042397chr10181 158 ----
NM_001042403chr121952 ------
NM_001042404chr13777 410 32 1197 ----
NM_001042412chr1674055 3972 3598 2016 1710 1328 55 35129 985 255 13299 --
NM_001042413chr963603 3468 3303 1078 816 276 43175 1628 796 359 23770 1282 --
NM_001042414chr13166 ------
NM_001042424chr472677 2155 2077 1169 751 715 145 1262 12601 12702
NM_001042453chrX41551 1512 632 223 ------
NM_001042459chr3----1234 --
NM_001042473chr1012045 1312 11506 --
NM_001042475chr6196 ------
NM_001042479chrX3675 455 169 ------
NM_001042480chrX3675 455 169 ------
NM_001042481chr1421031 166 21796 310 ----
NM_001042486chr2021366 1163 11504 21004 397 11338
NM_001042492chr1743048 2764 2650 102 22235 644 11331 --
NM_001042493chr611541 ----11899
NM_001042494chr1553258 3213 1392 1378 923 21421 174 23394 153 --
NM_001042495chr1553258 3213 1392 1378 923 21421 174 23394 153 --
NM_001042496chr1553258 3213 1392 1378 923 21421 174 23394 153 --
NM_001042497chr1553258 3213 1392 1378 923 21421 174 23394 153 --
NM_001042498chrX1436 --162 --
NM_001042510chr8169 ------
NM_001042511chr8169 ------
NM_001042517chr13--168 ----
NM_001042537chrX22218 1544 22101 320 12013 1754
NM_001042539chr161727 ------
NM_001042555chr1263328 3074 1220 530 136 29 ------
NM_001042599chr287523 6253 6035 5833 4873 1087 1058 37 11647 17737 --
NM_001042601chr363113 3071 2072 739 392 236 12188 ----
NM_001042603chr1275341 4840 4652 3243 1085 473 85 25062 2065 ----
NM_001042604chr344850 1833 188 148 1870 34170 3149 1861 --
NM_001042610chr161197 --11208 --
NM_001042632chr2061913 1756 1745 1650 289 203 --1542 --
NM_001042633chr2061913 1756 1745 1650 289 203 --1542 --
NM_001042669chr431676 357 91 ------
NM_001042681chr12858 815 11014 ----
NM_001042682chr12858 815 11014 ----
NM_001042682chr12858 815 11014 ----
NM_001042683chr61588 ------
NM_001042729chr11540 ------
NM_001042747chr11540 ------
NM_001042762chr731124 986 26 2191 142 ----
NM_001043318chr1484107 3449 3293 3000 1659 1466 994 538 ------
NM_001043351chr131738 1639 210 155 11539 --
NM_001044305chr6160 21247 38 ----
NM_001044385chr243144 2564 938 764 11388 13747 11064
NM_001044722chr52500 46 ------
NM_001044723chr52500 46 ------
NM_001048183chr192748 1186 760 746 544 369 280 136 83 21229 789 22396 877 --
NM_001050chr1731248 1234 97 11412 ----
NM_001068chr3182 ------
NM_001071775chr1331539 491 327 11332 ----
NM_001080418chr13591 249 232 --1530 --
NM_001083620chr422433 2010 2486 406 11667 --
NM_001095chr122429 81 21526 322 ----
NM_001096chr172279 254 --1798 --
NM_001099678chr365814 5451 4769 3905 1484 286 14798 ----
NM_001100108chr1167867 7033 6966 6767 6730 6701 6657 6086 5446 5432 5125 2552 2110 1092 303 125 36675 6115 5823 15566 --
NM_001106chr3189038 8644 7391 7327 7139 6710 6184 3735 3460 3213 2897 2539 2149 2028 1761 1598 1131 833 68375 8288 7549 5954 5898 2623 17456 17914
NM_001107chr141143 ------
NM_001111chr142503 2071 1690 643 --32282 1913 287 --
NM_001113490chrX43017 2726 1336 199 ------
NM_001121chr1021795 360 2571 370 ----
NM_001122631chr111452 ------
NM_001122679chr51289 ------
NM_001128chr1662912 2476 1004 482 472 253 --12698 --
NM_001135chr154810 724 674 189 ------
NM_001140chr172179 127 ------
NM_001144chr1651009 558 529 437 300 ------
NM_001148chr462120 1850 1758 1441 721 492 --167 --
NM_001156chr103542 534 467 ------
NM_001157chr10132 --1490 --
NM_001167chrX66033 5233 2477 1272 946 323 46076 4417 4082 1588 ----
NM_001173chr1444300 3850 3447 564 23784 542 --13337
NM_001175chr122131 34 ------
NM_001177chr1232445 2376 731 32367 478 190 32460 1972 1673 --
NM_001179chr41190 ------
NM_001186chr2142763 1246 1010 80 1539 12146 13244
NM_001187chr211127 ------
NM_001189chr441022 827 243 188 --3725 706 107 --
NM_001190chr19141 182 ----
NM_001191chr2021419 113 1301 11390 --
NM_001198chr641982 509 498 247 ------
NM_001204chr287379 5541 4858 4844 4786 1528 807 211 22599 667 14977 --
NM_001206chr932295 2051 795 1102 ----
NM_001218chr1552678 2456 515 470 76 --11993 --
NM_001219chr732276 578 210 --1831 12044
NM_001222chr1031827 1621 527 ------
NM_001226chr4288 74 2257 117 ----
NM_001231chr12498 454 ------
NM_001241chr21713 ------
NM_001241chr21713 ------
NM_001256chr1722675 2464 ------
NM_001257chr161183 1482 11392 --
NM_001259chr7106317 5393 5047 4174 4103 1729 1317 1201 1134 858 56222 5873 4874 2286 1446 46396 5149 4904 2457 --
NM_001270chr5----1951 --
NM_001271chr1563076 3061 2948 2526 202 142 --21181 257 --
NM_001273chr122447 220 ------
NM_001280chr192541 92 ------
NM_001282chr1751807 1642 544 400 228 ------
NM_001284chr51500 ------
NM_001290chr42898 277 ----1836
NM_001299chr191480 ------
NM_001300chr101470 ------
NM_001304chr1732650 1358 584 23353 725 12998 --
NM_001310chr1253002 2778 1959 1887 309 --11118 --
NM_001313chr41993 --1662 --
NM_001316chr201509 ------
NM_001319chr191218 --3745 718 144 --
NM_001329chr1051335 552 504 251 37 1563 ----
NM_001331chr1152700 2199 1096 561 23 ------
NM_001332chr521039 237 ------
NM_001343chr531695 463 314 ------
NM_001346chr362842 2550 2451 2261 2084 774 22178 1993 1648 --
NM_001349chr2------1458
NM_001355chr22----128 --
NM_001356chrX12091 ----11899
NM_001364chr1154003 1916 1212 628 406 --21456 555 23582 888
NM_001378chr21172 ------
NM_001386chr852121 1986 1921 1872 346 22006 48 ----
NM_001387chr542459 1229 679 313 12835 ----
NM_001396chr2132520 1867 505 ------
NM_001400chr13927 915 418 1516 ----
NM_001402chr622008 1841 11637 ----
NM_001407chr331264 229 132 --1164 --
NM_001408chr13417 221 104 21334 133 ----
NM_001412chrX23171 2490 23338 2783 23254 2390 --
NM_001417chr1211905 --1777 --
NM_001419chr1923965 3946 1739 ----
NM_001420chr1932705 989 417 ------
NM_001421chrX41332 1147 331 81 21599 115 ----
NM_001426chr2----186 --
NM_001427chr741875 1644 1551 707 ------
NM_001429chr221316 ------
NM_001430chr251906 1505 213 123 27 ------
NM_001431chr62899 313 1386 ----
NM_001432chr443822 3653 2598 2389 1830 ----
NM_001438chr143473 3312 3154 1323 ------
NM_001440chr862487 1982 994 580 421 90 11887 11105 1713
NM_001447chr551067 1049 1019 890 385 ------
NM_001451chr162928 182 1285 ----
NM_001452chr63670 219 115 ------
NM_001460chr133539 1394 1150 ----11264
NM_001463chr21778 ------
NM_001482chr151817 1275 ----
NM_001494chr101649 ------
NM_001497chr952304 1867 1692 1088 1066 ------
NM_001498chr64953 563 524 385 1479 ----
NM_001527chr644816 4300 4210 1226 --34345 3189 3043 --
NM_001530chr142963 268 1735 ----
NM_001552chr1721034 259 ------
NM_001553chr4160 ------
NM_001567chr111519 ------
NM_001604chr111863 ------
NM_001616chr233235 2801 2348 ------
NM_001617chr241025 1011 988 909 --1928 --
NM_001618chr13682 485 76 --1105 --
NM_001620chr112769 161 ------
NM_001634chr631730 1418 293 ------
NM_001649chrX51993 1920 1875 614 83 1233 ----
NM_001650chr1824118 699 ------
NM_001655chr1141784 1744 807 509 ------
NM_001658chr11755 1445 1303 --
NM_001661chr172726 50 ------
NM_001663chr1431089 667 424 ------
NM_001668chr122256 2117 --11851 --
NM_001674chr14354 296 205 97 ------
NM_001676chr132168 48 ------
NM_001677chr11978 ------
NM_001682chr1232631 750 124 ------
NM_001683chr352684 2532 2046 1991 1668 12091 ----
NM_001684chr174224 3503 3229 3157 1505 1073 263 2892 140 ----
NM_001693chr841253 1041 887 197 1291 ----
NM_001695chr894072 3847 3455 3166 3031 1652 1351 603 526 ------
NM_001696chr222445 417 ------
NM_001698chr9----1141 --
NM_001699chr1931355 202 104 ------
NM_001701chr921345 1214 ------
NM_001709chr1132089 2042 771 22213 2020 ----
NM_001716chr1151508 1191 436 293 260 --1360 --
NM_001718chr631091 176 56 ------
NM_001731chr121184 127 ----
NM_001735chr9135 --1141 --
NM_001745chr521124 260 1404 11028 --
NM_001753chr711352 130 11176 --
NM_001754chr2173217 1722 1521 1422 503 475 250 23350 1225 ----
NM_001755chr1621902 227 ------
NM_001759chr1294917 4705 4165 4013 3508 1741 973 560 543 ------
NM_001761chr1641767 1211 423 261 1406 11526 --
NM_001777chr3113345 3216 2617 2563 1332 1306 1254 1217 772 554 60 ------
NM_001788chr72721 219 ------
NM_001791chr121019 123 ------
NM_001792chr181254 1207 ----
NM_001794chr20--1248 ----
NM_001797chr161245 ------
NM_001798chr1221013 210 ------
NM_001806chr1911962 11944 --22759 2462
NM_001827chr91107 ------
NM_001830chrX63127 2719 1336 1213 1144 868 --1641 --
NM_001833chr9129 ------
NM_001845chr132228 92 ------
NM_001854chr121550 1423 1454 ----
NM_001858chr663578 3506 3365 1011 307 82 ------
NM_001861chr161125 --232 26 --
NM_001863chr191109 ------
NM_001874chr1263614 1658 1107 1087 444 35 43783 3643 1749 1345 44942 3739 983 558 --
NM_001879chr351623 735 513 398 357 ------
NM_001882chr51377 --1431 --
NM_001892chr51608 ------
NM_001901chr631051 966 316 ------
NM_001918chr1148629 8590 7058 6656 3572 2379 1946 1777 1757 1648 1634 449 329 315 53705 1677 1544 820 358 12512 --
NM_001933chr1441324 1079 531 475 --2957 199 --
NM_001938chr121210 96 ----11850
NM_001939chrX2290 260 12333 ----
NM_001941chr1812691 23536 1202 1245 --
NM_001944chr1841531 456 442 105 --1576 --
NM_001946chr12----1365 --
NM_001949chr652204 2113 945 374 63 ------
NM_001951chr82513 435 ------
NM_001954chr63741 595 82 1537 ----
NM_001961chr192451 82 1162 122 --
NM_001962chr5122 ------
NM_001969chr1463434 3196 2989 2655 853 682 33718 1237 383 1537 --
NM_001975chr122874 214 1155 1312 --
NM_001977chr4--1678 --21641 1173
NM_001980chr1262071 1997 1803 1431 841 48 12147 ----
NM_001982chr122828 194 1857 ----
NM_001987chr1264125 3259 1562 728 267 166 31164 809 383 33133 3066 2996 --
NM_001991chr1732212 1594 26 ------
NM_001993chr13902 875 247 ------
NM_001999chr52937 459 1578 ----
NM_002009chr1512623 11856 11100 --
NM_002010chr132215 176 122 ----
NM_002015chr1341244 1136 528 477 --12433 --
NM_002017chr111242 1179 ----
NM_002024chrX31599 1584 236 1842 ----
NM_002025chrX97761 6828 6082 3560 2893 1880 1533 1492 768 22825 2452 1332 --
NM_002037chr61165 1367 ----
NM_002039chr44765 685 325 285 ------
NM_002040chr2132984 2498 1051 ------
NM_002044chr1531638 1162 40 ------
NM_002046chr121163 ------
NM_002048chr91180 --180 --
NM_002051chr101201 --2962 327 --
NM_002061chr141379 1261 1247 25 11763 ----
NM_002063chrX1143 1477 ----
NM_002065chr131659 1490 1245 --1295 --
NM_002069chr721200 630 --1114 --
NM_002074chr11427 11375 ----
NM_002076chr1263262 2756 2570 2105 447 97 --12744 --
NM_002077chr982118 1987 1608 1486 606 421 311 279 1348 1334 1286
NM_002086chr1762101 1559 667 653 628 110 --1782 --
NM_002092chr485022 4785 4744 3551 3537 3353 1686 1246 34756 4308 840 11117 --
NM_002107chr11119 ------
NM_002126chr1753996 2964 2610 720 96 --24053 142 --
NM_002130chr5----1420 --
NM_002140chr92905 89 --1421 --
NM_002141chr7289 38 1264 ----
NM_002143chr11740 --1543 --
NM_002146chr1731176 952 197 ------
NM_002148chr2----1623 --
NM_002152chr19132 ------
NM_002158chr243403 3369 2325 858 12822 ----
NM_002160chr91100 ----1584
NM_002167chr12511 415 1125 ----
NM_002182chr322202 1963 ------
NM_002184chr5137 ------
NM_002192chr72447 408 ------
NM_002193chr231197 1189 400 11628 21254 1220 --
NM_002203chr5103468 3013 2855 2755 1524 1319 1120 1103 775 446 --13780 --
NM_002204chr17130 11072 ----
NM_002214chr784824 4549 4180 4107 2287 2215 878 236 --1316 12071
NM_002221chr1112852 2672 2239 1964 1880 1155 878 739 620 354 30 193 22760 2406 --
NM_002222chr31422 1924 --2273 262
NM_002227chr141294 1178 294 251 1987 ----
NM_002228chr12784 226 ----2918 909
NM_002229chr192401 311 ------
NM_002233chr11138 ------
NM_002240chr211161 ------
NM_002241chr153102 2547 2262 2226 2058 --1926 --
NM_002242chr22366 204 ------
NM_002246chr221010 378 --126 --
NM_002247chr1011796 --1313 --
NM_002252chr21108 ------
NM_002253chr4----1338 --
NM_002254chr241784 1550 439 72 1233 22295 506 --
NM_002264chr375047 4195 4053 1844 508 267 161 --31329 143 26 12002
NM_002267chr1342405 2312 2217 21 1803 ----
NM_002268chr311694 ------
NM_002270chr534094 1185 214 23973 1720 15411 --
NM_002283chr123625 266 166 --137 --
NM_002285chr222566 186 23759 652 21105 843 --
NM_002290chr621033 314 --1968 --
NM_002293chr152735 2419 2090 1998 1702 --1478 --
NM_002298chr132575 412 ------
NM_002313chr1055042 3505 3343 1430 182 ------
NM_002314chr731081 1043 347 ------
NM_002334chr1131788 794 176 --21878 518 --
NM_002351chrX1134 ------
NM_002355chr1231344 905 142 --11025 --
NM_002356chr642051 1874 1067 323 ------
NM_002359chr1743645 3361 3338 1439 --11332 --
NM_002360chr762640 2141 654 618 431 230 --172 --
NM_002361chr192303 232 ------
NM_002374chr252978 2925 2820 753 663 11429 ----
NM_002375chr322270 552 --21991 1423 12169
NM_002382chr1431006 873 379 ------
NM_002385chr1831188 1176 71 --21232 1074 --
NM_002387chr585031 4627 4512 4398 4307 4127 870 810 34873 4145 1292 1126 --
NM_002397chr542201 1397 652 228 1488 --1208
NM_002398chr21409 ------
NM_002419chr112426 353 1191 ----
NM_002422chr112208 33 ------
NM_002429chr1221496 108 11525 11022 --
NM_002430chr2232587 1795 631 1715 1150 --
NM_002442chr1211735 ------
NM_002444chrX31812 1594 1513 1294 ----
NM_002445chr831333 448 75 ----1141
NM_002460chr673071 3034 1359 1259 957 753 684 1359 23254 2482 --
NM_002465chr12160 ------
NM_002473chr222952 914 ------
NM_002480chr121567 11053 ----
NM_002489chr7------1415
NM_002499chr1592402 2334 2210 1936 1759 1631 898 168 135 --12091 1100
NM_002501chr1911108 --12879 --
NM_002505chr621044 300 ------
NM_002509chr20--1336 ----
NM_002515chr1451440 1370 1311 1269 763 1613 1601 --
NM_002518chr25990 933 362 347 305 ------
NM_002519chr113392 375 103 ----11186
NM_002522chr1763293 2646 2640 1512 376 182 22914 1303 --1752
NM_002524chr12224 200 1305 ----
NM_002526chr621629 432 ------
NM_002543chr123193 162 74 ------
NM_002544chr172337 291 ------
NM_002545chr1173907 3239 1429 1055 881 634 32 25109 1465 --44223 1652 1624 1318
NM_002546chr81749 ----177
NM_002547chrX33495 628 128 2436 306 --11119
NM_002563chr31866 ------
NM_002569chr1551385 1334 1131 151 47 1160 ----
NM_002572chr11290 28 ------
NM_002576chr11----1823 --
NM_002577chr31396 13028 12779 --
NM_002578chrX1422 ------
NM_002581chr995325 5153 4720 4150 1863 1453 802 372 329 11957 ----
NM_002586chr631578 411 356 11431 ----
NM_002588chr52165 65 ------
NM_002589chr42274 119 ------
NM_002594chr2031893 860 79 ------
NM_002595chr12----1404 --
NM_002599chr1141112 991 448 260 1428 ----
NM_002600chr141635 450 376 110 ------
NM_002603chr81169 ------
NM_002605chr153848 442 373 11148 ----
NM_002607chr721255 1181 11269 1971 --
NM_002608chr2231506 1293 456 1365 1348 --
NM_002609chr531704 446 58 --21356 681 --
NM_002613chr16124976 4777 4614 4607 4498 3590 1781 1174 1130 527 88 42 --13745 14662
NM_002627chr10178 ------
NM_002628chr341161 1150 840 355 11183 ----
NM_002632chr141340 1828 184 --
NM_002636chr62219 128 --1194 --
NM_002643chr21164 ------
NM_002645chr1162000 704 646 374 166 90 1816 ----
NM_002648chr62846 502 ------
NM_002649chr731415 1309 364 1135 ----
NM_002655chr874246 3632 3206 1940 1351 368 198 24819 1287 24626 1592 --
NM_002657chr2073747 3600 3248 1153 543 462 277 --32793 725 144 --
NM_002662chr331360 623 513 1758 ----
NM_002667chr62504 172 ------
NM_002670chr311601 ------
NM_002687chr1431282 1137 415 ------
NM_002698chr1952775 2742 1039 228 116 ------
NM_002703chr4--11202 ----
NM_002709chr242729 895 826 339 ----11258
NM_002710chr1211057 ------
NM_002711chr71842 1570 ----
NM_002713chr131136 1042 197 ------
NM_002714chr64935 861 413 135 ------
NM_002715chr51901 ------
NM_002716chr1193538 3139 2874 1459 1238 1128 860 644 276 1244 ----
NM_002717chr81224 ------
NM_002718chr372576 2075 1959 567 541 394 120 11987 ----
NM_002719chr1452268 1580 1510 950 629 ------
NM_002720chr16--1199 ----
NM_002721chr92471 94 ------
NM_002725chr1114433 3905 3735 2818 1516 1391 1377 1323 1027 903 334 12861 41101 987 621 60 139
NM_002729chr101653 --1623 --
NM_002730chr192427 110 ------
NM_002731chr143177 3017 2723 779 22527 22 ----
NM_002734chr1761489 1414 755 694 502 309 ------
NM_002736chr721814 1491 --1394 --
NM_002738chr162460 168 ------
NM_002740chr332800 747 158 21942 655 ----
NM_002742chr141584 ------
NM_002745chr2294134 3972 1063 762 738 480 450 413 258 --32883 1793 591 13861
NM_002747chr1841610 699 353 304 ------
NM_002748chr151795 ------
NM_002752chr51366 ------
NM_002753chr43717 536 142 --1873 179
NM_002756chr173968 138 53 --1109 --
NM_002758chr171546 ------
NM_002779chr103489 220 185 ----139
NM_002791chr14142 ------
NM_002794chr1123 ------
NM_002819chr1931214 974 133 --11459 --
NM_002829chr92133 117 1859 ----
NM_002830chr22348 146 ------
NM_002833chr152531 23 --1227 --
NM_002835chr71146 ------
NM_002839chr933075 3005 2199 ----2236 81
NM_002841chr32181 22 ------
NM_002843chr1153109 2882 2432 488 209 ------
NM_002844chr6181 --172 --
NM_002846chr23444 159 61 ------
NM_002847chr751318 650 603 358 241 ------
NM_002849chr121862 ------
NM_002852chr31416 1101 ----
NM_002860chr10----1124 --
NM_002868chr1251621 1583 969 833 150 ------
NM_002869chr112660 531 --11817 --
NM_002874chr952176 1848 1724 1603 838 11632 ----
NM_002886chr374904 4117 4075 3721 3206 1848 1332 21705 690 ----
NM_002892chr1441651 418 393 280 --21082 484 --
NM_002893chrX1138 ------
NM_002894chr181158 ------
NM_002895chr203961 260 31 --1745 1881
NM_002906chr111104 ------
NM_002926chr461153 1138 1040 1013 840 112 ------
NM_002940chr421450 375 ------
NM_002945chr172773 146 ------
NM_002946chr12495 464 ----122
NM_002950chr32109 42 ------
NM_002953chr13791 689 671 ------
NM_002955chr621507 576 ----11538
NM_002956chr121517 ----11129
NM_002957chr973328 2695 2595 1296 953 443 260 --13470 --
NM_002958chr31862 2994 54 ----
NM_002959chr153854 768 507 188 48 14468 2378 364 --
NM_002968chr1631005 820 150 ------
NM_002971chr311052 ------
NM_002973chr121156 ------
NM_002977chr221066 301 ------
NM_002996chr1661749 1636 741 710 458 190 11511 ----
NM_002998chr861899 1396 607 588 193 116 ------
NM_002999chr2051911 1896 1542 527 459 --1771 --
NM_003010chr1731964 824 751 1182 ----
NM_003012chr822678 2101 13183 22692 100 --
NM_003016chr1711768 ------
NM_003026chr911277 2363 228 ----
NM_003027chr151417 ------
NM_003028chr943679 3078 2789 1088 12964 ----
NM_003031chr163743 242 69 ------
NM_003032chr352596 1811 803 506 392 3958 902 711 21887 1870 --
NM_003036chr131165 976 462 2833 391 ----
NM_003037chr11158 ------
NM_003042chr321719 1582 166 1210 --
NM_003043chr373489 3426 3023 1423 1263 1080 1042 1371 ----
NM_003045chr1364362 3921 3327 3195 523 101 --11599 --
NM_003047chr121333 573 --21011 25 --
NM_003048chr231097 943 106 12344 1862 --
NM_003051chr12791 659 11305 ----
NM_003060chr531249 1031 261 --1904 --
NM_003068chr81308 ------
NM_003069chrX--1305 ----
NM_003074chr31252 32149 2059 1594 11456 --
NM_003076chr1231155 513 158 ------
NM_003079chr17--1850 ----
NM_003088chr751063 926 864 286 151 ------
NM_003105chr11184 ------
NM_003107chr612104 ------
NM_003108chr275993 2846 2149 2069 1459 1140 1032 36954 6735 4812 ----
NM_003111chr221259 1053 ------
NM_003112chr733248 782 580 --138 --
NM_003128chr262714 2641 2628 2611 1776 1048 12578 ----
NM_003144chr621783 574 21424 282 ----
NM_003150chr1771650 1571 628 614 453 163 44 191 21489 744 --
NM_003156chr1131282 1186 143 ------
NM_003161chr1753542 3485 3045 911 746 23412 2658 ----
NM_003173chrX91250 1150 217 205 132 122 112 102 54 --2928 349 --
NM_003178chr372232 2146 2107 1897 1724 1654 173 ------
NM_003185chr201999 11184 ----
NM_003186chr11194 --1148 --
NM_003189chr143295 3212 2476 914 1364 23072 2886 --
NM_003194chr6175 ------
NM_003198chr11272 ------
NM_003199chr1874660 4599 4520 4509 1842 1464 1174 ------
NM_003200chr1941531 906 292 108 ------
NM_003202chr5101669 1429 1415 1181 487 470 454 235 98 47 21593 1458 ----
NM_003204chr1721417 1321 ------
NM_003214chr661151 1092 1036 100 55 41 ------
NM_003216chr2283078 2981 2889 2745 2416 493 460 38 12609 22938 121 --
NM_003221chr632742 1131 603 13677 21501 838 --
NM_003222chr201917 ------
NM_003236chr243536 2472 2360 127 11347 11336 --
NM_003238chr1------1191
NM_003242chr372429 2061 2047 917 608 273 224 11013 1574 --
NM_003244chr181338 ------
NM_003246chr1561724 1608 691 616 264 54 ------
NM_003247chr631975 1669 100 ------
NM_003253chr2111240 21764 713 ----
NM_003257chr1511069 --1454 --
NM_003262chr354652 3831 3337 1294 871 14925 ----
NM_003269chr62304 222 --11229 --
NM_003286chr20175 1863 ----
NM_003291chr132811 253 ------
NM_003298chr3125860 5803 4463 4446 3974 1845 1301 1259 1151 724 431 420 --1768 --
NM_003304chr321501 1479 1389 ----
NM_003305chr42363 290 ------
NM_003319chr221018 823 ----1808
NM_003325chr222554 539 182 ----
NM_003336chrX21005 410 --1208 1941
NM_003337chr561366 1352 1183 1066 603 366 11395 11486 --
NM_003338chr102640 254 11594 ----
NM_003339chr511579 1131 ----
NM_003340chr4--31209 362 160 ----
NM_003342chr1753242 3131 2559 2483 580 12582 ----
NM_003345chr162477 106 --1368 --
NM_003347chr2262243 1967 1733 919 833 106 ------
NM_003348chr1221138 213 ------
NM_003352chr21120 ------
NM_003368chr11277 ------
NM_003369chr112467 65 --12789 --
NM_003370chr191134 ------
NM_003372chrX1720 1356 ----
NM_003373chr1041693 1289 516 231 ------
NM_003374chr51300 ------
NM_003376chr62585 182 ------
NM_003376chr62585 182 ------
NM_003379chr61368 ----1806
NM_003383chr91391 ------
NM_003387chr252931 2351 1104 895 171 ------
NM_003390chr11----21093 417 --
NM_003392chr344266 3299 2930 1332 ------
NM_003399chrX31057 1009 201 ------
NM_003400chr21756 ------
NM_003403chr142803 40 1815 ----
NM_003404chr2031673 1661 1299 1533 ----
NM_003405chr22------1593
NM_003406chr82616 432 ------
NM_003409chr1821100 242 ------
NM_003410chrX22282 1967 1527 1888 --
NM_003411chrY1398 11848 11522 --
NM_003412chr322371 989 1270 --12917
NM_003413chrX31896 470 307 ------
NM_003421chr1034412 4086 374 64205 3953 3591 1512 1377 361 13276 13101
NM_003430chr19--1667 140 --
NM_003439chr783577 3563 3223 2892 2588 2276 2262 1125 22441 2305 12398 1786
NM_003452chr92975 727 ------
NM_003454chr1631370 500 209 ------
NM_003458chr352958 2663 1585 1324 845 12706 23119 218 --
NM_003466chr241918 518 434 383 12336 ----
NM_003467chr22469 398 ------
NM_003468chr221207 354 ------
NM_003471chr3--1171 11662 --
NM_003482chr124931 459 275 226 --1320 --
NM_003483chr123833 407 110 --1755 --
NM_003489chr2172970 2639 2620 1056 1004 965 950 --33006 974 904 --
NM_003506chr83946 484 101 1195 ----
NM_003507chr231865 1828 589 11757 ----
NM_003551chr51472 ------
NM_003559chr1773511 2616 1478 1371 886 770 290 --21064 199 --
NM_003563chr1741131 987 578 310 --11281 2976 321
NM_003565chr1241651 1241 480 182 --11187 --
NM_003566chr1252872 1357 1037 929 405 ------
NM_003574chr1875442 4709 4282 3839 3732 2319 1220 44719 1377 905 671 ----
NM_003576chr1342797 2337 936 687 11963 22717 1061 --
NM_003583chr1273271 2921 2520 1551 741 531 129 ------
NM_003589chr13166 --1965 --
NM_003590chr263652 3406 2651 1571 557 392 ------
NM_003592chr71343 --1326 --
NM_003597chr252152 1559 1530 848 169 ------
NM_003601chr4--1204 ----
NM_003603chr462014 1463 1437 1367 128 32 --147 162
NM_003607chr163891 3547 797 776 244 84 11017 ----
NM_003615chr322484 1030 12638 ----
NM_003620chr171390 ------
NM_003628chr2--1513 ----
NM_003629chr163167 2765 2585 2243 1315 613 --13006 --
NM_003630chr61161 ------
NM_003632chr173599 584 576 ------
NM_003633chr522400 146 11038 ----
NM_003637chr11481 ------
NM_003645chr151202 159 ----
NM_003651chr12121 ------
NM_003655chr171765 --160 --
NM_003663chr312831 1235 ----
NM_003672chr121315 55 ------
NM_003679chr132873 2496 408 11156 ----
NM_003688chrX138 ------
NM_003701chr131942 1377 ----
NM_003705chr24735 327 277 34 ------
NM_003711chr52236 77 ------
NM_003718chr7----1483 --
NM_003722chr32429 170 21832 160 ----
NM_003728chr42221 105 ------
NM_003735chr52165 65 ------
NM_003736chr52165 65 ------
NM_003743chr242245 2023 1661 1621 ----11500
NM_003749chr133398 179 137 --1607 --
NM_003758chr1531609 1187 434 ------
NM_003758chr1531609 1187 434 ------
NM_003759chr444087 4023 3664 1205 ----1335
NM_003763chr2073115 2589 2540 2226 2104 1126 420 ------
NM_003766chr172502 453 ------
NM_003768chr131492 650 469 ------
NM_003772chr112332 160 ------
NM_003774chr1252567 2452 1075 781 115 12072 ----
NM_003783chr121209 1048 ------
NM_003787chr1821449 595 1654 1390 --
NM_003794chr31958 ------
NM_003796chr191442 ------
NM_003800chr632126 1973 663 11502 ----
NM_003822chr142589 2013 513 473 ------
NM_003827chr193566 97 42 ------
NM_003846chr12705 301 ------
NM_003858chr142239 93 ------
NM_003861chr1452506 1797 1114 1047 683 ------
NM_003872chr212396 1451 1753 --
NM_003873chr1012411 1405 ----
NM_003877chr121948 1194 ----
NM_003884chr331167 641 125 --11604 --
NM_003887chr241730 1671 1583 874 12192 11701 --
NM_003893chr10293 38 ------
NM_003895chr2121495 758 ------
NM_003899chr1342329 1664 562 370 --12502 --
NM_003904chr112363 127 ------
NM_003913chr633756 3483 746 --1283 --
NM_003927chr183986 435 301 11061 1992 --
NM_003930chr741987 860 618 221 ------
NM_003934chr911317 ------
NM_003939chr1053542 3325 985 774 302 1706 33665 1665 507 13210
NM_003941chr732283 927 371 1239 ----
NM_003949chr1771993 1595 798 612 240 57 37 --11973 --
NM_003955chr1731266 1082 646 1211 ----
NM_003956chr101449 273 55 ----
NM_003958chr673540 3023 2873 2777 2669 1141 153 13785 ----
NM_003966chr5137494 7413 7123 6746 6716 6677 5710 5399 2532 1294 804 577 385 27348 1505 14801 12812
NM_003968chr33571 542 217 ------
NM_003972chr101945 ------
NM_003980chr621100 412 --11032 --
NM_003983chr1634390 1178 699 2974 421 2786 738 --
NM_003993chr14281 229 125 28 ------
NM_004006chrX22001 824 11981 ----
NM_004007chrX22001 824 11981 ----
NM_004009chrX22001 824 11981 ----
NM_004010chrX22001 824 11981 ----
NM_004011chrX22001 824 11981 ----
NM_004012chrX22001 824 11981 ----
NM_004013chrX22001 824 11981 ----
NM_004014chrX22001 824 11981 ----
NM_004015chrX22001 824 11981 ----
NM_004016chrX21915 738 11895 ----
NM_004017chrX22001 824 11981 ----
NM_004018chrX21915 738 11895 ----
NM_004019chrX1394 1176 ----
NM_004020chrX22001 824 11981 ----
NM_004021chrX21915 738 11895 ----
NM_004022chrX21915 738 11895 ----
NM_004023chrX21915 738 11895 ----
NM_004024chr12564 456 ------
NM_004028chr1824118 699 ------
NM_004034chr103542 534 467 ------
NM_004035chr1754006 3356 1741 1727 1675 45018 3162 1770 1453 44448 3654 1868 42 --
NM_004040chr231192 1172 933 --2122 21 --
NM_004050chr1412147 --1778 --
NM_004055chr1151851 783 430 329 44 ------
NM_004056chr83179 158 96 --11009 --
NM_004067chr731127 609 505 183 ----
NM_004077chr121953 ------
NM_004089chrX2425 152 1395 ----
NM_004093chr1353241 830 558 532 382 1539 22142 21 --
NM_004094chr1442925 2541 2087 1908 11936 ----
NM_004096chr1021686 804 21307 175 --155
NM_004098chr101505 ------
NM_004099chr942118 2016 1802 744 1342 ----
NM_004102chr11423 ------
NM_004107chr19180 ------
NM_004113chr312054 --1470 --
NM_004117chr622207 592 ------
NM_004123chr17----151 --
NM_004124chr1452719 2376 748 641 408 ------
NM_004132chr1041163 1129 462 269 ------
NM_004134chr52699 629 ------
NM_004137chr5397 74 27 ------
NM_004156chr8143 ------
NM_004161chr21986 ------
NM_004169chr172285 28 2656 69 ----
NM_004171chr11129379 8340 8063 8031 6608 6539 3717 1209 1022 847 527 222 --18717 --
NM_004177chr1141305 1229 487 253 2695 197 1325 --
NM_004187chrX11166 1251 ----
NM_004193chr102355 121 ------
NM_004203chr16124 ------
NM_004209chr1631167 868 305 --1198 --
NM_004210chr1051711 1590 1391 387 361 2683 321 12137 --
NM_004215chr81156 1428 ----
NM_004225chr841012 962 945 51 --169 144
NM_004226chr21108 ------
NM_004229chrX51452 852 735 552 149 ------
NM_004232chr183452 28 21 ------
NM_004233chr651591 1524 597 388 135 ------
NM_004235chr91617 ------
NM_004236chr15----1507 --
NM_004240chr19177 ------
NM_004242chr62398 352 ------
NM_004255chr15164 ------
NM_004263chr211761 1253 ----
NM_004267chr31142 ------
NM_004273chr1094434 4355 4242 3920 3751 3127 1399 1121 105 14136 11462 13579
NM_004274chr1421297 51 --11057 12119
NM_004277chr61140 --161 --
NM_004279chr732290 1830 1551 --1330 --
NM_004286chr2262735 2491 2083 968 511 258 ------
NM_004293chr973666 3644 3444 2353 576 94 51 1145 ----
NM_004302chr1262712 2163 1852 1099 742 647 --1299 --
NM_004311chr102749 95 ----12380
NM_004319chr182209 2108 776 759 747 632 183 59 12779 12048 --
NM_004321chr273495 2734 2644 892 590 562 72 22631 744 43189 3005 2177 1250 13553
NM_004323chr92972 438 21001 78 1529 --
NM_004326chr11262 1168 ----
NM_004329chr1021092 888 1410 ----
NM_004330chr1531173 970 303 --1395 --
NM_004331chr822634 2351 21991 1780 11033 --
NM_004338chr1876908 5461 5288 2520 2444 654 197 26933 6094 15595 14906
NM_004342chr721680 415 22213 303 ----
NM_004365chr51124 ------
NM_004371chr14425 305 291 79 1334 11328 --
NM_004379chr251573 1545 1531 185 23 --11666 --
NM_004380chr1632093 1679 67 ------
NM_004381chr61134 ------
NM_004384chr52500 46 ------
NM_004389chr22174 83 ------
NM_004392chr1332051 446 185 --11001 --
NM_004397chr1143219 1696 1264 199 --13845 1905
NM_004419chr103323 279 79 ------
NM_004420chr1162398 2227 2165 2117 2055 348 22180 2070 1931 --
NM_004423chr352422 1735 663 505 166 11764 11852 195
NM_004426chr122588 249 --1772 --
NM_004427chr131135 148 36 11060 ----
NM_004429chrX31208 1153 415 11200 ----
NM_004432chr972336 2277 2047 1723 658 610 231 ------
NM_004438chr262074 561 409 271 75 56 1983 11057 --
NM_004439chr4143 ------
NM_004440chr63781 520 139 1245 ----
NM_004441chr311215 ------
NM_004443chr32480 293 ------
NM_004449chr2141402 927 436 229 ------
NM_004454chr332115 1698 1472 ------
NM_004458chrX22243 2145 ------
NM_004459chr1731975 1878 492 ------
NM_004463chrX1118 ------
NM_004464chr433843 583 440 ------
NM_004472chr52457 171 ------
NM_004482chr22707 648 1641 ----
NM_004485chr174373 4318 3544 3376 2822 1746 144 11223 13195 --
NM_004491chr1964239 1607 1521 1397 1235 458 --33023 1131 544 --
NM_004496chr1411098 1421 ----
NM_004499chr52433 117 ------
NM_004500chr141166 22065 1710 ----
NM_004501chr133380 3366 2958 23842 3409 1321 13574
NM_004504chr242877 2334 1044 559 22359 2142 ----
NM_004505chr1731640 745 257 --11963 --
NM_004506chr61132 ------
NM_004514chr1752560 2360 2342 2261 795 1172 3630 317 230 --
NM_004516chr19--1483 11049 --
NM_004521chr102326 144 ------
NM_004525chr22553 475 11336 ----
NM_004528chr1195 ------
NM_004529chr911221 ------
NM_004530chr1631169 812 137 --11036 --
NM_004543chr2122 ------
NM_004560chr91409 ------
NM_004566chr1052579 927 813 761 488 --1947 --
NM_004571chr2163303 3234 2836 2825 1219 103 21332 882 23018 2476 122
NM_004575chr421383 1150 --1617 --
NM_004583chr172174 78 141 ----
NM_004586chrX125212 4449 3461 1930 1502 1375 1315 919 874 581 394 87 11545 11638 --
NM_004588chr11123901 3236 2557 1197 1163 1149 1062 969 858 345 250 119 --13872 --
NM_004592chr122173 83 ------
NM_004593chr31837 ------
NM_004594chr162946 837 1804 1929 --
NM_004596chr19----1171 --
NM_004600chr12463 302 --1625 --
NM_004602chr2021472 315 ------
NM_004615chrX4667 640 306 109 ------
NM_004626chr112540 149 ------
NM_004631chr121044 324 ------
NM_004637chr311281 ------
NM_004642chr123685 656 130 ------
NM_004651chrX1355 1319 ----
NM_004654chrY11328 ------
NM_004655chr1721079 987 1351 21156 1150 --
NM_004660chrY----1639 21830 1425
NM_004663chr1541264 1112 599 166 1313 ----
NM_004684chr41352 ------
NM_004685chr1332228 2118 642 ------
NM_004686chr82360 326 1287 --1423
NM_004687chr1741835 1286 847 467 --11578 --
NM_004703chr1762370 2256 2186 1814 719 31 1586 ----
NM_004705chr112182 136 ------
NM_004709chrX31562 1360 65 1642 ----
NM_004711chr2293597 3535 3053 2323 1217 1111 281 93 37 ----13318
NM_004713chr142532 241 ------
NM_004716chr11186 ------
NM_004717chr741500 292 208 46 1128 ----
NM_004723chr12825 145 ------
NM_004726chrX55689 5275 2207 157 151 24776 206 14613 --
NM_004730chr531804 700 575 11569 ----
NM_004731chr1221453 1422 2672 242 11732 11250
NM_004734chr1342336 2259 1252 1050 1195 1425 --
NM_004736chr131740 519 79 --1490 --
NM_004742chr321471 1316 1497 ----
NM_004745chr885974 2577 2550 1572 1547 1472 694 241 --16447 15465
NM_004747chr1031102 544 141 140 ----
NM_004748chr1523161 416 13819 --14028
NM_004755chr1431138 753 35 ------
NM_004756chr1941067 1053 379 47 11453 11188 --
NM_004760chr741584 811 777 244 --21542 736 --
NM_004762chr1761620 1598 1507 757 204 61 --21801 536 --
NM_004766chr3--124 ----
NM_004768chr13961 282 34 ------
NM_004772chr511347 --11468 11018
NM_004774chr17------12252
NM_004775chr182918 825 21498 699 ----
NM_004776chr2011301 12633 ----
NM_004779chr54872 345 116 108 ------
NM_004781chr121735 595 ------
NM_004781chr121735 595 ------
NM_004788chr1112138 12764 ----
NM_004798chr2053685 2975 971 575 214 33261 3222 2234 ----
NM_004799chr1170 ------
NM_004808chr1052939 2925 2238 749 735 12968 13061 --
NM_004818chr122468 32 ------
NM_004821chr52555 166 ------
NM_004824chr6----11366 --
NM_004830chr61299 2759 661 ----
NM_004831chr1921003 418 ----1337
NM_004840chrX52051 2001 1533 556 42 --1477 --
NM_004842chr631570 1238 447 11535 ----
NM_004850chr251543 1529 1505 1274 418 11572 1584 1633
NM_004856chr151462 ------
NM_004857chr1443498 789 668 310 14057 --11863
NM_004859chr1732928 2287 237 12270 ----
NM_004865chr6139 ------
NM_004866chr584131 4117 3076 3049 1854 1313 123 40 --24255 1088 --
NM_004869chr1821123 640 1669 ----
NM_004871chr17124290 4024 4010 2870 1753 1330 1256 1095 919 840 800 727 24127 600 ----
NM_004874chr81390 154 ----
NM_004884chr1541716 656 619 453 ------
NM_004887chr52451 164 1346 ----
NM_004896chr1041316 1224 571 493 --11385 --
NM_004897chr101769 1321 ----
NM_004898chr432013 1074 645 ----12216
NM_004904chr786025 5547 5231 4682 2600 1252 590 561 15115 ----
NM_004906chr62665 549 ------
NM_004907chr194998 734 680 236 ------
NM_004921chr12718 364 --1970 --
NM_004922chr1021030 972 ------
NM_004925chr91183 ------
NM_004926chr144578 569 512 139 ------
NM_004927chr11--11492 ----
NM_004929chr8122 11091 ----
NM_004936chr962973 2818 2754 2003 1203 711 13031 1404 --
NM_004945chr191231 ------
NM_004947chr352436 2006 1946 1860 542 12570 ----
NM_004956chr744524 536 414 175 ------
NM_004961chrX51095 978 472 466 177 11540 ----
NM_004966chr102930 860 ------
NM_004972chr91406 ------
NM_004973chr6----1653 --
NM_004975chr204972 659 216 66 ----1617
NM_004978chr131708 1418 585 2317 284 11062 --
NM_004979chrX1763 1354 ----
NM_004985chr1224255 3150 ------
NM_004991chr3----193 --
NM_004992chrX125565 2967 2834 2823 2527 2288 2103 1337 1116 1098 319 247 17963 58476 8203 8034 1782 634 --
NM_004992chrX125565 2967 2834 2823 2527 2288 2103 1337 1116 1098 319 247 17963 58476 8203 8034 1782 634 --
NM_004995chr1431056 365 191 1293 --1317
NM_004996chr1651627 1496 686 625 589 --11094 --
NM_005006chr22964 387 ------
NM_005010chr721914 1666 --156 --
NM_005012chr11120 ------
NM_005017chr31209 ------
NM_005025chr31233 ------
NM_005026chr152045 1568 1551 378 97 --31658 367 240 --
NM_005028chr1012218 2909 175 ----
NM_005032chrX3771 717 704 2941 222 ----
NM_005036chr2297031 6873 6684 5564 5479 1974 1624 625 421 36229 5248 2003 11708 --
NM_005044chrX53521 3228 826 642 66 3990 788 532 1131 --
NM_005045chr7--2118 79 ----
NM_005054chr241490 1339 1172 164 ------
NM_005056chr1285585 5084 4896 3487 1329 717 329 135 15306 13430 --
NM_005065chr1474161 4077 3582 3316 2154 1465 61 ------
NM_005066chr11260 ------
NM_005077chr93419 183 108 ------
NM_005080chr222813 98 ------
NM_005087chr32552 106 ------
NM_005096chrX--1181 11180 --
NM_005097chr10190 ------
NM_005109chr352255 1986 1782 885 388 2677 256 --1491
NM_005116chr2064177 3787 3671 2909 680 617 ------
NM_005117chr112779 683 --2887 50 --
NM_005121chr171433 ------
NM_005126chr341544 282 225 194 --11482 --
NM_005134chr181780 ------
NM_005135chr1553258 3213 1392 1378 923 21421 174 23394 153 --
NM_005137chr2232255 966 678 1336 138 --
NM_005140chrX2781 660 ------
NM_005151chr181597 ------
NM_005156chr935403 3564 1295 11840 21781 1773 --
NM_005157chr961800 1320 722 196 183 106 ------
NM_005163chr14------1776
NM_005168chr221481 287 --11233 --
NM_005171chr1221117 1005 ------
NM_005181chr8--2835 697 ----
NM_005182chr162523 453 178 ----
NM_005184chr1951628 1301 1169 1128 1086 --11008 --
NM_005188chr11128128 7068 5921 5796 3084 3060 3028 2491 2249 1286 276 66 11391 ----
NM_005190chr6133 ------
NM_005197chr1496080 5709 5197 4932 4737 4265 2375 1690 381 15587 --1553
NM_005201chr31135 ------
NM_005203chr101100 ------
NM_005204chr101291 ------
NM_005206chr1731339 1219 254 ------
NM_005207chr2253365 2890 2495 2466 1036 23003 2793 21211 865 --
NM_005214chr21240 ------
NM_005220chr173559 273 57 --1410 --
NM_005224chr19--1238 ----
NM_005225chr202985 392 --1947 --
NM_005227chr13451 424 391 ------
NM_005230chr122118 70 ------
NM_005231chr1111417 ------
NM_005235chr287523 6253 6035 5833 4873 1087 1058 37 11647 17737 --
NM_005241chr31293 1408 ----
NM_005245chr43665 232 136 ------
NM_005248chr11540 ------
NM_005254chr151898 ------
NM_005256chr111901 ------
NM_005264chr101639 1753 ----
NM_005276chr1241702 1530 599 68 --41450 1313 681 159 --
NM_005276chr1241702 1530 599 68 --41450 1313 681 159 --
NM_005277chr421945 161 1135 11207 --
NM_005279chr2--1585 ----
NM_005284chr62355 176 ------
NM_005311chr752613 2581 1853 908 865 22590 2256 21050 98 --
NM_005312chr962655 2576 2498 1983 896 749 1673 ----
NM_005316chr111117 ------
NM_005324chr1721984 1862 11739 1645 --
NM_005328chr81242 1266 ----
NM_005329chr1632358 2309 747 1396 1254 2506 354
NM_005334chrX41665 1627 1085 99 --1662 --
NM_005336chr262179 1804 855 723 615 492 --1148 --
NM_005338chr743597 3477 3018 1609 23641 3506 13369 --
NM_005339chr421028 59 ------
NM_005342chrX42674 2452 2151 281 --12107 --
NM_005358chr1331592 244 229 ------
NM_005359chr1895257 2553 2480 2423 1693 1664 1391 1362 255 14656 ----
NM_005368chr223504 184 30 1349 ----
NM_005370chr1931292 889 233 ------
NM_005375chr61898 ------
NM_005376chr12864 194 11039 ----
NM_005378chr22864 854 ------
NM_005380chr131078 1026 413 ------
NM_005381chr2--167 ----
NM_005386chr202876 53 1638 1124 --
NM_005387chr11----1151 --
NM_005392chr941565 1508 1406 63 ------
NM_005399chr154379 3884 1553 1196 41 2608 76 --1667
NM_005400chr242412 1029 902 176 --11919 --
NM_005402chr72542 521 --11293 --
NM_005406chr1811109 2523 45 ----
NM_005430chr124944 177 157 100 ------
NM_005433chr1822678 964 11986 ----
NM_005435chr71567 ------
NM_005436chr1043066 2520 1266 652 12779 ----
NM_005437chr103984 937 269 ------
NM_005442chr3--2602 533 ----
NM_005455chr121576 61 ------
NM_005458chr932052 895 257 ----1180
NM_005460chr51579 ------
NM_005465chr12790 100 12061 ----
NM_005475chr1252225 2018 1032 755 196 23120 2762 ----
NM_005476chr931180 432 418 ------
NM_005479chr101234 11616 ----
NM_005487chr2251974 1548 1415 414 334 ------
NM_005494chr72240 114 ------
NM_005497chr17116038 5281 5160 5146 4851 4467 4258 4244 3873 2083 2005 14419 14378 --
NM_005502chr943084 2564 2508 938 ------
NM_005504chr1296498 4450 4352 2429 2180 1981 1049 775 100 11088 ----
NM_005507chr112318 46 --131 --
NM_005509chr531593 1213 307 ------
NM_005513chr321552 614 ------
NM_005517chr131432 1181 403 --1484 --
NM_005520chr5153 ------
NM_005521chr102793 669 --1228 --
NM_005522chr7135 ------
NM_005523chr721593 1459 ------
NM_005529chr14997 927 781 225 1413 ----
NM_005530chr1521165 228 ------
NM_005537chr1321082 1061 --1704 --
NM_005540chr141225 1211 97 52 21393 1254 ----
NM_005563chr12264 244 ------
NM_005570chr181355 --11075 --
NM_005573chr5150 ------
NM_005574chr11283 61 ------
NM_005578chr374050 3974 3344 3109 1316 314 108 34728 4646 822 ----
NM_005587chr152272 190 ------
NM_005595chr11657 ------
NM_005596chr964928 2565 2207 1563 1080 256 ------
NM_005598chr171551 1541 1442 1288 1080 301 182 ------
NM_005599chr141422 1126 148 28 --11022 --
NM_005603chr1831430 540 241 2569 270 ----
NM_005604chr621885 338 ------
NM_005607chr83746 131 101 ------
NM_005610chr1--1714 ----
NM_005613chr132205 1693 878 11563 ----
NM_005619chr192279 29 1160 ----
NM_005626chr11490 ------
NM_005632chr164925 263 194 58 ------
NM_005638chrX21575 1338 31672 1469 1434 21398 1177 --
NM_005639chr1221763 1206 --1685 --
NM_005647chrX83366 3102 2961 2368 1294 1276 903 863 ------
NM_005648chr8150 ------
NM_005650chr2221271 167 ------
NM_005663chr43544 89 31 ------
NM_005667chr21371 ------
NM_005668chr574369 3031 1750 1141 814 162 30 --1802 --
NM_005670chr641662 1535 346 136 190 ----
NM_005678chr152768 279 ------
NM_005688chr31949 ------
NM_005717chr111263 11146 196 --
NM_005721chr2162 ------
NM_005724chr151166 ------
NM_005731chr2285 51 ------
NM_005734chr111614 ------
NM_005737chr222289 2046 22212 452 1440 --
NM_005738chr721402 785 1793 ----
NM_005739chr1542199 1701 1496 299 --1705 --
NM_005740chr223717 675 52 ------
NM_005746chr732202 1702 785 --12240 --
NM_005748chr1233374 2708 485 ------
NM_005749chr171639 ------
NM_005751chr72419 344 ------
NM_005756chrX21300 114 ------
NM_005759chr241806 1278 603 457 13207 23472 3308 1570
NM_005766chr13191 11255 21246 925 --
NM_005776chr141271 ------
NM_005779chr542727 1395 1204 390 23490 3472 1929 --
NM_005786chr182970 225 1431 11111 --
NM_005797chr1141749 1224 717 395 11510 ----
NM_005806chr2121255 400 --1150 1898
NM_005807chr12718 251 ------
NM_005808chr372972 2347 2182 1148 335 141 27 ------
NM_005819chr162645 2601 1389 1118 356 248 22798 885 11370 --
NM_005822chr611854 11976 1318 --
NM_005828chr1784540 4142 3790 1615 1303 571 412 200 21557 666 13110 24946 865
NM_005832chr311290 ------
NM_005840chrX107678 7120 6903 6300 2788 2715 2293 1586 851 668 17094 22820 1881 17500
NM_005841chr4122 1238 2782 200 --
NM_005842chr131675 ------
NM_005843chr211808 ------
NM_005851chr112345 289 ------
NM_005852chr171270 ------
NM_005859chr521425 590 ------
NM_005862chr321026 334 ------
NM_005866chr93873 240 65 ------
NM_005871chr102294 259 ------
NM_005875chr31134 1281 ----
NM_005880chr1621240 109 --1396 1225
NM_005895chr1253452 3224 2948 941 457 --31414 1392 372 --
NM_005897chr151119 978 964 919 177 21150 206 11107 --
NM_005898chr1163009 2696 1256 686 586 170 ------
NM_005899chr171143 ------
NM_005900chr41352 1755 ----
NM_005901chr18118651 8613 2692 2610 1764 1612 1512 1345 1218 433 142 11980 --1120
NM_005902chr1583833 2862 1795 1695 1134 1125 894 140 --14539 --
NM_005903chr574982 4192 3592 1331 1317 941 853 43629 3472 3415 1493 13481 --
NM_005904chr1831518 1371 328 --1513 --
NM_005909chr574078 3802 3604 2825 981 648 115 --23913 1144 --
NM_005920chr133314 1058 620 13678 ----
NM_005923chr61103 ------
NM_005933chr1142879 1925 1210 561 12964 ----
NM_005934chr1982360 2326 2050 1712 396 142 86 64 12197 ----
NM_005935chr463917 3762 3598 3554 2019 520 24738 917 ----
NM_005937chr1731335 452 190 --24155 82 1368
NM_005938chrX21249 171 --21360 1233 --
NM_005941chr814179 ------
NM_005955chr154254 4053 3717 3585 2000 ------
NM_005964chr1721226 240 11432 21520 479 --
NM_005966chr222022 626 --12398 --
NM_005967chr122662 129 --1262 --
NM_005968chr191213 ------
NM_005975chr201862 1796 1989 1725
NM_005977chr132935 280 ------
NM_005985chr202618 32 --1561 --
NM_005994chr172740 211 ------
NM_006005chr42307 94 ------
NM_006007chr983784 1696 1504 1369 1257 1012 870 120 11660 13937 1826
NM_006011chr15154267 4167 4153 4142 3733 3577 3524 3405 3109 3068 2940 2686 1103 387 155 31535 804 250 14206 --
NM_006016chr631881 1749 625 12161 --11476
NM_006022chr131990 --11070 --
NM_006024chr72211 119 ------
NM_006033chr1822209 1527 --1761 --
NM_006035chr1451300 1127 359 231 193 --11211 --
NM_006037chr283662 3174 1490 1055 1027 1020 193 81 14622 13956 --
NM_006038chr2042085 423 358 222 --12015 1107
NM_006040chr163466 206 89 1909 31291 425 220 --
NM_006047chr2021288 517 ------
NM_006054chr1131615 1103 277 1604 ----
NM_006055chr253040 2977 1158 550 323 ------
NM_006076chr782993 2979 2493 2401 2053 780 590 73 --11015 --
NM_006080chr723004 1829 ------
NM_006084chr142310 226 ------
NM_006085chr1154 183 2945 172 --
NM_006094chr832423 1925 1741 --1345 --
NM_006095chr433806 3545 705 11313 ----
NM_006099chr12779 357 ------
NM_006106chr1123318 2567 13167 ----
NM_006135chr131471 526 401 ------
NM_006139chr252411 2192 860 331 45 22610 889 1973 --
NM_006141chr1672498 2361 2300 1980 619 391 258 ------
NM_006148chr1732667 530 300 ------
NM_006154chr1541925 920 543 258 --1894 --
NM_006159chr121579 ------
NM_006161chr51246 1134 ----
NM_006162chr1831647 250 134 --11451 --
NM_006164chr21321 ------
NM_006166chr1232190 2068 1772 11900 11940 --
NM_006177chr143825 760 96 ------
NM_006185chr113177 54 30 --1459 --
NM_006186chr211069 ------
NM_006190chr211078 186 ----
NM_006191chr121917 ------
NM_006194chr1431130 941 52 ------
NM_006195chr92968 211 --11047 --
NM_006197chr831898 662 510 178 ----
NM_006201chrX5453 227 128 120 101 ------
NM_006203chr565496 5261 3698 753 655 101 11890 --15148
NM_006206chr422762 219 12363 ----
NM_006216chr2170 ------
NM_006224chr1761978 1671 772 695 264 23 --11661 12213
NM_006226chr221144 404 ------
NM_006242chr2051899 1444 187 48 23 1569 11490 --
NM_006245chr63880 270 106 1292 --1143
NM_006246chr141142 ------
NM_006251chr543396 3130 2485 2059 ------
NM_006255chr141881 1736 ----
NM_006256chr142585 2206 870 774 ------
NM_006258chr103988 503 348 ------
NM_006267chr241185 693 575 31 ------
NM_006282chr2073916 3388 1825 1569 421 113 86 33959 3546 1120 13620 --
NM_006283chr844801 4748 4117 370 ------
NM_006292chr111173 ------
NM_006306chrX64530 2304 1280 1154 914 242 1512 ----
NM_006312chr125923 344 233 135 119 ------
NM_006313chr12--31682 1379 1322 --11672
NM_006315chr432847 1777 667 11575 1640 --
NM_006317chr5----1705 1336
NM_006321chr322218 738 --11765 --
NM_006325chr122848 122 --1658 --
NM_006335chr13951 863 137 1204 ----
NM_006336chr931323 1163 568 ------
NM_006350chr51130 ------
NM_006352chr121508 133 ------
NM_006357chr2142 ----1498
NM_006359chrX22218 1544 22101 320 12013 1754
NM_006364chr141465 ------
NM_006367chr13803 695 134 ----1865
NM_006371chr3104613 3450 1063 933 840 587 546 526 453 185 14003 33906 1981 340 14965
NM_006372chr6193 ------
NM_006375chrX31651 731 164 ------
NM_006377chr921226 885 1787 ----
NM_006380chr1743597 3028 1619 643 21381 590 ----
NM_006387chr1931018 913 114 --2836 328 --
NM_006389chr111184 ------
NM_006390chr1231141 140 124 ------
NM_006415chr91989 ------
NM_006420chr2052668 2622 1213 1123 103 ------
NM_006421chr821213 814 178 ----
NM_006434chr1032756 2528 760 ----1593
NM_006449chr252179 1502 1379 798 142 ------
NM_006451chr521007 805 ------
NM_006454chr473047 2037 1938 770 719 674 460 --1526 --
NM_006457chr463325 2922 1173 1159 559 545 1723 23268 680 --
NM_006459chr1041860 1688 565 107 1535 2815 438 --
NM_006467chr51415 21839 506 ----
NM_006469chr141448 1252 1246 66 11261 ----
NM_006472chr121198 801 --21172 516 --
NM_006482chr1273271 2921 2520 1551 741 531 129 ------
NM_006489chr1451440 1370 1311 1269 763 1613 1601 --
NM_006496chr11242 ------
NM_006500chr114992 324 166 116 --1440 --
NM_006504chr1062669 2315 2039 2020 401 137 ----11862
NM_006513chr11222 ------
NM_006516chr161507 1501 1271 1207 1012 355 1567 ----
NM_006517chrX21576 89 1126 ----
NM_006519chr61108 ------
NM_006520chrX31676 1092 305 1611 ----
NM_006526chr2051654 710 692 483 395 ------
NM_006527chr4----291 85 --
NM_006532chr1911977 1101 1313 --
NM_006534chr2052706 2676 2550 1301 719 --12874 --
NM_006537chr15195 ------
NM_006540chr821051 44 ------
NM_006544chr1435794 5370 3891 15427 ----
NM_006546chr17136095 6066 5834 5617 4792 4780 4055 2366 2170 1463 1159 247 103 22058 135 1694 --
NM_006547chr71272 ------
NM_006548chr321332 690 2110 55 ----
NM_006557chr911476 --1307 --
NM_006559chr12945 285 ------
NM_006560chr11--1356 ----
NM_006561chr1085531 4007 2382 2152 1965 1946 1772 1537 14150 26022 4967 --
NM_006565chr16159 ------
NM_006575chr14----11193 --
NM_006599chr16108173 7482 7159 6894 6226 5818 2213 1403 1182 935 23003 1223 15320 --
NM_006601chr1211061 ------
NM_006609chr252308 1834 1090 270 70 ----12546
NM_006614chr323475 184 ------
NM_006621chr171808 1733 1706 578 436 330 304 132 ----
NM_006622chr51229 ------
NM_006625chr1----1474 --
NM_006625chr1----1474 --
NM_006625chr1----1474 --
NM_006626chr942673 2335 552 417 ------
NM_006628chr1544529 3912 1855 1163 11344 14505 12874
NM_006629chr1882203 2138 2078 2027 1802 1792 1739 89 1444 1401 --
NM_006633chr5137 ------
NM_006636chr231031 296 172 ------
NM_006642chr1156 ------
NM_006646chr1372140 1173 1002 991 979 923 99 --1256 --
NM_006650chr573542 2892 2706 797 605 188 31 1985 ----
NM_006654chr1263328 3074 1220 530 136 29 ------
NM_006667chrX----1110 --
NM_006670chr61417 --1507 --
NM_006675chr1283335 3271 2652 1362 1288 664 473 73 --3728 426 229 --
NM_006677chr32175 38 --1109 --
NM_006682chr772641 2361 2252 361 347 212 63 2688 390 ----
NM_006690chr2072214 1914 1780 1764 581 447 28 ------
NM_006695chr17144 ------
NM_006696chr5----1111 --
NM_006698chr2031205 503 122 --1476 --
NM_006699chr14550 349 271 30 1186 ----
NM_006706chr5128 1106 ----
NM_006717chr922543 669 ------
NM_006720chr1055042 3505 3343 1430 182 ------
NM_006722chr342961 2656 2329 989 171 ----
NM_006726chr42876 334 178 21199 50 --
NM_006729chrX105548 5333 4943 4867 4518 3829 3496 657 593 464 11511 ----
NM_006732chr1921829 1805 11816 --12079
NM_006734chr631267 631 361 --11168 --
NM_006738chr1534158 4004 2949 24247 1322 ----
NM_006745chr411091 ------
NM_006746chrX21359 1012 11509 ----
NM_006749chr811059 ------
NM_006751chr2182 ------
NM_006764chr32384 160 --1343 --
NM_006765chr8127 ------
NM_006766chr82908 492 --12202 --
NM_006769chr11128 ------
NM_006772chr621622 370 1685 ----
NM_006775chr622344 2087 22280 1904 1123 --
NM_006777chrX42860 2485 1108 371 1584 ----
NM_006788chr1821751 52 --2533 400 --
NM_006793chr10123 ------
NM_006802chr13923 326 126 11111 ----
NM_006806chr212316 172 ------
NM_006807chr1731259 338 241 132 ----
NM_006810chr3147 ------
NM_006811chr2021003 695 ------
NM_006815chr1211248 ------
NM_006823chr811170 2258 30 1323 --
NM_006825chr121610 1130 ----
NM_006826chr221164 71 --1515 --
NM_006827chr1443357 2314 353 34 ------
NM_006837chr8--127 ----
NM_006838chr1241867 1322 1312 367 ------
NM_006851chr1242946 1887 1137 862 ------
NM_006852chr1722204 917 1861 ----
NM_006854chr741777 1748 1597 182 1763 126 --
NM_006874chr42945 898 ------
NM_006875chrX1353 ------
NM_006885chr1643389 3331 2736 1287 ----13726
NM_006888chr1452718 1270 1243 710 143 ------
NM_006910chr162115 42 ------
NM_006914chr921455 118 ----1170
NM_006920chr231291 580 510 --11738 --
NM_006922chr212322 ------
NM_006924chr172587 319 --11303 --
NM_006930chr51552 --1239 11245
NM_006931chr1231741 1727 424 11460 11851 --
NM_006940chr12------1515
NM_006948chr211308 ------
NM_006950chrX3861 820 150 ------
NM_006951chr101572 2675 559 ----
NM_006981chr91289 12225 144 --
NM_006990chr142463 1976 975 46 --22030 1005 --
NM_006991chr31175 1204 ----
NM_006999chr531374 774 191 21501 1388 ----
NM_007005chr93157 85 45 ------
NM_007008chr23696 316 165 ------
NM_007010chr1721520 95 --1510 11534
NM_007011chr15106465 6291 5416 4913 4701 1951 1642 1477 1212 141 15444 45536 922 616 271 11651
NM_007017chr5----1800 --
NM_007023chr22893 252 ----1825
NM_007024chr32167 27 1538 --177
NM_007026chr17----145 --
NM_007027chr3--2205 156 --1103
NM_007033chr121855 797 --11393 --
NM_007036chr52646 190 1922 ----
NM_007038chr2135285 2261 1130 1928 --25111 1298
NM_007040chr1921101 1031 --156 --
NM_007046chr22372 87 175 ----
NM_007050chr20128013 7589 7084 6083 5308 4998 2388 1447 1343 977 302 160 --17802 --
NM_007054chr563382 3111 2931 1322 1201 1187 42866 1365 1230 632 ----
NM_007067chr171372 --2469 286 --
NM_007073chr643474 3458 3373 68 --33608 1542 711 --
NM_007084chr1331265 294 233 ------
NM_007096chr9129 ------
NM_007111chr132871 136 ------
NM_007118chr53663 632 36 --1905 --
NM_007126chr9----1346 1353
NM_007144chr1751289 1236 1010 987 870 ------
NM_007146chr1712845 ------
NM_007158chr13910 359 233 1942 ----
NM_007159chr321588 1141 ------
NM_007174chr1252017 1590 280 243 219 --11538 --
NM_007189chr751277 1127 1015 217 36 21460 1058 2300 185 --
NM_007198chr831625 1276 137 1639 ----
NM_007200chr1534158 4004 2949 24247 1322 ----
NM_007212chr12868 277 ------
NM_007214chr621349 233 ------
NM_007217chr31397 ------
NM_007232chr202397 162 --2342 60 --
NM_007236chr1532087 1797 1631 --1823 --
NM_007245chr161652 --151 --
NM_007246chr43103 92 83 1717 ----
NM_007249chr13158600 8430 7725 6478 6377 3694 3670 3473 2553 2358 2334 2117 990 695 531 23486 1773 22168 1454 18754
NM_007257chr832775 2434 637 12358 1347 --
NM_007277chr52336 294 ------
NM_007278chr171119 ------
NM_007282chr31780 ------
NM_007285chr161403 ------
NM_007286chr541933 1823 849 239 --11996 --
NM_007292chr1754006 3356 1741 1727 1675 45018 3162 1770 1453 44448 3654 1868 42 --
NM_007308chr42520 468 --1155 --
NM_007313chr961800 1320 722 196 183 106 ------
NM_007324chr1170 ------
NM_007331chr442612 2442 956 190 1415 ----
NM_007345chr1821769 1447 --166 --
NM_007349chr71163 ------
NM_007350chr1264179 3084 2912 1278 803 78 2980 699 24294 3198 --
NM_007351chr42735 75 ------
NM_007358chr111797 --1154 --
NM_007359chr1711469 1230 ----
NM_007373chr1021786 1149 1708 ----
NM_007375chr152601 1877 998 574 486 12441 12461 12408
NM_012062chr121862 2256 61 ----
NM_012069chrX12064 1516 22138 473 169
NM_012072chr2043914 3356 3171 2780 21496 826 ----
NM_012073chr53380 153 70 ------
NM_012074chr1431075 1051 737 ------
NM_012081chr533480 2271 1269 1700 1740 --
NM_012082chr8192 --2897 386 --
NM_012089chr121372 286 --1158 --
NM_012090chr12956 364 ------
NM_012095chr1073152 3031 3017 2386 2179 512 266 13060 ----
NM_012096chr312660 12903 11504 1621
NM_012098chr921170 304 --1578 --
NM_012102chr12858 815 11014 ----
NM_012104chr1122895 103 12754 33016 186 89 --
NM_012104chr1122895 103 12754 33016 186 89 --
NM_012134chr171602 1405 1329 1245 754 665 24 ------
NM_012137chr142383 2236 605 188 ------
NM_012141chr1333861 2761 494 1637 --12580
NM_012156chr2053297 2170 585 504 470 53179 2162 2125 485 256 12652 --
NM_012157chr32978 285 1392 ----
NM_012158chr1341646 409 183 23 ----1744
NM_012161chr421088 60 ------
NM_012164chr9137470 7272 6617 6501 6432 6155 6103 6035 5946 5799 5520 2498 2449 26717 1127 12351 --
NM_012166chr931091 1038 135 --21524 1374 --
NM_012175chr111349 1812 ----
NM_012193chr11104685 4215 3665 3596 3421 3317 2024 1640 1528 941 34583 2096 874 14563 --
NM_012197chr941202 560 516 105 ----1551
NM_012199chr1134559 4382 3993 3622 3580 3309 3244 3151 1516 1003 821 720 242 ----11365
NM_012207chr101385 --141 --
NM_012214chr275761 5610 4660 2334 1293 1279 138 15460 34584 2484 2242 15550
NM_012215chr1051473 1463 764 365 46 1344 ----
NM_012218chr1952946 2782 1872 1011 36 21083 496 22952 1904 --
NM_012229chr1031124 1024 1010 11053 ----
NM_012233chr21859 --1837 --
NM_012234chr343100 2316 680 60 12950 21324 151 --
NM_012236chr16945 890 734 613 381 87 ------
NM_012242chr101223 ------
NM_012243chr11176 ------
NM_012247chr101197 ------
NM_012248chr161221 1562 ----
NM_012249chr223529 2203 22407 512 --1193
NM_012250chr11183 ----11233
NM_012257chr72854 836 ------
NM_012259chr631385 1286 242 ------
NM_012261chr20168 ------
NM_012262chr184375 4156 3585 1372 1321 1313 1232 886 14451 ----
NM_012281chr741943 977 722 579 --12291 --
NM_012282chrX3329 213 61 2692 106 ----
NM_012287chr344352 3720 3300 352 13654 ----
NM_012288chr6114997 4713 3633 1392 1378 1225 1108 1092 942 811 302 45460 5341 1421 1271 35589 4302 1510 --
NM_012290chr21608 ------
NM_012294chr7103806 2963 2735 2708 1422 1010 929 534 471 37 1454 ----
NM_012296chr1153437 3233 624 188 36 --13559 1134
NM_012297chr442317 761 511 128 ----11716
NM_012300chr542501 892 859 375 ------
NM_012301chr711725 --11470 --
NM_012302chr121009 429 ------
NM_012307chr1821035 292 ------
NM_012308chr1152561 1792 695 326 278 --1262 --
NM_012309chr1133365 1107 484 2474 70 1505 11883
NM_012316chr194960 4647 4609 3867 3551 2240 1795 1342 329 34989 4809 191 35089 4766 1662 14462
NM_012317chrX2785 193 ------
NM_012319chr181834 1695 ----
NM_012325chr2041610 229 140 123 ------
NM_012328chr73945 416 258 1316 ----
NM_012329chr1731565 1053 530 --150 --
NM_012330chr102290 212 ------
NM_012333chr111067 --11397 --
NM_012334chr594755 4401 4095 3681 3644 1701 1633 840 21 21097 35 24228 1192 --
NM_012342chr10171 ------
NM_012343chr5193 --1415 1783
NM_012347chr632853 841 64 11113 1653 --
NM_012384chr2022241 253 ----1832
NM_012399chr223369 322 259 --11832 --
NM_012402chr1121163 94 --21284 1076 1500
NM_012412chr74875 794 605 179 ------
NM_012416chr911268 ------
NM_012421chr11429 ----1392
NM_012425chr102992 35 12520 12342 --
NM_012434chr64473 438 370 230 11423 ----
NM_012460chr141115 2261 73 ----
NM_012475chr1----122 --
NM_012478chr174988 745 227 92 ------
NM_012479chr731857 995 422 12081 12169 --
NM_013227chr154810 724 674 189 ------
NM_013230chrY1507 ------
NM_013231chr1454388 4002 3391 3078 1368 13532 ----
NM_013233chr2--1442 ----
NM_013246chr113347 311 79 ------
NM_013255chr7128391 6536 6051 3313 3096 2531 1921 1624 1431 1247 671 485 ----1738
NM_013256chr191265 --1505 --
NM_013259chr31311 ------
NM_013261chr443679 3529 2943 1391 ----1391
NM_013262chr641407 1128 329 104 ------
NM_013269chr1254148 1732 855 192 168 ------
NM_013272chr151266 ------
NM_013275chr161143 --1131 --
NM_013277chr123910 200 57 ------
NM_013279chr1121960 1779 --11470 --
NM_013282chr1921185 427 ------
NM_013283chr5157 ----1585
NM_013293chr72546 130 ------
NM_013309chr1542526 2234 1941 974 ------
NM_013313chr2242782 393 379 272 43249 720 557 422 23195 78 --
NM_013316chr711034 2879 839 --1117
NM_013336chr371843 718 641 622 334 298 44 ------
NM_013341chr222296 996 22840 2193 1485 148
NM_013354chr82431 95 11109 ----
NM_013377chr122178 143 ------
NM_013381chr1211734 --1581 --
NM_013390chr92378 172 --11740 --
NM_013399chr163517 91 30 21750 152 1667 --
NM_013401chr113892 768 722 1317 ----
NM_013433chr1952025 1494 548 292 175 ------
NM_013436chr2154 --1781 --
NM_013438chr941823 625 550 68 --1288 --
NM_013444chrX1765 ------
NM_013446chr761439 1272 1011 924 475 280 11037 1523 --
NM_013448chr14--1592 ----
NM_013449chr12273 34 12731 11111 --
NM_013951chr241918 518 434 383 12336 ----
NM_013952chr251995 595 511 460 74 12413 ----
NM_013953chr251995 595 511 460 74 12413 ----
NM_013958chr8140 ----1393
NM_013959chr8140 ----1393
NM_013960chr84704 574 563 62 ------
NM_013961chr8140 ----1393
NM_013962chr8140 ----1393
NM_013989chr141637 2344 308 ----
NM_013992chr251995 595 511 460 74 12413 ----
NM_013993chr63741 595 82 1537 ----
NM_013994chr63741 595 82 1537 ----
NM_013995chrX52414 1036 1022 996 972 ------
NM_014000chr1041693 1289 516 231 ------
NM_014001chr171208 21066 407 ----
NM_014011chr222528 141 --12144 12259
NM_014021chr13834 656 305 --33002 2474 216 --
NM_014023chr1062249 1940 968 850 820 731 1800 ----
NM_014028chr642899 2631 2112 2098 12938 ----
NM_014030chr1761159 1028 752 242 222 24 --11034 1926
NM_014034chr631256 957 282 ------
NM_014043chr32599 508 ------
NM_014048chr1674958 4680 3588 3332 2024 1670 284 24245 3663 2449 231 --
NM_014060chrX----121 --
NM_014069chr63341 267 35 ------
NM_014089chr134660 544 530 436 2704 573 11506 --
NM_014106chr1531984 996 726 --22352 2309 --
NM_014109chr861214 862 459 341 298 95 ------
NM_014110chr131136 1042 197 ------
NM_014112chr854897 4820 4375 1816 878 ------
NM_014117chr1622409 2209 21741 46 1477 --
NM_014154chr321508 1030 1461 ----
NM_014155chr11117361 6166 5738 5608 1873 1856 1404 1272 1024 874 138 --15339 25914 1972
NM_014157chr1683938 3812 3148 2942 1391 284 233 149 ------
NM_014188chr12279 266 ------
NM_014191chr121158 ------
NM_014217chr11174 ------
NM_014232chr171550 --2486 324 --
NM_014232chr171550 --2486 324 --
NM_014233chr1741884 1388 435 367 --21340 291 --
NM_014240chr383828 3708 3694 3419 2865 2786 1013 173 23845 492 23553 889 --
NM_014241chr101351 150 ----
NM_014243chr41804 ----11700
NM_014246chr223910 800 370 11580 ----
NM_014249chr151518 ------
NM_014250chr2251974 1548 1415 414 334 ------
NM_014253chrX22450 1590 ------
NM_014268chr1831386 997 248 ------
NM_014271chrX1547 ------
NM_014278chr43382 158 67 ------
NM_014282chr95982 871 465 133 44 ------
NM_014283chr131564 1227 351 ------
NM_014284chr12785 61 1753 --1761
NM_014289chrX11031 --1167 --
NM_014293chr22103544 3363 3126 3110 3024 2901 1454 1440 240 140 32616 1483 195 12603 --
NM_014294chr831242 496 209 ------
NM_014309chr2265009 4065 3706 3512 1458 1173 14855 --1370
NM_014319chr1251767 1516 1497 790 402 11852 ----
NM_014323chr222996 35 1192 ----
NM_014325chr1222257 1457 1571 --11787
NM_014329chr16191 1258 ----
NM_014333chr1122236 2003 ------
NM_014344chr112776 143 ------
NM_014345chr62122 91 ------
NM_014351chr2251470 1350 1013 552 489 ----1939
NM_014368chr932067 1526 535 --123 --
NM_014376chr51121 --12536 --
NM_014382chr321145 294 ------
NM_014388chr1125513 4844 4527 4473 4383 4171 3898 2207 1908 1442 1130 266 15625 ----
NM_014392chr42628 34 ----11482
NM_014393chr842074 1924 293 55 --1624 --
NM_014399chr72284 113 --1223 --
NM_014405chr1752333 2209 1795 1501 1443 11733 12319 --
NM_014410chr182364 50 ------
NM_014415chr31595 ------
NM_014423chr595421 4808 4676 3983 1888 1333 1239 948 519 1527 --15242
NM_014426chr203538 478 56 ------
NM_014431chr1021602 279 ------
NM_014432chr621100 336 --178 --
NM_014445chr341996 933 543 426 ------
NM_014452chr641088 857 431 340 ------
NM_014456chr1021466 1323 11495 199 --
NM_014458chr131335 1116 153 ------
NM_014465chr4--122 ----
NM_014480chr191584 1627 ----
NM_014488chr111524 ------
NM_014491chr73935 793 369 ------
NM_014494chr1651866 697 673 91 74 ------
NM_014506chr92501 108 --11637 1445
NM_014507chr2211169 1921 ----
NM_014515chr121792 ------
NM_014521chr211719 11176 ----
NM_014554chr1252095 2004 623 595 156 ------
NM_014562chr23534 171 38 --1336 --
NM_014564chr92176 26 --1281 --
NM_014572chr132368 268 1128 ----
NM_014574chr14----11526 --
NM_014575chr3--1484 ----
NM_014586chr2164512 3300 1844 1830 116 64 24709 490 --23233 1305
NM_014587chr1651286 1241 505 305 292 11233 ----
NM_014588chr203708 216 140 1542 ----
NM_014600chr231619 1165 311 ------
NM_014601chr1941072 409 372 304 ------
NM_014603chr1731438 302 171 1443 ----
NM_014607chr231861 1739 564 --11472 --
NM_014612chr91250 ------
NM_014613chr572750 2060 1915 779 766 416 275 --12517 13015
NM_014614chr241200 585 355 65 ----1240
NM_014615chr1662765 2747 2685 2653 2574 1060 --11164 12704
NM_014620chr12----2599 251 --
NM_014629chr821227 207 1437 ----
NM_014634chr2242778 2746 2340 1213 --12255 --
NM_014635chr231462 1307 109 ------
NM_014636chr973875 3102 3089 3036 741 275 181 --1281 --
NM_014655chr141644 681 312 181 21614 1481 ----
NM_014659chr153465 275 73 ------
NM_014660chr731092 944 282 ------
NM_014662chr221480 ------
NM_014665chr853340 1249 1238 1082 215 --33628 2634 192 --
NM_014666chr51189 ------
NM_014667chr321515 227 --12015 --
NM_014671chr731051 288 59 196 ----
NM_014677chr81322 ------
NM_014678chr222227 65 1791 ----
NM_014679chr113963 267 42 ------
NM_014680chr171502 --1137 --
NM_014682chr811619 ------
NM_014686chr1932294 883 632 21821 315 21594 802 --
NM_014690chr733065 2689 1113 138 ----
NM_014701chr1562213 1284 1230 997 983 825 ------
NM_014703chr3----21225 1006 --
NM_014705chr731344 265 85 ------
NM_014707chr732113 1920 196 ------
NM_014709chr23612 525 181 1548 ----
NM_014713chr22432 158 ------
NM_014717chr192591 333 ------
NM_014720chr1031479 218 102 2363 282 ----
NM_014721chr696284 5712 5674 2628 2576 1751 956 659 162 21644 755 --15627
NM_014723chr2052998 2453 2158 902 722 --23234 27 --
NM_014725chrX41340 336 308 289 --11116 --
NM_014726chr1741421 1148 552 124 ------
NM_014727chr192257 97 ------
NM_014729chr862110 1435 927 802 421 118 11894 ----
NM_014730chr1264536 3204 1973 1421 920 180 35210 1046 390 14294 --
NM_014730chr1264536 3204 1973 1421 920 180 35210 1046 390 14294 --
NM_014732chr16125856 5180 4665 4449 3915 2321 2201 1250 1194 1103 769 584 21580 1417 ----
NM_014733chr532028 1417 307 ------
NM_014739chr653942 3277 1588 1428 442 2541 59 12600 1918
NM_014743chr463123 2862 2037 1142 735 297 12653 ----
NM_014752chr111292 ------
NM_014755chr273447 3363 3113 1473 1441 1328 426 11577 23847 684 --
NM_014757chr531913 1816 214 --1230 --
NM_014761chr1621114 108 --1895 --
NM_014764chr1241247 188 148 52 ------
NM_014765chr142538 1898 1057 804 ------
NM_014767chr1063596 3228 3109 3082 3020 112 11093 --11103
NM_014770chr1221132 121 --1903 --
NM_014774chr11388 ------
NM_014776chr1282904 2744 2714 2670 2554 2506 1992 184 32462 2087 1046 --12688
NM_014779chr321074 264 ------
NM_014782chrX190 ------
NM_014783chr1511099 11766 ----
NM_014786chr114452 427 415 38 21073 1056 ----
NM_014795chr2154 ------
NM_014797chr622605 2420 12767 ----
NM_014800chr71174 ------
NM_014803chr1052266 901 623 381 229 ----1104
NM_014806chr9----1134 --
NM_014807chr111780 ------
NM_014810chr143641 1300 1210 160 1292 1758 11307
NM_014812chr13777 410 32 1197 ----
NM_014819chr521933 291 ------
NM_014820chr331785 576 137 --12039 --
NM_014822chr41643 ------
NM_014824chr11177 1428 ----
NM_014826chr163891 3547 797 776 244 84 11017 ----
NM_014827chr111249 2396 78 11625 --
NM_014828chr1462495 1705 1679 1672 741 653 ------
NM_014830chr1253528 2729 1536 833 213 23876 2608 13325 --
NM_014832chr133638 402 127 21553 798 ----
NM_014835chr2081977 1837 1577 1563 1534 1513 1421 213 ------
NM_014839chr142312 2234 435 58 ------
NM_014840chr1272942 2781 1104 1049 373 243 129 --12411 12477
NM_014841chr61922 1297 ----
NM_014850chr364548 3585 3048 1677 1266 435 ------
NM_014868chr122914 31 1762 1587 --
NM_014869chr341201 583 361 283 177 134 --
NM_014871chr122581 429 --1565 --
NM_014872chr972215 2148 1621 877 568 468 408 1544 --12241
NM_014874chr141780 1448 506 425 --1400 --
NM_014876chr2241951 1638 727 214 --21992 715 11973
NM_014877chr1746596 5798 977 497 27111 2495 16194 --
NM_014883chr441825 802 701 545 --1604 --
NM_014884chr19----136 --
NM_014885chr4172 ------
NM_014888chr741402 1227 499 34 ------
NM_014890chr3----1234 --
NM_014898chr1942039 1793 829 286 11530 --12211
NM_014899chr552561 2458 693 562 551 12075 13059 --
NM_014900chr2127 ------
NM_014902chr2021366 1163 11504 21004 397 11338
NM_014903chr1231896 1666 696 12300 ----
NM_014904chr1043609 3448 3406 141 ------
NM_014906chr171198 --12565 --
NM_014912chr1043097 396 257 228 22897 274 ----
NM_014914chr231308 1162 425 --133 --
NM_014918chr15----11201 1240
NM_014920chr632763 2752 75 ------
NM_014921chr1921242 1208 1977 ----
NM_014923chr1342241 1456 690 168 ------
NM_014926chr341018 942 793 87 ------
NM_014927chrX--189 132 --
NM_014932chr321473 1262 ------
NM_014934chr1343851 3066 2549 1560 ------
NM_014935chr1113752 3484 3392 3260 3168 2930 2862 2415 1366 1301 393 22779 82 1475 --
NM_014942chr642327 1789 1738 422 1780 ----
NM_014944chr121197 262 ------
NM_014945chr531483 459 261 --21500 791 11737
NM_014947chr143136 2575 2303 2146 --11204 --
NM_014951chr1031879 376 137 --1300 --
NM_014952chr1541957 1311 658 232 1811 179 --
NM_014953chr1374169 3426 3169 3025 1473 976 130 ------
NM_014962chr2052824 2750 246 75 44 22290 1072 12052 --
NM_014964chr1731736 1492 598 --22313 32 --
NM_014969chr121142 482 1789 ----
NM_014974chr1041568 1561 1497 533 --11613 --
NM_014978chr1031383 726 230 11794 11543 --
NM_014982chr1454860 4535 3747 1582 146 ----14776
NM_014988chr421884 643 ------
NM_014989chr642011 1932 616 495 ------
NM_014991chr442795 2654 2603 317 11148 1772 --
NM_014994chr1551616 735 550 525 458 11645 11735 --
NM_014997chr742963 2714 1905 286 --11073 --
NM_014999chr1211386 11121 ----
NM_015000chr1222891 502 ------
NM_015001chr1----1878 --
NM_015002chr1252078 2055 1504 525 23 11592 31769 1744 1492 --
NM_015008chr363648 3540 3509 2634 2434 714 --12613 --
NM_015009chr32645 255 ------
NM_015017chr121091 1026 --2513 367 --
NM_015020chr1673698 3594 2876 1177 951 880 591 --1250 --
NM_015025chr231929 1717 761 12125 1167 --
NM_015026chr1224705 3069 33980 725 140 ----
NM_015035chr20115692 5300 5286 5095 5046 5029 1951 1479 1449 567 48 35464 5329 4096 55421 5174 4542 2062 118 14169
NM_015039chr113372 --1961 11070
NM_015040chr272951 1226 976 919 741 194 178 11133 ----
NM_015042chr1543944 3760 1726 486 31705 1072 183 1671 --
NM_015044chr1653214 2998 2003 1230 637 ----33118 2894 2104
NM_015049chr223245 1150 12311 ----
NM_015052chr7--1323 ----
NM_015063chr1921162 1147 --160 --
NM_015068chr723188 320 23359 110 11081 --
NM_015071chr596245 5877 5771 5634 4468 1987 1444 1425 122 24836 1059 45286 5184 4647 4435 --
NM_015073chr192606 522 --1768 --
NM_015074chr183861 1976 1764 1684 1094 517 418 137 24579 3904 24642 1109 13331
NM_015075chrX41797 648 431 188 --11522 --
NM_015076chr673985 2979 1583 985 453 313 270 --14277 --
NM_015077chr1754178 3140 1183 997 504 11745 24481 690 --
NM_015082chr551671 1644 1610 561 478 1749 12085 --
NM_015086chr1231539 1463 115 11027 ----
NM_015087chr1342086 1858 1694 586 --1188 --
NM_015090chr1125775 5451 4913 4402 4010 3947 2401 2330 2107 1590 871 381 24832 2012 11027 14025
NM_015091chr143824 149 90 ------
NM_015092chr16104676 4605 4375 4003 3721 3646 3122 1547 1533 480 2362 247 11669 --
NM_015093chr641734 1342 1161 557 ------
NM_015097chr332034 1530 723 11751 12028 --
NM_015099chr173704 238 37 ------
NM_015100chr111706 11685 1784 --
NM_015102chr11115 --2176 132 --
NM_015103chr34291 258 202 185 ----1923
NM_015107chrX3760 663 290 --1891 --
NM_015113chr1742222 943 455 35 --21964 377 --
NM_015115chr462711 2552 2535 2493 915 714 11148 ----
NM_015124chr2242274 1953 681 657 ----11816
NM_015125chr191421 ------
NM_015130chr4----21120 112 --
NM_015132chr7--1565 ----
NM_015137chr861900 1804 1000 862 581 513 12428 ----
NM_015138chr1542701 1959 1135 135 --1462 1716
NM_015143chr45320 257 231 95 30 ------
NM_015144chr1643513 2973 2454 223 22520 1014 33197 2899 673 --
NM_015149chr142171 2161 1748 1417 --1648 --
NM_015150chr32623 52 1143 ----
NM_015151chr214655 330 158 141 --1775 --
NM_015155chr1032229 1062 911 ------
NM_015156chr1473532 3523 1574 213 152 83 24 --1826 --
NM_015170chr84895 764 750 472 ------
NM_015171chr162400 44 1192 ----
NM_015172chr12240 203 --11112 --
NM_015173chr431756 1459 1309 ------
NM_015176chr121521 1492 1385 ----
NM_015180chr142289 33 ------
NM_015192chr2022993 2006 1640 ----
NM_015196chr41107 ------
NM_015199chr332545 1897 67 22825 608 ----
NM_015200chr422075 293 ------
NM_015205chr1384180 2007 1085 728 691 444 307 47 --132 --
NM_015208chr1853837 3529 2537 1124 611 --23960 3823 --
NM_015215chr142691 2220 799 204 --1451 --
NM_015216chr521049 370 ------
NM_015225chr921948 109 165 ----
NM_015233chr1372506 1798 1709 846 567 245 174 12306 22477 2051 --
NM_015236chr41410 --11242 --
NM_015245chr682126 1097 988 780 316 140 117 84 --12226 1639
NM_015247chr1674055 3972 3598 2016 1710 1328 55 35129 985 255 13299 --
NM_015250chr921754 348 ----1770
NM_015251chr1652030 764 673 395 35 1793 1890 --
NM_015263chr152454 176 ------
NM_015265chr221030 327 ------
NM_015267chr1232020 564 56 1280 ----
NM_015269chr1179 ------
NM_015270chr1261936 1731 926 791 509 482 --11861 --
NM_015271chr453831 3165 1651 1523 240 12979 ----
NM_015272chr1652078 1710 1453 241 23 ------
NM_015277chr1821855 52 11514 11446 --
NM_015278chr643455 3212 496 237 ------
NM_015284chr171986 1891 1617 859 456 418 382 11728 21957 490 --
NM_015285chr1842432 386 182 143 ------
NM_015288chr533721 3376 2732 1608 11548 --
NM_015291chr153388 3267 2409 2393 939 --2492 361 11242
NM_015299chr1454003 3516 3371 983 613 13501 --23900 1229
NM_015305chr1451351 727 564 368 78 ------
NM_015310chr8116809 6716 6594 5387 5100 3081 2647 2205 2062 1808 220 38201 5743 1992 1560 --
NM_015313chr1184803 4788 3812 3522 3111 704 550 124 --21133 921 24355 771
NM_015315chr573244 3121 1362 1312 522 487 321 23499 2532 22790 1301 --
NM_015317chr222892 2113 --12551 --
NM_015321chr1964904 3940 1777 1595 980 45 34050 3254 1081 ----
NM_015326chr152322 2061 1933 1033 394 ------
NM_015328chr722604 1918 --1397 --
NM_015329chr1972607 2133 2123 2070 1874 621 527 22221 376 1285 --
NM_015335chr1222017 929 1433 ----
NM_015336chr1222287 420 --22223 684 --
NM_015338chr2051416 1401 1244 706 159 21719 366 1508 --
NM_015345chr652769 2264 1076 869 842 --22108 1917 1950
NM_015347chr1262751 2103 2073 2055 1902 1153 ------
NM_015349chr622330 1041 12898 1450 --
NM_015352chr2063488 1275 996 433 212 116 13517 12416 --
NM_015355chr171610 ------
NM_015361chr21871 ------
NM_015365chrX54014 3600 3393 1372 1320 24086 492 ----
NM_015374chr22133 ----1492
NM_015382chr141104 1266 ----
NM_015385chr1032756 2528 760 ----1593
NM_015386chr163362 35 21 ------
NM_015387chr22449 318 ------
NM_015388chr61135 ------
NM_015392chr92195 26 ------
NM_015393chr443491 2329 689 668 33444 3400 2717 12763 179
NM_015397chr951343 743 731 505 139 ----11924
NM_015441chr12329 46 ------
NM_015442chr3--129 ----
NM_015443chr174613 439 332 211 1205 ----
NM_015446chr12608 434 --11550 --
NM_015453chr321451 832 31596 372 243 1329 --
NM_015455chr533088 3048 35 --1228 --
NM_015458chr854347 3939 3925 3375 1334 13674 14059 --
NM_015460chr31468 198 --11850
NM_015463chr23275 218 108 1784 ----
NM_015464chr7140 198 ----
NM_015472chr31396 ------
NM_015472chr31396 ------
NM_015475chr2173 ------
NM_015477chr152900 174 1131 ----
NM_015483chr71445 128 ----
NM_015488chr251747 1731 1645 1620 1248 ------
NM_015492chr151936 --11039 --
NM_015497chr15----157 --
NM_015508chr361357 1171 1027 985 264 111 ------
NM_015511chr2021128 289 ------
NM_015515chr173259 180 22 ------
NM_015520chr31154 1803 22518 2039 1796
NM_015523chr112106 89 ------
NM_015525chr61999 ------
NM_015526chr192225 45 --11340 --
NM_015527chr16186 --1841 --
NM_015535chr283959 3811 2958 2766 2636 1119 505 429 ------
NM_015541chr331073 476 95 ------
NM_015542chr1011079 1288 ----
NM_015545chr71784 --1283 --
NM_015548chr61283 21008 885 1691 --
NM_015550chr762975 2530 2270 1054 610 108 12781 ----
NM_015554chr1542115 1136 345 23 1351 ----
NM_015557chr162960 2844 755 330 67 55 32877 2641 525 2864 539 --
NM_015559chr18----124 11076
NM_015564chr533279 2762 376 ------
NM_015567chr1311162 11338 ----
NM_015568chr2073674 3084 3010 2975 2819 1630 404 32801 583 213 11334 --
NM_015569chr134818 4723 4465 ------
NM_015571chr63485 264 224 12058 ----
NM_015575chr241385 1296 976 630 ------
NM_015576chr31135 --1852 --
NM_015577chr531612 556 38 ------
NM_015578chr1911833 ------
NM_015595chr32215 122 ------
NM_015602chr131367 1346 1184 11610 ----
NM_015605chr10181 158 ----
NM_015607chr1147 ------
NM_015609chr182711 2662 2607 2001 1191 1163 322 314 --1760 --
NM_015626chr1721174 240 1448 ----
NM_015627chr171536 1440 1168 735 613 89 58 ------
NM_015630chr22732 337 ----1261
NM_015635chr941983 1375 551 406 ------
NM_015646chr12--11288 ----
NM_015675chr19----1565 --
NM_015676chr14------1276
NM_015678chr1341586 1369 679 445 ------
NM_015686chrX42165 1848 1540 519 ------
NM_015687chr62376 65 ------
NM_015691chrX2682 37 1475 ----
NM_015695chr6--11445 ----
NM_015716chr171499 --1663 --
NM_015719chr194821 731 685 92 ------
NM_015726chr12176 98 --11493 1621
NM_015833chr2161972 569 468 231 225 153 21810 72 ----
NM_015840chr142503 2071 1690 643 --32282 1913 287 --
NM_015841chr142503 2071 1690 643 --32282 1913 287 --
NM_015848chr123528 452 30 ------
NM_015850chr841937 1890 192 78 11665 12147 --
NM_015878chr831485 1455 887 ------
NM_015879chr18118367 6492 6343 6244 6210 5720 3217 2030 1416 870 776 18212 13243 --
NM_015886chr885421 5047 4573 4464 1790 1237 1122 881 14456 15348 --
NM_015888chr183000 2585 2505 2144 1096 664 531 70 13281 23139 2725 --
NM_015891chr621417 284 ------
NM_015898chr1962394 1781 1737 917 773 558 ------
NM_015902chr84798 737 631 115 ------
NM_015905chr71583 ------
NM_015906chr134345 1234 118 21327 374 ----
NM_015912chr832242 2185 227 ------
NM_015920chr15----1597 --
NM_015952chr6----145 --
NM_015976chr11115 ------
NM_015981chr572690 2672 2359 2279 2079 1172 989 1305 1137 --
NM_015994chr142453 265 ------
NM_015999chr12732 241 ------
NM_016009chr143710 3390 3164 520 44235 3553 3418 3131 13510 --
NM_016018chr832162 325 141 --1392 --
NM_016019chr7----1731 --
NM_016021chr662567 2505 2096 2081 2068 1971 12141 --12129
NM_016022chr13240 226 34 ------
NM_016032chrX41191 872 564 556 --11324 --
NM_016033chr831358 1300 1263 --11957 --
NM_016041chr171127 ------
NM_016045chr20--3733 336 188 ----
NM_016061chr2--1424 ----
NM_016076chr152073 1982 642 455 169 12205 ----
NM_016083chr663951 3507 3055 3016 1172 556 13028 ----
NM_016096chr8169 ------
NM_016097chr1811088 --2175 105 --
NM_016098chr62438 337 ------
NM_016099chr83500 262 163 ------
NM_016104chr6----145 --
NM_016107chr511170 ------
NM_016120chrX2273 60 11123 ----
NM_016123chr1251219 1098 1083 967 474 11127 ----
NM_016131chr222157 151 11830 ----
NM_016133chr221165 190 ------
NM_016151chr16144 ------
NM_016152chr32929 37 ------
NM_016166chr151226 ------
NM_016169chr1041984 909 680 413 11311 22219 2063 13113
NM_016172chr93330 99 79 ------
NM_016173chr373433 2917 1668 1008 556 151 66 13588 --23709 1223
NM_016185chr172514 112 ------
NM_016201chr33591 487 136 ------
NM_016206chr378259 8159 6483 2638 2618 1835 394 26010 217 28478 7323 --
NM_016217chr623560 3195 ------
NM_016224chr631873 1688 751 11519 ----
NM_016227chr131564 1227 351 ------
NM_016231chr1711277 11586 1512 --
NM_016248chr1354037 3567 3372 2432 1564 --11538 --
NM_016252chr22880 164 --1912 --
NM_016258chr1----139 --
NM_016260chr2126778 6628 5884 5368 5029 2738 2458 2396 1920 1318 228 64 2657 302 ----
NM_016269chr42353 341 ----1983
NM_016270chr193492 432 22 ------
NM_016271chr18123 --132 --
NM_016272chr2232196 1808 660 2611 543 ----
NM_016275chr31140 2976 933 1786 --
NM_016277chr651554 1424 1316 1223 1004 ------
NM_016281chr1211102 ------
NM_016284chr161328 1651 1361 --
NM_016287chr121627 697 ----11814
NM_016297chr283586 2444 1378 1313 374 317 270 186 13201 --22766 494
NM_016303chrX1141 ------
NM_016308chr111285 ------
NM_016315chr231485 307 275 ------
NM_016316chr2--1583 ----
NM_016320chr1131011 149 109 ------
NM_016322chr922546 956 --12087 --
NM_016339chr172394 57 183 2530 43 --
NM_016374chr151081 152 142 30 23 --11130 --
NM_016374chr151081 152 142 30 23 --11130 --
NM_016377chr631570 1238 447 11535 ----
NM_016396chr1572222 2198 1951 1077 1023 919 263 12683 11944 --
NM_016436chr2052303 2182 1804 1726 1069 22211 285 145 --
NM_016441chr211676 --22326 82 --
NM_016442chr53918 567 557 ------
NM_016448chr131791 1622 163 ------
NM_016454chr151326 ------
NM_016470chr201143 ------
NM_016480chr51323 1579 ----
NM_016485chr621575 906 ----11895
NM_016507chr1752951 608 314 148 103 22037 1274 ----
NM_016513chr632763 2752 75 ------
NM_016516chr21713 2657 32 ----
NM_016519chr4166 ------
NM_016520chr92313 107 1136 ----
NM_016522chr1131396 1281 450 ------
NM_016530chr1572977 2944 2792 2603 1253 877 259 ------
NM_016531chr463624 3426 3411 3353 3031 42 1566 11184 --
NM_016538chr17131 ------
NM_016542chrX41551 1512 632 223 ------
NM_016544chr273140 2818 1203 960 898 831 301 22735 1525 1766 --
NM_016562chrX31589 1032 498 11151 --1226
NM_016575chr1274828 4132 3889 3367 871 832 128 2818 299 21626 1542 --
NM_016577chr384440 4346 3451 2880 1770 1541 1000 507 23664 1222 ----
NM_016578chr11--1682 ----
NM_016588chr6--1771 ----
NM_016589chr3--1501 1117 --
NM_016603chr522223 2059 ------
NM_016605chr532589 996 829 --22453 351 --
NM_016612chr8--1666 ----
NM_016621chr1164265 3614 3446 3121 2856 743 13077 --13522
NM_016623chr8----121 --
NM_016626chr181715 11264 ----
NM_016628chr101664 ------
NM_016644chr52138 69 ------
NM_016654chr151898 ------
NM_016823chr1731209 1089 124 ------
NM_016824chr1021795 360 2571 370 ----
NM_016929chr654010 3440 1663 1273 101 24224 591 1650 --
NM_016936chr1672094 1403 874 379 336 146 28 ------
NM_016950chr41457 ------
NM_017413chrX3867 445 146 --22349 111 --
NM_017415chr584478 4008 3815 3581 2774 1418 1171 248 --13302 --
NM_017420chr14----13034 --
NM_017423chr43885 618 177 2371 68 ----
NM_017426chr42470 39 ------
NM_017443chr94984 592 161 24 31201 551 41 --1181
NM_017447chr2164073 4048 4028 3684 2974 300 ----12743
NM_017450chr1741397 953 119 46 ------
NM_017452chr2021472 315 ------
NM_017453chr2021472 315 ------
NM_017454chr2021472 315 ------
NM_017456chr1761620 1598 1507 757 204 61 --21801 536 --
NM_017481chr111207 ------
NM_017483chr241025 1011 988 909 --1928 --
NM_017488chr261360 1346 1323 1244 1092 1083 --11263 --
NM_017522chr121044 324 ------
NM_017544chrX1161 ------
NM_017548chr32633 479 174 11714 --
NM_017551chr1032387 1662 454 --12321 --
NM_017553chr1561026 460 240 169 159 91 11059 1189 --
NM_017563chr3126375 5713 5666 5112 4995 3948 2240 1863 1754 418 326 87 35756 1124 671 --12562
NM_017567chr21119 ------
NM_017580chr1062286 1920 846 812 369 331 --11739 --
NM_017589chr11147 --131 --
NM_017590chr2212715 2621 366 ----
NM_017594chr961217 1017 556 477 383 43 ------
NM_017602chrX3926 595 192 ------
NM_017610chr1532063 1486 84 ------
NM_017613chr212351 126 ------
NM_017626chr1031791 1679 1222 11242 11301 --
NM_017633chr653781 3520 3051 2729 2432 --32961 2723 2478 --
NM_017634chr851711 1392 1269 514 270 ------
NM_017635chr1121283 94 --11465 --
NM_017637chr9149227 9083 8001 7865 7338 7119 6705 3045 2137 1095 923 820 724 523 18096 16100 --
NM_017641chr122920 341 ------
NM_017643chr1712060 --22809 409 --
NM_017644chr364875 4101 1923 1164 884 245 ----14469
NM_017650chr786007 5633 5625 4997 4002 2221 1508 307 --13904 --
NM_017651chr61512 --1636 11626
NM_017657chr2172 ------
NM_017658chr1464523 3963 3163 2878 1478 255 1555 ----
NM_017660chr1973288 2947 2761 2667 2468 757 46 --22692 2092 --
NM_017661chr152377 132 ------
NM_017672chr15137 ------
NM_017686chr13877 766 62 ------
NM_017694chr211495 ----11582
NM_017709chr164253 3062 2871 1352 1260 410 1380 ----
NM_017712chr19125592 5037 4749 4611 4148 4111 3942 3914 1921 1213 787 343 26359 816 54427 3885 2430 2274 226 15982
NM_017719chr351901 1782 576 316 294 1139 ----
NM_017721chr191325 ------
NM_017724chr31713 ------
NM_017730chr33659 462 170 ------
NM_017736chr162308 36 1816 ----
NM_017737chr12757 405 ------
NM_017738chr911126 ----1210
NM_017740chr1631418 190 81 11509 ----
NM_017741chr441937 326 205 191 32130 579 369 ----
NM_017742chr1811792 ------
NM_017745chrX----1456 --
NM_017748chr171319 ------
NM_017753chr92979 911 ------
NM_017754chr694479 4346 3085 1847 1833 913 844 136 21 35047 3813 1205 ----
NM_017758chr1721506 502 --21014 450 --
NM_017763chr1741169 1130 215 58 ------
NM_017772chr631696 1568 180 --11129 --
NM_017778chr81329 --1493 11250
NM_017780chr81736 ------
NM_017789chr23658 212 173 --195 --
NM_017790chr92467 424 1128 ----
NM_017798chr203996 280 112 --11049 --
NM_017799chr14--11481 11273 --
NM_017811chr953146 3115 2290 2160 942 22990 1935 1764 --
NM_017813chr855503 5442 4093 3643 2243 11673 11815 --
NM_017824chr1022291 138 --180 --
NM_017830chr42681 67 ------
NM_017831chr1864087 4026 3557 2997 1428 568 34186 3737 737 1694 --
NM_017847chr13416 223 82 ------
NM_017848chrX44173 3854 3778 3250 23003 2980 ----
NM_017851chr152236 64 ------
NM_017856chrX3675 455 169 ------
NM_017887chr1--2511 389 ----
NM_017893chr1021167 333 ------
NM_017899chr122132 32 ------
NM_017902chr10115754 4943 4841 3695 3565 1951 1823 1257 1084 222 104 --25141 479 11657
NM_017913chr9191 --1346 --
NM_017915chr1211078 1407 ----
NM_017919chr975714 5468 4690 3535 2197 1783 1767 25219 1252 11438 15014
NM_017933chr231375 1033 394 ------
NM_017935chr42256 172 ------
NM_017938chrX3649 617 375 --1390 --
NM_017943chr1421076 200 ------
NM_017946chr721345 1225 11253 ----
NM_017948chr9----1350 --
NM_017953chr1------1222
NM_017964chr2--1311 1741 --
NM_017966chr1131518 314 265 11298 21312 178 --
NM_017974chr231150 1041 291 ------
NM_017988chr121705 ------
NM_017994chr752655 2531 2524 826 423 23024 259 12809 --
NM_017999chr14177 ------
NM_018000chr252150 1708 1383 624 520 --11414 --
NM_018003chr1511567 21596 295 ----
NM_018013chr692991 2959 2855 2593 1940 1159 568 201 147 12450 11169 --
NM_018014chr221255 313 --1495 --
NM_018017chr1042285 1031 1017 124 11060 ----
NM_018018chr1231616 1518 557 --2760 147 --
NM_018027chr1063274 2124 960 540 353 219 1581 22715 1250 --
NM_018030chr18--11101 1900 --
NM_018036chr1474422 4118 4082 4008 1581 1488 596 11700 --1507
NM_018045chr173066 2845 2769 2427 2220 186 69 1741 21180 923 --
NM_018046chr551874 1805 1398 1213 337 ------
NM_018047chr53245 207 43 ------
NM_018054chr16----1266 --
NM_018064chr61209 ------
NM_018067chr12533 146 ----1555
NM_018070chr11109 ------
NM_018078chr421073 870 --1855 --
NM_018084chr222993 2610 13198 ----
NM_018085chr1168108 6808 6738 6134 6120 5161 5141 3150 2916 1626 1612 1517 1203 1189 105 81 47729 7155 1232 748 57491 7395 4998 1747 942 --
NM_018086chr22654 136 ------
NM_018092chr1621088 582 ----11428
NM_018098chr31168 --191 --
NM_018105chr8------1914
NM_018112chr9151 ------
NM_018113chr122136 45 1454 ----
NM_018121chr1033036 984 352 2903 126 ----
NM_018126chr41128 ------
NM_018128chr1751419 1405 1156 1014 945 11334 ----
NM_018133chr31108 ------
NM_018137chr111095 --1274 --
NM_018144chr101345 ------
NM_018145chr152499 258 1522 ----
NM_018150chr13237 203 43 ------
NM_018155chr322499 1220 11363 ----
NM_018157chr1273023 2516 2308 1281 726 356 43 ----1694
NM_018171chr12--1802 ----
NM_018172chr1161455 1378 1362 1267 1207 335 --11143 --
NM_018179chr121230 ------
NM_018181chr1841760 1302 510 132 ------
NM_018182chr1762225 2166 1633 677 619 403 1605 21661 589 --
NM_018184chr331396 1341 232 ------
NM_018191chr131125 ------
NM_018200chr1582348 2197 1801 1704 1585 853 807 333 22069 989 ----
NM_018201chr972482 2281 1993 1650 524 414 189 --11664 --
NM_018203chr12584 21 ------
NM_018206chr164300 187 145 123 ------
NM_018207chr131353 1107 45 --31544 614 493 --
NM_018211chr131832 1674 216 ------
NM_018240chr12309 25 ------
NM_018241chr4149 ------
NM_018243chr473422 2606 1348 1204 472 332 36 12635 14010 1634
NM_018244chr2021355 128 --1117 1943
NM_018247chr641928 1919 715 27 12716 ----
NM_018254chr142302 1828 885 736 162 11950 --
NM_018266chr321063 310 ------
NM_018270chr201607 ------
NM_018287chr1031143 954 113 ------
NM_018299chr833066 2435 56 ------
NM_018310chr8122 --1567 --
NM_018313chr352495 1707 746 719 690 22598 2556 1672 --
NM_018314chr111711 ------
NM_018315chr4----1458 --
NM_018318chr121930 ------
NM_018328chr21396 ------
NM_018348chr1631182 980 336 --1329 --
NM_018351chr1274278 4229 4093 3650 3610 1129 597 11336 ----
NM_018364chr193728 3687 3496 3362 2983 1415 995 923 582 --1475 --
NM_018370chr1252359 1594 1580 680 468 11758 1107 --
NM_018371chr841193 1055 1002 634 ------
NM_018373chr14116232 5615 5573 5238 5196 4065 3957 1412 1313 1299 759 --1443 25745 1165
NM_018374chr764188 3923 1947 1895 1133 544 14936 ----
NM_018375chr143769 464 106 ------
NM_018383chr241465 732 465 292 --11514 1123
NM_018387chr92451 213 ------
NM_018388chrX21343 377 --11458 --
NM_018398chr31123 ------
NM_018400chr11104304 3869 3602 3504 3358 1155 790 546 356 158 139 --11506
NM_018403chr334148 2902 2649 12946 14030 --
NM_018416chr1242113 1937 1835 1759 ------
NM_018440chr8118681 8043 7946 6905 6672 6171 5880 2294 2114 1793 999 36338 6200 112 1602 28500 194
NM_018442chr12349 23 ------
NM_018444chr82809 655 --1213 1220
NM_018445chr152513 131 ------
NM_018452chr6_random63595 3268 3101 3065 2356 479 31502 816 574 11265 --
NM_018460chr2135 ------
NM_018469chr1741461 1194 175 69 ------
NM_018471chr21143 ------
NM_018476chrX2235 93 ------
NM_018482chr852515 2486 246 239 208 1818 --11867
NM_018488chr171753 1690 ----
NM_018489chr132348 1786 101 1512 2586 30 --
NM_018490chr113533 89 79 11709 ----
NM_018534chr22243 70 ------
NM_018553chr1731795 1355 179 11676 ----
NM_018557chr22525 365 ------
NM_018561chr63624 354 126 1169 1669 --
NM_018566chr175021 3500 1728 1613 1606 1143 990 33935 1914 1903 11545 --
NM_018569chr421313 194 ------
NM_018571chr2--1541 ----
NM_018584chr121198 84 --1485 --
NM_018590chr1041125 432 323 272 21356 517 ----
NM_018602chr1531690 1456 1263 ----11303
NM_018638chr1234393 3988 1398 ------
NM_018639chr1241392 411 214 83 ------
NM_018640chr1262708 2673 2365 1980 692 261 --1153 --
NM_018644chr114894 868 678 288 11629 12186 --
NM_018650chr121784 632 --11751 1319
NM_018657chr32845 651 ----1135
NM_018667chr1682409 2018 1773 1037 804 576 506 162 12787 ----
NM_018682chr7----165 --
NM_018683chr2031647 87 81 1558 11371 1458
NM_018684chrX----11203 --
NM_018685chr711175 ------
NM_018689chr1542691 1650 195 173 --1672 --
NM_018695chr531747 1716 1535 ------
NM_018698chrX1135 ------
NM_018700chr521508 107 ------
NM_018703chr162115 42 ------
NM_018704chr141575 765 218 112 --11561 --
NM_018708chr193585 408 142 ------
NM_018710chr811371 11206 ----
NM_018712chr1141506 987 522 508 ------
NM_018713chr1140 ------
NM_018715chr131596 1564 1399 --11776 12151
NM_018718chr73787 505 380 12079 ----
NM_018719chr711317 ----1343
NM_018728chr1531360 1012 23 ------
NM_018834chr5--2721 404 1877 --
NM_018840chr201443 ------
NM_018841chr153785 3316 1173 884 219 13322 33775 1057 347 --
NM_018847chr921525 661 11461 ----
NM_018898chr542264 1559 692 351 ------
NM_018899chr542264 1559 692 351 ------
NM_018900chr542264 1559 692 351 ------
NM_018901chr542264 1559 692 351 ------
NM_018902chr542264 1559 692 351 ------
NM_018903chr542264 1559 692 351 ------
NM_018904chr542264 1559 692 351 ------
NM_018905chr542264 1559 692 351 ------
NM_018906chr542264 1559 692 351 ------
NM_018907chr542264 1559 692 351 ------
NM_018908chr542264 1559 692 351 ------
NM_018909chr542264 1559 692 351 ------
NM_018910chr542264 1559 692 351 ------
NM_018911chr542264 1559 692 351 ------
NM_018912chr52165 65 ------
NM_018913chr52165 65 ------
NM_018914chr52165 65 ------
NM_018915chr52165 65 ------
NM_018916chr52165 65 ------
NM_018917chr52165 65 ------
NM_018918chr52165 65 ------
NM_018919chr52165 65 ------
NM_018920chr52165 65 ------
NM_018921chr52165 65 ------
NM_018922chr52165 65 ------
NM_018923chr52165 65 ------
NM_018924chr52165 65 ------
NM_018925chr52165 65 ------
NM_018926chr52165 65 ------
NM_018927chr52165 65 ------
NM_018928chr52165 65 ------
NM_018929chr52165 65 ------
NM_018945chr672809 2795 1050 856 660 478 147 ------
NM_018948chr111094 --1584 --
NM_018951chr71143 --187 --
NM_018963chr2121148 104 ----130
NM_018970chr722866 911 12791 ----
NM_018976chr12--135 22528 934 --
NM_018981chr22948 520 ------
NM_018993chr2021376 1369 ----1227
NM_018999chr1063989 1515 1115 742 517 420 ------
NM_019000chr521466 441 21630 1251 ----
NM_019001chr344850 1833 188 148 1870 34170 3149 1861 --
NM_019004chr742305 2092 2013 710 ------
NM_019005chr72378 103 ------
NM_019006chr15----134 --
NM_019008chr2283591 3116 2833 2507 1447 806 294 63 --22735 1215 --
NM_019016chr172151 87 ------
NM_019028chr11----1418 --
NM_019035chr41209 ------
NM_019041chr61439 32363 1884 1876 ----
NM_019045chrX2968 878 ------
NM_019049chr11132 ------
NM_019050chr41532 11427 ----
NM_019058chr104723 616 586 278 2785 603 ----
NM_019059chr71328 --1133 --
NM_019060chr11121 ------
NM_019071chr7----1587 --
NM_019072chr564195 3573 3527 3492 3399 1007 --12596 1608
NM_019083chr12212 26 ------
NM_019084chr1012598 --1338 --
NM_019087chr531454 1225 278 1635 ----
NM_019088chr19288 56 ------
NM_019091chr231100 227 103 1956 ----
NM_019094chr1273831 1475 1172 1152 1001 660 409 31082 627 78 11380 --
NM_019096chr64450 360 239 129 ----1824
NM_019106chr2283212 2769 2574 2468 2444 2179 659 123 ----11002
NM_019107chr192119 27 ------
NM_019114chr942532 1853 1574 981 --1281 1832
NM_019116chr1673502 3352 3307 3009 2831 726 617 23075 1144 23426 3213 --
NM_019555chr361223 442 142 88 43 37 ------
NM_019556chrX1253 11098 ----
NM_019557chr1--1885 ----
NM_019558chr22317 96 ----1363
NM_019593chr2073158 2754 2311 2247 426 374 298 1405 1809 --
NM_019596chr2152850 2574 982 459 445 22644 488 ----
NM_019605chr13561 508 161 ------
NM_019606chr71374 --1182 --
NM_019610chr132007 1509 1454 ------
NM_019843chr221455 --1136 --
NM_019859chr10----11258 --
NM_019860chr1011040 --11306 --
NM_019862chr1651627 1496 686 625 589 --11094 --
NM_019891chr1--1137 11268 --
NM_019898chr1651627 1496 686 625 589 --11094 --
NM_019899chr1651627 1496 686 625 589 --11094 --
NM_019900chr1651627 1496 686 625 589 --11094 --
NM_019903chr1021795 360 2571 370 ----
NM_020039chr122429 81 21526 322 ----
NM_020116chr421189 51 1664 ----
NM_020117chr52781 354 1809 1901 --
NM_020119chr743810 2508 901 159 13922 ----
NM_020120chr231327 396 203 ------
NM_020122chr276015 4735 4721 1793 1052 686 236 11845 13645 15102
NM_020123chr101403 ------
NM_020125chr121997 1660 11612 12157 --
NM_020134chr241074 882 394 190 ----1811
NM_020139chr42791 763 --1271 --
NM_020141chr1--1746 21890 129 --
NM_020144chr772041 1946 1640 1505 604 522 121 12010 --11415
NM_020150chr1032129 826 560 ----1284
NM_020163chr352010 1587 711 536 62 2603 482 ----
NM_020168chr1561325 1264 1104 846 510 394 --11358 --
NM_020177chr522913 1089 1738 ----
NM_020178chr1721109 895 --1213 --
NM_020193chr1141349 1342 89 23 ------
NM_020194chr21222 --1612 --
NM_020198chr1731076 180 35 ------
NM_020204chr11161 --1151 --
NM_020205chr163281 3249 2416 880 687 192 ------
NM_020208chr382849 2725 2352 1210 1168 800 786 205 22472 828 ----
NM_020210chr152977 750 ------
NM_020211chr1561431 1118 630 590 545 129 ------
NM_020225chr4193 ------
NM_020231chr32119 84 ------
NM_020235chr31327 1141 ----
NM_020239chr142189 1689 816 345 1787 ----
NM_020248chr172254 2243 2004 1542 735 672 315 --1766 --
NM_020309chr192835 709 ------
NM_020310chr1752640 2243 2220 478 242 --22782 1032 --
NM_020336chr2042887 2369 1391 309 11348 ----
NM_020337chr432112 1173 243 12203 1877 --
NM_020338chr1053300 2351 1415 954 72 --11249 12381
NM_020340chr642066 2052 879 648 11874 12191 --
NM_020341chr204399 209 181 158 ------
NM_020342chr2----156 --
NM_020346chr111371 ------
NM_020348chr1042432 1784 711 74 12595 ----
NM_020357chr321106 269 ------
NM_020360chr174611 455 150 57 --1419 --
NM_020362chr12272 56 --1252 --
NM_020373chr121434 ------
NM_020381chr651982 1904 773 688 205 1226 31925 822 676 --
NM_020382chr1221554 638 ------
NM_020383chr101263 ------
NM_020384chrX51931 1555 1276 702 327 ------
NM_020390chr374707 4653 4397 4213 4184 1163 451 24094 3543 ----
NM_020403chr131502 ------
NM_020405chr1793919 3543 3153 1811 1337 995 981 828 338 34093 1157 1024 ----
NM_020408chr63848 693 650 --1807 --
NM_020416chr42830 717 1709 ----
NM_020425chr611541 ----11899
NM_020429chr742786 2183 1162 69 1111 ----
NM_020432chr71719 ------
NM_020440chr183006 2593 2311 2245 2087 844 722 205 32884 2351 406 ----
NM_020443chr186993 6964 5977 5630 5282 1442 1022 166 ----12070
NM_020449chrX5691 575 287 134 112 ------
NM_020456chr1321564 71 ------
NM_020466chr684715 4583 3449 1537 1405 1357 784 544 33572 496 360 --23302 1682
NM_020474chr182654 328 11367 ----
NM_020475chr872211 2123 1819 815 514 477 378 1847 ----
NM_020476chr872211 2123 1819 815 514 477 378 1847 ----
NM_020477chr872211 2123 1819 815 514 477 378 1847 ----
NM_020478chr872274 2186 1882 878 577 540 441 1910 ----
NM_020480chr872211 2123 1819 815 514 477 378 1847 ----
NM_020526chr15709 583 295 234 215 --21730 176 --
NM_020532chr23696 316 165 ------
NM_020546chr532645 910 189 23129 384 22225 375 --
NM_020640chr322203 461 1635 ----
NM_020644chr113790 758 287 ------
NM_020647chr862254 1641 928 725 690 335 21818 432 ----
NM_020654chr311207 ------
NM_020663chr141612 1710 ----
NM_020666chr5----1776 --
NM_020673chr20127443 7330 6875 5563 2999 2950 1233 1135 1067 675 549 346 16085 12203 --
NM_020676chr31755 --2679 38 --
NM_020689chr2051416 1176 1112 1073 557 --1604 --
NM_020697chr83426 204 73 ------
NM_020699chr1105414 5310 4504 4470 4243 1915 1713 1557 638 580 34926 4719 1657 ----
NM_020708chr2051622 1601 1572 1554 152 ------
NM_020713chr2093072 2974 2686 2305 2143 2098 739 578 196 ----1429
NM_020727chr2133477 3076 2965 2522 385 ----
NM_020728chr742765 2639 2625 2116 12047 ----
NM_020734chr1252602 2272 846 737 424 ------
NM_020739chr1523161 416 13819 --14028
NM_020742chrX--22214 382 ----
NM_020746chr2051112 736 180 54 32 ------
NM_020747chr52934 761 --1687 --
NM_020748chr1721489 1339 --11471 --
NM_020750chr621501 333 1584 ----
NM_020752chr1052254 1943 857 653 640 ----12202
NM_020753chr171218 1722 ----
NM_020760chr221446 573 ------
NM_020762chr1221012 268 --1414 1922
NM_020766chrX54280 3789 3436 3027 1062 33916 3248 1293 ----
NM_020769chrX2392 151 ------
NM_020772chr1777348 6935 6735 5721 2888 2263 1881 32480 2448 1763 18212 --
NM_020773chr432594 849 564 11862 1242 --
NM_020774chr1866021 5728 4743 2048 1904 1231 26102 1783 25038 1922 14937
NM_020791chr172505 86 ------
NM_020801chr531691 854 532 ------
NM_020804chr672553 2301 2265 2039 783 259 181 1734 42593 2086 1038 371 --
NM_020805chr182594 362 1459 ----
NM_020809chr1141757 304 286 90 11679 ----
NM_020812chr192150 25 ------
NM_020813chr1931986 881 301 --31150 550 219 --
NM_020819chr61283 ------
NM_020825chr1693154 3140 3092 2941 2873 2490 1076 248 93 23318 3183 12672 1927
NM_020834chr1421686 433 ------
NM_020839chr331473 594 337 --21001 652 --
NM_020841chr1223873 3437 23786 308 1750 --
NM_020845chr1262279 1890 981 671 654 424 --21783 545 --
NM_020850chr1652923 1134 972 514 254 --22660 2372 --
NM_020856chr192406 59 ------
NM_020858chr1561785 1682 1573 646 537 73 ------
NM_020860chr41387 --139 --
NM_020868chr23581 431 375 ------
NM_020870chr442065 2021 1982 1869 ------
NM_020871chrX1361 ------
NM_020872chr321726 599 ------
NM_020873chr31834 ------
NM_020886chr113969 268 169 ------
NM_020888chr11399 1340 41569 802 785 115 --
NM_020896chr1131035 311 61 ------
NM_020897chr121182 505 ------
NM_020899chr1741865 1717 718 506 1493 ----
NM_020918chr1062832 2237 854 830 517 206 --12814 --
NM_020919chr23991 413 57 ------
NM_020920chr14------1151
NM_020921chr1463216 3138 2737 1370 584 34 11207 ----
NM_020925chr11514 --1463 --
NM_020935chr234555 978 235 43852 1570 611 430 ----
NM_020946chr961712 1528 1517 538 527 465 11232 ----
NM_020948chr121369 325 --13171 --
NM_020952chr94860 630 227 91 --1357 --
NM_020956chr1984019 3656 3211 1049 1015 768 703 503 ----11260
NM_020958chr141269 ------
NM_020962chr1541801 1703 909 61 --11659 --
NM_020977chr462120 1850 1758 1441 721 492 --167 --
NM_020981chr21781 --1529 1291
NM_020983chr1261936 1731 926 791 509 482 --11861 --
NM_020993chr1252599 1914 1021 817 599 11892 ----
NM_021003chr141706 ------
NM_021005chr152995 408 ------
NM_021007chr231680 1664 380 1335 ----
NM_021032chr312054 --1470 --
NM_021033chr1332735 2441 692 --1223 12849
NM_021035chr2081329 1088 1010 984 489 418 139 125 --21219 258 --
NM_021038chr343219 3193 2452 462 --13137 --
NM_021045chr1042501 2012 862 24 ------
NM_021069chr462014 1463 1437 1367 128 32 --147 162
NM_021072chr51447 ----1996
NM_021076chr221525 ------
NM_021079chr1733348 3034 2215 12324 ----
NM_021081chr20128 ------
NM_021088chr25635 589 486 298 61 --31869 786 498 --
NM_021090chr2294240 1868 1237 1179 875 793 628 113 88 13929 11146 11633
NM_021096chr2282809 2531 2003 1236 1210 947 818 95 --33244 2818 1158 12549
NM_021097chr241076 857 682 102 11213 ----
NM_021101chr322478 1705 11577 1614 --
NM_021111chr911281 ------
NM_021116chr7188923 8484 8253 7883 7514 7063 6838 6742 6577 6272 5882 5688 3191 2439 2058 1954 817 114 12288 38685 6727 769 16603
NM_021120chrX42701 2354 1254 676 22719 936 ----
NM_021129chr102243 49 ------
NM_021131chr91374 --11479 --
NM_021136chr143719 512 185 ------
NM_021137chr1731644 591 191 ------
NM_021140chrX2720 336 ------
NM_021145chr71719 1178 ----
NM_021148chr72987 320 146 12123 --
NM_021151chr73985 394 24 ------
NM_021155chr1922188 337 1939 1863 --
NM_021158chr205841 779 744 541 152 ------
NM_021159chr451688 1318 513 144 94 ------
NM_021161chr14----1565 --
NM_021163chr743506 2773 1359 1131 ----1773
NM_021165chr11720 1861 ----
NM_021177chr6----1239 --
NM_021183chrX52588 2557 2339 1880 573 ------
NM_021202chr2082511 2183 2151 1949 1921 1914 896 222 ------
NM_021215chr2032057 1817 743 --32269 473 440 --
NM_021218chr92901 779 1808 ----
NM_021222chr14946 436 409 236 21071 39 ----
NM_021224chr9----1153 --
NM_021229chr1221023 308 --2897 31 --
NM_021238chr1232012 767 324 11474 ----
NM_021239chr1421416 342 21260 186 ----
NM_021240chr92492 171 ----164
NM_021242chrX2378 29 ------
NM_021244chr61175 ------
NM_021249chr1431589 1035 473 ------
NM_021252chr1021953 230 ------
NM_021255chr1463693 3658 3402 3016 1125 1016 1918 14074 --
NM_021259chr161173 --2875 71 11041
NM_021572chr65975 370 328 314 184 ------
NM_021614chr52257 199 ------
NM_021619chr911276 --11328 --
NM_021622chr101231 12229 ----
NM_021629chr364779 4443 3223 3209 539 186 21913 1778 13342 24772 881
NM_021633chr141199 1121 867 274 21018 571 ----
NM_021638chr463915 3229 1729 189 162 61 11703 ----
NM_021643chr241814 1456 1450 269 ------
NM_021644chr101385 --141 --
NM_021647chr484536 1786 1533 911 774 749 548 146 11730 175 --
NM_021705chr621044 300 ------
NM_021722chr71113 ------
NM_021728chr141840 1115 ----
NM_021813chr695474 5457 5324 5163 4755 1420 858 734 78 11689 11498 --
NM_021814chr631727 1668 585 138 11519 --
NM_021907chr23309 258 123 ------
NM_021911chr535444 2038 1819 --1827 --
NM_021912chr1593895 3522 3393 3326 3318 775 723 644 78 13646 ----
NM_021913chr1931355 202 104 ------
NM_021914chr1462239 610 588 511 448 22 ----1407
NM_021935chr3145 1853 1976 --
NM_021940chr6160 21247 38 ----
NM_021943chr621571 284 2606 473 ----
NM_021945chr653541 3088 2364 1069 264 22954 2591 33533 3094 2717 --
NM_021946chrX21226 544 ------
NM_021947chr171503 ------
NM_021949chrX61991 843 772 395 203 144 2831 209 11863 --
NM_021951chr92190 31 ----1926
NM_021954chr1363400 3033 2956 928 441 70 1696 ----
NM_021958chr11309 ------
NM_021961chr11127147 6917 6592 5877 5429 5163 2416 2116 1806 1766 1258 1091 12997 ----
NM_021964chr344016 926 395 34 16671 ----
NM_021965chr941246 1103 326 77 --1916 --
NM_021970chr4126 ------
NM_021973chr43578 566 526 --1180 --
NM_021984chrX51095 978 472 466 177 11540 ----
NM_021987chrX51095 978 472 466 177 11540 ----
NM_021990chrX51095 978 472 466 177 11540 ----
NM_021992chrX--142 ----
NM_021994chr751073 954 755 735 177 ------
NM_021998chrX21532 1135 --1472 --
NM_021999chr13----1538 --
NM_022048chr15104450 4158 2423 2069 2016 1308 1040 835 752 195 14424 154 --
NM_022049chr141858 1721 1689 400 31733 217 163 ----
NM_022051chr12567 254 ------
NM_022062chr1151905 1833 1525 1472 158 ------
NM_022073chr1431599 1088 333 2455 265 ----
NM_022085chr621404 393 ------
NM_022093chr12310 157 1992 ----
NM_022114chr134466 3999 3536 11072 23137 1154 --
NM_022116chr731124 986 26 2191 142 ----
NM_022117chrX198 ------
NM_022118chr13141 ------
NM_022123chr14185 1156 ----
NM_022124chr101251 ----1190
NM_022130chr53578 294 256 ------
NM_022137chr1451995 1646 1403 627 132 --11955 --
NM_022138chr61100 ------
NM_022165chr19164 ------
NM_022166chr16116136 6121 4998 4938 4856 4658 4383 1827 1405 791 489 16070 ----
NM_022169chr1121210 262 ------
NM_022170chr741644 1488 1237 554 --199 --
NM_022171chr351440 1373 1161 1082 397 11008 --11314
NM_022340chr3113494 2818 2697 2311 794 624 552 525 359 155 21 12726 ----
NM_022351chr843764 3483 1528 951 ------
NM_022369chr154405 188 32 24 ------
NM_022371chr11267 ------
NM_022373chr73898 786 360 ------
NM_022405chr382849 2725 2352 1210 1168 800 786 205 22472 828 ----
NM_022454chr8--1165 ----
NM_022456chr12116853 6719 6332 6308 6106 5169 5105 2833 2122 1649 1400 34960 2785 799 17453 --
NM_022457chr1148 ------
NM_022459chr1376136 5534 5336 5010 4358 2098 419 21514 429 14346 11606
NM_022465chr1232411 487 308 2129 117 12275 --
NM_022469chr173135 2934 2851 987 612 217 127 ------
NM_022470chr321036 1022 ------
NM_022474chr1432747 1856 1070 ------
NM_022476chr162421 30 ------
NM_022477chr2021753 1337 --11239 --
NM_022479chr741449 1161 514 62 ------
NM_022482chr201630 22269 1691 12211 --
NM_022483chr531672 692 325 11715 21807 587 --
NM_022484chr721314 250 ------
NM_022485chr32357 323 ------
NM_022494chr102446 307 --1340 --
NM_022496chr121456 ------
NM_022497chr382722 2543 2515 1419 997 837 327 143 12589 1629 23754 2856
NM_022553chr63150 132 77 ------
NM_022572chr251747 1731 1645 1620 1248 ------
NM_022652chr12----1365 --
NM_022658chr122271 135 ------
NM_022659chr81143 ------
NM_022716chr142058 615 222 80 21283 845 --12776
NM_022719chr2243843 3192 940 750 --31403 949 663 32492 2387 1396
NM_022726chr6--11757 ----
NM_022728chr7----1680 --
NM_022730chr22124 85 --1849 --
NM_022733chr13848 273 248 11112 ----
NM_022737chr193466 305 284 --1520 --
NM_022739chr171965 ------
NM_022749chr811390 ------
NM_022753chr12505 366 ------
NM_022756chr131446 1084 327 21141 84 ----
NM_022758chr663137 3082 2635 2325 2301 536 ------
NM_022763chr342488 667 392 154 --12202 --
NM_022771chr121308 --1799 --
NM_022776chr341366 1277 1253 133 1245 ----
NM_022781chr932965 2228 1206 --1980 --
NM_022782chr121135 ------
NM_022802chr1051335 552 504 251 37 1563 ----
NM_022818chr1631418 1385 1291 --11347 --
NM_022821chr1288 49 ------
NM_022824chr54437 389 337 100 ------
NM_022826chr22855 423 ------
NM_022828chr541674 1500 1246 715 1379 ----
NM_022831chr141659 1323 524 381 --21807 1223 --
NM_022836chr131404 727 145 ------
NM_022841chr15----12692 --
NM_022843chr13----21331 526 --
NM_022845chr1621856 181 ------
NM_022893chr242996 2678 2347 186 135 ----
NM_022894chr23319 221 62 ------
NM_022898chr1464631 4278 3949 1381 962 663 --128 --
NM_022900chr73735 137 70 --21111 416 --
NM_022902chr51323 ------
NM_022912chr252844 2225 2016 1033 35 11134 22650 1231 --
NM_022918chr1111699 1780 ----
NM_022965chr431597 457 190 ----1549
NM_022970chr1041144 482 249 97 ------
NM_022977chrX22243 2145 ------
NM_023000chr1441651 418 393 280 --21082 484 --
NM_023001chr1441651 418 393 280 --21082 484 --
NM_023008chr193133 119 103 1162 ----
NM_023009chr12714 181 ------
NM_023010chrX1659 ------
NM_023011chr131335 ------
NM_023012chr122774 495 ------
NM_023016chr232812 2061 208 12717 ----
NM_023018chr151311 1250 1183 430 89 11493 11320 --
NM_023037chr133852 323 121 ------
NM_023076chr1662938 2528 992 385 268 157 --42397 2167 1106 808 --
NM_023079chr174649 393 261 247 --21396 202 1643
NM_023105chr841937 1890 192 78 11665 12147 --
NM_023106chr841937 1890 192 78 11665 12147 --
NM_023110chr841937 1890 192 78 11665 12147 --
NM_023111chr841937 1890 192 78 11665 12147 --
NM_023923chr192748 1186 760 746 544 369 280 136 83 21229 789 22396 877 --
NM_023925chr121250 ------
NM_023927chr521277 1163 ------
NM_023929chr812242 ------
NM_023940chr42956 931 ------
NM_024007chr542682 2130 538 214 ------
NM_024017chr1731409 174 142 ------
NM_024037chr13840 134 30 ------
NM_024043chr161197 --11208 --
NM_024052chr1742496 454 262 237 --174 --
NM_024054chr71335 ------
NM_024085chr22850 777 ------
NM_024090chr421905 207 ------
NM_024095chr122222 153 1470 1562 --
NM_024107chr172583 315 ------
NM_024122chrX1262 ------
NM_024165chr6145 --189 --
NM_024293chr21821 --1182 --
NM_024294chr663137 3082 2635 2325 2301 536 ------
NM_024295chr831627 1552 62 ------
NM_024297chr171103 ------
NM_024306chr162342 202 ------
NM_024345chr965914 1695 1576 902 179 139 11738 ----
NM_024408chr13789 486 433 --13437 --
NM_024491chr32621 146 ------
NM_024503chr14160 139 131 97 --126 --
NM_024511chr453330 3316 2489 1194 1094 --13449 --
NM_024522chr131414 528 28 11506 1137 --
NM_024524chr313093 --12663 --
NM_024529chr11138 ------
NM_024535chr162137 30 --1575 --
NM_024539chrX11075 ------
NM_024546chr133892 498 392 1461 1804 --
NM_024548chr321259 241 ----11343
NM_024551chr1212015 --22528 52 22310 2267
NM_024551chr1212015 --22528 52 22310 2267
NM_024561chr135565 444 430 189 176 1473 ----
NM_024565chr531712 1340 1066 ------
NM_024567chr8148 ------
NM_024570chr13--2234 211 ----
NM_024582chr41746 ------
NM_024595chr131007 993 252 21173 1036 ----
NM_024612chr1751100 844 821 814 758 --2980 107 --
NM_024615chr51229 ------
NM_024617chr9----1883 --
NM_024624chr221502 483 ----1374
NM_024640chr1----1185 --
NM_024659chr21149 178 ----
NM_024665chr3--191 ----
NM_024667chr1251349 698 484 216 39 1542 21286 1202 --
NM_024670chr1051670 1549 1535 1364 532 11713 ----
NM_024676chr121293 886 ------
NM_024702chr17187 1226 ----
NM_024704chr2031148 914 399 ------
NM_024713chr15------21337 1285
NM_024721chr832393 897 304 ------
NM_024740chr1194104 3410 2787 1101 1090 989 942 566 81 13425 13386 1399
NM_024745chr162719 311 1748 ----
NM_024749chr141435 125 64 52 ------
NM_024755chr153946 746 645 ------
NM_024761chr945137 1328 583 286 2749 560 ----
NM_024770chr286008 5677 5647 5501 4698 1948 798 677 22112 411 36246 2069 663 --
NM_024779chr1241042 605 404 53 ------
NM_024780chr163851 188 76 ------
NM_024792chr1731093 342 182 ------
NM_024804chr14340 249 129 115 ------
NM_024811chr1131383 780 48 ----11396
NM_024828chr92444 140 --11546 --
NM_024834chr1021687 1333 1144 ----
NM_024835chr172359 54 ------
NM_024837chr151529 11646 ----
NM_024881chr1963748 3314 1085 1071 851 297 1258 23579 342 12638
NM_024884chr1434123 1166 365 1513 ----
NM_024887chr182089 1849 1577 1462 540 512 301 82 ------
NM_024894chr22431 21 ------
NM_024900chr432141 1726 1552 ------
NM_024900chr432141 1726 1552 ------
NM_024911chr11277 ------
NM_024913chr721458 113 21694 1434 ----
NM_024915chr852018 1811 853 674 188 ------
NM_024917chrX1855 --1900 --
NM_024920chr41276 --11453 --
NM_024922chr1611599 11941 11363 --
NM_024944chr211460 ------
NM_024947chr3139483 9473 9437 9315 8342 7592 7543 7457 6543 3301 2178 1331 702 27178 7093 26018 2509 --
NM_024949chr484561 4016 1852 1249 554 540 173 32 13478 24922 3047 --
NM_024953chr1251110 605 588 207 75 ------
NM_024956chr152359 169 ------
NM_024960chr201429 199 --1533
NM_024969chr24897 876 844 265 --1577 --
NM_024971chr94860 630 227 91 --1357 --
NM_024979chr1361572 1217 1040 1033 265 92 --1116 --
NM_024989chr248079 7084 2730 2334 32805 1941 1049 21453 1381 --
NM_024991chr1032756 2528 760 ----1593
NM_025045chr22----2329 35 --
NM_025054chr833945 3014 974 --12910 --
NM_025057chr1421260 125 21275 956 ----
NM_025061chr1931015 892 261 ------
NM_025073chr173716 3566 1565 721 603 539 500 --13354 11376
NM_025074chr442983 2529 2228 583 1525 ----
NM_025076chr22239 198 142 ----
NM_025077chr1----1186 --
NM_025090chr1781204 1192 1039 1026 404 333 304 199 --1311 --
NM_025106chr181803 1661 1530 710 361 86 59 36 --11352 --
NM_025126chr121632 ------
NM_025133chr21423 ------
NM_025134chr1621828 582 ------
NM_025135chr181439 ------
NM_025146chr331965 1781 1097 12742 130 --
NM_025151chr832226 2042 50 1400 21719 1418 --
NM_025152chr1431432 478 227 ------
NM_025154chr741085 404 172 160 ------
NM_025164chr1141831 1702 884 579 ------
NM_025179chr1114892 4684 3906 3709 3703 3400 1316 1302 974 815 781 ------
NM_025181chr22181 153 ------
NM_025182chr93838 753 328 1395 11038 --
NM_025191chr132534 2202 1095 ------
NM_025195chr85686 631 266 136 39 ------
NM_025196chr4--138 ----
NM_025201chr1532078 1603 1313 --1324 --
NM_025202chr241049 887 108 70 ------
NM_025208chr1162330 2211 2196 2103 1759 483 ------
NM_025219chr2061759 897 812 724 520 399 --140 --
NM_025222chr3102406 2287 2273 1869 1159 1106 1089 878 305 149 ------
NM_025235chr1022275 209 ------
NM_025248chr1782811 2497 2287 1246 1039 887 166 27 --22881 299 --
NM_025263chr621279 336 --1328 --
NM_030594chr152866 851 1493 1136 --
NM_030621chr1434189 1228 1090 --12906 23541 561
NM_030625chr101626 ------
NM_030627chr531652 1063 796 ------
NM_030629chr1641445 1281 648 544 ------
NM_030637chr141141 ------
NM_030647chr726253 5519 32421 1655 1098 11054 --
NM_030648chr475337 5140 3868 3593 1165 1126 406 11454 14679 14285
NM_030650chr274070 4028 3794 2967 1594 1317 75 21675 912 23949 3533 1738
NM_030661chr731365 1040 418 ------
NM_030670chr1251969 1822 791 543 215 ------
NM_030671chr1251969 1822 791 543 215 ------
NM_030674chr12104880 4019 3631 2080 1698 1238 1116 995 900 408 35673 5612 525 11795 --
NM_030751chr10----1351 --
NM_030751chr10----1351 --
NM_030758chr2241442 1411 437 49 --21081 31 --
NM_030759chr102275 116 ------
NM_030766chr121802 ----1298
NM_030767chr952097 706 645 441 142 12882 ----
NM_030786chr141419 1233 333 223 --1766 --
NM_030802chr173256 232 116 --1240 --
NM_030803chr231150 1041 291 ------
NM_030805chr211102 1465 ----
NM_030806chr1138876 8653 8556 7948 7457 6706 6261 6237 3311 3292 2272 1512 414 13182 17602 --
NM_030808chr174688 439 314 241 ------
NM_030810chr621404 393 ------
NM_030815chr205672 560 516 310 77 ------
NM_030816chr183497 3301 3028 2564 1169 849 675 663 1713 11332 --
NM_030820chr62106 59 ------
NM_030884chr322270 552 --21991 1423 12169
NM_030906chr112410 53 ------
NM_030911chr13150 ------
NM_030912chr102856 609 ------
NM_030915chr231954 825 803 --2133 41 --
NM_030918chr195170 4283 4108 3975 3826 1980 1688 1279 1100 --35162 4633 3345 --
NM_030922chr151641 ------
NM_030937chr141433 1075 1041 233 11263 11103 152
NM_030939chr61374 ------
NM_030949chr62428 332 ------
NM_030962chr1141511 1423 1056 433 ------
NM_030963chr6146 ------
NM_030964chr551106 777 690 462 197 --12896 --
NM_030981chr1171177 1064 832 804 150 73 35 ------
NM_031203chr191213 ------
NM_031216chr18--11789 ----
NM_031226chr153811 444 169 11132 1428 --
NM_031262chr92848 32 --1364 --
NM_031263chr92905 89 --1421 --
NM_031266chr52433 117 ------
NM_031267chr7----1483 --
NM_031268chr16124976 4777 4614 4607 4498 3590 1781 1174 1130 527 88 42 --13745 14662
NM_031283chr25754 352 318 294 138 ------
NM_031305chr431676 357 91 ------
NM_031306chr12233 219 3906 888 262 1844 --
NM_031309chr852328 2103 1899 1644 1596 ------
NM_031314chr141166 22065 1710 ----
NM_031371chr151081 152 142 30 23 --11130 --
NM_031371chr151081 152 142 30 23 --11130 --
NM_031411chr542264 1559 692 351 ------
NM_031412chr122824 452 --132 --
NM_031417chr1982062 1939 1043 970 889 764 483 252 ----1538
NM_031419chr311049 1234 ----
NM_031427chr1475313 4592 4166 4114 3609 2036 1557 34195 1586 659 35672 5385 1678 --
NM_031442chrX103106 2963 2168 1290 1279 994 499 418 92 62 --12802 --
NM_031444chr2282270 2139 1981 1608 523 385 128 21 --1213 22437 569
NM_031445chr233377 2249 838 --12731 --
NM_031453chr101585 32293 1937 1615 ----
NM_031461chr852234 2207 2044 902 548 ------
NM_031468chr7127213 7098 6390 5938 5352 2100 1926 1052 986 792 750 167 --1673 --
NM_031469chr652883 535 396 259 243 ------
NM_031483chr2083546 3446 2806 1387 1291 759 573 312 ------
NM_031844chr133380 3366 2958 23842 3409 1321 13574
NM_031845chr252978 2925 2820 753 663 11429 ----
NM_031847chr252978 2925 2820 753 663 11429 ----
NM_031849chr542264 1559 692 351 ------
NM_031857chr542264 1559 692 351 ------
NM_031858chr171143 ------
NM_031860chr542264 1559 692 351 ------
NM_031862chr171143 ------
NM_031866chr102941 369 174 2334 186 --
NM_031892chrX1947 ------
NM_031908chr5------1989
NM_031922chr61393 ------
NM_031942chr21929 --1360 --
NM_031954chr1222723 2147 22609 858 12269 --
NM_031966chr52223 60 ------
NM_031990chr1931214 974 133 --11459 --
NM_031991chr1931214 974 133 --11459 --
NM_031992chr741644 1488 1237 554 --199 --
NM_032012chr974847 4653 4536 4336 1454 1440 360 11627 ----
NM_032013chr2021753 1337 --11239 --
NM_032015chr11----1620 1627
NM_032021chr1131101 888 464 ------
NM_032027chr11283 ------
NM_032042chr542761 2464 2029 485 ----12063
NM_032047chr332321 2058 621 12257 1431 --
NM_032050chr222996 35 1192 ----
NM_032051chr221180 --1266 --
NM_032052chr2221381 420 1577 ----
NM_032088chr52165 65 ------
NM_032092chr52165 65 ------
NM_032102chr1122050 749 12079 12036 --
NM_032105chr1117894 6846 6640 4998 2215 1811 1415 1281 1148 385 301 11983 37147 5798 2335 21713 894
NM_032121chrX42389 2359 2181 485 1347 ----
NM_032139chr19--2747 77 ----
NM_032144chr22512 380 --11673 --
NM_032147chr121952 ------
NM_032149chr41140 ------
NM_032153chr342577 848 118 58 --2333 66 --
NM_032154chr10157 --1179 --
NM_032156chr121250 ------
NM_032169chr32688 140 ------
NM_032174chr1----11484 --
NM_032182chr1011052 ------
NM_032189chr1373982 1809 887 530 493 246 109 ------
NM_032195chr212498 100 1389 ----
NM_032199chr1053464 3133 1491 557 239 1317 23370 2367 --
NM_032217chr41490 11331 ----
NM_032221chr2021566 637 1317 --1121
NM_032229chr131999 ------
NM_032231chr151103 ------
NM_032236chr1----1788 --
NM_032242chr392804 2789 2768 2541 2499 2455 2096 1006 967 --32841 2621 191 --
NM_032246chr1521111 80 1258 ----
NM_032256chr12--1417 ----
NM_032268chr1643110 3027 2459 2170 12015 ----
NM_032281chr1932705 989 417 ------
NM_032288chr33417 246 199 --12024 --
NM_032289chr551597 1297 1247 191 81 11274 1774 --
NM_032291chr11141 1278 1105 --
NM_032294chr1731421 1387 49 --31676 1466 1396 --
NM_032307chr92230 56 2207 126 ----
NM_032312chr2--1721 1307 --
NM_032321chr243194 2834 729 269 1214 ----
NM_032325chr1141416 470 335 26 ------
NM_032352chr1421133 581 ------
NM_032373chr1044940 4206 3925 208 24726 3954 35701 4045 615 15423
NM_032379chr111107 ------
NM_032380chr5136 ------
NM_032382chr161109 1547 ----
NM_032403chr52165 65 ------
NM_032408chr72899 217 11181 ----
NM_032410chr821211 31 1988 ----
NM_032424chr1131087 509 309 ------
NM_032429chr102593 115 ------
NM_032433chr1931342 1257 617 31318 646 242 ----
NM_032434chr211119 ------
NM_032438chr631542 1223 665 ------
NM_032439chr1021333 461 ------
NM_032440chr1032200 2080 102 12743 ----
NM_032445chr1532604 445 126 1805 --1404
NM_032446chr5--1792 --12441
NM_032452chr141979 ------
NM_032457chr433611 2679 424 --13679 --
NM_032458chrX22372 2335 ------
NM_032466chr81530 1300 ----
NM_032468chr81530 1300 ----
NM_032499chr152543 90 1656 ----
NM_032505chr342467 984 825 34 12785 ----
NM_032509chr82587 568 ------
NM_032532chr61617 ------
NM_032539chrX1553 ------
NM_032547chr431092 931 85 ------
NM_032552chr91730 1475 21666 133 --
NM_032557chr4----1262 --
NM_032560chr14--1130 2773 29 --
NM_032578chr1041205 1193 1116 978 ------
NM_032590chr121409 ------
NM_032595chr1731505 1405 516 --3416 380 302 --
NM_032603chr21743 ----1268
NM_032626chr161119 ------
NM_032632chr143806 371 289 ----1152
NM_032638chr31430 ----1198
NM_032646chr1751803 1783 1470 1261 692 --195 --
NM_032682chr343115 2777 699 385 ------
NM_032689chr1941438 1379 553 475 11157 ----
NM_032701chr19------1636
NM_032711chr1743645 3361 3338 1439 --11332 --
NM_032727chr1031363 1318 87 --11382 --
NM_032765chr51786 ------
NM_032780chr112799 372 ------
NM_032784chr64944 928 700 300 ------
NM_032808chr154904 850 168 64 ------
NM_032818chr951881 1867 898 746 212 21910 155 ----
NM_032826chr7115138 4668 4476 4088 3395 2051 1562 998 765 447 370 2943 808 ----
NM_032827chr241138 977 208 156 ------
NM_032828chr1964332 3083 1881 1791 1494 1436 --44276 3272 1930 424 14349
NM_032833chr142098 1883 699 310 146 ----
NM_032837chr1732086 1463 701 ------
NM_032842chr7--1354 ----
NM_032844chr101251 ------
NM_032859chr1332985 2914 973 23006 2925 22801 89 --
NM_032869chr822002 369 --152 --
NM_032873chr1164538 4525 4420 1735 712 694 13084 24457 259 --
NM_032875chr172734 675 --1683 --
NM_032932chr17136014 5964 5935 5379 5228 5036 4519 4505 1472 1066 906 671 223 --1539 --
NM_032943chr111107 ------
NM_032961chr42997 475 21192 23 ----
NM_032966chr1151508 1191 436 293 260 --1360 --
NM_032968chrX23089 3018 ----14111
NM_032969chrX23089 3018 ----14111
NM_032973chrY23084 3013 ----14103
NM_032992chr4288 74 2257 117 ----
NM_032995chr231396 1257 1150 1523 2676 190 --
NM_032998chr11966 ------
NM_033012chr131942 1377 ----
NM_033016chr2231506 1293 456 1365 1348 --
NM_033018chrX5453 227 128 120 101 ------
NM_033020chr134345 1234 118 21327 374 ----
NM_033023chr721231 1157 11245 1947 --
NM_033025chr192976 693 ------
NM_033044chr12956 364 ------
NM_033055chr11741 1751 ----
NM_033089chr2021207 973 ------
NM_033116chr143278 272 99 ------
NM_033125chr6------129
NM_033127chr12284 136 ------
NM_033129chr2081767 813 566 479 455 294 259 61 ------
NM_033132chr1332290 1873 550 --1582 --
NM_033135chr1162330 2211 2196 2103 1759 483 ------
NM_033138chr721680 415 22213 303 ----
NM_033139chr721680 415 22213 303 ----
NM_033140chr721680 415 22213 303 ----
NM_033141chr1451981 1708 845 607 126 12024 ----
NM_033143chr444174 914 771 280 ------
NM_033147chr23309 258 123 ------
NM_033148chr23309 258 123 ------
NM_033157chr721680 415 22213 303 ----
NM_033181chr663951 3507 3055 3016 1172 556 13028 ----
NM_033211chr551908 1632 818 572 326 ------
NM_033215chrX1389 ------
NM_033221chr951924 903 657 632 470 11849 --11010
NM_033222chr911144 132 ----
NM_033224chr7107706 7655 7552 7525 5108 2462 1338 1267 247 238 --1400 --
NM_033225chr811210 --1238 --
NM_033226chr161179 ------
NM_033239chr151432 ------
NM_033240chr1521727 419 ------
NM_033247chr151323 ------
NM_033254chr3----1127 --
NM_033259chr32845 234 --1620 --
NM_033274chr533043 775 351 11318 22941 1440 --
NM_033281chr51146 ------
NM_033285chr854459 4420 4372 1316 337 13672 23953 699 11015
NM_033290chrX63642 3303 3131 3069 2744 1453 1407 13699 --
NM_033300chr121044 324 ------
NM_033305chr921108 247 ------
NM_033310chr111233 ------
NM_033326chr1152042 2024 1758 974 645 ------
NM_033337chr32807 285 ------
NM_033340chr1031356 1012 22 --1475 --
NM_033348chr11------1284
NM_033360chr1224376 3271 ------
NM_033375chr1761245 558 526 506 484 120 --11071 --
NM_033380chrX2993 169 ------
NM_033381chrX2993 169 ------
NM_033387chr952636 1741 1047 840 283 --2791 169 --
NM_033389chr1774784 3996 3482 1738 797 307 78 13492 11669 --
NM_033393chr472668 2622 1093 1026 881 425 240 1589 12761 12165
NM_033394chr221125 646 ------
NM_033396chr112158 26 1427 ----
NM_033421chr2031257 646 520 --1756 --
NM_033425chr1183093 2822 2695 2470 2283 1307 887 216 ------
NM_033426chr1472149 1883 1035 709 552 385 148 2613 584 1539 --
NM_033429chr1552658 2495 2269 1087 80 13090 ----
NM_033480chr632853 841 64 11113 1653 --
NM_033481chr632853 841 64 11113 1653 --
NM_033495chrX11021 1893 ----
NM_033496chr102212 38 ------
NM_033497chr102212 38 ------
NM_033498chr102212 38 ------
NM_033500chr102212 38 ------
NM_033505chr296169 5044 4892 4645 4504 2694 2583 2272 833 25210 1031 11326 --
NM_033512chr84