TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-765
miRNA Sequence: UGGAGGAGAAGGAAGGUGAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr53371 212 130 --2447 436 --
NM_000025chr841200 777 357 177 1394 1231 --
NM_000044chrX--1109 184 --
NM_000056chr6172 ------
NM_000061chrX2152 32 ----139
NM_000070chr151355 --1140 1144
NM_000074chrX4852 773 674 112 1611 1656 --
NM_000088chr1741239 1208 1146 366 1372 21175 404 11189
NM_000090chr23810 161 55 --2813 619 1817
NM_000127chr8----163 --
NM_000138chr1562315 2291 1993 903 302 201 21848 812 --1378
NM_000161chr1431469 1328 394 21220 398 --11269
NM_000166chrX3255 141 121 --265 62 --
NM_000183chr2----1101 --
NM_000208chr19104026 3303 1887 1750 1395 1361 728 561 238 51 44119 3522 3178 2924 24536 759 13954
NM_000217chr12115227 5221 4966 3786 3593 3447 3352 2031 1954 1696 828 24188 3406 14937 33790 3454 1004
NM_000244chr112544 215 1167 5756 617 550 306 218 --
NM_000267chr1773457 3443 2933 1121 894 157 46 22749 768 32140 1130 1127 --
NM_000276chrX51446 510 448 353 153 12004 --1273
NM_000278chr1082224 1891 1702 1637 1594 906 878 740 --41628 1542 909 751 1840
NM_000314chr1023105 2426 --12691 1915
NM_000318chr832018 1892 545 11039 22747 123 1282
NM_000332chr6126504 6212 5951 5916 5801 5470 4885 2868 2306 961 498 289 36289 6128 2429 ----
NM_000362chr22103405 2899 2883 1249 1103 844 819 370 274 175 13547 52689 1214 413 399 68 22680 417
NM_000366chr151210 --169 --
NM_000411chr2132971 2448 668 22862 90 12044 11309
NM_000412chr3----1265 --
NM_000430chr1733528 3431 36 33477 2337 788 125 --
NM_000445chr84704 306 226 90 ------
NM_000448chr1132496 2004 1009 22669 960 21014 69 --
NM_000478chr13491 171 95 --1648 1470
NM_000488chr1----127 --
NM_000495chrX1954 3878 791 260 ----
NM_000507chr91237 ------
NM_000525chr1111501 --21033 204 11208
NM_000530chr131092 712 357 --1245 --
NM_000533chrX51381 749 411 334 109 11905 1761 --
NM_000555chrX187545 6973 6326 6106 5691 5658 5607 5541 5019 2898 2890 2776 1961 999 990 509 340 175 32406 1620 785 47651 2707 2700 178 35821 3026 2575
NM_000578chr231791 1512 1168 --11633 11313
NM_000599chr2104589 3466 3188 2855 2836 1120 1087 1022 675 608 44166 3879 3298 831 74317 4104 3981 3293 2993 614 567 1571
NM_000633chr1833183 2106 870 11670 --11048
NM_000724chr1041452 1227 245 225 1382 11384 --
NM_000725chr124781 641 329 260 --1266 --
NM_000726chr221061 952 --11349 --
NM_000801chr2041009 994 199 186 --1190 --
NM_000813chr592130 2104 2080 1771 1630 1166 369 362 38 65052 3812 3521 2115 1941 1857 ----
NM_000814chr1553842 3396 1363 559 523 ----12723
NM_000831chr165861 5258 3842 1069 973 194 2715 375 --31770 767 299
NM_000833chr1641386 1336 1265 1171 31227 1126 172 11010 --
NM_000834chr1261297 907 346 336 316 109 --2211 191 --
NM_000842chr112653 275 ----1681
NM_000855chr11------128
NM_000875chr15145841 5171 4966 4896 2220 1852 1396 954 634 609 324 314 296 151 26419 5957 64747 4374 4328 1990 1579 339 --
NM_000883chr73618 516 118 1111 1626 --
NM_000894chr19280 63 ------
NM_000924chr1241129 1094 467 273 1546 41197 1144 1020 974 --
NM_000945chr231704 658 541 11498 --144
NM_000949chr53731 300 117 1153 --1736
NM_000964chr1731229 957 161 11175 --11314
NM_000966chr124936 930 340 127 2940 886 1673 --
NM_001001323chr1242936 2872 2135 243 32800 820 163 ----
NM_001001331chr352479 2058 1875 1860 353 ----21931 1912
NM_001001522chr112320 44 --1160 --
NM_001001549chr752569 1905 1792 853 733 1542 1407 --
NM_001001560chr221534 --2158 126 1721
NM_001001664chr223757 2856 1362 22561 2558 21117 47
NM_001001684chr1711983 --32351 1784 510 --
NM_001001790chr9----161 --
NM_001001924chr811870 1206 1465 11390
NM_001002269chr9------1164
NM_001002296chr831025 378 358 1459 180 --
NM_001002762chr1082909 2509 2301 2258 981 967 938 240 32575 524 381 42377 1188 830 250 --
NM_001002838chrX61786 692 439 402 239 77 ------
NM_001002860chr1494289 4249 3366 2923 1862 1704 1679 1496 551 44049 4022 3397 621 1517 --
NM_001002909chr17101717 1641 1591 1488 770 433 371 334 227 204 --3343 318 207 --
NM_001002919chr2------1128
NM_001003682chr121250 535 ----11101
NM_001003799chr71251 1131 1243 1582
NM_001004065chr913477 33352 1384 488 1557 --
NM_001004127chr131635 ----1789
NM_001004342chr1185814 5350 5075 4775 4387 2225 2147 1482 1431 1410 1031 978 814 775 768 751 725 456 44762 796 691 684 155817 5562 4621 1910 1907 1872 1423 1416 1314 843 779 740 712 701 680 --
NM_001004419chr1254314 4253 4062 3532 271 11230 34333 4038 1330 --
NM_001005336chr91452 --191 --
NM_001005340chr7----1856 --
NM_001005404chr17133751 3659 3503 3011 1585 1353 1222 1077 972 643 222 128 60 24288 1146 --11568
NM_001005417chr11197 --1230 --
NM_001005753chr242063 1704 1675 663 12153 137 --
NM_001005920chr161724 1318 --3996 827 360
NM_001006634chr16------1472
NM_001006665chr13765 507 187 --2170 167 --
NM_001007156chr1571884 1687 720 673 452 221 21 1739 21763 748 --
NM_001007232chr11----188 --
NM_001007237chr122190 1938 11813 --1462
NM_001007271chr102851 767 --1168 --
NM_001008220chr563253 2663 706 560 545 303 33554 2518 553 31035 141 123 13317
NM_001008222chrX41334 890 500 379 31170 1059 259 41012 1007 1002 299 11185
NM_001008239chr1893297 2353 1411 1007 700 660 53 46 22 13234 33511 147 144 11011
NM_001008272chr32288 226 --3291 95 92 --
NM_001008529chr1731295 1056 83 ------
NM_001008541chr101320 --21773 95 --
NM_001008567chr9----1323 1315
NM_001008701chr19102976 2967 2896 2739 2477 1194 1180 1020 612 504 --82936 2026 1062 887 884 881 870 435 --
NM_001008897chr62463 144 ----1378
NM_001009894chr121249 ------
NM_001009993chr243734 3659 1604 939 24363 1133 44112 3662 2839 1662 --
NM_001010861chr132486 1717 173 --1714 --
NM_001010924chr1031198 331 248 ------
NM_001010935chr13801 367 226 11069 1113 --
NM_001010986chrX21832 399 ------
NM_001011708chr282806 2762 2744 2025 1191 1174 1077 346 --22797 2794 --
NM_001012338chr15----142 --
NM_001012393chr11143913 2064 2045 1756 1705 1606 1493 1348 945 887 625 321 291 283 35048 4934 4091 --21724 40
NM_001012977chrX6499 482 283 204 176 153 --41161 286 196 191 --
NM_001012989chrX155 --134 --
NM_001013031chr1052406 1303 864 401 248 21070 843 1815 --
NM_001013399chr6------11162
NM_001013415chr411425 11358 11429 1314
NM_001013438chr3--21015 272 ----
NM_001013620chr12168206 7540 6605 5992 5909 3123 2930 2360 1873 1733 1591 1510 1175 860 806 352 23210 1695 --17977
NM_001013642chr171159 1147 1106 1002 265 204 158 --1149 --
NM_001013690chr1232396 934 335 12372 52401 2182 1622 362 359 --
NM_001014435chr164428 130 87 42 --1510 1115
NM_001014831chr191126 --2626 89 --
NM_001014839chr12105 64 --2906 426 --
NM_001015053chr1751530 1408 1118 271 212 1510 81269 1241 1238 1228 565 562 559 417 2425 130
NM_001015508chr83709 701 628 1103 ----
NM_001015877chrX23003 813 31140 707 125 1659 1523
NM_001015881chrX1454 --2460 457 --
NM_001015887chr331517 1404 513 --21520 621 --
NM_001017424chr151857 578 525 269 47 --1528 --
NM_001017440chr7237958 7613 7448 6699 6551 6251 6239 6018 5909 5781 5758 5470 3029 2648 2576 1628 1613 1092 882 848 735 509 182 47647 7000 514 73 27394 69 36517 5762 2253
NM_001018025chrX4748 739 253 34 ------
NM_001018064chr941782 283 40 26 11591 --1104
NM_001018067chr184888 3507 3500 1938 1246 866 678 580 11258 21254 165 --
NM_001018078chr9151 --1188 --
NM_001018108chr15121901 1583 1508 851 782 726 700 689 596 588 156 77 32157 866 471 11819 --
NM_001024226chr1----128 --
NM_001024401chr1642881 2540 1039 960 12815 42269 2063 1894 449 --
NM_001024460chr611204 --2984 430 --
NM_001024649chr552223 1835 913 895 542 32891 2198 859 42480 916 43 36 11885
NM_001024858chr1462759 2553 2503 2421 1990 806 12950 152762 2710 2707 2694 2568 2556 2530 1993 692 682 624 316 303 239 71 --
NM_001024937chr173718 197 180 1291 5698 695 589 200 183 --
NM_001024948chr132391 1272 709 13469 ----
NM_001025076chr10155924 5216 5022 4979 4800 4384 4338 4271 2451 2365 2211 1712 1109 393 167 45494 4423 2445 1545 35927 5238 4920 --
NM_001025077chr10177282 6574 6380 6337 6158 5742 5696 5629 2467 1751 1525 1326 1051 443 271 246 221 36852 5781 2903 57285 6596 6278 1387 1161 1226
NM_001025079chr3133727 3206 2921 2675 2653 2555 2542 1511 1107 906 779 737 659 --53538 2712 2656 2527 782 23097 2531
NM_001025205chr31294 --192 144
NM_001025579chr1741127 477 291 43 1827 61130 766 763 28 25 22 2867 124
NM_001025579chr1741127 477 291 43 1827 61130 766 763 28 25 22 2867 124
NM_001025580chrX94035 3027 1387 597 464 374 355 332 319 --34117 4027 47 13606
NM_001029882chr12598 93 ----1184
NM_001029998chr431350 1338 576 1551 1459 --
NM_001030005chr1531309 1213 161 1962 ----
NM_001030006chr1772624 2617 2236 2229 2155 771 613 --12416 1263
NM_001030007chr16103630 3014 2982 2951 2719 2469 1285 1112 443 183 --32835 240 232 3761 258 189
NM_001031679chr1223300 1244 33481 2760 2607 33359 2725 359 --
NM_001031690chr7112777 2460 2245 2116 2061 2041 1223 1169 961 410 132 52865 2732 835 416 377 42739 2249 2100 1136 22830 2071
NM_001031695chr22135206 5093 5075 4712 4379 4128 3592 3299 1514 1285 1243 813 598 44986 3936 1296 1221 74931 4926 3905 827 621 607 604 --
NM_001031740chr11518 11095 --1183
NM_001031804chr1684419 3660 3263 2993 2909 2761 1147 445 1294 3637 595 579 --
NM_001032280chr641492 1176 1110 603 --11194 --
NM_001032282chr811182 ------
NM_001032288chr20----1380 1579
NM_001032296chr1372850 2803 1044 1029 839 53 43 --2214 56 --
NM_001032380chr1021307 128 1132 ----
NM_001033561chr172796 773 1299 4833 828 805 802 --
NM_001034025chr121881 --163 --
NM_001034837chr51263 --1197 --
NM_001034954chr1022652 1100 ------
NM_001035254chr972507 2458 2393 1989 959 661 226 1832 52396 828 746 589 229 21947 121
NM_001035267chr121200 --1282 --
NM_001035511chr1102137 2126 1875 1758 791 747 713 662 345 26 21767 1449 42140 720 717 215 11887
NM_001037164chr721785 198 --1201 --
NM_001037165chr7178926 8365 8107 7528 7298 7086 6558 5779 5542 5534 3015 2454 2307 1821 1520 1042 250 11349 68929 6562 6074 1784 271 253 --
NM_001037954chr1163396 2991 891 804 648 154 --13270 1127
NM_001039350chr7--1697 41283 239 171 79 --
NM_001039479chr1461835 1658 470 445 391 228 11634 ----
NM_001039550chr2187 --3755 752 180 --
NM_001039583chr221513 --1131 --
NM_001039618chr1142225 539 481 233 34753 4155 1262 1306 --
NM_001039690chr1652221 1897 589 210 39 22048 912 12166 --
NM_001039711chr11893 ----1904
NM_001039802chr121233 1039 --1431 --
NM_001039888chr14726 629 559 504 1664 1791 --
NM_001039937chr1333296 3194 1002 33056 1143 247 ----
NM_001040034chr12124 ------
NM_001040108chr1453318 3303 2242 2109 1205 ------
NM_001040110chr721312 697 11532 31464 1457 1454 --
NM_001040134chr191131 --21374 1371 --
NM_001040152chr795080 3132 1793 1705 1270 1206 696 342 94 63428 3301 1167 772 458 191 25056 5022 --
NM_001040167chr7----21027 382 --
NM_001040214chr632217 1745 277 --2346 207 --
NM_001040272chr932342 446 285 12154 41660 1451 459 456 22346 138
NM_001040424chr2132086 1034 472 11901 22090 932 --
NM_001040429chr1332529 376 42 ------
NM_001040439chr1631426 541 100 --11309 --
NM_001040624chr862339 2079 2067 1878 1860 135 21915 1864 52450 2348 2345 2342 536 --
NM_001040708chr81378 --11027 --
NM_001040709chr1102134 1632 897 829 817 751 549 476 187 44 32458 2350 2155 4832 190 83 77 187
NM_001040715chr16----1460 1404
NM_001042353chr203555 407 370 --4473 411 374 223 --
NM_001042404chr121934 1588 ------
NM_001042486chr2051527 1389 1215 411 248 --11531 --
NM_001042506chrX6499 482 283 204 176 153 --3286 196 191 --
NM_001042533chr311089 ------
NM_001042539chr161356 --3986 365 240 1945
NM_001042599chr2157709 7611 5977 5764 5471 5365 3036 2808 2444 2162 1957 1911 1525 349 79 22197 896 47614 7589 6735 5511 17593
NM_001042601chr352333 2323 2176 503 36 13298 --1508
NM_001042632chr2031927 1672 1664 11807 31902 1616 119 11715
NM_001042681chr172398 2387 2249 2194 2084 1981 989 32283 924 570 32428 2156 2042 1877
NM_001042749chrX2757 625 11816 ----
NM_001043318chr14143771 3711 3537 3253 3215 3166 2943 2711 1596 1486 1377 968 885 226 13393 41264 1064 888 816 --
NM_001043351chr141897 1500 785 120 11856 3176 139 33 --
NM_001046chr52370 220 1467 --1431
NM_001077628chr11463 165 1484 --
NM_001079874chr151890 1869 269 130 124 ------
NM_001092chr1741574 622 474 421 2478 351 1489 --
NM_001095chr1291840 1722 1710 1520 1493 707 161 120 74 --41685 1497 1282 1271 1265
NM_001106chr3198436 8211 7570 7399 7227 6609 6273 3643 3382 3039 2662 2203 1765 1722 1014 729 521 479 462 11197 47476 2960 1839 497 --
NM_001121chr101565 ----1299
NM_001124chr111561 --1173 --
NM_001140chr173464 222 201 --3238 194 98 --
NM_001144chr1631041 241 165 --1198 --
NM_001148chr441498 528 503 329 31660 1512 371 21501 128 --
NM_001163chr931002 758 326 --21005 41 --
NM_001204chr2107383 6932 5367 2202 1845 1323 1298 1182 688 93 31762 799 578 45370 5221 1186 556 22206 1491
NM_001206chr932865 306 148 12059 22783 1190 --
NM_001221chr41102 --2110 107 --
NM_001222chr10----21805 1613 --
NM_001257chr163441 195 186 ----1563
NM_001259chr785988 5430 4473 1937 1311 1060 921 578 24825 1508 --1145
NM_001273chr123382 102 46 1115 170 --
NM_001275chr141405 1279 ----
NM_001315chr642141 1937 785 265 1108 1386 --
NM_001351chr321370 729 1441 --1380
NM_001364chr11154530 4467 4370 4173 3867 3312 3297 3265 3231 3220 3187 3170 1919 919 295 34487 3373 1091 73706 3340 3315 3191 3130 3127 3124 --
NM_001365chr173501 258 238 --1163 --
NM_001390chr1851342 1214 1128 999 314 --128 22864 985
NM_001395chrX2993 194 ------
NM_001406chr1771516 1358 533 466 451 439 388 --71670 1647 1476 454 416 275 126 154
NM_001407chr351548 1442 564 555 421 11385 1382 11660
NM_001417chr1231728 1215 25 11962 31744 1467 523 11219
NM_001426chr22589 264 --2592 496 --
NM_001427chr73828 735 693 11403 18835 832 819 816 813 802 799 796 793 790 768 755 748 742 739 726 723 720 --
NM_001429chr223904 416 235 ------
NM_001448chrX1502 --11545 --
NM_001454chr172874 265 --1217 --
NM_001455chr684837 4716 4409 4251 3925 3298 468 237 13655 11731 11461
NM_001478chr128945 863 818 342 242 180 122 45 --2795 130 --
NM_001495chr83936 286 156 --5982 916 913 906 143 --
NM_001543chr584720 4620 4216 3576 1947 1874 705 679 24829 398 21920 1805 21809 470
NM_001546chr631245 1112 234 21304 1250 ----
NM_001617chr261232 1222 1111 835 476 423 --4267 57 44 35 --
NM_001621chr731868 892 525 ----22537 530
NM_001635chr71876 1299 --1956
NM_001654chrX----1416 --
NM_001659chr12112668 2626 2264 2206 2045 912 887 743 342 160 80 --62630 2512 2507 2209 2080 673 --
NM_001662chr73105 93 75 ----1256
NM_001664chr32988 922 --1223 --
NM_001668chr132123 595 92 21792 684 ----
NM_001678chr1791729 1645 1634 1627 1469 1411 661 496 148 31609 1219 739 81402 1325 585 565 562 559 449 204 --
NM_001695chr864219 3583 3330 3115 2981 132 14130 1281 13587
NM_001701chr941472 1294 557 56 11510 11281 --
NM_001706chr3139 --1232 --
NM_001709chr111337 --1882 --
NM_001731chr122920 275 --170 --
NM_001743chr22150 89 1139 ----
NM_001753chr751518 1407 590 564 166 ----11511
NM_001759chr12144509 4287 3979 3740 3572 3420 3326 1951 1414 1185 1086 1042 605 51 33761 3524 714 34939 1262 1035 --
NM_001760chr61729 1830 3803 216 213 --
NM_001798chr122786 242 --1733 144
NM_001810chr203768 222 216 --1694 --
NM_001839chr1188 --2661 166 --
NM_001842chr91118 --1195 --
NM_001859chr933002 2993 267 --197 23540 271
NM_001862chr2----282 79 --
NM_001895chr2081052 1003 451 423 362 296 276 56 21205 384 --1427
NM_001923chr111199 --167 --
NM_001933chr143984 540 461 1284 21013 57 1906
NM_001949chr673045 1203 529 399 307 95 24 22305 99 2428 314 --
NM_001969chr1441322 1311 524 352 21105 51 ----
NM_001970chr172536 40 --3242 237 106 --
NM_001975chr125791 226 183 144 44 2795 755 1244 --
NM_001995chr44523 286 141 48 --151 21167 582
NM_002010chr13----2191 188 --
NM_002025chrX198439 8042 7775 7559 7441 7377 6813 6784 6586 6067 5691 3536 3390 3055 2677 1199 1077 1050 916 28332 1413 17563 17549
NM_002026chr231021 1013 874 21037 131 --1158
NM_002060chr12375 198 --1485 --
NM_002074chr121155 230 1148 --21518 1495
NM_002077chr972150 1917 1837 1635 1490 844 510 21938 294 42065 1561 1552 1549 21795 1533
NM_002086chr1762066 2058 2008 1790 284 255 21837 500 32044 1884 244 --
NM_002088chr191411 --1417 --
NM_002114chr62456 66 ------
NM_002135chr121123 --2413 402 --
NM_002137chr72770 318 ------
NM_002140chr91131 ------
NM_002145chr172296 41 ------
NM_002205chr121224 --1117 --
NM_002207chr31123 162 --188
NM_002214chr7124632 3526 3483 2244 1894 1806 1571 1468 1409 1268 872 284 43985 2202 2063 1847 33560 1043 648 --
NM_002230chr177892 825 744 430 323 105 44 --3985 62 48 --
NM_002264chr3104798 4572 4464 3334 1591 1440 1160 763 92 57 44231 3122 571 486 1343 --
NM_002265chr17----1305 --
NM_002267chr1342154 744 347 227 1451 ----
NM_002270chr595461 5450 4252 4209 4039 3729 1667 1573 690 35438 2179 43 11983 --
NM_002278chr17----1408 --
NM_002293chr152411 2173 1773 969 378 21737 1111 32162 497 103 32415 1777 218
NM_002309chr2273050 2753 2001 1966 726 476 231 --73008 2732 2594 2247 2244 847 714 --
NM_002334chr1181988 1511 685 406 340 286 104 36 --71605 1514 691 113 110 107 39 --
NM_002355chr1241109 1093 996 146 1911 2569 28 --
NM_002356chr642826 254 175 40 22611 1984 11946 --
NM_002359chr17103825 3044 2949 2889 2729 1613 1079 117 96 82 --63892 3074 2825 1121 123 106 --
NM_002361chr192220 78 ------
NM_002373chr1541271 1225 504 45 1483 21310 333 --
NM_002382chr144941 177 117 55 --2492 180 1347
NM_002399chr1541333 1075 969 542 21020 885 1119 --
NM_002399chr1541333 1075 969 542 21020 885 1119 --
NM_002401chr171412 --21868 84 --
NM_002442chr1241723 1712 442 210 --11328 --
NM_002465chr121235 --246 33 --
NM_002473chr222276 182 --3450 447 117 --
NM_002479chr12210 147 ------
NM_002501chr1993926 3197 3007 1649 617 354 182 80 32 --73903 3900 1549 1546 1409 1336 899 44130 3907 1340 189
NM_002505chr641510 1270 568 353 31313 1029 542 1393 171
NM_002507chr1751912 1744 1395 1277 672 --2287 120 --
NM_002516chr19----8230 107 65 62 53 50 47 37 --
NM_002522chr17112713 2526 2446 1376 1367 978 879 843 386 205 76 --12537 11238
NM_002526chr6----1581 --
NM_002537chr15185 --1793 --
NM_002544chr17----138 --
NM_002547chrX53083 1657 742 358 194 --2339 114 --
NM_002576chr1161186 1122 291 225 127 86 --2104 89 1317
NM_002577chr3133725 3504 2948 2882 1526 1514 985 901 895 792 779 504 444 --43123 1540 1532 1493 1415
NM_002581chr954728 4706 2151 1229 961 12141 --15063
NM_002585chr11260 --1134 --
NM_002587chr51314 --2426 137 --
NM_002588chr551681 1375 501 485 384 21275 323 81718 1667 1395 1300 645 540 361 58 1316
NM_002601chr21319 2197 74 1328 --
NM_002607chr72889 129 --1132 --
NM_002616chr17----3383 115 49 --
NM_002628chr32439 385 1433 ----
NM_002636chr63426 387 43 --167 1401
NM_002636chr63426 387 43 --167 1401
NM_002648chr641207 974 236 22 1330 3986 428 220 1513
NM_002649chr73625 476 400 11175 1143 --
NM_002655chr874488 4469 4406 4184 3913 1491 744 ----14421
NM_002657chr20133645 3394 3239 3232 3164 2516 2491 2465 1338 1144 977 777 529 2951 852 53655 2520 1545 312 287 11301
NM_002698chr19102380 2221 1968 1867 1198 1130 325 214 199 76 --152605 2343 2323 2312 2309 2304 2293 2285 2274 2266 1067 1014 220 217 190 1224
NM_002699chr141256 597 537 495 1417 11373 --
NM_002711chr72295 259 ----1150
NM_002717chr82652 464 1189 1468 --
NM_002719chr1431493 580 316 --21759 615 --
NM_002726chr6----1170 --
NM_002730chr1951358 948 935 909 241 --11266 11133
NM_002745chr22144457 4179 4172 4072 3999 3208 2947 1693 1045 387 319 197 118 59 34110 4023 3483 11313 --
NM_002753chr42547 298 ----151
NM_002763chr11139 ------
NM_002821chr64557 546 156 87 1253 4308 249 163 160 --
NM_002827chr2031192 728 156 --21371 731 --
NM_002829chr94347 272 45 26 ----1854
NM_002833chr152626 413 --31202 364 317 --
NM_002834chr1243416 972 399 219 --11002 --
NM_002838chr11484 11024 ----
NM_002840chr141217 519 325 296 --31377 370 62 1597
NM_002850chr1951143 942 359 245 236 --2945 394 --
NM_002855chr11103633 3455 3200 3121 3064 1408 1033 654 254 190 11479 72559 814 571 458 455 200 37 12563
NM_002865chr8----165 --
NM_002867chr1----158 --
NM_002868chr1282407 2255 1680 887 728 413 329 311 31909 1690 806 42171 416 317 314 --
NM_002869chr1162067 1764 1706 857 453 383 --11768 11775
NM_002886chr394822 4668 3362 1863 1827 1575 1438 543 243 11350 14600 14152
NM_002896chr111160 --2302 164 --
NM_002924chr13589 504 205 --3234 208 161 --
NM_002938chr431302 498 215 2780 56 21995 1286 21477 1290
NM_002942chr33476 271 178 --1274 --
NM_002959chr194146 4060 3957 3489 2859 2850 1433 1113 547 2955 503 33070 1589 894 --
NM_002965chr1--1184 1180 --
NM_002973chr12----140 --
NM_003010chr1722376 703 11910 21818 1686 12381
NM_003011chr91380 147 1586 --
NM_003016chr1741687 1575 770 424 1356 11855 --
NM_003043chr373850 3753 2869 2802 1376 1181 907 23562 1305 34000 3245 3054 13284
NM_003047chr131343 322 187 --71346 1242 506 325 306 274 160 145
NM_003070chr9140 --2745 742 --
NM_003072chr19--1132 1357 --
NM_003075chr12----1126 --
NM_003081chr2051146 437 271 236 21 --11157 253 25
NM_003098chr202479 342 --1497 --
NM_003099chr15146055 5991 5941 2523 2461 2267 2199 1978 1504 1196 767 677 117 58 --15241 162
NM_003107chr621057 662 11863 --11621
NM_003108chr2127029 6311 6071 4786 2858 2581 2265 1873 1763 1060 1037 865 16303 46503 1876 1855 1767 25645 1859
NM_003110chr172164 52 --2842 167 --
NM_003112chr722362 275 31047 651 218 ----
NM_003131chr6112113 1959 1767 665 522 505 407 369 249 208 189 --61967 1431 677 653 372 252 --
NM_003137chr63484 277 69 32086 1784 1666 295 73 12002
NM_003139chr112804 52 1777 2677 137 --
NM_003145chr13193 129 103 --246 24 --
NM_003155chr892807 2529 2418 2326 2300 2118 908 259 227 1538 12075 --
NM_003164chr113546 436 179 ------
NM_003173chrX41377 1239 1226 1198 --21380 390 --
NM_003178chr321872 1592 1598 3410 405 156 --
NM_003179chrX21463 1444 1417 61447 1361 1358 1199 394 376 --
NM_003185chr2041347 1107 463 138 --1493 --
NM_003204chr1741333 1165 606 120 --11336 11457
NM_003205chr1532179 577 54 42192 1865 1688 1430 1733 --
NM_003250chr171149 --150 --
NM_003253chr212561 378 ----1475
NM_003275chr91471 --11483 1379
NM_003289chr92201 34 --142 --
NM_003299chr122180 103 ------
NM_003300chr141329 --142 --
NM_003315chr17----179 --
NM_003320chr1193574 2777 2752 1599 1522 970 315 160 83 23331 682 44167 4164 4159 986 33648 3272 2756
NM_003339chr521404 110 ------
NM_003345chr16--1133 2416 196 --
NM_003348chr1251704 1395 1209 402 54 --258 34 --
NM_003370chr192228 216 --3738 587 29 --
NM_003374chr52798 581 1776 ----
NM_003385chr21350 1276 1272 --
NM_003404chr2051756 1443 1389 1361 591 11365 ----
NM_003413chrX51900 789 455 255 247 ----1290
NM_003439chr732767 185 131 2811 771 1597 --
NM_003453chr13----194 --
NM_003458chr3123962 3844 3819 3534 3050 2967 2555 1317 1288 1015 950 832 33932 3785 527 73852 3823 3732 3452 3241 1302 722 13198
NM_003466chr282345 2257 2176 1716 694 546 477 207 2553 198 --12014
NM_003468chr242952 1395 1126 996 11492 31130 500 497 1175
NM_003470chr1641333 540 531 156 1423 41729 1163 543 501 1547
NM_003482chr1272601 1996 1779 923 774 539 196 12759 32489 199 51 1927
NM_003483chr1242776 880 700 499 --11051 12195
NM_003487chr17287 76 --1200 --
NM_003489chr2122191 1117 11052 1747 --
NM_003505chr761666 1280 697 386 132 103 1778 31568 593 571 --
NM_003559chr1782743 2503 2413 1482 990 841 485 246 32757 644 600 43435 2988 2735 1008 23835 3546
NM_003574chr1835017 4143 474 ------
NM_003590chr272722 2708 952 633 228 96 42 11151 ----
NM_003632chr172760 212 --189 1679
NM_003680chr12252 54 129 --1680
NM_003684chr16785 452 442 415 266 230 --2431 407 --
NM_003704chr42439 256 1448 1204 --
NM_003714chr542769 2457 2275 2195 133 --11098
NM_003716chr321031 717 1831 1720 --
NM_003728chr42545 250 ------
NM_003743chr262214 2005 1761 1610 922 517 --1580 --
NM_003768chr151826 1790 1634 300 195 2318 64 11574 1734
NM_003779chr13445 72 56 --1338 1311
NM_003787chr18----2622 619 --
NM_003795chr61486 1490 ----
NM_003822chr143145 2537 1974 1169 1425 1494 --
NM_003850chr131503 --1244 --
NM_003861chr1472898 2853 2141 2115 2106 1050 240 32572 592 379 22874 2029 --
NM_003870chr1562048 1773 1626 76 69 57 2541 240 42007 1994 1985 150 --
NM_003893chr10----2462 415 --
NM_003913chr694050 4031 3926 3742 3207 2903 2691 494 465 197 44175 4172 4034 2694 11639
NM_003924chr431406 661 201 ----11380
NM_003939chr10163462 3426 3318 3197 2676 1521 1496 1384 1195 1053 1008 901 887 735 650 634 13430 83645 3144 1502 1393 738 654 286 281 --
NM_003945chr52517 343 ------
NM_003974chr8----283 55 --
NM_003975chr1----1326 --
NM_003980chr61589 --1252 --
NM_003988chr1072301 1968 1779 1714 1671 955 817 --31705 1619 828 1917
NM_003993chr1----1103 --
NM_004019chrX2331 96 --152 172
NM_004082chr2----2230 111 --
NM_004093chr1332378 1310 951 12177 31314 269 130 1599
NM_004096chr105824 777 694 651 137 11444 51675 1341 792 455 188 --
NM_004098chr101806 --1975 1227
NM_004100chr632568 379 361 --22571 2539 --
NM_004113chr351965 150 71 52 22 11766 11589 --
NM_004162chr31467 21041 327 ----
NM_004187chrX71287 1094 979 433 361 212 59 11341 3451 420 355 --
NM_004193chr103401 194 88 --1198 1393
NM_004200chr1173230 2799 1198 1055 923 835 244 21097 1028 52292 2074 1237 790 782 32067 1185 967
NM_004202chrY----1174 --
NM_004210chr1081867 1606 1351 572 392 112 87 37 --2265 91 1117
NM_004211chr11143 --155 --
NM_004225chr821328 299 1243 11290 --
NM_004263chr231607 519 501 11413 21519 1484 --
NM_004274chr1473048 1026 544 389 259 158 80 1178 2330 143 --
NM_004277chr6----1179 --
NM_004293chr953463 3017 2437 1124 27 12450 13001 --
NM_004296chr1473223 3030 1409 1026 896 829 238 --43952 3429 2745 1090 --
NM_004326chr161150 1141 1035 924 800 783 --1356 --
NM_004349chr8158 --1288 --
NM_004379chr22358 263 --1198 1655
NM_004392chr1331643 556 347 31833 426 171 ----
NM_004393chr332338 1542 165 --21829 1545 --
NM_004395chr52302 229 --2694 272 --
NM_004397chr1143754 1353 940 410 23900 369 3599 400 73 --
NM_004416chr1251084 761 747 739 661 --41087 689 686 59 --
NM_004418chr23559 188 116 ------
NM_004423chr382521 2453 2442 2241 2140 784 219 55 1709 11011 --
NM_004427chr131037 495 408 2426 257 4459 444 288 41 1154
NM_004430chr862768 2607 2186 1066 1044 795 1697 72194 1756 1069 977 961 952 621 --
NM_004433chr151484 626 313 272 255 --2549 198 --
NM_004437chr163471 3269 2397 2297 1112 1047 32665 2420 374 22409 37 --
NM_004442chr12672 635 132 51600 1557 1158 1151 28 1470
NM_004443chr31189 ----1147
NM_004451chr111560 --1161 --
NM_004454chr352011 1725 1547 508 274 --1664 11729
NM_004458chrX32282 1689 379 ----1471
NM_004474chr12405 38 ----1958
NM_004475chr17101015 1007 959 838 478 460 398 353 154 24 --41128 187 184 181 --
NM_004484chrX2265 50 ----1119
NM_004501chr173894 3587 3510 1549 1249 976 488 136 23302 847 --
NM_004516chr191994 2848 52 ----
NM_004529chr91232 ----11416
NM_004530chr1631054 324 30 --3327 203 168 --
NM_004535chr20----11723 --
NM_004561chr1121848 532 --11627 --
NM_004583chr171259 1134 3490 250 35 --
NM_004586chrX95373 5136 4683 4616 4454 4017 1948 832 153 --14515 22178 1952
NM_004588chr11113811 3672 3607 3466 3399 3093 2841 2800 2641 1629 651 --53244 3099 1084 459 41 32948 837 183
NM_004598chr582921 2678 2398 2120 1049 867 421 97 12581 22924 264 1101
NM_004637chr341155 1114 453 242 133 21285 80 184
NM_004645chr171277 ----1834
NM_004647chr19269 61 --1247 --
NM_004654chrY1473 --1995 --
NM_004660chrY21493 119 --1233 --
NM_004687chr1742001 1344 275 130 1183 1515 1393
NM_004714chr19184 --1333 --
NM_004723chr11238 1924 1857 --
NM_004734chr13----274 31 --
NM_004736chr121417 56 21858 460 1129 --
NM_004739chr111539 --1669 --
NM_004740chr172328 250 196 ----
NM_004755chr1421021 869 ------
NM_004758chr1751063 842 417 385 182 1758 --1165
NM_004772chr521272 585 1281 21411 1402 --
NM_004774chr1742848 2487 1120 1027 12324 32859 2851 340 --
NM_004798chr20113533 3506 3131 2578 2408 928 863 801 690 344 290 --2338 308 1628
NM_004800chr13146 ------
NM_004808chr1053265 2542 2322 2180 1070 1589 --11212
NM_004822chr1733702 1447 528 --43736 3715 1389 282 32881 1254 587
NM_004824chr631015 393 384 1488 11146 --
NM_004834chr242807 2732 2686 159 1310 1150 22988 2893
NM_004839chr153451 179 150 --1171 --
NM_004845chrX73937 3204 2920 2886 1387 506 322 --53913 3910 1085 845 550 --
NM_004852chr183213516 13479 13379 13348 13273 12484 12400 11651 10852 10838 10775 10277 9701 9546 9422 9221 9192 8722 8712 5212 4577 4208 3823 3754 3475 3398 3205 3159 2436 2360 1217 1105 613558 12404 11564 11185 11087 3091 614154 9684 9681 9160 3501 2083 112455
NM_004856chr15--179 --1394
NM_004857chr1454255 3452 3391 1719 1224 33666 1399 955 1909 23596 3456
NM_004860chr17----2372 231 130
NM_004869chr18--21251 161 ----
NM_004898chr442744 2136 1957 1949 22415 1141 22275 627 --
NM_004901chr8161 1111 164 --
NM_004921chr11733 11886 ----
NM_004923chr11------1722
NM_004924chr191112 176 3901 345 159 --
NM_004930chr11273 --2590 177 --
NM_004947chr331819 847 278 --1426 22002 553
NM_004952chr11915 --1104 --
NM_004973chr611069 --11334 --
NM_004992chrX207911 7161 7088 7048 6985 6804 6006 5775 5699 5318 3079 3048 2368 1800 1378 1305 1282 1218 953 60 77753 6313 2623 2609 1276 935 762 117980 7659 6783 6172 2619 2567 1508 1288 1285 1221 63 35382 1310 267
NM_005020chr7171 1557 4177 83 80 74 --
NM_005022chr17154 ------
NM_005027chr1961111 1054 271 194 159 111 1175 21117 911 --
NM_005029chr10------1271
NM_005032chrX1720 --2259 184 --
NM_005053chr193366 211 157 1408 1214 --
NM_005056chr12115580 5570 4942 4153 4141 2028 1786 1582 705 481 389 11639 32032 1789 192 21616 665
NM_005065chr1445115 2031 1645 733 14833 21857 636 1642
NM_005096chrX71113 1012 439 416 170 143 117 --31018 448 285 --
NM_005100chr62370 209 ------
NM_005110chr54734 641 529 280 ----3671 628 250
NM_005116chr2064230 1470 684 267 209 189 13444 43859 1487 1002 445 13846
NM_005121chr1763476 3258 2993 2387 437 82 ----11509
NM_005124chr61132 ------
NM_005146chr113720 69 58 1206 2223 216 --
NM_005184chr1961409 1121 349 174 69 48 1246 51157 1146 1097 213 177 3332 312 233
NM_005186chr115606 574 507 131 42 --2567 146 --
NM_005187chr1681306 1290 523 412 380 372 343 258 21626 1440 31654 1496 1322 11310
NM_005203chr10----1163 --
NM_005220chr1741451 1289 959 448 2316 135 11253 --
NM_005229chrX2929 200 --1879 1171
NM_005252chr142311 84 --1198 --
NM_005256chr11------154
NM_005276chr1251183 705 624 263 111 1255 21522 587 --
NM_005313chr1521124 1007 ----139
NM_005329chr1652262 2242 2068 883 384 11721 1276 --
NM_005334chrX71655 1131 586 570 488 454 246 11548 1128 133
NM_005336chr232152 1878 842 12170 31797 404 113 2477 172
NM_005342chrX82722 2516 1928 861 705 446 266 23 12046 12851 --
NM_005349chr4----1486 1568
NM_005398chr1031457 951 265 11008 --11436
NM_005399chr1124242 3582 3268 2924 2766 1325 1316 1209 1084 704 577 560 --12794 21448 594
NM_005400chr22656 291 12805 4480 164 99 96 --
NM_005407chr1461383 1283 1249 291 207 201 --41506 409 307 300 --
NM_005412chr12----2490 46 --
NM_005413chr2----12362 98 95 89 86 80 77 74 50 39 30 21 1102
NM_005418chr112578 570 1118 2695 95 --
NM_005430chr12131039 947 923 899 847 810 668 415 406 381 167 150 37 ------
NM_005435chr72162 110 --1571 --
NM_005437chr1041042 915 419 306 --2224 118 --
NM_005458chr922232 247 11706 11669 1465
NM_005465chr132041 1634 821 ----11638
NM_005488chr225715 669 657 228 121 --2125 76 --
NM_005515chr71215 --2622 58 --
NM_005529chr1------1807
NM_005581chr191132 --2104 97 --
NM_005584chr132573 39 --1110 --
NM_005596chr932464 2281 1105 45567 1801 927 93 ----
NM_005599chr121312 336 --11045 --
NM_005611chr1621283 26 1830 2920 157 --
NM_005618chr61143 --1146 --
NM_005652chr1631109 921 191 1915 21168 434 --
NM_005667chr21344 ------
NM_005678chr151315 ----1764
NM_005688chr32484 79 ------
NM_005796chr16134 --348 45 38 170
NM_005801chr172319 63 ----1151
NM_005802chr9----1108 --
NM_005807chr12221 209 --1225 --
NM_005811chr12----196 --
NM_005819chr183435 2532 2481 1350 1035 811 130 28 12936 13064 1161
NM_005828chr17164589 4224 3778 3737 2025 1966 1678 1601 1100 578 559 445 338 260 238 204 --74152 3754 3668 1928 737 582 249 --
NM_005832chr321033 256 --1976 --
NM_005851chr11----4318 315 293 62 --
NM_005859chr51185 11445 ----
NM_005866chr91675 1651 1351 --
NM_005904chr1831041 144 73 --1594 --
NM_005907chr62504 350 ----1355
NM_005909chr533905 2912 2703 23222 2832 24089 3329 24259 693
NM_005911chr22493 100 11034 2945 81 --
NM_005920chr1113491 3484 3318 3224 3053 2904 2721 1501 1233 1197 1138 13604 113706 3594 3591 2435 2419 2373 1474 1176 1163 83 21 --
NM_005922chr6----1142 --
NM_005933chr1192834 2761 2707 2421 2245 728 713 515 224 1343 12764 --
NM_005934chr1961969 1833 1704 739 479 147 12157 72130 1972 942 939 926 504 73 --
NM_005941chr843590 859 354 256 22947 1452 23593 3323 1841
NM_005964chr1751297 1043 998 432 99 1497 11046 11033
NM_005967chr122556 101 --1115 1638
NM_005975chr202716 673 --2364 168 --
NM_005984chr22----1440 --
NM_006015chr121245 912 --4915 165 162 127 --
NM_006054chr1151380 523 486 339 140 31368 1143 1115 ----
NM_006055chr242957 966 408 223 1426 ----
NM_006067chr161684 1250 ----
NM_006091chr1561748 1672 1647 1396 1386 551 --51719 1716 563 493 65 --
NM_006106chr1132504 1244 559 33274 2896 141 1153 --
NM_006128chr81235 --1238 --
NM_006135chr131251 490 392 11412 21042 493 --
NM_006136chr731174 1009 467 ------
NM_006160chr1741576 1384 327 209 --61237 1234 340 331 236 233 1257
NM_006190chr221094 903 ----160
NM_006191chr121716 1642 --186
NM_006198chr211230 ------
NM_006201chrX2427 79 11100 1850 1223
NM_006202chr1941974 1389 618 95 21245 410 71885 1292 598 460 73 70 37 21833 780
NM_006224chr1762323 2140 1632 1617 939 907 22523 1802 61966 1913 870 867 864 225 --
NM_006245chr64861 342 276 174 1974 2381 177 1335
NM_006246chr143518 468 209 --1471 --
NM_006247chr19----1325 --
NM_006252chr197496 7460 6544 6428 6253 5344 1540 1478 346 12462 26176 2640 --
NM_006279chr1----1934 1302
NM_006282chr20104729 4714 4656 4286 3577 3140 1651 1518 1344 1131 14641 24717 317 --
NM_006283chr874605 4416 3568 1496 1285 758 46 24060 1895 54030 4015 3014 894 348 23861 363
NM_006292chr113183 49 33 --153 --
NM_006293chr153886 174 121 ----2756 663
NM_006301chr122507 447 ------
NM_006310chr171946 --1972 --
NM_006317chr51604 1597 4118 104 91 48 2786 361
NM_006321chr341858 1628 877 164 --11647 --
NM_006327chr102265 85 ------
NM_006354chr32262 64 --2329 268 --
NM_006375chrX41479 442 389 220 ------
NM_006391chr11152 ------
NM_006439chr4--1217 1510 --
NM_006464chr294479 2968 1781 1663 1627 1551 591 293 100 32992 1384 1119 1297 21744 170
NM_006465chr1582351 2268 1994 1698 868 831 813 482 1272 41940 1785 1425 421 --
NM_006469chr1--11408 1332 1294
NM_006472chr12828 281 --155 --
NM_006546chr17156515 6276 5948 5937 5538 5319 4864 4664 4379 4350 2644 2439 2151 1554 421 36226 6198 335 55958 5215 4220 2143 1420 --
NM_006557chr931768 1103 603 ------
NM_006558chr8----1495 --
NM_006559chr111134 --1137 --
NM_006562chr101292 --2114 95 --
NM_006574chr3----167 --
NM_006593chr24666 314 270 251 --4753 652 90 64 --
NM_006599chr16157546 7494 7389 7183 7143 5865 5650 5151 2574 2561 1757 1701 1678 1392 773 38055 6402 5143 37414 2577 1153 17577
NM_006614chr342287 2257 1306 362 --22677 1309 --
NM_006622chr5----134 --
NM_006624chr1011604 11389 1171 --
NM_006651chr451446 1371 959 557 56 --41476 1299 563 204 1963
NM_006662chr162324 133 --1125 --
NM_006668chr14129 --2375 83 --
NM_006690chr2042198 2012 594 52 2930 487 11971 --
NM_006698chr2071255 1125 557 447 425 414 374 --1389 --
NM_006703chr6286 59 --199 --
NM_006732chr1961836 1797 818 659 556 413 --21800 125 --
NM_006736chr22606 509 --71765 1762 1190 745 742 530 527 --
NM_006742chr1631984 1713 1279 31497 592 425 1439 --
NM_006750chr16127820 7331 7304 5468 3174 3163 2066 1803 1744 1722 988 815 26737 5570 41747 818 517 371 33101 1726 95
NM_006761chr17----6744 736 723 703 700 45 --
NM_006772chr661646 1448 1190 306 203 25 11701 81616 1286 1205 675 564 561 558 29 --
NM_006775chr62411 29 21170 177 11210 12001
NM_006777chrX22871 2836 12334 ----
NM_006811chr203988 923 179 1838 --148
NM_006814chr2042251 829 512 42 1686 52138 835 832 262 241 --
NM_006826chr22420 23 132 11249 --
NM_006827chr1442590 2260 2251 966 23201 827 2347 22 --
NM_006836chr12------1182
NM_006852chr1752634 2361 1996 932 691 22730 2227 22564 694 --
NM_006856chr1231077 1041 1034 --3886 874 369 --
NM_006861chr1251502 736 164 151 69 --2545 220 --
NM_006875chrX3755 261 214 --3884 877 799 --
NM_006885chr16124213 3519 3441 3113 2935 2758 1514 1364 1327 1101 1041 970 13513 11104 --
NM_006896chr71832 ------
NM_006898chr22578 223 1682 ----
NM_006902chr143098 2382 606 351 --2609 355 --
NM_006927chr1642150 787 757 195 12192 --1249
NM_006940chr1221249 552 --11597 1565
NM_006943chr20103297 2957 2949 2819 668 590 396 356 330 285 --21034 376 --
NM_006950chrX6881 774 687 314 133 43 1112 1169 --
NM_006965chr1811168 11103 11149 1269
NM_006977chr14181 ------
NM_006981chr942788 656 514 96 12641 133 12922
NM_006990chr162492 2155 2081 797 183 39 2248 164 51875 1783 1780 1622 614 --
NM_007005chr9----234 31 --
NM_007011chr15196471 5868 5847 5492 5069 5032 4992 4875 4627 4580 4531 2678 2653 2148 1571 1559 1439 1433 1397 56694 4744 2658 823 208 31986 163 38 11564
NM_007017chr5----1193 --
NM_007047chr682556 2455 2080 1771 852 797 725 27 12249 12043 --
NM_007067chr1771571 1557 1153 1055 427 317 308 --11119 21296 1123
NM_007122chr1--181 1245 --
NM_007129chr131856 --2376 366 --
NM_007144chr1741273 1128 1086 79 126 298 47 --
NM_007146chr1721097 376 22189 142 21100 379 --
NM_007150chrX51733 1683 1494 764 140 21640 566 21773 104 --
NM_007159chr3285 31 ------
NM_007174chr1241781 783 183 26 11555 11713 --
NM_007185chr12808 220 --2432 52 --
NM_007191chr12----1156 --
NM_007192chr1461113 1044 1001 910 274 33 2415 37 1280 --
NM_007231chrX31982 1725 722 ------
NM_007232chr201327 --2977 720 --
NM_007236chr1571715 1580 680 657 629 253 59 1445 4835 506 99 62 --
NM_007245chr161757 --1364 --
NM_007245chr161757 --1364 --
NM_007246chr4------188
NM_007249chr13178983 8016 7879 7707 7516 7409 7270 6959 6211 5821 2793 2605 2503 1354 1289 1269 267 48947 7732 7550 6022 26214 849 17462
NM_007275chr3--4818 445 396 330 ----
NM_007327chr91760 --2918 22 1891
NM_012069chrX32549 621 402 11928 22703 2564 --
NM_012072chr2074220 3767 3530 3424 3112 1329 339 34005 574 526 44484 4481 415 135 13779
NM_012081chr532275 289 191 ------
NM_012083chr1041090 1069 1026 947 11261 11094 --
NM_012175chr111799 1922 --1225
NM_012199chr1224610 4054 3956 3828 3636 3254 3101 2929 2878 1870 1541 1525 1437 1304 1152 1084 1075 1069 939 749 636 131 --54079 1482 673 670 601 --
NM_012244chr1441657 1198 574 316 11649 21291 31 11667
NM_012257chr72773 393 3872 231 172 ----
NM_012259chr62952 941 142 ----
NM_012262chr1114396 4291 3735 3368 2061 1939 1683 1533 1286 666 387 21550 776 23905 3711 --
NM_012288chr6175441 4539 4521 4152 4089 3573 3489 2228 2040 2018 767 537 432 225 173 159 29 33669 866 184 94931 4670 4667 4644 3932 3638 2027 85 82 23882 1829
NM_012290chr21154 ----11682
NM_012297chr422349 770 11856 2809 806 11680
NM_012300chr551811 478 245 189 150 --11659 --
NM_012301chr741871 1771 1554 316 ------
NM_012302chr121096 1012 ----11087
NM_012308chr1161923 796 714 581 70 39 21766 141 2350 192 2971 459
NM_012316chr1175406 4493 3685 1919 1710 1640 1315 1283 1099 981 973 943 745 410 401 378 243 14184 33688 1965 604 11106
NM_012325chr202159 127 ------
NM_012327chr182240 41 1625 1275 --
NM_012402chr115366 298 241 206 114 ----1420
NM_012410chr162203 46 --1101 --
NM_012412chr72826 222 --126 --
NM_012463chr1221608 599 --1149 11612
NM_012478chr175832 696 407 249 100 --1296 1327
NM_012479chr762706 1768 942 828 792 785 ----12209
NM_013245chr164646 573 462 225 --3252 229 216 --
NM_013261chr442922 2773 100 62 23243 917 13015 --
NM_013316chr75910 796 133 85 54 --2802 799 --
NM_013374chr312216 ----1804
NM_013392chr21111 ------
NM_013416chr22----1159 --
NM_013438chr911295 ------
NM_013444chrX7989 779 343 276 250 216 186 --11000 --
NM_013449chr12172716 2301 2262 2112 865 748 709 641 633 626 540 337 323 224 195 175 154 --6842 830 644 343 327 187 --
NM_013943chr143165 2142 716 36 1641 172 --
NM_013960chr82609 193 --1256 --
NM_014010chr94507 443 152 61 --1555 --
NM_014034chr631128 979 405 --2969 260 --
NM_014038chr7----1292 --
NM_014141chr745053 3928 3455 1533 14715 53909 3906 3903 3500 431 --
NM_014153chr161120 ------
NM_014155chr1175973 5629 2780 1490 1353 987 115 36651 1833 551 35660 1493 83 --
NM_014159chr31492 ------
NM_014191chr12--1835 ----
NM_014203chr191133 --1264 --
NM_014231chr1291955 1927 1794 1581 1480 738 475 132 52 2640 99 31712 1702 235 1119
NM_014232chr17111492 1377 651 412 405 380 359 352 346 292 276 163 51633 1254 1213 1034 1031 --
NM_014238chr1741707 1371 1293 36 ------
NM_014240chr3104196 4086 3579 3364 2919 2665 1598 635 299 223 11158 1414 --
NM_014243chr41169 --157 --
NM_014253chrX2553 540 ------
NM_014271chrX2700 179 --1589 --
NM_014280chr13889 262 74 1616 1266 --
NM_014283chr1----1323 --
NM_014289chrX11066 --1121 21245 1217
NM_014292chr2261758 1669 1568 548 411 274 11346 21761 500 --
NM_014332chrX----1154 --
NM_014335chr15----11000 11004
NM_014342chr1121480 1264 --21383 1321 --
NM_014397chr921424 62 21438 331 ----
NM_014405chr1762258 2130 1941 1590 703 525 --32268 2140 339 --
NM_014408chr11534 1136 1561 --
NM_014417chr19----1384 --
NM_014452chr62213 178 21002 299 1181 --
NM_014458chr141180 1103 252 32 --31273 1270 881 --
NM_014470chr123639 593 39 ------
NM_014494chr1662050 1909 1893 1667 314 306 --22073 1847 1799
NM_014516chr19----1197 --
NM_014554chr1222017 1606 1554 ----
NM_014562chr21562 ----1102
NM_014573chr1721243 283 1171 21566 1563 --
NM_014587chr1621525 540 --1267 11190
NM_014591chr1061322 1090 1071 845 428 75 --179 --
NM_014620chr12----2194 125 --
NM_014630chr15103820 2473 2428 1041 927 899 542 384 343 268 32506 1221 51 3850 532 420 13856
NM_014665chr883689 3516 3315 3290 2863 2350 2285 363 12757 1704 11163
NM_014674chr383843 3256 3164 2654 1602 639 460 329 12927 43667 3505 3183 3168 --
NM_014686chr192819 658 12105 21851 417 1425
NM_014702chr673291 3274 2461 2285 1401 1099 161 23193 2726 192 13024
NM_014707chr721708 477 11780 12288 --
NM_014726chr1741008 153 38 31 1495 1186 11225
NM_014730chr12185192 5057 4912 4867 4854 4826 4222 4061 3948 3647 1711 1487 1062 759 274 243 236 210 13838 84767 4762 3951 3429 3420 1309 894 813 --
NM_014731chr2041224 701 342 143 --31443 1352 83 --
NM_014761chr1641055 1030 283 70 --1150 1160
NM_014764chr124514 401 354 55 1507 ----
NM_014774chr132317 2200 2143 32289 94 86 ----
NM_014784chr151159 1114 754 385 23 1400 3811 95 39 143
NM_014802chr1211021 1382 ----
NM_014820chr341901 1369 587 50 --11904 --
NM_014822chr4----151 --
NM_014824chr1131884 630 212 --2501 154 21531 598
NM_014827chr12317 253 11079 --11476
NM_014830chr1273404 2873 2832 2674 2653 1573 734 --33752 3417 2878 --
NM_014838chr2212796 --2701 167 1171
NM_014840chr1272738 2514 2440 2295 817 418 180 22364 1092 1833 --
NM_014841chr621176 127 2975 968 1401 1132
NM_014847chr12206 46 --1376 --
NM_014849chr12893 276 --51106 913 886 279 56 1195
NM_014868chr121616 --1230 127
NM_014877chr17117411 7367 7193 6776 6009 5585 4963 2503 2445 1439 906 --25620 2554 1910
NM_014897chr1743153 2568 2312 2080 2924 26 32083 338 100 --
NM_014903chr123431 376 325 22396 522 ----
NM_014909chr1483730 3593 3229 3161 3088 2967 525 373 23168 465 23164 2772 --
NM_014912chr10--22791 614 ----
NM_014925chr126776 655 365 246 234 198 --1174 --
NM_014931chr19240 33 --2668 127 --
NM_014932chr321332 678 1712 ----
NM_014950chr1431776 602 110 ----11781
NM_014962chr201871 --1406 --
NM_014977chr141443 --1408 --
NM_015001chr12270 34 1168 2925 906 --
NM_015012chr11----186 --
NM_015020chr1683507 3351 3294 2605 1472 1385 789 211 --43702 1388 1132 355 --
NM_015023chr171778 1673 1552 1466 1434 1124 90 --81555 1522 1453 1424 1272 1217 1214 613 --
NM_015025chr232031 1757 888 ------
NM_015035chr20116033 5844 4848 4604 4228 4081 2521 1961 1625 552 224 34675 1936 976 35112 4054 1628 --
NM_015039chr1113701 3571 3514 3344 3137 2970 1523 1498 359 320 88 2198 81 1398 --
NM_015042chr15174296 4262 3853 3680 3660 3608 3441 3431 2876 2805 1489 1432 1344 1117 1080 911 840 14254 33636 608 196 --
NM_015044chr1692990 2754 2625 2571 2492 2283 2066 801 773 1658 1804 1509
NM_015052chr741233 491 195 92 --21213 201 11217
NM_015064chr12113256 1444 1050 1038 989 910 894 821 714 362 141 22719 1087 12701 --
NM_015075chrX82245 2073 1959 1899 1623 1571 97 90 21599 197 32048 357 181 --
NM_015080chr114391 373 175 117 ------
NM_015100chr141714 1565 737 627 --31718 614 608 --
NM_015107chrX32442 2372 1519 21592 1496 2577 163 2210 49
NM_015138chr1562672 494 477 471 167 60 --42600 1010 938 811 1391
NM_015144chr1663787 3226 2514 1077 821 656 2854 381 23255 553 1665
NM_015147chr242641 1156 197 148 --2736 151 1229
NM_015156chr1473516 3429 3154 2994 2625 632 354 21115 177 43632 858 635 322 --
NM_015176chr1----1165 --
NM_015178chr851082 818 726 328 135 22128 943 2712 66 --
NM_015187chr4------1711
NM_015191chr1122572 168 --22731 827 --
NM_015210chr18------167
NM_015236chr41981 1114 ----
NM_015252chr23606 160 153 --1597 --
NM_015270chr1232246 1870 1684 1256 1931 --
NM_015272chr1651929 1681 514 245 33 1226 1191 --
NM_015284chr172100 2088 1623 1534 1344 597 274 11762 42103 1675 1570 338 11897
NM_015288chr593869 3662 3391 2805 2578 967 854 205 175 --42833 2752 995 992 11319
NM_015305chr1471822 1331 607 464 270 125 28 1157 1208 133
NM_015313chr11114075 3432 3327 3240 3188 3122 1262 708 684 602 232 1792 13634 11442
NM_015320chr261014 386 374 355 90 62 ----11018
NM_015326chr182689 2482 2372 2297 2071 1158 1015 64 12810 12708 1786
NM_015328chr752547 1189 616 598 317 42325 673 623 56 12697 21223 94
NM_015335chr1261913 400 195 185 135 37 12450 21002 40 --
NM_015338chr2041845 1449 767 752 2391 344 11265 --
NM_015344chr831924 679 131 ------
NM_015346chr1471608 1566 1223 603 525 338 99 21736 82 2606 465 1342
NM_015347chr1222140 2134 --21876 551 --
NM_015359chr882746 2707 2240 2209 927 526 231 223 --52584 824 821 741 310 12750
NM_015361chr21750 ------
NM_015393chr452886 1226 1127 674 139 --22379 149 --
NM_015397chr981864 1561 1512 1495 1278 737 362 292 11404 ----
NM_015435chr8--11330 --11027
NM_015443chr1731029 274 215 ------
NM_015444chr31106 1659 1110 --
NM_015455chr574101 3392 1530 1166 1002 405 325 1388 --13337
NM_015457chr113801 352 70 ------
NM_015475chr24983 744 406 216 ----1749
NM_015481chr1231084 1073 1010 --2109 82 --
NM_015488chr251634 1489 1374 684 73 --51516 524 349 299 296 21574 1183
NM_015497chr151243 ------
NM_015503chr162585 573 ------
NM_015509chr1261538 1412 1366 1138 440 92 11542 --3561 444 136
NM_015530chr22919 728 --1343 --
NM_015542chr101250 163 ----
NM_015576chr3--2293 213 --1622
NM_015584chr172199 78 1960 ----
NM_015595chr32860 392 --1283 --
NM_015627chr171646 1531 1379 682 521 507 379 1695 --1653
NM_015634chr10----1402 --
NM_015635chr9----2881 878 --
NM_015638chr202558 86 1240 1511 --
NM_015649chr19--1124 1290 1384
NM_015652chr101180 --1629 --
NM_015680chr23580 548 116 1540 2607 592 --
NM_015686chrX42382 2083 1919 1761 12222 22088 79 --
NM_015690chr22240 166 1263 1172 --
NM_015695chr671841 1801 663 489 177 132 65 11676 21823 323 --
NM_015702chr22310 269 --1272 --
NM_015719chr193738 244 146 --2202 149 --
NM_015726chr181849 1687 1172 1139 745 643 566 453 1635 11869 --
NM_015853chr11--171 1192 --
NM_015872chr151418 1335 1257 1107 131 --41708 1452 1410 449 --
NM_015894chr2061507 1064 574 373 129 95 11307 2133 99 11165
NM_015898chr1982167 2147 1001 942 881 440 214 198 1765 31662 1655 546 --
NM_015906chr164323 3720 1471 1156 746 122 23261 886 34508 4200 3662 --
NM_015912chr821738 531 --31940 946 943 12098
NM_015980chr521465 1327 --11473 --
NM_015982chr17----1300 --
NM_016022chr16855 774 744 732 712 702 --2876 102 --
NM_016037chr13885 455 320 ------
NM_016057chr1241122 373 31 24 21195 524 ----
NM_016061chr231449 1105 553 11547 --140
NM_016131chr23946 758 48 --2794 743 --
NM_016147chr115872 856 358 231 23 1948 2321 85 --
NM_016162chr122670 316 2846 34 2132 129 1217
NM_016169chr10133248 3097 3012 2645 2557 2328 1289 1177 1125 1002 729 498 473 11159 33262 2791 454 12812
NM_016224chr6102108 2077 1988 1787 1511 756 487 477 288 40 1374 12111 12081
NM_016248chr131390 23226 1405 54000 1300 1284 1273 1245 13467
NM_016258chr11795 ------
NM_016269chr43732 321 66 --1765 --
NM_016277chr631571 1525 204 --1235 --
NM_016281chr125908 893 881 231 185 --1885 --
NM_016284chr162795 730 --189 --
NM_016287chr152062 1611 821 600 106 1324 11801 --
NM_016485chr622166 1827 --1783 --
NM_016531chr473628 3232 754 587 338 189 181 1328 21117 519 --
NM_016577chr3114214 4031 3989 3325 3303 3007 1595 1013 972 437 36 24303 3583 54368 1353 701 399 396 24074 1282
NM_016588chr6----1734 --
NM_016605chr581919 1883 1874 1862 1682 488 395 141 --42538 1877 1745 912 --
NM_016623chr82126 118 --1130 --
NM_016628chr102637 589 1216 1627 --
NM_017409chr122588 86 1313 4142 54 35 21 --
NM_017410chr1241067 954 489 468 --41107 793 786 289 1873
NM_017450chr1731157 985 72 --11068 --
NM_017488chr241567 1557 1446 1170 --5602 392 379 370 296 --
NM_017508chr1121695 857 --12302 --
NM_017519chr631285 1276 449 --1116 --
NM_017553chr1521285 344 126 ----
NM_017575chr1771590 1525 595 341 302 166 124 1367 2644 641 1128
NM_017582chr14640 325 282 22 ------
NM_017596chr1124239 4155 4083 3753 3557 3479 1791 1563 1491 1283 121 38 54548 3455 2854 510 445 74220 1397 1365 985 708 114 27 14424
NM_017602chrX182 --2130 96 --
NM_017634chr821847 1401 166 11851 --
NM_017637chr9139026 8251 8186 7507 7401 7098 6604 6298 2597 1507 1345 1144 369 58738 7992 7214 6850 1655 38210 6285 5747 25751 2272
NM_017640chr66593 231 114 95 81 24 2268 235 1576 --
NM_017643chr1722752 492 ------
NM_017644chr374841 3507 1862 1045 772 135 86 1781 11101 --
NM_017668chr162255 93 --281 48 1106
NM_017672chr151443 ----1867
NM_017709chr1134207 3528 3462 3389 2969 2878 2819 1627 1094 965 906 868 453 --21313 72 11098
NM_017714chr201281 --2934 259 --
NM_017715chr74706 690 527 42 --1185 --
NM_017721chr191340 ------
NM_017724chr3133 ------
NM_017739chr11524 --1514 --
NM_017741chr441984 694 523 89 --11987 --
NM_017742chr1831371 440 403 --11866 --
NM_017753chr921017 950 2711 43 --1385
NM_017758chr1761397 1000 543 497 212 57 1491 11087 1964
NM_017772chr641793 1592 1474 1339 --41797 1604 441 434 11639
NM_017778chr841191 994 550 536 ------
NM_017789chr22697 215 --1221 1778
NM_017799chr14--171 --11830
NM_017811chr942705 2639 1166 162 --12715 1632
NM_017824chr1022058 765 2581 278 1879 --
NM_017848chrX51817 1767 1477 1244 493 33759 2998 107 34400 504 281 --
NM_017893chr104355 318 222 173 11030 31448 538 115 130
NM_017902chr10195643 4687 4548 4515 4413 4401 4059 4000 3781 2227 2002 1979 1827 1573 1544 823 808 377 226 34384 4208 1004 23979 1315 15391
NM_017907chr11126 --232 29 --
NM_017915chr12----3393 303 300 --
NM_017919chr9115020 4929 4843 4309 4183 4123 3903 1820 1142 582 262 35518 4045 348 24846 614 22079 587
NM_017966chr113960 218 203 --11442 --
NM_017988chr122732 205 --1219 --
NM_018008chr33354 158 24 --1260 --
NM_018013chr683018 2610 2266 2033 1877 1087 784 337 11202 63025 3022 2703 2110 1880 253 --
NM_018027chr1062290 2244 867 835 228 35 --11281 12008
NM_018028chr1941203 1023 278 272 --41216 912 511 73 1318
NM_018030chr18----1432 --
NM_018062chr21158 --1406 --
NM_018071chr144784 568 338 106 --7765 762 341 262 195 39 36 1720
NM_018105chr8150 ----154
NM_018110chr165938 530 522 296 130 1385 1942 --
NM_018116chr1----1466 --
NM_018121chr1042715 2004 1221 518 22191 568 22212 302 --
NM_018133chr31450 --11462 1682
NM_018150chr11650 --1612 --
NM_018164chr122277 202 ------
NM_018178chr141605 256 190 21 1330 22035 1650 1154
NM_018200chr1591938 1911 1830 1819 1771 1589 1034 795 719 --32275 2268 563 --
NM_018205chr1052254 1957 1735 1712 310 --22257 2031 --
NM_018240chr15700 235 214 113 97 --2840 703 1707
NM_018287chr101361 1914 ----
NM_018312chr1111611 1454 21702 1669 21910 1868
NM_018371chr821027 387 --11119 --
NM_018403chr342635 2552 1572 530 --13234 --
NM_018412chr7----151 --
NM_018426chr62410 101 ------
NM_018448chr12--31220 152 124 11250 --
NM_018489chr131799 534 501 ----1220
NM_018509chr1761515 1318 1226 692 670 387 21519 604 21451 142 --
NM_018584chr1--11226 1203 --
NM_018638chr1234377 1477 1002 123 ----
NM_018649chr101222 ----1159
NM_018653chr17----3357 87 84 --
NM_018667chr1642758 977 959 934 --52148 788 718 601 330 --
NM_018717chr41912 12097 1945 --
NM_018841chr1123985 3123 3085 3070 2453 1306 1258 1042 979 741 59 22 13423 2677 31 --
NM_018896chr17--133 3120 61 58 --
NM_018898chr542375 2058 261 81 --1264 --
NM_018977chrX----1433 --
NM_018979chr1222329 1708 --1462 --
NM_018999chr1074739 3545 3211 1848 771 705 242 13177 --23549 881
NM_019063chr242334 2067 1753 1484 2767 32 ----
NM_019087chr54644 282 243 112 11465 1258 --
NM_019106chr22112801 2247 2235 2173 1267 1246 1234 748 386 287 78 22375 428 63200 2991 2499 2400 2395 761 22685 263
NM_019106chr22112801 2247 2235 2173 1267 1246 1234 748 386 287 78 22375 428 63200 2991 2499 2400 2395 761 22685 263
NM_019106chr22112801 2247 2235 2173 1267 1246 1234 748 386 287 78 22375 428 63200 2991 2499 2400 2395 761 22685 263
NM_019114chr962427 2262 1658 968 953 593 --22228 989 --
NM_019116chr16113434 3335 3159 3057 2775 2547 2448 2303 1364 1072 563 --33327 1367 1269 21061 938
NM_019592chr94819 328 241 72 2890 125 1149 --
NM_019594chr931109 632 188 21262 361 2275 77 1377
NM_019606chr74477 359 222 143 --1164 --
NM_019854chr121712 --2303 190 --
NM_019885chr252956 2347 651 604 409 --52490 1042 822 424 421 --
NM_020062chr20----2878 38 --
NM_020066chr12859 343 2901 388 ----
NM_020116chr441772 1702 1229 1193 ------
NM_020122chr2115524 5488 5299 5063 4971 4508 4385 3909 1507 1420 30 --45152 1590 1587 1412 --
NM_020130chr831244 1191 109 --1260 --
NM_020134chr241139 936 310 205 --21166 428 --
NM_020137chrX----128 --
NM_020148chr1842329 518 304 78 --1344 --
NM_020150chr1062161 1858 680 170 63 36 11612 --1174
NM_020159chr441708 1520 691 587 1167 ----
NM_020180chr18----21186 973 --
NM_020184chr272030 1981 1542 1455 903 540 463 12119 92034 1957 1954 1951 479 476 473 470 467 --
NM_020205chr192318 2202 1352 1099 732 666 648 521 212 33485 2590 809 13427 --
NM_020229chr112355 154 --1359 --
NM_020310chr1732476 780 411 --32499 432 335 --
NM_020336chr2063552 2830 2686 2587 1015 621 22792 600 33555 3195 2590 22933 2702
NM_020337chr462851 2454 2263 970 671 173 32839 2439 764 1936 --
NM_020342chr211692 ----12633
NM_020363chrY21396 95 ----1479
NM_020374chr124788 618 528 235 1820 11567 --
NM_020382chr1261460 1259 1063 608 543 354 1360 --1613
NM_020384chrX61698 1670 1649 1523 479 228 ----11686
NM_020404chr11------1239
NM_020439chr14873 861 832 740 --2639 57 166
NM_020440chr1103139 2514 2409 1090 992 630 302 282 191 107 21190 1072 --13143
NM_020443chr1176614 6540 6330 6300 5840 5464 5445 5341 4721 4229 2406 1979 1480 1257 918 856 433 26921 2774 106977 6362 5651 5648 5519 2705 486 79 67 64 35330 2044 245
NM_020457chr164444 423 234 162 --1426 177
NM_020465chr1631635 738 187 11375 11707 --
NM_020466chr655039 4290 4133 3191 749 11455 14153 --
NM_020474chr183256 150 104 --1108 --
NM_020530chr222394 354 ----1169
NM_020630chr10128 1511 1721 --
NM_020689chr2051748 1162 549 524 184 2564 532 3341 218 33 --
NM_020693chr11----1375 1192
NM_020699chr1155013 4908 4499 4126 4035 3771 3392 3363 1889 1537 945 446 381 231 51 14630 --34966 3374 1127
NM_020703chr11106 ------
NM_020717chrX84567 4145 3763 1877 1731 1621 1601 1544 33930 3467 3289 34148 674 245 11279
NM_020742chrX41800 1674 810 447 ------
NM_020750chr6246 22 --21285 297 --
NM_020753chr171301 --1783 --
NM_020760chr21173 ------
NM_020772chr1788534 8201 5395 5336 2855 2575 2521 2343 35584 3019 2646 48205 7455 6724 491 --
NM_020774chr1895882 5115 4321 1864 1452 1430 1296 1284 999 54755 4595 2296 2052 364 11890 --
NM_020778chr15124617 4412 3042 1783 1694 1542 1201 853 469 324 280 203 14392 51793 843 641 510 507 --
NM_020795chr1771743 1356 1252 227 186 142 89 11676 91945 1810 1747 1338 1318 812 432 422 25 --
NM_020796chr572914 2760 2473 1998 1024 769 136 --52001 658 655 224 139 1744
NM_020801chr52584 305 --22634 52 --
NM_020805chr181268 21731 1359 --1224
NM_020810chr1433099 737 355 ----12747
NM_020839chr341542 1535 1128 298 145 ----
NM_020856chr1951553 1317 1305 476 265 ----11403
NM_020861chr641199 366 116 50 41161 1106 492 84 3125 122 119 --
NM_020899chr1781699 1607 942 915 618 585 533 215 3788 610 219 22034 1703 21693 266
NM_020918chr1043091 2920 2602 167 1891 1145 --
NM_020919chr22909 66 --11097 --
NM_020924chr9--1484 --192
NM_020956chr1943001 697 682 83 --4843 578 528 101 12993
NM_020971chr192671 76 --4679 608 605 151 --
NM_021090chr22134750 4217 3238 1940 1494 1243 1071 993 748 656 436 346 204 14864 51498 1074 916 210 207 --
NM_021097chr253042 2571 2054 1157 846 1796 22941 1040 --
NM_021155chr19202511 2445 2378 2328 2265 2253 2234 2102 1975 1919 1165 1109 1050 765 675 505 124 91 47 35 --92514 2448 2402 2319 2241 2238 1168 947 252 12106
NM_021174chr82308 275 --1664 --
NM_021188chr141488 --1134 --
NM_021189chr131033 832 235 --2978 950 --
NM_021191chr1232542 724 171 2410 142 12083 --
NM_021202chr2062041 1991 585 267 127 66 63075 2609 1903 352 316 163 158 --
NM_021238chr1241829 1712 1439 183 ------
NM_021260chr1471427 1118 564 534 442 393 108 126 51349 488 358 113 80 --
NM_021614chr51224 ------
NM_021642chr1------11051
NM_021648chr672300 1789 1726 982 336 185 99 22177 85 52724 1104 1101 339 49 --
NM_021724chr17266 59 --1200 --
NM_021808chr122617 484 --1194 1266
NM_021809chr2012054 1206 2185 118 22180 276
NM_021813chr6105406 5376 4331 4111 4050 1705 1544 1536 561 156 --35412 1085 161 23802 1548
NM_021814chr6------11321
NM_021943chr622201 439 --21896 1625 --
NM_021946chrX61081 1044 548 312 60 31 --41063 1053 34 22 --
NM_021950chr1142216 2048 1964 1936 1327 32111 1939 146 --
NM_021956chr61233 ------
NM_021964chr345364 4250 4057 705 11776 --16625
NM_022048chr15156404 6002 5040 4777 4133 4060 2351 1783 1731 1689 1572 1008 582 526 326 35966 692 235 106365 6124 4064 1586 1442 530 492 329 272 90 14199
NM_022062chr1131588 470 165 --41928 1887 1558 1328 11447
NM_022066chr173745 304 123 --2126 83 --
NM_022114chr1153868 3854 3497 3229 3153 3130 3080 1896 1866 1460 1324 1025 969 116 106 11096 53877 3730 3233 1200 980 --
NM_022117chrX1423 1441 3456 453 65 --
NM_022119chr16--2363 338 ----
NM_022169chr1161475 1189 1075 242 215 114 --101454 1082 986 534 531 528 522 318 297 119 1132
NM_022170chr781498 428 298 270 262 248 227 113 11263 11478 --
NM_022459chr1346317 4254 612 86 11266 34167 2475 530 --
NM_022465chr12192942 2821 2499 2170 2071 1950 1883 1874 1224 986 979 849 780 654 621 540 340 228 144 2377 162 62897 2894 2824 528 404 158 21044 990
NM_022469chr152885 2612 2255 693 130 --12316 12717
NM_022574chr752211 2031 2014 1840 1444 --42186 1843 1831 1369 --
NM_022648chr294557 4453 3391 1828 1270 1209 983 823 347 13784 44351 3698 3394 2865 13349
NM_022658chr124376 338 299 255 ------
NM_022719chr2253475 2774 1478 483 82 --33879 3744 654 --
NM_022726chr631197 1081 268 1231 ----
NM_022744chr1641096 1067 249 203 1400 1429 --
NM_022753chr162283 894 880 768 600 496 21062 392 22765 605 11982
NM_022758chr692856 2387 2178 1070 1059 1025 793 615 75 1831 32589 2276 619 --
NM_022764chr1631328 1130 139 --2617 596 11475
NM_022780chr241736 664 553 341 ------
NM_022822chr114790 652 565 211 --3575 228 141 --
NM_022836chr151603 1471 1399 451 189 2639 432 1445 --
NM_022841chr1531757 962 436 --1994 --
NM_022898chr14154431 4019 3857 3618 3606 3541 3424 3163 3098 3002 2968 1618 1445 1050 528 33631 3559 3552 23527 835 --
NM_022918chr111646 2856 199 ----
NM_023009chr14627 188 168 146 --4276 191 150 126 1710
NM_023067chr361362 1110 879 871 386 203 --21143 179 --
NM_023079chr17121737 1641 1590 1285 1265 1162 671 655 513 500 323 186 ----11635
NM_024016chr175594 584 537 338 218 1786 1211 1599
NM_024017chr1781468 1448 1230 1211 353 185 157 26 --21507 37 1124
NM_024034chr201706 --1709 1863
NM_024046chr33913 865 67 1427 31236 873 324 --
NM_024076chr1942347 2258 947 264 --31935 480 202 --
NM_024293chr22260 67 --1762 --
NM_024551chr1222003 1716 --22452 362 --
NM_024636chr742652 2641 683 362 1687 12644 22718 2107
NM_024645chr82526 349 1534 ----
NM_024646chr144000 3222 467 437 31503 889 685 1207 --
NM_024665chr353366 3228 1311 1062 353 --23895 3845 --
NM_024676chr12941 318 --1216 1190
NM_024692chr221169 693 11356 ----
NM_024713chr1511469 11328 --11094
NM_024721chr82744 88 --11701 --
NM_024798chr1552546 2495 1911 566 80 ------
NM_024811chr1181807 1509 675 520 372 331 180 52 2393 106 ----
NM_024830chr551981 1962 1532 297 89 21558 1361 2719 337 --
NM_024835chr17158 ------
NM_024850chr54572 317 284 86 --1346 --
NM_024877chr1951124 962 803 795 63 11027 187 125
NM_024887chr142083 688 355 86 2847 326 41440 694 691 522 --
NM_024889chr1041245 641 502 96 21637 454 151210 1195 1173 1159 1144 1129 728 713 699 684 669 655 628 614 599 --
NM_024947chr3159135 8966 8683 8156 6879 6738 6674 6291 5833 3066 2801 2326 2088 631 360 17993 21142 363 29641 8689
NM_024949chr444790 4318 4125 1467 24393 1215 24895 374 --
NM_024979chr1331446 1118 363 ------
NM_025057chr1421110 429 31177 844 332 ----
NM_025146chr36581 496 130 109 103 67 12585 ----
NM_025179chr1144418 4384 3692 3547 3220 1757 1478 1443 1432 1417 1320 561 479 471 33735 3504 3486 74723 4208 3550 3010 1874 483 146 11817
NM_025182chr91762 --3832 747 414 --
NM_025208chr1122432 1715 --22184 1902 --
NM_025211chr9------1272
NM_025248chr1763266 2888 1079 586 144 56 --53187 2072 607 314 66 --
NM_030571chr531467 1459 1200 1355 ----
NM_030625chr103942 800 549 1476 ----
NM_030627chr573500 3169 886 197 80 71 49 11612 11278 13215
NM_030647chr7105252 4968 4753 4700 3859 1638 1376 846 753 27 55540 5078 4859 4257 1303 ----
NM_030648chr485199 4930 4803 4779 4268 1103 917 112 13660 --13573
NM_030661chr751623 249 122 105 92 --51629 1396 1294 241 125 1285
NM_030665chr17----1980 --
NM_030796chr762156 855 493 479 377 113 11733 41729 1726 582 192 1498
NM_030802chr172754 151 1653 --1200
NM_030806chr1209170 8569 8546 8080 8069 7744 7157 7035 3453 3266 2857 2090 2063 1643 1459 1248 841 480 380 257 38633 7059 2052 67186 7183 3456 784 725 431 13497
NM_030914chr93781 319 107 --1921 1786
NM_030935chr71155 --3344 339 68 --
NM_030964chr593481 3261 2552 1500 1155 749 635 390 49 --73264 694 639 504 501 360 357 --
NM_030981chr113897 359 302 --3809 352 139 141
NM_031216chr1821507 74 1791 71696 1693 1690 1687 1684 1677 1510 --
NM_031417chr1992170 2095 1953 1750 956 704 597 513 360 22532 591 3871 303 201 --
NM_031426chr9112596 2360 2284 2195 2103 1909 1023 941 928 557 213 12253 22209 224 --
NM_031445chr282689 2445 2128 1274 1267 1023 827 221 --4854 697 79 76 22174 254
NM_031478chr16193 1687 2463 185 --
NM_031492chr113431 394 179 --1543 --
NM_032017chr191864 1764 1514 1436 845 837 799 673 579 142 42094 1867 1382 439 --
NM_032028chr52161 126 ------
NM_032104chr12537 265 1510 --137
NM_032120chr7----1113 --
NM_032153chr342370 2146 1979 1085 12070 12804 11936
NM_032182chr101529 --11584 --
NM_032192chr173708 531 461 2505 231 2552 91 --
NM_032193chr1181931 1885 1619 1333 713 478 337 93 ------
NM_032195chr211192 ------
NM_032207chr1941033 799 782 136 --21053 787 --
NM_032268chr16102495 2265 1098 661 629 568 506 220 157 150 32752 2586 1110 2470 27 --
NM_032298chr192380 82 --1181 --
NM_032311chr2291944 1749 1730 1605 1581 1552 557 185 137 1677 1502 21948 1881
NM_032320chr114751 84 59 37 ------
NM_032345chr122178 167 1141 ----
NM_032354chr1711013 ------
NM_032376chr17161 1717 ----
NM_032420chr51178 --4758 280 261 157 --
NM_032434chr271021 537 503 320 220 208 153 --41223 1045 275 127 11364
NM_032440chr1052147 1952 1895 608 283 12814 ----
NM_032452chr14101397 1304 621 299 216 137 114 97 72 44 1552 41447 81 78 75 --
NM_032458chrX33333 1143 261 21037 455 1989 22137 853
NM_032499chr154669 436 359 287 1176 1362 --
NM_032512chrX41046 870 199 131 ------
NM_032538chr692594 2415 1987 1820 1097 943 257 249 235 --42364 1914 1804 439 --
NM_032560chr14--150 ----
NM_032575chr1651949 1676 1503 497 72 12025 31953 711 296 --
NM_032595chr172456 52 ------
NM_032622chr411526 --11577 --
NM_032632chr1451985 1658 1506 1280 1247 22030 1434 11496 --
NM_032682chr353553 2405 620 481 265 32291 789 89 ----
NM_032689chr19--2352 265 --11409
NM_032808chr153764 122 82 --2177 93 --
NM_032846chr1481204 1037 524 437 406 218 170 29 1497 21266 1260 21484 174
NM_032875chr171566 ------
NM_032892chr151109 --1112 --
NM_032906chr41302 1271 1115 --
NM_032968chrX64086 3559 2640 2625 1393 1382 11464 14090 --
NM_032973chrY74078 3555 2637 2624 1393 1382 1362 11464 24082 2641 --
NM_032983chr7103195 2809 2767 2629 2484 2348 2110 1245 996 154 23228 2352 22720 281 --
NM_033058chr81629 1790 182 1953
NM_033082chr12--130 152 --
NM_033129chr2081703 1395 1368 377 348 324 191 151 1404 51975 1972 1716 1706 1558 --
NM_033132chr1321935 501 --11784 --
NM_033201chr1661028 478 379 301 275 212 ------
NM_033224chr7128024 8005 7681 6699 5544 4903 2907 2468 2051 1650 1485 242 35975 2765 2572 12936 --
NM_033259chr31612 1897 1735 --
NM_033285chr893407 3187 3048 1493 1088 942 824 802 316 14016 23191 1580 --
NM_033312chr1----159 --
NM_033387chr9112481 2392 1800 1005 848 758 643 582 258 248 73 22544 985 42579 861 851 334 32473 2116 1009
NM_033389chr17104761 3861 3315 3223 3163 1409 1000 838 562 313 1986 44750 4621 4138 4074 --
NM_033397chr1051986 1912 1634 706 682 11545 12078 --
NM_033419chr1751322 1179 1171 503 306 --2322 63 1440
NM_033420chr19----1332 1970
NM_033449chr562119 1901 1705 1559 222 177 11365 ----
NM_033495chrX161 1772 2933 930 --
NM_033505chr2115838 4781 4681 4171 4133 2650 2440 1005 938 928 627 36229 4533 59 16198 11009
NM_033512chr871883 1218 1190 1166 1146 675 74 1337 11199 1372
NM_033626chrX61481 1380 727 407 393 274 3673 511 285 ----
NM_033656chr2182277 1928 1917 1770 1523 1413 593 521 11041 11716 1840
NM_052840chr15----21606 287 11610
NM_052848chr1981607 1506 825 715 596 547 391 333 --1575 11936
NM_052855chr17------1185
NM_052868chr1140 --2100 63 --
NM_052879chr1263696 3471 3274 2687 1222 1023 1360 31235 1230 37 --
NM_052897chr121600 --3681 655 139 --
NM_052900chr831314 624 415 --11721 --
NM_052906chr2285045 4937 4911 4792 2023 986 977 730 21580 894 74978 4693 4690 4531 3416 3375 500 14494
NM_052925chr1971011 1004 971 894 853 813 735 --4995 975 859 669 --
NM_052933chr7121 --1283 --
NM_052950chr1371893 1830 1775 1737 528 464 436 --1440 1189
NM_052953chr3----175 --
NM_052978chr1431932 1264 96 21788 300 --11752
NM_053023chr1193043 2951 2838 2796 2622 2344 2156 1306 178 12011 63165 2699 2159 567 405 402 1409
NM_053046chr191404 --177 1414
NM_053056chr1132379 638 122 --32385 880 82 --
NM_054027chr541782 1657 720 302 11800 3322 305 66 --
NM_057175chr41259 ------
NM_057749chr811194 1933 11197 --
NM_058175chr215786 692 308 250 176 2768 147 2779 724 --
NM_058243chr194855 802 714 311 --1805 1809
NM_078476chr65584 548 532 476 201 --2613 251 --
NM_080391chr12485 120 ------
NM_080546chr92631 216 21819 767 ----
NM_080625chr202829 29 1954 133 --
NM_080738chr151748 608 590 479 311 21365 251 11973 --
NM_080836chr20184413 4084 3570 3517 3386 3243 3159 2905 2890 1817 1455 970 940 759 575 412 228 48 1395 33912 3854 2985 23555 78
NM_101395chr2153379 897 383 371 356 21163 284 173 2390 300
NM_101395chr2153379 897 383 371 356 21163 284 173 2390 300
NM_130386chr183245 80 60 --1248 --
NM_130459chr981587 1517 1488 1177 1131 1111 601 185 --31539 1134 415 11138
NM_130783chr1161681 1661 1358 339 86 63 1235 21891 811 11882
NM_130901chr15----1110 --
NM_133264chr17143576 3505 2856 2520 2444 1337 1302 1246 796 290 232 142 44 23 3993 237 109 43148 1135 366 359 --
NM_133265chrX42479 2272 1174 770 23375 573 13469 --
NM_133266chr1131065 974 861 ------
NM_133334chr4116412 6323 6115 6079 5324 5308 5032 4717 3960 2399 1095 32108 1973 1212 35991 4767 342 1346
NM_133367chr673048 3031 2960 2395 1173 543 189 13306 ----
NM_133369chr5--1150 2718 308 --
NM_133499chrX7951 844 757 384 203 113 61 1182 2239 64 --
NM_134268chr1731156 233 68 --1968 --
NM_138328chr17103246 3132 2766 2704 2494 2346 1077 469 356 73 2756 304 33249 742 362 1366
NM_138357chr1051578 1389 1352 1135 514 --21610 1581 --
NM_138376chr142445 153 --2329 163 --
NM_138471chr11----2453 407 --
NM_138473chr12135173 5080 5064 5053 5045 4984 4780 4635 4325 4301 4015 735 307 34253 3143 1159 23731 704 44135 3891 1314 319
NM_138620chr91387 1324 2393 332 --
NM_138761chr19--135 1154 --
NM_138764chr19135 1217 2336 90 --
NM_138795chr131417 212 100 --11259 --
NM_138992chr215837 384 291 173 90 --1890 --
NM_139321chr2054245 3439 3355 1583 170 12952 41493 1201 731 705 2735 513
NM_144571chr447009 2750 2201 1980 11687 11608 --
NM_144578chr1495136 5088 4966 4479 1961 1788 980 809 493 --11625 --
NM_144594chr122144 78 ------
NM_144635chr34966 423 408 307 --1133 --
NM_144645chr4----160 --
NM_144703chr2011014 --11176 --
NM_144778chr132923 82 ------
NM_144963chr822260 2000 --1419 --
NM_144967chrX21055 191 ----1419
NM_144977chr14505 262 250 66 ------
NM_145113chr1461213 449 389 327 142 33 --2452 37 1619
NM_145117chr11123171 3159 2504 2373 2358 2201 1259 1159 902 786 286 196 1142 93194 3183 3175 2727 2376 2278 1068 34 29 --
NM_145204chr152628 143 1632 137 1550
NM_145234chrX1150 ----1189
NM_145239chr1641183 489 455 34 1372 3460 414 175 --
NM_145253chr162464 278 --2632 561 --
NM_145274chr173937 814 611 --1642 --
NM_145284chrX3735 417 150 --12353 1154
NM_145296chr191610 --2622 111 1696
NM_145307chr1034234 4094 2968 1205 --13946
NM_145349chr1712118 --41856 677 470 207 --
NM_145349chr1712118 --41856 677 470 207 --
NM_145798chr174701 362 224 34 --3596 561 42 --
NM_145800chrX1152 1972 2912 240 --
NM_147189chr831870 1733 70 11722 11859 21852 91
NM_147202chr962631 2238 1042 604 535 145 --42597 2504 2271 610 12027
NM_147223chr252397 2188 1944 1793 700 --1763 1164
NM_152237chr2261145 522 420 391 274 223 11138 51533 1254 1149 532 321 --
NM_152247chr222266 223 ----1150
NM_152253chr2263652 3609 1505 1495 1469 620 43839 3027 3012 1367 166 13536
NM_152265chr151249 1106 539 363 181 --1366 --
NM_152280chr1103493 3266 2670 2610 1358 1101 977 762 748 331 --73189 3073 2946 2792 2785 2744 334 --
NM_152296chr192249 230 --2105 31 --
NM_152342chr162498 129 --1150 --
NM_152344chr1741120 1002 954 251 1412 11123 126
NM_152346chr1731195 1148 195 ------
NM_152365chr11188 --2349 123 --
NM_152381chr221899 1887 --1354 --
NM_152424chrX84599 3869 3820 3221 1197 912 597 164 43966 3940 1344 973 24185 1430 24606 4154
NM_152440chr1241097 975 828 131 --1380 --
NM_152470chr1893197 2713 2667 2608 1513 1404 1347 568 345 136 63474 3200 2979 2976 1407 1030 --
NM_152493chr121463 440 1126 ----
NM_152525chr21112 ------
NM_152594chr152947 557 ------
NM_152622chr543295 2884 582 253 --2280 259 --
NM_152636chr1162704 2156 731 366 114 39 12888 1212 --
NM_152641chr1242597 2245 1944 1105 22819 2336 1121 --
NM_152716chr1151414 1374 562 364 30 11400 21561 1160 --
NM_152744chr753307 2603 700 454 320 --43442 2911 766 424 21113 428
NM_152749chr731017 1001 212 ----1314
NM_152758chr883043 2272 2230 1883 948 676 181 140 22214 962 22234 683 --
NM_152777chr142427 158 ----1162
NM_152860chr1291426 502 404 359 335 184 171 159 105 31023 436 324 ----
NM_152890chr121167 147 ------
NM_153025chr16----21420 651 9588 524 475 411 347 283 220 156 92
NM_153211chr18----1159 --
NM_153235chr642457 905 66 29 --32461 1970 895 --
NM_153246chr631971 1377 1338 --21646 657 1687
NM_153262chr173007 2604 2547 2091 1282 854 574 32303 464 248 --22608 2551
NM_153266chr113920 745 617 --1857 --
NM_153334chr221541 --1743 --
NM_153340chr1----146 --
NM_153487chr674591 4471 4404 3900 3367 1225 689 14068 64381 3833 3794 3316 3302 1674 11067
NM_153619chr1562460 2282 1197 922 888 220 1509 42297 2285 1129 331 1818
NM_153686chr451949 1837 1813 934 49 11864 --1457
NM_153756chr1121945 1867 1749 1445 681 595 513 499 440 372 155 131 11607 31542 684 119 --
NM_153810chr1074313 4268 3441 1334 1297 1261 26 34318 1153 324 25074 650 --
NM_170607chr1771421 1324 1204 1015 624 595 370 21537 995 1628 --
NM_170672chr231359 622 205 21372 1152 1209 --
NM_170721chr173310 288 257 2850 206 11285 --
NM_172070chr22420 296 --1621 --
NM_172071chr166350 6329 6149 5496 2300 421 36058 5960 1312 46153 6129 4843 2404 --
NM_172115chr4----152 --
NM_172375chr141189 ----199
NM_173156chr182069 1807 1660 1455 671 605 383 368 1508 21846 1843 1291
NM_173172chr2----2318 23 --
NM_173470chrX82795 2774 2248 2167 2138 2046 1881 705 --175 --
NM_173475chr1631674 1543 694 --11284 11579
NM_173476chr1622266 2110 --21800 1727 --
NM_173485chr202224 179 --1110 --
NM_173500chr1531243 103 39 --11143 --
NM_173511chr253785 1507 1040 957 47 --1609 12402
NM_173595chr12125237 5215 5167 4723 4347 4311 3585 2128 2019 1450 994 670 21621 402 83931 3589 3238 1870 831 365 348 334 34487 4214 3447
NM_173808chr122739 586 --23616 769 --
NM_173822chr281759 1654 1551 743 603 498 265 193 2784 588 1750 --
NM_173824chr3------1110
NM_174893chr17140 --248 43 --
NM_174934chr1163403 3289 2785 2629 1277 352 2555 344 52832 1197 1078 931 689 1303
NM_175630chr24816 761 576 218 ------
NM_175736chr12247796 7619 7289 7155 6671 6403 6333 6119 6050 5992 5454 4863 2367 2257 2078 1981 1925 1912 1345 828 766 677 664 613 55589 5495 2458 2390 2057 104945 4838 4804 2575 2537 1820 1817 1329 902 769 47694 7293 6420 2261
NM_175767chr531260 670 646 ------
NM_175852chr183016 2416 2298 1866 1232 929 677 487 22828 2500 22903 1906 22734 910
NM_175854chr13--1713 ----
NM_175866chr151174 1139 413 267 32 --135 139
NM_175884chr72364 276 ------
NM_175898chr1561579 1277 574 515 232 77 1323 ----
NM_175902chr17----154 --
NM_176792chr1051431 1190 925 306 138 11367 2917 914 --
NM_177999chr993218 2951 2940 2875 2866 2525 1012 527 137 2754 680 1389 --
NM_178026chr201411 2399 162 3482 65 62 --
NM_178126chr17142038 1786 1779 1587 1541 1408 881 866 553 538 373 241 148 47 --11420 --
NM_178496chr31300 --11089 --
NM_178557chr421647 1527 --11271 --
NM_178566chr911594 133 ----
NM_178831chr7102908 2521 2410 2105 1143 1104 444 431 323 146 11108 12166 32172 1973 448
NM_178835chr4----1816 137
NM_178839chr22109 86 --1257 --
NM_181358chr173976 3345 3316 2812 1608 196 82 23558 1383 31614 1595 41 --
NM_181458chr231059 1000 159 1163 ----
NM_181504chr544113 3272 1401 22 --271 25 --
NM_181552chr71776 ------
NM_181672chrX41844 1269 699 666 1275 ----
NM_181704chr2141131 1040 969 125 ------
NM_181715chr14340 106 58 25 --1351 --
NM_181836chr532129 979 273 22133 52 ----
NM_181844chr1751853 1833 1374 1254 551 11315 31843 1836 206 1405
NM_182485chr412868 23630 250 ----
NM_182488chr13144 --1256 --
NM_182503chr6114931 4549 4518 3811 3800 3688 3430 1985 1468 1124 475 23522 451 24860 4765 1396
NM_182526chr1452699 2230 1210 1199 928 12337 23107 563 --
NM_182557chr1161784 1751 473 453 411 65 --52071 2041 1732 1536 254 --
NM_182580chr192492 2438 2291 1837 1724 1612 938 519 421 22371 869 62428 2367 1969 1865 1831 1731 --
NM_182687chr164192 62 43 24 --135 --
NM_182734chr2022140 339 13236 1243 --
NM_182757chr632964 2697 2683 --3599 89 86 --
NM_182830chr142627 584 1102 ----
NM_183397chr20104550 4309 4104 3880 3639 3168 1566 590 298 194 1141 14980 14011
NM_194071chr7165035 4805 4157 4100 4086 3663 3655 3365 1947 1801 1509 1349 1156 792 447 79 13430 63516 3448 1539 1132 717 714 --
NM_194449chr182822 99 --1231 --
NM_197941chr532978 932 316 12169 ----
NM_198243chr151981 --1788 --
NM_198353chr4----1106 --
NM_198458chr1931712 1416 1397 --31652 1644 1321 --
NM_198490chr3133010 2469 2396 2319 2197 1154 1082 623 405 333 299 168 41 1755 43266 3079 2482 2479 23298 2252
NM_198513chr81705 ----2813 145
NM_198560chr353267 1295 409 393 113 13470 101129 1123 824 757 754 549 280 275 272 221 --
NM_198571chr751536 1498 589 476 326 --1381 --
NM_198581chr285830 5690 5571 5242 4945 2862 2340 52 27058 4706 17466 --
NM_198904chr51171 31550 521 86 1725 --
NM_198990chr742479 2407 2039 793 23008 2460 --12085
NM_199072chr722542 2183 12477 2888 280 22187 844
NM_199245chr12122361 2333 2200 1987 1886 1698 1641 1618 881 538 458 342 21046 505 62118 2108 1712 1706 641 46 1525
NM_199262chr1752042 1813 748 599 236 --11709 12046
NM_199334chr172166 99 --3497 494 105 --
NM_199342chr1------1332
NM_201521chr61160 --181 --
NM_203403chr951169 1050 226 162 51 1415 157 --
NM_203434chr931167 249 241 1853 ----
NM_203446chr2152389 2088 1885 994 418 2382 267 1678 1708
NM_203458chr173080 3032 2452 2375 486 350 268 --23282 1499 --
NM_206853chr621602 1011 12611 13459 --
NM_206854chr61560 13872 24720 576 --
NM_207009chr101184 ------
NM_207303chr1083814 3396 2550 1309 1080 1007 919 127 --24204 751 --
NM_207330chr42843 304 1185 2858 264 --
NM_207379chr141997 --1768 11001
NM_207387chr1721405 470 --2356 73 --
NM_207391chr1951297 913 890 837 166 --1840 --
NM_207645chr117519 468 326 148 105 89 66 21218 918 2151 109 --
NM_212464chr1581919 840 830 692 612 378 367 203 1358 11704 21708 258
NM_212467chr1512496 1184 22281 529 12285
NM_213609chr32904 352 --11018 1714