TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-766-5p
miRNA Sequence: AGGAGGAAUUGGUGCUGGUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5262 24 ------
NM_000021chr145898 885 787 142 35 --2693 132 11049
NM_000024chr53447 436 130 --2371 213 --
NM_000037chr872514 2074 1916 1660 923 831 611 1790 22192 138 --
NM_000038chr531640 1580 282 --11583 --
NM_000044chrX2170 84 ----1109
NM_000052chrX83319 2360 2283 2231 1109 857 559 99 22515 2158 --22331 793
NM_000061chrX161 139 ----
NM_000068chr1931510 1494 1178 ------
NM_000074chrX3656 624 112 ----1611
NM_000081chr12702 432 125 ----
NM_000084chrX176919 6273 6129 5820 5807 5563 5442 5410 4854 2343 2216 1770 1633 1497 1046 827 176 --45856 5827 1996 722 35832 2117 819
NM_000088chr1771239 1208 1175 997 970 404 146 11189 --1372
NM_000089chr76662 191 104 95 63 49 ----1708
NM_000090chr23937 810 619 1817 156 --
NM_000092chr294469 3013 2839 1632 1532 1487 594 157 149 --33115 483 118 13156
NM_000093chr942188 2087 951 105 --62275 2130 2127 2113 1745 967 --
NM_000097chr331186 963 842 1112 1875 --
NM_000103chr1531001 985 36 --21030 1019 --
NM_000104chr231087 614 169 --183 --
NM_000109chrX32137 2027 913 ----22050 594
NM_000110chr121047 998 ------
NM_000112chr5115481 5130 5006 4374 3892 3432 2098 1874 1783 794 750 32010 1168 339 23435 128 --
NM_000125chr694272 3679 3331 1598 1504 1438 1222 1160 899 --21631 1448 11496
NM_000127chr8163 ------
NM_000129chr61442 1984 ----
NM_000133chrX41306 522 344 125 3364 292 263 --1511
NM_000138chr1542291 1763 302 192 2812 378 22316 1993 11848
NM_000141chr104992 967 308 182 --11315 --
NM_000142chr421183 1085 ------
NM_000153chr1421444 535 --31674 1622 40 --
NM_000161chr1431708 192 117 11269 21470 394 21220 398
NM_000163chr51894 1733 --22374 2111
NM_000165chr631550 1143 1093 --1299 11487
NM_000167chrX21343 696 2608 338 --1687
NM_000168chr7123219 2830 2647 2373 2338 2238 2203 2112 770 442 324 146 52492 2172 2156 2105 202 12833 --
NM_000170chr91476 ----1438
NM_000176chr542472 1324 533 343 --11099 --
NM_000178chr20277 34 --151 --
NM_000183chr21101 ------
NM_000189chr271924 1881 1848 833 419 247 40 --244 29 --
NM_000192chr1231389 1179 310 --21340 321 --
NM_000196chr162545 385 --163 --
NM_000202chrX113972 3296 2637 2612 2521 2484 2447 1586 1479 1252 873 --22491 2417 --
NM_000208chr19144536 4259 4130 3947 3552 1882 1876 1748 1361 800 759 726 561 514 34119 3954 2924 43517 1396 763 52 23522 3178
NM_000210chr21768 1507 12348 --
NM_000212chr1772010 1923 1899 1681 921 362 333 --1290 --
NM_000214chr201674 ------
NM_000217chr12125221 4964 4937 3986 2075 2064 2031 1522 955 769 714 217 33790 3454 1004 43594 3448 3352 1955 24188 3406
NM_000221chr26921 621 286 227 210 61 ------
NM_000232chr432672 2393 534 ------
NM_000240chrX21936 843 22111 1449 2670 426 --
NM_000245chr722146 822 ------
NM_000248chr382395 2213 2139 776 712 356 96 40 ------
NM_000259chr15176370 6009 5542 5398 5041 5020 4970 4925 3907 3883 2247 2029 1870 1010 691 535 407 55440 4913 2484 1917 1660 25035 4020 1979
NM_000264chr983331 3288 2214 1340 898 749 681 600 1245 13133 22334 2145
NM_000266chrX2207 112 ------
NM_000267chr1773443 3319 2933 2140 1121 391 206 12749 23458 1124 1768
NM_000271chr182566 222 ------
NM_000276chrX2353 236 22004 273 11446 --
NM_000278chr1071702 1628 1566 1542 906 878 751 1840 11595 --
NM_000280chr112997 687 ------
NM_000281chr10----128 --
NM_000284chrX61712 1284 608 518 405 267 ------
NM_000286chr173658 637 309 ------
NM_000289chr121106 ----1337
NM_000297chr482012 1951 1916 1629 1601 1344 417 193 --11884 --
NM_000310chr131261 1237 115 147 2990 502 173
NM_000314chr1052691 2275 1059 896 345 1915 ----
NM_000318chr892747 2492 2018 1892 1050 919 759 545 123 21039 282 ----
NM_000321chr1311278 1455 1257 --
NM_000330chrX21416 438 --1612 --
NM_000332chr6146504 6370 5522 4693 2868 2852 2306 2296 2136 1773 1688 607 498 433 36289 6128 2429 25951 4886 --
NM_000334chr1792031 1904 1894 1815 1801 1598 1589 673 273 11871 --11908
NM_000335chr321770 1698 --1846 11829
NM_000337chr5176466 6232 6061 5277 5264 5176 5125 5101 4971 4659 4652 2632 1150 1091 777 722 206 ------
NM_000340chr331398 291 71 1470 11150 11372
NM_000345chr42792 95 1127 1866 --
NM_000346chr1781977 1578 1336 1225 705 610 416 130 11787 1143 --
NM_000353chr163389 199 177 --1266 --
NM_000362chr2263405 2689 1214 399 175 68 22680 417 52884 845 820 370 275 13547
NM_000368chr944811 4272 3587 267 24101 805 44241 1908 715 286 --
NM_000369chr1441781 1410 1336 482 --11934 --
NM_000378chr112113 80 ------
NM_000384chr2130 ------
NM_000390chrX21165 148 ----1822
NM_000391chr1171666 1461 1147 548 524 274 215 --31581 1183 527 --
NM_000393chr251582 715 598 359 306 1162 31324 741 363 --
NM_000394chr213431 101 81 ----1435
NM_000399chr10----1169 --
NM_000406chr452684 1972 529 283 204 1625 --2719 407
NM_000408chr282818 2339 2123 751 547 526 513 230 12182 22745 1334 1530
NM_000412chr31265 ------
NM_000425chrX2713 588 ------
NM_000430chr1743431 2654 2530 25 33477 2337 788 137 --
NM_000435chr1913879 863 806 632 304 287 275 265 246 179 100 75 65 --2250 78 --
NM_000439chr541829 1029 768 438 --82436 2058 1613 1563 735 727 135 43 --
NM_000441chr741443 928 72 52 ------
NM_000448chr1162112 2004 1199 1009 457 69 --12496 22669 960
NM_000449chr131015 458 114 21319 945 11356 --
NM_000451chrX61883 1770 458 423 313 95 1542 21931 316 1463
NM_000452chr1341820 1308 804 434 31518 731 586 21888 1687 --
NM_000460chr32493 378 --1100 --
NM_000461chr394339 4278 4133 3099 1761 1457 990 936 195 34329 3309 1429 23583 1095 --
NM_000474chr71525 --1529 --
NM_000478chr14697 648 248 171 1470 1491 --
NM_000480chr1151630 616 547 269 209 --31079 492 93 1359
NM_000484chr21--1772 ----
NM_000488chr1127 ------
NM_000489chrX103155 3002 1128 1096 793 704 693 686 426 263 32255 778 124 42477 1056 294 172 --
NM_000492chr741118 478 472 466 ------
NM_000493chr62791 384 ----1241
NM_000495chrX1954 1791 --2878 260
NM_000500chr61371 --140 1121
NM_000503chr831859 1503 1319 1349 31716 1384 1327 11470
NM_000522chr72413 157 --2217 136 --
NM_000523chr22140 134 --1267 --
NM_000527chr195824 779 551 274 252 11916 1191 --
NM_000530chr141090 712 357 245 ------
NM_000533chrX4761 411 332 25 --11381 11905
NM_000536chr112542 236 1607 ----
NM_000544chr6_cox_hap193241 3134 3123 2745 2552 1015 1004 983 490 11291 23262 281 23285 1077
NM_000555chrX247832 7651 7545 7113 6973 6960 5931 5868 5814 5527 5447 5019 4829 3046 3039 2895 2707 2700 2307 2269 1528 1356 445 340 45821 3026 2575 2406 106977 6326 6106 5662 5658 5607 5542 2776 343 175 21620 785
NM_000557chr20122 ------
NM_000575chr221040 234 1710 ----
NM_000578chr231791 1633 1168 11313 11513 --
NM_000582chr4293 23 ------
NM_000595chr63626 127 50 ------
NM_000599chr2114317 4104 3981 3893 3293 3188 2993 1670 1413 1120 1087 1571 42855 1022 676 609 44166 3879 3298 831
NM_000610chr1142261 2106 715 686 --12946 --
NM_000612chr1173681 3630 2384 520 514 122 52 ------
NM_000615chr1172502 2461 2193 1959 1219 892 134 ------
NM_000618chr12145651 5637 5398 5300 4477 4306 4221 4063 2614 2173 1279 1186 745 416 --55786 2330 1824 806 349 1765
NM_000618chr12145651 5637 5398 5300 4477 4306 4221 4063 2614 2173 1279 1186 745 416 --55786 2330 1824 806 349 1765
NM_000620chr1241878 501 327 159 11908 42024 1400 409 68 --
NM_000627chr22197 135 ----1681
NM_000633chr1845228 2106 1924 870 11048 --11670
NM_000635chr1951635 1581 1237 292 271 ------
NM_000679chr5----1516 --
NM_000680chr8----157 --
NM_000684chr103499 231 199 --11249 --
NM_000685chr32683 175 --161 --
NM_000685chr32683 175 --161 --
NM_000686chrX21205 301 --31357 521 362 --
NM_000687chr203676 283 60 ------
NM_000693chr153486 106 23 --21139 152 11575
NM_000719chr1295197 4480 4446 2359 2175 2163 1106 997 914 76333 6308 5002 4337 2632 2539 2035 16279 22382 2349
NM_000722chr7--1254 ----
NM_000723chr174448 364 309 277 --2494 256 --
NM_000724chr1031528 1384 225 --11453 1382
NM_000725chr122790 329 --1261 --
NM_000726chr231349 952 251 ------
NM_000729chr31217 ------
NM_000757chr14736 321 299 90 2877 762 ----
NM_000793chr1434537 3364 1452 14631 33979 1272 1076 --
NM_000794chr521060 774 ------
NM_000795chr114895 376 312 109 --3920 907 323 --
NM_000801chr2011130 --3995 199 187 --
NM_000806chr551785 1547 563 117 33 ------
NM_000809chr4319140 8794 8649 8612 8559 8506 8106 8028 7828 7802 7778 7654 7146 7060 6966 6836 6759 6434 6334 5934 5694 5629 3653 3347 2586 2527 2248 2230 1529 1432 578 26932 3248 36816 6339 3604 25698 2844
NM_000811chr51673 1284 ----
NM_000812chr4189 --138 --
NM_000813chr5115329 4641 3605 2104 2078 1847 1696 1630 1166 1054 369 25052 1941 32130 1633 39 43812 3521 2115 1857
NM_000814chr1553010 2696 1096 523 149 12723 11363 --
NM_000817chr2--11251 --1459
NM_000818chr10176 --1475 --
NM_000824chr4----1386 --
NM_000826chr422055 1794 --21860 958 --
NM_000827chr592401 2031 1869 1710 1026 858 824 773 183 1545 1425 --
NM_000831chr186233 5861 5641 5529 5258 1695 805 194 41770 767 715 299 --1375
NM_000833chr1671543 1386 1336 1122 1010 404 380 21227 172 11265 11126
NM_000834chr124907 346 211 191 --31297 317 215 --
NM_000837chr82364 208 --1528 --
NM_000838chr652187 2031 1926 563 331 --22737 1092 12010
NM_000840chr71455 ------
NM_000842chr111203 1681 1654 --
NM_000859chr541300 584 563 366 ------
NM_000861chr352587 1907 1896 998 718 --21732 1030 1599
NM_000864chr111122 --2959 955 1795
NM_000868chrX32522 282 59 12028 3291 288 271 --
NM_000870chr55652 630 587 521 238 11352 2558 153 --
NM_000872chr1041364 1321 1070 146 --11004 --
NM_000875chr15207024 5742 4999 4747 4374 4328 2678 2383 1990 1852 1579 1147 1129 810 634 339 331 324 314 180 15957 55841 4897 1399 1396 609 16419
NM_000876chr631395 1258 171 --1448 --
NM_000880chr8--149 1912 --
NM_000891chr1773631 3267 3254 2657 1071 584 439 ----1664
NM_000895chr122156 33 ------
NM_000898chrX--2792 607 2778 165 --
NM_000899chr12103370 3000 2687 1723 1705 1684 1545 608 464 384 ------
NM_000901chr431701 250 121 ----11925
NM_000902chr373081 2805 1971 655 482 274 217 1473 22038 1292 --
NM_000903chr1611530 11041 2290 24 --
NM_000912chr853433 3418 3030 2330 32 --2281 252 --
NM_000917chr10----123 --
NM_000919chr53545 239 54 ------
NM_000921chr121132 ------
NM_000927chr72575 117 ------
NM_000933chr2031703 176 88 --21650 1385 --
NM_000935chr331045 1020 818 11095 1954 --
NM_000938chr41138 ------
NM_000944chr452373 1812 1780 1554 698 --11655 12214
NM_000945chr272029 1918 1861 1400 525 284 110 144 31707 1704 541 11498
NM_000949chr53780 300 44 --1732 1153
NM_000950chrX73547 3400 3377 3271 2302 1167 506 ------
NM_000958chr531209 972 480 ------
NM_000961chr2083796 3766 3185 3120 2890 2682 2579 706 23851 3740 1131 --
NM_000962chr982742 2058 1957 1919 1243 927 726 599 1791 52637 2333 2303 1042 932 1182
NM_000963chr12761 713 1378 ----
NM_000964chr17150 11314 --11175
NM_000965chr32953 385 --1257 --
NM_000966chr121673 --2936 341 2940 886
NM_000990chr1173760 1148 870 535 142 67 45 --43948 3598 2509 1046 --
NM_001001132chr2151498 1371 1333 1288 1251 ------
NM_001001323chr1252788 2649 2135 2108 789 32800 820 163 12872 --
NM_001001331chr352290 2058 1860 353 165 21931 1912 ----
NM_001001344chrX32181 2116 280 --1731 --
NM_001001389chr1142261 2106 715 686 --12946 --
NM_001001390chr1142261 2106 715 686 --12946 --
NM_001001391chr1142261 2106 715 686 --12946 --
NM_001001392chr1142307 2152 761 732 --12992 --
NM_001001394chr2254 30 1247 288 85 --
NM_001001396chr1194089 3825 3735 3681 3665 3539 3446 3425 3069 1584 1325 1191 1049 944 867 860 602 576 295 --53982 3828 3543 2980 615 11694
NM_001001419chr594506 4474 4168 4086 1931 1791 1645 670 623 23381 405 13498 13557
NM_001001420chr594506 4474 4168 4086 1931 1791 1645 670 623 23381 405 13498 13557
NM_001001433chr2052946 2649 698 484 148 11071 --1200
NM_001001481chr8113218 3086 2783 2739 2701 2628 2616 2545 723 328 125 --13419 --
NM_001001484chr1062473 1646 959 872 854 593 --3359 297 118 12424
NM_001001502chr52108 87 --1111 --
NM_001001549chr752883 781 733 710 407 1542 31909 1905 1792 --
NM_001001550chr752883 781 733 710 407 1542 31909 1905 1792 --
NM_001001555chr752883 781 733 710 407 1542 31909 1905 1792 --
NM_001001556chr1541136 420 408 83 --2424 86 1596
NM_001001557chr83400 342 275 11680 22226 1588 --
NM_001001560chr222158 126 1721 1534 --
NM_001001664chr252558 1577 1222 1059 171 31117 362 47 ----
NM_001001668chr1963371 3184 3155 3131 2842 316 --11221 --
NM_001001701chr452184 1486 647 634 128 ------
NM_001001709chr9180 --1929 --
NM_001001787chr13194 186 86 ------
NM_001001790chr92357 61 ------
NM_001001890chr2164269 2861 2828 2822 2798 2764 12839 74249 3992 3476 2981 2942 2854 1111 23000 2832
NM_001001924chr841870 808 465 363 11390 --1206
NM_001001925chr841870 808 465 363 11390 --1206
NM_001001931chr841870 808 465 363 11390 --1206
NM_001001933chr11179 ------
NM_001001938chr9153980 3799 3459 3440 3338 3074 2898 1642 1562 1540 1287 1212 1056 314 129 13553 73572 3474 3348 1599 1236 1090 317 --
NM_001001971chr1031236 1093 924 21287 233 160 --
NM_001001974chr1041914 1813 1622 48 ------
NM_001002032chr172595 59 ----1599
NM_001002033chr172695 159 ----2699 42
NM_001002233chr831813 1444 776 2868 381 11727 --
NM_001002243chr23935 299 36 ------
NM_001002252chr12----129 --
NM_001002269chr9--1164 ----
NM_001002294chr12311 304 ------
NM_001002295chr101446 --1823 --
NM_001002296chr84964 365 97 80 ----1459
NM_001002762chr1092909 2634 2377 1188 981 936 830 250 240 12575 32509 2261 2258 2524 381
NM_001002811chr131491 1222 182 ------
NM_001002812chr131491 1222 182 ------
NM_001002812chr131491 1222 182 ------
NM_001002838chrX51796 1207 692 439 239 --31787 80 77 --
NM_001002860chr14114596 3569 3366 1879 1704 1496 1372 551 517 316 271 24049 3397 31862 1683 1679 24022 621
NM_001002909chr1761578 1488 749 343 318 204 --41591 770 372 335 --
NM_001002914chr1731252 1220 990 ------
NM_001002919chr2--1128 ----
NM_001003652chr18178411 8246 8172 7878 7306 6830 6315 6294 6128 5912 5577 5334 3455 2921 2224 1500 937 27499 2365 18494 15975
NM_001003665chr152330 1393 815 702 168 23555 1202 ----
NM_001003674chr18116559 5913 5133 4685 2663 2560 2311 1631 1148 994 147 1978 34705 2314 448 14689
NM_001003675chr18116559 5913 5133 4685 2663 2560 2311 1631 1148 994 147 1978 34705 2314 448 14689
NM_001003676chr112733 267 --1260 --
NM_001003681chr2241910 1637 1575 1485 --21568 259 179
NM_001003688chr431192 822 802 --11121 --
NM_001003698chr641699 1236 542 70 --21746 1668 --
NM_001003699chr641699 1236 542 70 --21746 1668 --
NM_001003712chr1253910 1256 1208 1116 411 ------
NM_001003786chr172611 273 127 --2666 120
NM_001003787chr172611 273 127 --2666 120
NM_001003788chr172611 273 127 --2666 120
NM_001003790chr84910 705 615 289 --1628 --
NM_001003791chr84910 705 615 289 --1628 --
NM_001003792chr32439 417 ------
NM_001003793chr32439 417 ------
NM_001003800chr963557 3285 1163 1106 678 397 --33289 1327 573 --
NM_001003810chr41585 ------
NM_001003937chr251491 1104 1097 335 247 --1690 --
NM_001003940chr15103819 2540 1246 1173 1030 1010 648 287 178 135 11513 32762 2509 2397 11177
NM_001003942chr15103819 2540 1246 1173 1030 1010 648 287 178 135 11513 32762 2509 2397 11177
NM_001003943chr15103823 2544 1250 1177 1034 1014 652 291 182 139 11517 32766 2513 2401 11181
NM_001004023chr11158 ------
NM_001004065chr993982 3387 3031 2509 1038 788 634 557 515 ----33352 1384 488
NM_001004106chr54397 223 141 81 ------
NM_001004127chr132635 126 1789 ----
NM_001004304chr1273071 2249 1252 1047 815 681 604 22206 2176 23226 684 --
NM_001004317chr643702 2842 569 27 13030 21640 1028 --
NM_001004329chr122379 346 ------
NM_001004342chr1205602 5562 4621 4201 3747 1907 1872 1475 1431 1423 1314 843 740 728 720 712 698 680 644 277 24762 691 75814 4388 1411 814 776 768 744 2796 684
NM_001004360chr221742 282 21702 1433 ----
NM_001004419chr12114589 4333 4314 4235 4102 4062 4038 1373 1330 846 271 11230 13533 --
NM_001004720chr23958 242 77 --1669 --
NM_001004722chr231127 411 246 --1838 --
NM_001005158chr3--155 ----
NM_001005159chr3--155 ----
NM_001005217chr4162 ----175
NM_001005242chr1251357 1074 563 368 107 1168 1670 11593
NM_001005266chr151485 --2210 189 --
NM_001005267chr151485 --2210 189 --
NM_001005268chr151485 --2210 189 --
NM_001005269chr151485 --2210 189 --
NM_001005271chr1721168 150 1263 21045 276 1179
NM_001005273chr1721168 150 1263 21045 276 1179
NM_001005335chr19399 52 45 ------
NM_001005340chr72856 850 ------
NM_001005366chr124773 621 395 185 ------
NM_001005375chrY41885 1473 255 95 1479 11396 --
NM_001005386chr24686 514 251 48 1823 1458 --
NM_001005404chr17103665 3657 3603 3240 3220 3189 1353 1222 643 128 24288 1568 53503 3011 1078 972 60 11146
NM_001005463chr106998 858 714 245 228 193 12015 22088 862 --
NM_001005473chr5116306 5299 5212 5186 4921 2600 2434 2283 2109 151 83 25517 2461 11476 36450 5196 4892
NM_001005474chr321236 183 ------
NM_001005502chr12104919 4559 4421 4274 3498 1964 1702 1230 1159 118 33474 2032 1000 11237 --
NM_001005527chr34923 401 320 230 --1386 --
NM_001005746chr231349 952 251 ------
NM_001005747chr231349 952 251 ------
NM_001005753chr241900 1440 789 37 --32063 1704 663 12153
NM_001005781chr21426 ------
NM_001005782chr21875 ------
NM_001005845chr82189 35 --139 1203
NM_001005849chr172149 118 ------
NM_001005910chr32498 21 ------
NM_001005911chr32498 21 ------
NM_001005920chr16--4996 827 360 318 1725 --
NM_001006115chr371893 1124 875 546 406 312 109 --32126 831 33 --
NM_001006600chr5----1430 --
NM_001006605chr131115 947 109 ----11131
NM_001006605chr131115 947 109 ----11131
NM_001006610chr162859 381 ------
NM_001006612chrX173 --1381 --
NM_001006613chrX173 --1381 --
NM_001006614chrX173 --1381 --
NM_001006617chr951263 940 529 392 334 11317 ----
NM_001006619chr951263 940 529 392 334 11317 ----
NM_001006620chr951263 940 529 392 334 11317 ----
NM_001006621chr951263 940 529 392 334 11317 ----
NM_001006636chr2------1887
NM_001006665chr11167 --1765 --
NM_001006684chrX2406 124 ------
NM_001006938chrX1527 1570 1500 --
NM_001006945chr11548 1269 ----
NM_001006946chr241645 1459 218 59 ----2528 280
NM_001007023chr1434537 3364 1452 14631 33979 1272 1076 --
NM_001007024chr1793915 3752 3733 1721 1506 958 845 548 177 --44238 3586 3115 429 13461
NM_001007025chr1793915 3752 3733 1721 1506 958 845 548 177 --44238 3586 3115 429 13461
NM_001007067chr851058 1012 998 791 255 --2343 47 --
NM_001007068chr851058 1012 998 791 255 --2343 47 --
NM_001007069chr851058 1012 998 791 255 --2343 47 --
NM_001007070chr851058 1012 998 791 255 --2343 47 --
NM_001007097chr9113871 3837 3828 3820 3501 3155 1792 1582 1356 1163 690 --34022 3159 1831 34100 3976 616
NM_001007098chr13859 230 113 --1117 --
NM_001007099chr12761 622 ------
NM_001007100chr12761 622 ------
NM_001007102chr631466 1176 618 ------
NM_001007156chr1551884 1763 1518 748 452 --1674 1739
NM_001007214chr11718 1140 ----
NM_001007226chr1751425 1298 1028 496 436 --11011 11032
NM_001007227chr1751425 1298 1028 496 436 --11011 11032
NM_001007228chr1751425 1298 1028 496 436 --11011 11032
NM_001007229chr1751425 1298 1028 496 436 --11011 11032
NM_001007230chr1751425 1298 1028 496 436 --11011 11032
NM_001007237chr142735 402 384 56 21813 462 22191 1938 --
NM_001007246chr2151896 1535 1201 627 173 ------
NM_001007257chr111029 ------
NM_001007267chr2------1134
NM_001007277chr11----2777 427 --
NM_001007464chr61119 ------
NM_001007466chr6105030 4456 1914 1590 1484 1475 996 842 309 301 1481 11183 24917 1965
NM_001007471chr92564 79 ------
NM_001007527chr5------2670 88
NM_001007538chr1331536 105 24 --21561 1216 --
NM_001007553chr131113 436 146 --1444 11192
NM_001007559chr1841724 834 490 89 ------
NM_001007793chr103100 68 23 ------
NM_001007794chr11689 ------
NM_001008220chr583821 3253 2663 1035 706 548 141 123 33554 3317 2518 1304 1553
NM_001008222chrX51002 890 500 379 299 21185 259 11335 21170 1059
NM_001008225chr74223 172 125 72 ------
NM_001008239chr1883511 3297 660 301 210 144 53 46 13234 21007 23 --
NM_001008272chr32288 92 ------
NM_001008273chr32288 92 ------
NM_001008388chr43815 397 21 1210 1107 193
NM_001008391chr113725 283 201 ------
NM_001008392chr363377 1346 992 949 316 303 12880 23574 799 --
NM_001008401chr19--11304 ----
NM_001008408chr7126176 5617 5308 4823 4040 3932 2428 2269 2234 1457 830 53 54468 4152 1503 1109 130 16204 25798 1024
NM_001008495chr882187 2013 1734 1538 1513 868 825 513 ------
NM_001008539chr8105301 5064 4422 4264 3975 1980 1758 1632 1279 1098 11770 34081 1306 1020 --
NM_001008541chr1062272 1939 1799 1773 320 95 ------
NM_001008541chr1062272 1939 1799 1773 320 95 ------
NM_001008564chr1331447 401 145 ------
NM_001008660chr1121408 532 --1980 2447 115
NM_001008701chr19112936 2846 2802 2755 2494 2026 1062 881 870 601 435 --72897 2740 2478 1180 1020 874 505 --
NM_001008708chr22565 490 ------
NM_001008726chr1441731 1542 409 52 --11618 --
NM_001008738chr552897 2427 2388 1908 482 --12346 --
NM_001008777chr171209 --1611 --
NM_001008860chr152694 582 1259 1617 --
NM_001008892chr152694 582 1259 1617 --
NM_001008894chr152694 582 1259 1617 --
NM_001008925chr473231 2736 928 655 601 414 239 32636 864 665 11147 1949
NM_001009184chr82364 208 --1528 --
NM_001009185chr55722 622 566 259 159 ------
NM_001009554chr484183 3974 3951 3888 1504 455 431 369 34136 1871 888 23428 1760 --
NM_001009554chr484183 3974 3951 3888 1504 455 431 369 34136 1871 888 23428 1760 --
NM_001009555chr451268 709 505 355 24 ----1510
NM_001009565chr22442 22 2585 391 ----
NM_001009566chr151075 1068 520 222 59 11324 ----
NM_001009880chr22184677 4373 4313 4007 3919 3587 3334 1944 1804 1792 1562 1500 1251 911 886 828 503 190 14812 24545 3999 11306
NM_001009899chr3166436 5372 5294 5085 4980 4480 4405 4068 2509 1962 1875 1732 1434 748 687 628 35949 4435 1082 11976 --
NM_001009923chr202689 141 --1580 --
NM_001009955chr11446 ------
NM_001009955chr11446 ------
NM_001009959chr262508 1962 903 868 570 534 11698 22468 395 --
NM_001009993chr2134276 4112 3659 3056 2879 2839 1662 968 939 789 498 465 98 14363 23734 1604 11133
NM_001009996chr31200 ----1562
NM_001010853chr652527 1164 918 614 511 ----1477
NM_001010854chr142716 181 ------
NM_001010857chr1----1107 --
NM_001010861chr152740 2689 2204 711 305 --11718 --
NM_001010867chr196682 5949 5771 5391 5244 2321 1963 1595 74 25101 5058 2642 201 15834
NM_001010876chr6162 ------
NM_001010888chrX114095 3889 3706 3493 1630 1576 1209 1066 387 381 167 23310 266 --13287
NM_001010891chr566934 6250 5648 5187 2129 1368 25636 1682 16440 12008
NM_001010895chr931998 688 497 --149 --
NM_001010924chr1041210 331 248 54 ------
NM_001010926chr12116 56 --1607 --
NM_001010927chr62567 33 ------
NM_001010971chr13298 264 216 ----1837
NM_001010984chr142468 909 860 279 135 1543 --
NM_001011513chr4113781 3163 3007 2930 2777 2591 1632 1529 1110 923 347 --1932 12705
NM_001011537chr332015 461 266 --1542 --
NM_001011546chr20149 1814 ----
NM_001011645chrX2170 84 ----1109
NM_001011658chrX61806 1392 688 357 200 136 ------
NM_001011666chr7136360 6123 5688 5472 5043 4709 2098 1963 1789 1435 1417 576 109 34786 4204 613 45865 1577 1574 663 1235
NM_001011705chr131270 1287 ----
NM_001011708chr262794 1953 1174 1161 1125 796 ------
NM_001011713chr1431162 637 342 ------
NM_001011720chr83386 304 167 ------
NM_001012264chr143785 670 236 1774 3607 240 85 1692
NM_001012267chr921495 1488 1543 ----
NM_001012329chr131741 1575 1536 22161 1914 ----
NM_001012393chr1194562 3913 3531 3365 2064 1397 1308 887 321 34934 1724 40 62048 2045 1706 890 625 284 25048 4091
NM_001012398chr162894 744 11101 1959 --
NM_001012410chr32487 459 1387 ----
NM_001012415chr91729 --1216 188
NM_001012420chr1562636 2295 1990 1174 983 732 11886 22350 1109 --
NM_001012423chr1552636 2295 1174 983 732 11886 22350 1109 --
NM_001012426chr6103200 3147 2738 2647 2125 1331 1048 949 897 310 21190 709 1923 --
NM_001012427chr6103200 3147 2738 2647 2125 1331 1048 949 897 310 21190 709 1923 --
NM_001012512chr18193 1209 ----
NM_001012513chr181104 1220 ----
NM_001012514chr251094 907 453 71 44 --3963 136 37 1832
NM_001012516chr251094 907 453 71 44 --3963 136 37 1832
NM_001012614chr43240 209 200 ------
NM_001012642chr1552023 1997 1750 159 138 12107 130 --
NM_001012732chr42869 146 ------
NM_001012751chr1041669 1292 1260 777 ----1714
NM_001012756chr1952997 2989 2442 2159 979 22238 112 --12665
NM_001012968chrX102421 2234 1757 1102 948 814 663 461 384 328 --21937 347 --
NM_001012977chrX31161 286 191 --2205 176 --
NM_001012989chrX134 --155 --
NM_001012993chr991380 1317 1273 1186 1155 1000 833 431 283 ------
NM_001013031chr104815 452 243 115 1843 21304 864 11070
NM_001013399chr611012 11162 ----
NM_001013406chr721750 1391 ----11730
NM_001013415chr421062 635 21358 314 11426 --
NM_001013438chr31939 11015 --1272
NM_001013439chr31785 1861 --1118
NM_001013620chr1287540 6288 5992 2930 1589 806 725 504 37977 3210 1695 45909 1733 1510 860 --
NM_001013624chr1761025 863 851 516 351 53 ----1296
NM_001013635chr1241183 1054 1044 860 --11169 --
NM_001013690chr12122396 2182 2168 1770 1739 1622 1616 1540 934 460 405 359 ----12372
NM_001013843chr151144 ------
NM_001014336chr122379 90 ------
NM_001014380chr13155816 5317 5261 5239 4895 2352 2134 2004 1698 976 866 735 652 565 329 --24012 1677 14175
NM_001014431chr144972 232 120 88 ------
NM_001014432chr144972 232 120 88 ------
NM_001014434chr1198 --3642 38 35 --
NM_001014764chr171164 ------
NM_001014797chr10167915 7732 7407 7231 5586 5520 2941 2768 2341 2259 1144 508 499 436 274 199 27449 2293 77741 7235 5477 3153 3025 2184 1049 --
NM_001014809chr44878 701 340 190 1625 ----
NM_001014831chr193626 262 89 ------
NM_001014832chr193626 262 89 ------
NM_001014834chr193626 262 89 ------
NM_001014835chr193626 262 89 ------
NM_001014839chr13906 426 64 --1106 --
NM_001014841chr13906 426 64 --1106 --
NM_001015048chr1443067 2477 1194 755 22366 593 32935 2187 1143 --
NM_001015049chr1443067 2477 1194 755 22366 593 32935 2187 1143 --
NM_001015053chr1771408 1269 1263 1228 559 417 212 3510 425 130 41235 1231 569 272 --
NM_001015508chr81628 --2710 702 1103
NM_001015877chrX73077 2050 1968 1024 659 488 385 3707 523 125 23004 814 11140
NM_001015881chrX2457 362 ------
NM_001015882chr91111 ----1738
NM_001015887chr351520 1402 621 318 97 ------
NM_001017365chr1152 ------
NM_001017366chr1152 ------
NM_001017367chr1152 ------
NM_001017368chr1792761 2489 2204 2183 853 407 338 306 162 --22093 309 11839
NM_001017371chr211073 --11086 --
NM_001017395chr3113220 3141 2974 2487 1433 1298 898 812 531 239 145 12781 ----
NM_001017405chr41967 --2357 67 --
NM_001017424chr131857 1503 578 --2525 270 --
NM_001017425chr131857 1503 578 --2525 270 --
NM_001017440chr7267987 7958 7558 7448 7394 6569 6239 6054 6018 5909 5700 3177 3029 2819 2729 2648 2510 2490 2342 2237 1680 1613 1092 882 828 69 26517 2253 87613 6552 5758 2577 1628 848 735 509 47647 7000 514 73
NM_001017523chr1251895 1782 1477 1322 45 11616 11739 --
NM_001017916chr1791789 1712 1689 1510 1403 704 678 175 167 11571 3813 603 182 --
NM_001017917chr1791789 1712 1689 1510 1403 704 678 175 167 11571 3813 603 182 --
NM_001017920chr21126 ------
NM_001017926chr851409 1239 1152 269 36 1643 ----
NM_001017930chrX31019 318 166 ------
NM_001017962chr10----123 --
NM_001017973chr5173 135 ----
NM_001017974chr5173 135 ----
NM_001017995chr5104817 4714 4230 4206 3795 3049 2973 476 439 274 24119 86 33130 1877 1482 --
NM_001017999chr172291 2152 2022 1958 1694 388 302 --21891 377 --
NM_001017999chr172291 2152 2022 1958 1694 388 302 --21891 377 --
NM_001018000chr172291 2152 2022 1958 1694 388 302 --21891 377 --
NM_001018000chr172291 2152 2022 1958 1694 388 302 --21891 377 --
NM_001018001chr172291 2152 2022 1958 1694 388 302 --21891 377 --
NM_001018037chr961406 1299 538 488 319 210 ------
NM_001018050chr22102763 2736 2696 2615 2566 2452 2135 1372 1120 332 41283 363 181 156 --1689
NM_001018052chr22102763 2736 2696 2615 2566 2452 2135 1372 1120 332 41283 363 181 156 --1689
NM_001018053chr171901 1859 1543 1330 1260 749 373 --1157 --
NM_001018054chr131256 1228 1024 --11068 --
NM_001018056chr9----296 93 --
NM_001018057chr111926 21463 178 2106 93 --
NM_001018064chr961782 283 240 213 167 26 1104 --11591
NM_001018072chr1251895 1782 1477 1322 45 11616 11739 --
NM_001018074chr542472 1324 533 343 --11099 --
NM_001018075chr542472 1324 533 343 --11099 --
NM_001018076chr542472 1324 533 343 --11099 --
NM_001018077chr542472 1324 533 343 --11099 --
NM_001018091chr1582890 2694 2337 960 668 654 432 98 ------
NM_001018100chr151694 ----1292
NM_001018108chr15101901 1819 1566 860 787 726 700 686 588 276 1471 3596 156 78 22157 866
NM_001018111chr783598 3525 3393 3067 1273 975 711 585 --31400 555 189 --
NM_001020658chr131487 1366 440 1134 ----
NM_001020658chr131487 1366 440 1134 ----
NM_001023567chr1521906 991 1459 --1578
NM_001023587chr34851 759 714 47 --11178 --
NM_001024024chr142762 167 1323 --1274
NM_001024070chr142758 163 1319 --1270
NM_001024094chr542472 1324 533 343 --11099 --
NM_001024218chr145850 650 562 322 229 ------
NM_001024401chr1682540 2448 2269 2070 2063 1894 960 449 --11039 12815
NM_001024455chrX122691 2447 2196 2176 2141 2027 1902 1702 970 951 835 362 --32450 1067 767 --
NM_001024463chr154849 366 154 55 --1738 --
NM_001024649chr5102959 2480 2302 1923 1018 932 895 883 43 33 11885 31835 913 543 32891 2198 859
NM_001024807chr192342 47 ------
NM_001024808chr1232205 981 539 --72362 2016 1904 863 822 403 86 12637
NM_001024809chr17150 11314 --11175
NM_001024858chr14192759 2707 2694 2568 2553 2530 2416 2014 1990 1111 806 692 682 624 397 316 303 239 71 12950 22765 2503 --
NM_001024934chr62104 63 ----1128
NM_001024935chr62104 63 ----1128
NM_001024936chr62104 63 ----1128
NM_001024937chr175695 589 482 197 180 ----1291
NM_001024948chr133293 2391 428 13469 21273 709 --
NM_001025068chr34288 140 133 82 --1660 --
NM_001025069chr34288 140 133 82 --1660 --
NM_001025076chr10155522 5238 4920 4657 4042 3957 3829 2451 2386 2211 1669 1389 1287 581 167 35494 4423 1545 95924 4980 4800 4339 2365 2214 1712 1109 393 12445
NM_001025077chr10166880 6596 6278 6015 5400 5315 5187 3027 2747 2645 1939 1525 1387 1161 1051 246 36852 5781 2903 87282 6338 6158 5697 2467 1751 1326 222 --
NM_001025079chr3123727 3538 3500 3489 3142 2712 2656 2542 939 737 699 659 23097 2531 72921 2675 2556 1511 1108 907 779 --
NM_001025081chr1831157 475 454 --21033 245 --
NM_001025090chr1831157 475 454 --21033 245 --
NM_001025092chr1831157 475 454 --21033 245 --
NM_001025101chr1831157 475 454 --21033 245 --
NM_001025105chr521412 983 --31380 1022 58 --
NM_001025107chr1102711 2535 2490 2048 1753 857 631 479 336 71 12126 3706 302 101 --
NM_001025107chr1102711 2535 2490 2048 1753 857 631 479 336 71 12126 3706 302 101 --
NM_001025108chr2113288 3181 2824 2683 1269 1221 1191 1034 877 629 119 12646 1881 1633
NM_001025201chr23744 525 515 ------
NM_001025232chr12167 1144 ----
NM_001025233chr1252757 2087 1848 422 68 --1624 --
NM_001025252chr853120 1217 370 212 124 --12271 --
NM_001025253chr853120 1217 370 212 124 --12271 --
NM_001025266chr3104886 4397 4309 3819 3358 1899 1686 920 501 358 44326 4028 3748 374 1488 11393
NM_001025366chr621518 603 ------
NM_001025366chr621518 603 ------
NM_001025367chr621518 603 ------
NM_001025367chr621518 603 ------
NM_001025368chr621518 603 ------
NM_001025368chr621518 603 ------
NM_001025369chr621534 619 ------
NM_001025369chr621534 619 ------
NM_001025370chr621518 603 ------
NM_001025370chr621518 603 ------
NM_001025389chr1151630 616 547 269 209 --31079 492 93 1359
NM_001025390chr1151630 616 547 269 209 --31079 492 93 1359
NM_001025579chr1751127 763 477 288 22 3867 827 124 ----
NM_001025580chrX114117 4027 3741 3631 1387 989 464 397 319 259 47 13606 104121 4035 3028 381 378 374 362 359 355 332 --
NM_001025595chr441385 1117 1110 222 --11558 11598
NM_001025596chr112470 206 ------
NM_001025603chr131015 458 114 21319 945 11356 --
NM_001025777chr231107 1033 254 21380 519 1379 --
NM_001025780chr931376 1019 33 ------
NM_001029858chr692948 2908 2223 2153 1298 941 891 841 506 1133 1539 --
NM_001029859chr1152413 1663 874 462 174 --22270 313 --
NM_001029860chr82316 85 ------
NM_001029863chr642628 2173 1195 615 --11158 --
NM_001029869chr5243 21 ------
NM_001029875chr572615 2594 2457 2134 1115 527 117 1553 11169 11119
NM_001029882chr12595 93 1184 ----
NM_001029882chr12595 93 1184 ----
NM_001029976chr8153 --142 --
NM_001029998chr471461 1350 1338 1005 576 524 459 ----1551
NM_001030001chr14------1328
NM_001030006chr1742416 878 776 619 1263 12625 --
NM_001030007chr16103719 2951 2835 2541 1285 774 443 410 232 183 3761 258 189 53630 2983 2470 1112 235 --
NM_001030055chr1441178 986 146 124 ----24730 4033
NM_001030272chr11----1420 --
NM_001030273chr11----1420 --
NM_001030287chr12868 88 1384 ----
NM_001031628chr123520 414 77 ------
NM_001031677chr52406 389 --2484 345 --
NM_001031679chr1293359 2851 2725 1244 557 523 359 235 131 12607 --23481 2760
NM_001031690chr7132739 2570 2116 2100 2061 1169 1136 1127 982 961 449 356 132 52865 2830 2732 2071 377 52777 2246 2041 1226 1223 2835 416
NM_001031694chr17905 694 617 265 223 171 52 ------
NM_001031694chr17905 694 617 265 223 171 52 ------
NM_001031695chr22155328 5093 4926 4712 4464 4379 4128 3917 3905 3592 1511 824 621 479 190 21296 1221 2813 599 24986 3936
NM_001031700chr482310 2108 1848 1830 1705 894 634 226 --11708 --
NM_001031702chr3--2772 246 188 --
NM_001031710chr71163 --11021 --
NM_001031723chr41461 ------
NM_001031732chr453640 3504 1178 544 331 --22892 2439 42785 2770 2263 274
NM_001031738chr23455 435 117 ------
NM_001031740chr121287 518 1183 --11095
NM_001031804chr16154212 3660 3643 3520 3263 2857 1226 1032 1021 647 634 595 579 438 385 1294 32761 1147 445 --
NM_001031812chr561878 943 474 415 309 180 ------
NM_001032221chr951656 1530 1350 303 80 31206 738 673 ----
NM_001032279chr112373 294 ------
NM_001032280chr641686 1194 1110 635 --21177 604 --
NM_001032282chr841182 1090 365 241 ------
NM_001032293chr173494 118 46 ------
NM_001032296chr1372725 2015 1871 753 214 53 34 --32804 839 43 --
NM_001032363chr1111919 1788 1592 1534 906 856 364 254 178 92 53 --31876 1557 480 --
NM_001032363chr1111919 1788 1592 1534 906 856 364 254 178 92 53 --31876 1557 480 --
NM_001032380chr1041480 1231 224 128 ----1132
NM_001032393chrX2776 717 --1168 --
NM_001032394chr632636 1022 539 ----1309
NM_001032395chr632503 889 406 ----1176
NM_001032999chr20145385 4857 4749 4514 4453 4116 3411 1887 1729 1468 1092 800 711 444 23335 235 41332 1258 1164 258 --
NM_001033025chr12506 358 2531 57 31258 1243 1222 11524
NM_001033045chr284158 3988 3853 3833 3491 2736 1158 700 ------
NM_001033047chr452457 2274 2059 71 44 22133 299 --12249
NM_001033049chr2141946 1631 777 326 2730 57 52303 1517 934 930 559 --
NM_001033057chr342040 1839 364 331 ----11787
NM_001033059chr6--11503 32003 1551 649 2550 338
NM_001033081chr141939 721 698 197 --1613 --
NM_001033082chr141939 721 698 197 --1613 --
NM_001033087chr2082893 2082 895 705 675 551 269 201 --1678 32696 2263 138
NM_001033088chr151394 --1341 --
NM_001033117chr3144925 4852 4803 4685 4523 4302 3926 3884 3657 3571 3549 1480 1460 291 --84700 4696 4555 4043 4040 3497 1613 318 --
NM_001033506chr11----123 --
NM_001033507chr121505 1488 --11491 --
NM_001033551chr1774056 3363 3134 2754 1105 1088 184 --1256 1330
NM_001033557chr221295 1157 ------
NM_001033561chr174828 802 720 178 --1808 1299
NM_001033578chr842387 2167 2070 146 --1954 --
NM_001033659chr1721442 1112 --21502 1457 --
NM_001033723chr852480 2180 1792 765 742 1484 21993 948 21973 247
NM_001033756chr621452 537 ------
NM_001033756chr621452 537 ------
NM_001033925chr1021341 543 --11748 --
NM_001033952chr113244 110 41 --173 --
NM_001034025chr12163 --1882 --
NM_001034850chr541305 1055 427 317 ------
NM_001034852chr1442043 1844 1406 408 ------
NM_001034954chr1043194 2972 2016 427 ------
NM_001034955chr1043194 2972 2016 427 ------
NM_001034956chr1043194 2972 2016 427 ------
NM_001034957chr1043194 2972 2016 427 ------
NM_001035chr12291 64 --1160 --
NM_001035005chr183648 206 62 ------
NM_001035254chr9102393 1989 959 828 746 661 589 557 226 39 21947 121 12508 1832
NM_001035260chr102455 212 ----11511
NM_001035267chr122282 200 ------
NM_001035511chr162034 1756 791 747 596 215 21887 1767 52137 2126 1875 714 219 11449
NM_001035512chr182141 1863 898 854 703 322 95 28 21994 1874 52244 2233 1982 821 326 11556
NM_001035513chr182141 1863 898 854 703 322 95 28 21994 1874 52244 2233 1982 821 326 11556
NM_001035521chr22736 666 ------
NM_001037132chr731477 230 32 1651 32139 2034 282 --
NM_001037133chr731477 230 32 1651 32139 2034 282 --
NM_001037164chr72201 40 --11785 --
NM_001037165chr7118365 7086 6597 6524 6074 5779 5542 1784 1520 271 244 11349 88926 7529 6559 5535 2454 1821 1042 250 --
NM_001037317chr152740 2689 2204 711 305 --11718 --
NM_001037331chr183359 304 199 ------
NM_001037332chr552170 1937 1791 520 346 --32253 1836 258 3778 301 196
NM_001037333chr552170 1937 1791 520 346 --32253 1836 258 3778 301 196
NM_001037339chr131804 1460 540 1564 2630 543 --
NM_001037340chr131804 1460 540 1564 2630 543 --
NM_001037341chr131804 1460 540 1564 2630 543 --
NM_001037341chr131804 1460 540 1564 2630 543 --
NM_001037494chr122257 241 ------
NM_001037495chr122257 241 ------
NM_001037533chr12258 221 ------
NM_001037535chrX51436 1077 537 521 404 ------
NM_001037536chrX51436 1077 537 521 404 ------
NM_001037540chrX51436 1077 537 521 404 ------
NM_001037553chr21125156 4880 4772 4763 4447 3570 1906 1894 1265 562 433 309 1735 ----
NM_001037582chr431705 614 309 ------
NM_001037738chr51197 ------
NM_001037872chr2------1532
NM_001037954chr1183396 3270 2639 1185 756 718 225 154 1127 ----
NM_001038707chr152212 1711 1540 648 451 11434 ----
NM_001038707chr152212 1711 1540 648 451 11434 ----
NM_001039029chr1241857 783 362 116 --11860 --
NM_001039199chr20134878 4517 4203 4008 3848 3823 3813 3334 3202 3048 1856 1788 1655 --63160 3154 3151 1175 846 39 --
NM_001039348chr231096 906 234 --1728 --
NM_001039349chr231096 906 234 --1728 --
NM_001039350chr761383 1283 691 239 171 79 ----1697
NM_001039395chr972340 2310 698 651 635 610 439 2929 413 --2955 711
NM_001039459chr751139 882 744 458 200 --1326 --
NM_001039479chr1421835 445 11634 ----
NM_001039538chr283614 3573 3215 2714 2282 1297 818 794 23065 2795 --13316
NM_001039550chr22752 180 --187 --
NM_001039570chr22104115 3473 1838 1306 1100 691 137 101 93 77 21826 604 54093 3530 1310 432 192 --
NM_001039571chr22104115 3473 1838 1306 1100 691 137 101 93 77 21826 604 54093 3530 1310 432 192 --
NM_001039577chr164390 3983 3958 1500 281 175 31355 1341 779 12874 11759
NM_001039585chr183964 3742 1610 1230 1025 965 202 96 13823 ----
NM_001039590chrX32941 2878 830 --23206 1031 --
NM_001039591chrX32941 2878 830 --23206 1031 --
NM_001039618chr1135014 3901 306 11262 22225 233 24753 4155
NM_001039690chr1662166 1897 1714 874 589 152 22048 912 ----
NM_001039697chr951756 1405 1225 1139 635 21219 461 1305 --
NM_001039709chr20145385 4857 4749 4514 4453 4116 3411 1887 1729 1468 1092 800 711 444 23335 235 41332 1258 1164 258 --
NM_001039762chr1052250 1744 1677 933 642 --11559 --
NM_001039771chr145976 883 804 315 49 --3953 887 435 11021
NM_001039802chr131365 1039 431 ------
NM_001039840chrX105533 4264 3726 2375 2309 1525 1287 1276 887 125 --55923 4589 2342 1676 959 --
NM_001039888chr11791 ----1664
NM_001039916chr122471 172 11040 189 2140 60
NM_001039917chr122471 172 11040 189 2140 60
NM_001039918chr122471 172 11040 189 2140 60
NM_001039919chr122471 172 11040 189 2140 60
NM_001039920chr122471 172 11040 189 2140 60
NM_001039937chr13144164 3679 3296 2999 2929 2911 2859 2709 2683 2546 860 841 168 40 11143 13194 23056 247
NM_001039960chr1291749 1481 1254 1124 445 398 321 268 248 21550 382 21317 260 --
NM_001040002chr1761065 363 342 328 204 82 11017 2483 85 11069
NM_001040057chr7--1207 ----
NM_001040058chr4293 23 ------
NM_001040060chr4293 23 ------
NM_001040100chr3182 --11056 2961 86
NM_001040101chr421342 1173 --1440 1380
NM_001040108chr1482539 2411 2242 2019 1254 1205 530 477 --43318 3307 3303 2110 --
NM_001040110chr751752 1464 1454 1364 1270 11532 ----
NM_001040135chr73784 240 204 155 ----
NM_001040142chr21521 --12014 --
NM_001040143chr21521 --12014 --
NM_001040144chr1662166 1897 1714 874 589 152 22048 912 ----
NM_001040146chr1662166 1897 1714 874 589 152 22048 912 ----
NM_001040147chr183706 266 98 --2243 114 --
NM_001040151chr1193830 3769 3270 3230 3143 2931 2893 1454 854 52990 1737 1488 559 395 94390 4262 3996 3681 3663 3121 824 821 312 13631
NM_001040152chr785094 5056 5022 3797 1793 1705 1270 94 43428 1167 772 458 1342 23301 191
NM_001040157chr42565 247 --1879 12891
NM_001040159chr41201 1302 179 --
NM_001040172chr55652 630 587 521 238 11352 2558 153 --
NM_001040173chr55652 630 587 521 238 11352 2558 153 --
NM_001040181chr32963 804 --1734 --
NM_001040182chr32963 804 --1734 --
NM_001040183chr32963 804 --1734 --
NM_001040199chr32963 804 --1734 --
NM_001040200chr32963 804 --1734 --
NM_001040202chr452052 1827 553 320 103 --11669 --
NM_001040214chr652217 1745 620 346 207 --1277 --
NM_001040260chr461028 896 744 432 391 126 ------
NM_001040261chr461028 896 744 432 391 126 ------
NM_001040272chr961660 1451 549 456 177 81 22154 138 22342 286 --
NM_001040284chr16125846 5273 5137 4125 3923 3693 1311 1093 933 691 603 304 15023 45588 5176 965 746 --
NM_001040402chr452797 2571 1017 803 792 ------
NM_001040424chr212932 725 11901 32087 1034 472 --
NM_001040429chr1331443 1203 376 ------
NM_001040441chr173349 1936 1622 1266 1161 269 249 --24139 1597 --
NM_001040446chr582033 1853 945 812 684 604 356 347 --32093 833 687 --
NM_001040450chr1522284 1887 --1379 --
NM_001040453chr1522284 1887 --1379 --
NM_001040455chr1131303 371 254 --21240 416 --
NM_001040458chr52477 270 1696 1608 --
NM_001040619chr171318 1183 1138 1029 538 128 69 --1131 --
NM_001040624chr882450 2322 2173 2079 1878 1860 536 55 --32339 2067 136 21915 1864
NM_001040625chr882450 2322 2173 2079 1878 1860 536 55 --32339 2067 136 21915 1864
NM_001040626chr882450 2322 2173 2079 1878 1860 536 55 --32339 2067 136 21915 1864
NM_001040627chr882450 2322 2173 2079 1878 1860 536 55 --32339 2067 136 21915 1864
NM_001040628chr882450 2322 2173 2079 1878 1860 536 55 --32339 2067 136 21915 1864
NM_001040629chr882450 2322 2173 2079 1878 1860 536 55 --32339 2067 136 21915 1864
NM_001040630chr882450 2322 2173 2079 1878 1860 536 55 --32339 2067 136 21915 1864
NM_001040633chr71697 ----1128
NM_001040647chr741783 782 552 484 1529 --1270
NM_001040648chr741783 782 552 484 1529 --1270
NM_001040665chr7125034 4365 4321 3990 3512 1680 1609 1477 1460 1453 510 151 13091 21727 1199 14166
NM_001040694chr112140 91 ----1349
NM_001040697chr111513 ------
NM_001040708chr821027 971 --1378 --
NM_001040709chr192132 1885 972 829 817 751 734 187 73 22155 87 31633 820 80 22458 2350
NM_001040712chr923255 91 ----1989
NM_001042353chr203583 473 223 --3408 378 371 --
NM_001042370chr1------1231
NM_001042383chr3113353 2787 2501 2446 2389 1378 1132 1106 567 242 168 22774 1288 52895 2492 1362 1311 1273 1198
NM_001042388chr185762 311 273 265 228 --2353 109 --
NM_001042404chr131934 1588 405 ------
NM_001042413chr971585 1444 1136 1090 566 528 198 13826 ----
NM_001042424chr463092 2580 2413 558 480 345 22835 2528 52744 2289 650 635 270 --
NM_001042425chr641686 1194 1110 635 --21177 604 --
NM_001042437chr24878 708 679 153 ----177
NM_001042472chr202489 43 --1558 155
NM_001042473chr1031906 1677 766 1322 --11410
NM_001042476chr1661996 1826 1785 1749 652 366 1441 22194 369 2324 85
NM_001042481chr1452178 2066 995 658 96 3672 635 242 1494 --
NM_001042486chr2041389 1215 461 77 --21528 249 --
NM_001042492chr1773443 3319 2933 2140 1121 391 206 12749 23458 1124 1768
NM_001042494chr15123639 3630 3448 3331 2699 2612 1274 1001 898 752 659 583 154 13417 --
NM_001042495chr15123639 3630 3448 3331 2699 2612 1274 1001 898 752 659 583 154 13417 --
NM_001042496chr15123639 3630 3448 3331 2699 2612 1274 1001 898 752 659 583 154 13417 --
NM_001042497chr15123639 3630 3448 3331 2699 2612 1274 1001 898 752 659 583 154 13417 --
NM_001042498chrX2341 101 --1126 --
NM_001042506chrX31460 286 191 --2205 176 --
NM_001042510chr831406 451 431 ------
NM_001042511chr831406 451 431 ------
NM_001042533chr342647 2616 1052 95 ------
NM_001042537chrX72326 832 496 434 408 302 181 12033 12027 1680
NM_001042539chr1641069 986 365 240 1945 1356 --
NM_001042550chr941637 1424 166 123 ------
NM_001042555chr12104343 3970 3553 3378 3034 1566 1325 1279 1211 535 11091 34167 1844 780 --
NM_001042573chr1782053 1921 1613 1535 1503 721 536 50 ------
NM_001042599chr2187709 7611 7586 7573 7024 6735 5764 5561 5511 5471 5441 1587 743 677 223 216 79 67 27593 2197 95977 5366 3036 2809 2444 1911 352 349 82 1896
NM_001042601chr373034 2999 2896 2323 820 356 343 --32333 504 36 13298
NM_001042603chr1274775 4698 1948 1737 1569 1542 1201 31395 1372 421 53910 1785 1338 461 146 --
NM_001042604chr394566 4318 4267 3753 3508 1720 1148 466 31 13835 13464 --
NM_001042610chr1661401 1381 1320 1283 1198 578 --11384 --
NM_001042632chr2072312 2239 1902 1672 1616 251 119 21807 1715 11927 --
NM_001042633chr2072312 2239 1902 1672 1616 251 119 21807 1715 11927 --
NM_001042681chr182428 2194 2156 2042 1871 1787 313 305 2924 877 52399 2387 2249 1981 989 22283 570
NM_001042682chr182428 2194 2156 2042 1871 1787 313 305 2924 877 52399 2387 2249 1981 989 22283 570
NM_001042682chr182428 2194 2156 2042 1871 1787 313 305 2924 877 52399 2387 2249 1981 989 22283 570
NM_001042683chr641729 1368 1152 581 ------
NM_001042728chr121673 --2936 341 2940 886
NM_001042749chrX31918 1717 100 11816 1757 --
NM_001042750chrX31918 1717 100 11816 1757 --
NM_001042751chrX31918 1717 100 11816 1757 --
NM_001043318chr14144137 3883 3771 3711 3535 3253 2711 1596 1537 1486 1264 1139 1064 816 13393 23166 885 --
NM_001043351chr151500 376 176 139 33 --1120 11856
NM_001044305chr621531 46 21283 1084 1284 --
NM_001044385chr273706 3065 2741 2488 1331 1204 265 1838 1780 --
NM_001044387chr19114163 3850 3486 2945 2728 2582 1539 1184 717 392 199 14203 ----
NM_001044388chr19114163 3850 3486 2945 2728 2582 1539 1184 717 392 199 14203 ----
NM_001044722chr561878 943 474 415 309 180 ------
NM_001044723chr561878 943 474 415 309 180 ------
NM_001046chr542809 370 254 218 1431 --1467
NM_001048183chr173771 3041 2891 2697 626 570 110 --31132 618 49 12786
NM_001069chr6--1139 ----
NM_001074chr4----194 --
NM_001077628chr13484 211 173 ----165
NM_001078chr13602 230 71 ------
NM_001079874chr141890 434 317 124 --1269 --
NM_001083620chr422053 1792 --21858 957 --
NM_001095chr1271840 1685 1520 1282 1271 707 161 1265 31722 1494 121 --
NM_001096chr172304 47 ------
NM_001100108chr1218320 7853 7766 7492 6775 6719 5851 5270 5175 2969 2751 2196 2152 1670 1571 1205 1151 1085 834 805 706 27474 6653 57874 6442 1425 1421 1221 --
NM_001106chr3199586 9044 8359 8164 7715 7476 7399 7298 7164 6609 5965 2960 2803 1988 1839 953 497 462 340 --118437 8211 7571 6274 3643 3382 2663 2204 1722 1015 480 11197
NM_001111chr1102711 2535 2490 2048 1753 857 631 479 336 71 12126 3706 302 101 --
NM_001113490chrX43469 2952 2477 911 13375 1771 1573
NM_001116chr1682600 2343 2192 2128 2032 1962 1936 1141 --32163 2143 181 1466
NM_001117chr1872071 2004 1849 1843 740 703 651 ------
NM_001119chr421359 205 --11261 11499
NM_001121chr103630 565 352 1299 ----
NM_001122679chr5262 24 ------
NM_001124chr113561 191 173 ------
NM_001126chr11328 --1934 --
NM_001127chr225875 852 842 750 73 --176 --
NM_001128chr16103719 2951 2835 2541 1285 774 443 410 232 183 3761 258 189 53630 2983 2470 1112 235 --
NM_001130chr191205 --1179 --
NM_001135chr154758 664 261 82 ------
NM_001140chr176464 247 238 222 194 98 --6241 229 225 209 205 201 --
NM_001144chr1631050 194 165 ------
NM_001146chr862319 1939 1917 1674 897 522 ----11759
NM_001147chr81389 195 ----
NM_001148chr441498 528 329 128 21660 371 --11512
NM_001159chr2140 ----1234
NM_001163chr941002 326 58 41 ------
NM_001167chrX54560 2491 2235 1787 769 11174 34662 2537 2534 11442
NM_001172chr14----1614 1298
NM_001173chr1441178 986 146 124 ----24730 4033
NM_001174chrX42009 430 269 53 --21579 378 --
NM_001175chr123435 119 76 ------
NM_001178chr11----1420 --
NM_001183chrX193 --1597 --
NM_001186chr2162159 643 559 280 135 107 22759 1142 43217 440 156 38 12528
NM_001187chr212476 228 ------
NM_001191chr2041213 944 379 59 --1480 --
NM_001198chr632241 827 433 1362 22176 1902 12306
NM_001200chr203866 795 224 1980 --11114
NM_001204chr2177383 6715 5370 5344 5221 5197 4802 2973 2439 2063 1747 1350 1323 681 556 490 93 11491 22202 1183 31762 799 578
NM_001205chr51413 ------
NM_001206chr942783 2088 1932 1190 --2306 149 12059
NM_001219chr751391 632 350 273 25 11743 3904 898 148 --
NM_001233chr742222 1726 934 566 ------
NM_001235chr111603 --1589 --
NM_001237chr42810 291 ----1358
NM_001237chr42810 291 ----1358
NM_001238chr19------1119
NM_001241chr231619 239 126 --1169 --
NM_001241chr231619 239 126 --1169 --
NM_001256chr1732332 2110 442 ------
NM_001257chr161186 1563 2441 189 --
NM_001259chr7135947 5915 5856 4769 4696 4473 2205 1619 1606 1600 1311 1060 915 1145 35989 1937 921 24825 1508
NM_001261chr931121 439 42 11191 ----
NM_001262chr12252 232 ------
NM_001263chr42431 126 --1443 --
NM_001270chr52857 807 ------
NM_001271chr1572999 2990 2793 2457 2294 1236 764 12146 11107 --
NM_001273chr124586 70 54 46 1115 2382 102 --
NM_001274chr11--1144 163 --
NM_001278chr102961 87 ------
NM_001280chr19128 ------
NM_001282chr1742416 878 776 619 1263 12625 --
NM_001283chr73683 109 63 --1466 --
NM_001284chr52456 375 --1384 --
NM_001288chr6------140
NM_001290chr42318 150 ----11001
NM_001293chr11198 164 ----
NM_001300chr102447 349 ------
NM_001304chr1752370 2339 466 176 99 22940 2733 52493 2490 2350 1200 56 --
NM_001310chr1242997 2745 2056 701 --42337 2099 1061 535 --
NM_001313chr44878 701 340 190 1625 ----
NM_001315chr652178 1778 1543 811 386 --1785 1108
NM_001316chr202364 91 ------
NM_001319chr1941068 436 231 33 ----1187
NM_001328chr43240 209 200 ------
NM_001331chr11132451 2333 2212 2164 2066 1959 1899 1869 1145 1101 500 83 76 --52186 1747 940 227 171 --
NM_001332chr541266 1159 1139 571 --2452 81 --
NM_001343chr541687 696 540 138 --31210 643 618 --
NM_001351chr331864 1447 160 1380 11370 1441
NM_001356chrX--1121 1755 --
NM_001364chr11134368 4173 3706 3340 3280 3246 3231 3124 3114 3102 1919 1786 895 13373 73709 3312 3298 3220 3188 3171 919 24487 1091
NM_001365chr173499 163 123 ------
NM_001383chr171273 1559 186 --
NM_001386chr872411 2013 1916 1577 779 349 315 --3873 76 73 1843
NM_001387chr562899 2784 2276 2209 791 736 12123 32924 893 794 2675 142
NM_001390chr1863642 2672 2557 1453 314 28 22864 985 11000 --
NM_001391chr1821017 37 ------
NM_001392chr18------167
NM_001394chr82572 112 --1126 --
NM_001395chrX----1993 --
NM_001396chr2142711 1132 1037 229 1495 ----
NM_001397chr162258 2046 1826 1038 503 113 11846 --11795
NM_001400chr1------1384
NM_001406chr17121670 1647 1476 1243 451 435 416 385 275 247 162 126 154 31517 533 439 --
NM_001407chr341210 564 555 382 21660 1385 1422 --
NM_001408chr151496 1484 1442 1299 1072 --31385 1101 1095 --
NM_001412chrX63704 3651 3220 3195 3047 1190 12597 12955 --
NM_001417chr1261744 1467 1355 567 523 34 --21215 25 11962
NM_001418chr11----1142 --
NM_001418chr11----1142 --
NM_001419chr19104582 3941 3613 3351 3146 3099 921 485 433 222 --21865 834 14010
NM_001420chr1942526 2510 2146 221 ------
NM_001421chrX31680 1436 610 11289 ----
NM_001422chr1141168 1098 208 89 ----1131
NM_001423chr1241990 1660 1593 766 --11566 --
NM_001426chr24592 569 533 496 ------
NM_001427chr74787 775 768 720 11403 7829 810 806 759 752 745 736 --
NM_001429chr224887 416 110 42 --3907 904 235 --
NM_001431chr621136 166 --2808 445 --
NM_001438chr1142466 1034 831 483 471 458 443 428 380 373 307 257 235 229 2853 31 8527 524 494 365 320 249 219 212 2196 162
NM_001439chr12506 358 2531 57 31258 1243 1222 11524
NM_001448chrX41545 1442 311 158 --1502 --
NM_001449chrX51081 490 275 117 99 --2512 132 --
NM_001451chr1641006 351 187 78 1199 11236 --
NM_001453chr651258 652 611 359 327 11276 1384 --
NM_001455chr6124878 4837 4716 4614 4374 3925 3286 1731 602 468 401 237 23655 1461 24252 3299 --
NM_001461chr15619 596 391 214 142 ------
NM_001463chr23814 704 149 ------
NM_001478chr1210945 935 863 855 818 795 342 242 130 122 ------
NM_001482chr152718 69 --1375 --
NM_001483chr741096 1065 263 211 ------
NM_001493chrX7689 246 228 185 169 68 47 --1209 --
NM_001494chr101674 ------
NM_001495chr8101045 982 936 929 913 906 800 299 154 143 --1286 --
NM_001497chr962422 2381 1963 983 642 484 ------
NM_001498chr661109 983 455 443 428 411 ----1926
NM_001518chr72844 357 ------
NM_001521chr22736 666 ------
NM_001523chr191114 --1249 --
NM_001527chr6114803 4745 4426 4134 3438 3299 3004 1835 1365 1185 1147 ----1203
NM_001530chr1431099 211 23 ------
NM_001533chr19399 52 45 ------
NM_001542chr142735 402 384 56 21813 462 22191 1938 --
NM_001543chr584237 4216 3699 3576 3288 3263 1920 679 31809 470 398 44720 4219 1875 705 14829
NM_001546chr621480 485 11304 11245 11250
NM_001552chr1741097 990 943 789 --1419 1329
NM_001555chrX2254 102 --130 --
NM_001560chrX52296 2125 1760 1048 624 158 2872 49 --
NM_001584chr111229 --11022 --
NM_001587chrX2353 236 22004 273 11446 --
NM_001604chr112997 687 ------
NM_001609chr1053687 2784 1110 385 165 12919 44111 3671 3596 3397 --
NM_001616chr253137 2977 2536 1371 358 --1832 --
NM_001617chr261111 835 267 57 44 35 --21232 423 --
NM_001621chr742970 1173 892 718 12537 1526 --
NM_001621chr742970 1173 892 718 12537 1526 --
NM_001634chr6--11503 32003 1551 649 2550 338
NM_001643chr1--123 ----
NM_001650chr1832874 2696 680 11359 5616 613 555 350 58 --
NM_001654chrX3424 416 159 ------
NM_001655chr1141603 1580 1528 727 1302 21532 1478 --
NM_001656chr531859 1792 784 --1615 --
NM_001659chr12132507 2264 2231 2209 2096 2080 2045 887 734 719 673 402 342 --32627 913 81 --
NM_001660chr34804 645 220 200 ------
NM_001661chr173533 291 209 --2627 25 --
NM_001662chr71284 1256 2106 94 --
NM_001663chr146552 416 399 191 163 94 11759 1868 --
NM_001664chr31223 --1922 --
NM_001665chr112486 135 1433 1152 --
NM_001668chr152123 1970 1919 1526 259 1684 2595 93 11792
NM_001670chr22------1633
NM_001674chr12868 88 1384 ----
NM_001677chr13832 824 724 ------
NM_001678chr17111707 1634 1627 1402 1360 1325 585 559 449 204 140 31609 1219 739 31729 1412 496 --
NM_001679chr32276 168 ------
NM_001682chr1262502 2363 1849 1822 1125 503 22514 534 12586 --
NM_001683chr352290 2058 1860 353 165 21931 1912 ----
NM_001684chr1193806 3542 3452 3398 3382 3256 3163 3142 2786 1553 1301 1042 908 766 661 584 577 319 293 --53699 3545 3260 2697 332 11411
NM_001690chr392102 1936 726 315 212 180 73 37 31 --22500 1696 --
NM_001693chr831191 1180 61 ------
NM_001695chr874085 3712 3115 2981 1014 281 132 14130 24219 3583 --
NM_001701chr931472 1294 1281 ----11510
NM_001702chr82568 552 ------
NM_001704chr63554 530 450 ------
NM_001707chr71168 ------
NM_001709chr1142352 882 337 228 ------
NM_001714chr124467 363 199 87 ------
NM_001717chr1521478 609 --1444 --
NM_001731chr124918 748 340 70 --1275 --
NM_001735chr9175 ------
NM_001740chr163498 468 430 125 ----
NM_001741chr113244 110 41 --173 --
NM_001742chr721172 84 178 ----
NM_001743chr2----2150 89 1139
NM_001744chr52377 359 157 ----
NM_001746chr5102959 2480 2302 1923 1018 932 895 883 43 33 11885 31835 913 543 32891 2198 859
NM_001748chr1----11006 1942
NM_001753chr761518 1325 682 228 140 42 11511 11408 --
NM_001754chr2164269 2861 2828 2822 2798 2764 12839 74249 3992 3476 2981 2942 2854 1111 23000 2832
NM_001755chr164767 523 418 165 1910 --32106 1943 349
NM_001759chr12154939 4509 4116 3572 3417 1965 1887 1852 1262 1185 1035 886 709 605 54 --44288 1952 1417 1414 33761 3524 714
NM_001761chr1611762 --2726 514 1731
NM_001768chr271293 1145 1059 330 88 65 43 --21187 91 1453
NM_001773chr161322 1211 1179 1167 84 58 --41230 1185 1099 62 --
NM_001777chr3123727 3538 3500 3489 3142 2712 2656 2542 939 737 699 659 23097 2531 72921 2675 2556 1511 1108 907 779 --
NM_001781chr121624 191 --1141
NM_001783chr193345 106 81 1155 1384 --
NM_001789chr321179 213 --11595 --
NM_001790chr52310 265 --1367 --
NM_001791chr131365 1039 431 ------
NM_001798chr121729 144 1787 --
NM_001800chr193186 173 74 --187 --
NM_001806chr1962926 2528 1114 983 928 439 ------
NM_001810chr205694 662 566 216 206 --1223 --
NM_001821chr174884 3124 3034 1398 1385 1301 57 139 21716 1195 11283
NM_001822chr23744 525 515 ------
NM_001829chr41620 --2872 99 --
NM_001830chrX93506 3357 2694 1583 1366 1345 741 670 338 --43205 3157 2911 980 --
NM_001839chr17729 704 661 166 152 145 88 ------
NM_001843chr12----175 --
NM_001854chr111107 ------
NM_001859chr963466 3384 854 348 231 97 13540 33005 3002 267 --
NM_001862chr2179 ------
NM_001874chr12104919 4559 4421 4274 3498 1964 1702 1230 1159 118 33474 2032 1000 11237 --
NM_001892chr521412 983 --31380 1022 58 --
NM_001895chr201296 21205 427 31004 362 276 1384
NM_001896chr16134 ------
NM_001904chr32872 306 ------
NM_001907chr16177 1360 ----
NM_001913chr71632 ------
NM_001914chr181360 --1266 --
NM_001915chr1791789 1712 1689 1510 1403 704 678 175 167 11571 3813 603 182 --
NM_001916chr81183 1152 ----
NM_001918chr1189280 9245 8273 7014 6587 5967 5951 5825 5738 5672 5612 3716 3666 2983 2762 1438 1084 193 47696 5663 2040 1146 39039 5615 3480 --
NM_001920chr121646 ------
NM_001921chr42869 146 ------
NM_001923chr114611 484 472 67 --1199 --
NM_001933chr1471151 1013 540 521 461 228 57 1906 21016 984 1284
NM_001935chr21923 --11002 --
NM_001936chr761383 1283 691 239 171 79 ----1697
NM_001938chr131923 267 28 --1361 --
NM_001945chr541137 1119 1000 110 ------
NM_001946chr1261000 953 786 773 356 53 11104 ----
NM_001949chr651270 521 428 399 307 --43045 318 311 95 22305 99
NM_001951chr81407 --1128 --
NM_001954chr62268 176 1281 4525 522 219 216 --
NM_001955chr651121 979 892 291 101 ------
NM_001963chr42778 559 ------
NM_001964chr531196 246 131 1923 196 --
NM_001965chr23434 135 90 ----182
NM_001967chr31192 ------
NM_001969chr1451311 1085 666 524 307 ----21105 51
NM_001973chr11365 --1271 --
NM_001975chr124687 244 238 44 --2791 226 2795 755
NM_001977chr421696 617 --3216 162 46 --
NM_001980chr1252167 1980 1938 697 467 ----11916
NM_001981chr152204 1470 410 156 39 --31738 1735 43 1507
NM_001982chr1271115 986 268 259 229 199 70 --1317 --
NM_001987chr12134274 4105 3919 3310 2953 1698 1635 1475 1314 1114 649 610 276 11502 54154 3493 629 502 245 11604
NM_001994chr1151 ------
NM_001995chr44329 286 139 51 21167 582 ----
NM_001999chr521248 541 --21335 119 --
NM_002006chr4185496 5447 5240 5188 4875 4845 4678 4632 3906 3718 2211 1434 1228 1184 476 445 318 197 --25436 663 21506 526
NM_002009chr1541961 1806 86 68 --22294 869 --
NM_002010chr131188 ------
NM_002015chr1332593 2323 149 12837 22326 2192 12106
NM_002017chr11----11410 1174
NM_002024chrX41785 1434 880 697 --11788 --
NM_002025chrX199255 8434 8039 7775 7449 6989 6813 6784 6169 6067 5691 3055 2211 1381 1157 1135 1098 1077 238 38332 7549 1413 68440 8046 7560 7441 6586 1050 --
NM_002026chr22192 92 2158 131 21021 1013 11037
NM_002033chr1193836 3020 2627 1465 1237 905 813 514 103 160 33302 1624 265 --
NM_002035chr1883715 3120 1455 1409 1071 921 774 432 ----1855
NM_002040chr21102364 2224 2171 2090 1268 1213 1059 906 850 447 --22747 2145 12270
NM_002044chr1541136 420 408 83 --2424 86 1596
NM_002048chr93443 224 196 ------
NM_002051chr101446 --1823 --
NM_002054chr2----1410 --
NM_002056chr22813 579 ------
NM_002060chr11485 --1199 --
NM_002061chr131580 266 205 ----137
NM_002062chr641589 1517 1155 468 --1211 --
NM_002069chr721652 1613 ----11196
NM_002072chr91937 --3788 371 224 --
NM_002074chr141614 1357 506 489 21518 1495 1230 1148
NM_002076chr1283176 2843 2705 1183 1096 876 223 160 --21116 306 --
NM_002077chr972065 1690 1561 1549 1377 867 762 31795 1533 294 31918 844 511 11938
NM_002080chr1661012 835 775 347 249 150 ----2799 240
NM_002082chr54360 186 104 44 ------
NM_002086chr1772291 2066 2044 1884 437 281 244 ----21837 500
NM_002091chr18193 1209 ----
NM_002092chr434968 4919 3753 --24806 3931 --
NM_002103chr193815 752 204 1993 ----
NM_002107chr1155 --162 --
NM_002111chr4103512 3220 3046 2447 1469 1019 878 550 534 347 23326 905 43265 3140 2429 283 --
NM_002114chr62456 71 ------
NM_002126chr1744184 3197 645 212 33805 379 330 33590 3393 550 --
NM_002131chr631242 1006 916 2388 137 2950 44 --
NM_002135chr122413 402 ------
NM_002137chr771893 1874 1725 962 731 439 380 --1318 --
NM_002138chr41585 ------
NM_002139chrX1579 1448 ----
NM_002140chr931078 960 205 --1132 --
NM_002141chr7370 57 46 ------
NM_002145chr171151 --1297 --
NM_002146chr1741407 1388 438 142 1181 ----
NM_002147chr173725 154 68 --1227 --
NM_002158chr253616 3609 2914 2418 309 12382 ----
NM_002160chr91173 ------
NM_002181chr21120 --2752 496 --
NM_002188chr53695 217 128 ------
NM_002198chr5----1293 130
NM_002199chr43884 666 76 ------
NM_002202chr51814 ------
NM_002203chr5104057 3878 3545 3005 2632 2592 1533 1002 823 596 11060 22833 929 --
NM_002207chr32203 126 288 62 ----
NM_002210chr283035 2801 2500 2493 1406 997 160 73 2699 313 --1980
NM_002214chr7164883 4647 4632 4621 3966 3640 3560 3464 1894 1517 1468 1268 1043 872 648 284 32202 2063 1847 43526 3483 2244 1806 13985
NM_002221chr192869 2752 2663 2507 2435 2156 1160 551 59 22728 1096 22631 45 182
NM_002222chr331035 918 545 ------
NM_002223chr1243941 3919 3290 1534 --13435 --
NM_002226chr144760 364 351 340 --1688 --
NM_002227chr12263 44 --1190 --
NM_002228chr121180 943 ------
NM_002230chr176981 892 430 323 168 62 --145 --
NM_002232chr121391 139 ----11270
NM_002234chr122706 162 --1138 --
NM_002240chr213252 51 31 ------
NM_002241chr172937 2358 2343 2267 964 857 619 42194 790 110 49 62087 1019 968 940 43 28 --
NM_002245chr11638 ------
NM_002247chr1032329 688 431 ------
NM_002252chr22171 25 ------
NM_002253chr42226 206 --1995 --
NM_002254chr282062 2051 1742 1569 784 408 277 163 --1882 --
NM_002264chr3104218 4211 3702 3427 1838 1591 1120 586 343 57 14231 34798 4573 4464 33122 571 486
NM_002265chr171305 ------
NM_002266chr172172 63 ------
NM_002267chr1342230 2073 2061 1785 1451 12155 --
NM_002270chr5105450 5124 4953 4915 4252 4004 1983 1609 1573 1028 25438 43 44209 4039 3730 1667 12179
NM_002271chr1361935 1518 795 298 121 58 1836 ----
NM_002285chr2113288 3181 2824 2683 1269 1221 1191 1034 877 629 119 12646 1881 1633
NM_002293chr172633 2380 2162 1093 1049 497 103 31777 1111 218 22411 500 11737
NM_002298chr1351483 1447 663 479 237 ------
NM_002310chr5135817 5640 5480 5416 5162 4433 4040 1838 1827 1815 1284 1267 359 1507 45498 2397 1046 972 14014
NM_002314chr751072 893 266 138 109 --163 --
NM_002317chr52301 292 ------
NM_002332chr121745 161 1620 2636 182
NM_002334chr1161988 1605 1514 1321 286 104 --3688 685 36 --
NM_002349chr22622 268 ----11600
NM_002350chr81917 1195 11157 --
NM_002353chr13622 188 84 ------
NM_002355chr1281109 1093 996 569 193 176 66 28 ----1911
NM_002356chr621946 269 --52827 257 254 175 40 22611 1984
NM_002358chr42265 152 ------
NM_002359chr17113892 3074 3044 2889 2825 1613 1121 1079 740 123 106 --43825 1616 97 82 --
NM_002373chr1521310 333 --11271 1483
NM_002374chr283614 3573 3215 2714 2282 1297 818 794 23065 2795 --13316
NM_002375chr351702 539 342 80 25 12154 11830 --
NM_002376chr141597 ------
NM_002382chr1461060 518 492 177 110 55 1347 2941 117 --
NM_002383chr169892 809 373 363 349 327 303 188 63 1768 1179 --
NM_002385chr1831157 475 454 --21033 245 --
NM_002387chr54843 372 301 209 25027 922 3751 425 415 23593 692
NM_002390chr1721916 1734 1104 --1208
NM_002397chr532096 2066 1739 --11938 --
NM_002398chr21440 ------
NM_002399chr1581333 1319 1312 1075 972 542 119 70 ----21020 885
NM_002401chr1732266 1868 84 --1412 --
NM_002404chr174864 688 375 239 --130 --
NM_002406chr54859 394 355 169 1372 1299 --
NM_002409chr2283158 2634 2363 1218 1060 968 871 723 --32881 910 754 12137
NM_002430chr2272194 1739 823 729 437 353 136 125 42058 1751 59 40 1296
NM_002442chr1221712 1328 ------
NM_002444chrX101665 1437 1382 1358 753 393 373 224 41 31 2467 271 1642 --
NM_002445chr851476 1433 1113 505 29 1112 ----
NM_002451chr983752 3555 3371 2939 2730 1198 489 276 --13262 --
NM_002460chr6113237 2520 2513 1442 1273 1100 994 810 796 594 33 13506 11085 --
NM_002465chr12246 33 --1236 --
NM_002473chr2241032 447 368 117 --1183 --
NM_002480chr12----1501 --
NM_002481chr1297492 7103 6976 6708 6699 6666 6639 6220 6145 5926 5482 5356 5342 5091 4972 4888 2963 2856 2641 1988 1655 1536 1505 982 915 685 550 404 161 46887 2550 1702 377 77565 7561 7229 6557 2389 998 630 45583 3027 652 187
NM_002486chr932284 2274 1622 1504 1270 1760
NM_002494chr41175 --154 --
NM_002499chr1532314 1634 985 2587 457 22047 695 1872
NM_002501chr19103900 3803 1649 1601 1546 1409 1248 1148 899 80 44130 3907 1340 189 43198 617 355 33 --
NM_002505chr651582 1449 1339 393 41 21029 71 21270 569 21313 542
NM_002507chr1731277 287 120 --21745 1395 --
NM_002508chr1111983 1953 1679 1619 1580 1573 546 509 478 86 23 ------
NM_002509chr203779 728 220 --1694 --
NM_002514chr821184 856 ------
NM_002515chr141660 1608 ----
NM_002516chr196230 107 62 47 37 31 --1234 --
NM_002518chr241164 976 399 202 ------
NM_002519chr1141367 1303 1057 387 --1973 --
NM_002522chr1783136 2956 2537 2526 2446 1376 512 393 11238 21367 386 --
NM_002524chr1------1264
NM_002526chr62581 294 ------
NM_002536chrX41438 1186 274 264 --1130 --
NM_002542chr31210 ------
NM_002545chr1194562 3913 3531 3365 2064 1397 1308 887 321 34934 1724 40 62048 2045 1706 890 625 284 25048 4091
NM_002546chr8399 67 28 1173 ----
NM_002547chrX53080 358 339 114 65 --1742 --
NM_002556chr1181989 1661 1624 1356 869 757 730 98 2845 673 61841 1786 1771 1528 1454 301 11993
NM_002563chr34750 341 255 197 --1200 11120
NM_002568chr82437 308 ------
NM_002570chr153368 229 200 --1826 21167 62
NM_002576chr1141122 291 104 89 1317 1226 --
NM_002577chr3113604 3504 3123 2964 2882 1511 1493 985 792 466 408 1415 31527 895 779 --
NM_002578chrX1308 1389 ----
NM_002581chr975582 5220 4709 4292 1474 1229 666 25063 2141 12151 --
NM_002582chr163859 644 622 --1627 --
NM_002585chr13260 134 69 ------
NM_002586chr651288 1162 373 316 288 --31102 304 236 --
NM_002588chr5121796 1769 1718 1667 1392 1296 1238 645 540 501 361 58 31275 323 316 1385 --
NM_002595chr122719 119 --1411 11644
NM_002600chr131804 1460 540 1564 2630 543 --
NM_002601chr21328 1197 --174
NM_002603chr8----1146 --
NM_002605chr151990 --139 --
NM_002607chr72245 129 --1889 --
NM_002608chr2271581 1399 1373 1253 622 337 189 --1262 11541
NM_002610chr262362 2312 2284 2087 1248 391 12895 ----
NM_002612chr71657 ----191
NM_002613chr1675380 4122 3621 2104 1866 1859 1104 --32119 2116 1944 44899 4688 4131 1263
NM_002616chr173383 115 46 ------
NM_002618chr2161 ------
NM_002620chr4170 ------
NM_002622chr55632 618 217 83 24 --127 --
NM_002623chr20----2801 68 --
NM_002628chr32862 385 ----1433
NM_002633chr12380 223 --1474 --
NM_002636chr64436 426 67 43 1401 ----
NM_002641chrX31643 780 526 ------
NM_002645chr1152688 2630 2306 1983 1124 ------
NM_002646chr182179 1964 1738 1497 855 797 183 79 --2789 186 --
NM_002648chr651207 428 239 220 22 1513 2983 975 1330
NM_002649chr75451 400 281 226 143 11175 1626 --
NM_002651chr14866 648 362 317 ------
NM_002655chr864079 3913 1736 1491 1235 744 14421 ----
NM_002657chr20163655 3581 3239 3164 2511 2491 1545 1528 1445 1273 1144 977 924 514 312 287 21301 852 73395 3232 2517 2465 1147 530 290 1951
NM_002668chrX162 2149 46 ----
NM_002670chr321619 1440 11251 --21244 438
NM_002687chr1441151 496 432 73 ------
NM_002690chr81103 ------
NM_002693chr152310 304 --1150 --
NM_002697chr1----198 --
NM_002698chr19152605 2592 2343 2323 2304 2293 2285 2274 2266 1965 1067 1014 214 199 190 1224 52297 2278 2222 1131 326 --
NM_002699chr131381 1373 597 1417 21256 537 --
NM_002701chr6197 ------
NM_002705chr16179 1229 1260 --
NM_002710chr121225 --1124 --
NM_002711chr73733 330 105 1150 ----
NM_002714chr61446 1987 --1194
NM_002715chr52836 278 --1914 --
NM_002716chr11153625 3532 3497 3487 3399 3274 3148 3111 2833 2775 2494 2279 2235 1448 193 23461 2443 23504 3296 13347
NM_002718chr352568 2321 1879 1864 214 1183 2894 890 1105
NM_002719chr1452351 2245 1759 615 316 ------
NM_002720chr16166 --1240 --
NM_002726chr62449 170 ------
NM_002730chr1971266 1191 1174 948 461 308 104 11133 31359 910 242 --
NM_002731chr162797 2729 906 842 676 300 --32621 276 255 1105
NM_002734chr1731526 916 439 2892 657 129 --
NM_002736chr721894 114 ------
NM_002738chr1631153 1076 240 2385 26 ----
NM_002745chr22134179 4121 4072 3999 3421 3208 3101 3026 1536 1313 606 180 55 34110 4023 3483 94460 4457 2947 1694 1045 387 320 198 59 --
NM_002747chr1831508 1502 507 --2646 562 1511
NM_002748chr15133 ------
NM_002752chr51437 1401 ----
NM_002753chr41164 151 1298 --
NM_002763chr12513 154 --1140 --
NM_002764chrX5887 803 697 627 214 --1890 --
NM_002773chr163156 101 57 ----1106
NM_002775chr101149 ----1399
NM_002809chr17--1373 ----
NM_002819chr1941399 1098 520 328 --11020 11024
NM_002821chr65567 546 308 249 87 --1157 1253
NM_002827chr2041482 1371 728 156 ------
NM_002829chr931026 347 45 1854 2272 27 --
NM_002833chr1551202 1161 364 317 39 --2413 324 --
NM_002837chr1253587 2920 1437 743 198 23918 359 1615 11265
NM_002838chr12484 348 ----11024
NM_002839chr923255 91 ----1989
NM_002840chr171377 519 385 370 294 284 62 1597 21380 1218 --
NM_002843chr1152422 1114 916 642 493 --33268 2108 737 1760
NM_002844chr631362 1162 301 --1367 --
NM_002854chr221148 127 ----
NM_002855chr11143633 3507 3121 2710 1408 1023 814 654 571 455 386 254 200 37 12563 33065 1033 191 11479
NM_002858chr121179 554 ----1360
NM_002866chr195618 508 496 38 29 ------
NM_002868chr12112330 2265 2171 2091 1989 1932 1750 887 564 537 265 21690 806 52410 2407 413 330 311 11909
NM_002869chr1172167 2067 1706 820 453 392 27 --31771 1765 857 --
NM_002874chr932354 1880 260 12424 ----
NM_002880chr33760 727 562 2681 659 --178
NM_002886chr385031 4600 3659 3362 3302 1827 1140 581 14152 44822 1863 543 243 11350
NM_002892chr1411609 1607 1235 11317
NM_002893chrX2282 125 --1339 --
NM_002906chr1142045 1610 427 28 ------
NM_002911chr193551 506 345 11595 31460 1403 324 --
NM_002912chr63794 359 202 ------
NM_002918chr196902 781 763 319 304 145 ------
NM_002924chr14517 504 234 161 --1205 --
NM_002926chr42323 130 ----11174
NM_002931chr6----1311 --
NM_002938chr461995 1915 1662 1504 1302 150 41477 1290 780 56 2498 216 --
NM_002941chr311239 --1130 --
NM_002942chr32271 176 ------
NM_002945chr171588 --160 1593
NM_002953chr11167 --1765 --
NM_002955chr641699 1236 542 70 --21746 1668 --
NM_002956chr122895 885 11213 1943 1928
NM_002959chr1114146 3957 3794 3489 3334 3070 2857 1589 894 793 248 1955 21433 1113 1503
NM_002968chr162926 906 --199 --
NM_002971chr311019 --2366 180 --
NM_002979chr12761 622 ------
NM_002994chr471567 1513 656 604 519 372 152 --1142 --
NM_002996chr163487 358 244 51765 1561 1243 186 127 1631 11878
NM_002997chr241645 1459 218 59 ----2528 280
NM_002998chr832255 1718 787 --1404 --
NM_003001chr182141 1863 898 854 703 322 95 28 21994 1874 52244 2233 1982 821 326 11556
NM_003009chr192313 264 ------
NM_003010chr1762229 1944 1818 1686 1496 502 11910 22377 703 --
NM_003011chr95586 472 387 137 30 --1381 147
NM_003012chr852995 2803 2713 1236 943 --22981 1142 22972 2410
NM_003013chr41634 ------
NM_003016chr1752042 1855 1418 784 424 1356 21687 770 --
NM_003017chr6----11377 --
NM_003021chr192818 32 1165 178 --
NM_003026chr93954 185 29 ----1384
NM_003029chr121503 1131 122 ----
NM_003030chr32113 76 11821 11360 --
NM_003031chr162859 381 ------
NM_003034chr12108101 7694 7634 7032 6325 5967 5446 5309 5284 1491 17205 52086 1033 723 635 632 37278 7046 6551
NM_003036chr12498 257 ------
NM_003042chr361776 1766 1733 855 619 411 --1536 --
NM_003043chr3114330 4227 4000 3850 3245 3054 2869 2802 1181 907 419 33562 3284 1305 23753 3058 --
NM_003045chr13114686 4390 4198 3416 3174 2019 1529 1289 552 422 183 13283 43697 1541 365 279 14671
NM_003046chr8105301 5064 4422 4264 3975 1980 1758 1632 1279 1098 11770 34081 1306 1020 --
NM_003047chr181343 1242 506 322 306 274 187 160 145 ----
NM_003051chr121947 1544 11645 21706 1698 --
NM_003060chr551070 921 814 473 113 183 1876 1192
NM_003063chr11--2175 102 ----
NM_003068chr82276 41 --2316 85 --
NM_003070chr92742 21 --244 40 --
NM_003071chr331902 1435 152 21625 295 11381 --
NM_003072chr191357 1132 ----
NM_003074chr3112199 1608 1464 1405 857 848 731 289 146 105 72 ------
NM_003075chr121126 ------
NM_003076chr1271679 1655 1414 1179 1036 187 167 1401 41694 1405 477 473 21698 1184
NM_003077chr174587 575 225 157 --121 --
NM_003081chr2041157 437 266 63 253 25 11147 --
NM_003085chr52108 87 --1111 --
NM_003088chr76886 715 412 325 294 71 ------
NM_003096chr2135 ------
NM_003100chr51454 ------
NM_003104chr1521185 89 --2987 282 --
NM_003107chr621731 1055 11621 1663 11863
NM_003108chr2156503 6468 5684 5461 5253 5006 4783 2858 1876 1842 1804 1419 281 52 26 25645 1859 42265 1764 1061 1037 16303
NM_003110chr174842 753 164 52 ------
NM_003111chr211073 --11086 --
NM_003112chr763218 2362 533 467 412 275 ----31047 651 218
NM_003128chr261936 1892 908 880 273 100 --21135 1132 12408
NM_003131chr6112113 1879 1431 791 677 665 653 522 369 249 189 --51962 1959 1767 505 208 --
NM_003133chr14961 769 333 278 ------
NM_003137chr641395 617 484 95 42086 2002 1784 1666 2277 70 199
NM_003139chr113804 677 137 1777 152 --
NM_003142chr2------1230
NM_003144chr62840 325 ------
NM_003145chr1246 24 --1129 --
NM_003149chr331040 590 579 --31539 1102 532 11106
NM_003150chr1741880 1599 390 324 11925 --1944
NM_003155chr852527 2254 2236 2227 2075 1538 32807 2326 260 --
NM_003156chr113376 61 38 1166 11219 175
NM_003161chr1763505 3220 1158 1144 634 237 22912 1262 33462 2193 1199 --
NM_003162chr22998 408 --1238 --
NM_003164chr111179 --3546 439 436 --
NM_003165chr951755 1629 1449 402 179 21305 772 ----
NM_003173chrX31377 1239 390 ------
NM_003178chr34856 405 211 156 --11592 1598
NM_003179chrX51444 1358 1199 394 376 ----1417
NM_003180chr191323 1331 2266 100 --
NM_003184chr8266 25 --1232 --
NM_003185chr203826 493 463 --21107 466 --
NM_003188chr62858 158 --1832 --
NM_003189chr182832 2568 2425 924 556 273 255 248 11304 22836 674 12297
NM_003194chr61554 ------
NM_003199chr1895097 4085 3710 1848 1493 1383 587 89 50 --1715 24470 924
NM_003204chr1721736 1165 11457 11333 --
NM_003214chr641199 961 461 46 --11019 --
NM_003217chr1262031 1600 1299 249 199 57 --31656 386 36 2253 135
NM_003220chr641686 1194 1110 635 --21177 604 --
NM_003221chr6143843 3539 3518 3346 2952 2896 2862 2847 1624 1213 1028 800 595 526 12653 63622 3435 3431 3372 2776 958 13463
NM_003223chr162308 21 1623 ----
NM_003224chr203815 132 114 --1857 1151
NM_003234chr342146 1485 560 482 31696 438 389 1682 21687 735
NM_003236chr293444 3240 2646 2395 2255 1294 1225 1019 62 43045 779 551 517 ----
NM_003239chr142723 149 --1837 --
NM_003246chr1541760 1317 250 97 2431 221 2664 109 --
NM_003247chr631633 639 133 ------
NM_003253chr211378 1475 1561 --
NM_003255chr1742369 2055 210 149 12106 --12044
NM_003262chr3104514 3702 3667 3656 3614 1349 1275 1232 789 692 1152 23772 3258 --
NM_003274chr2152771 1835 489 204 71 21200 965 ----
NM_003275chr921483 597 1379 ----
NM_003285chr13361 348 204 --6544 536 532 528 524 520 --
NM_003288chr2061584 1540 1364 1156 1134 239 --2392 389 --
NM_003290chr193236 77 56 --1185 --
NM_003292chr14713 591 179 163 ----21744 1711
NM_003297chr121207 ------
NM_003298chr3116011 5361 4918 4252 4238 4148 4068 3815 2311 796 39 1780 45091 1406 1208 127 1871
NM_003300chr14142 --1329 --
NM_003320chr1194159 4061 3583 3544 3012 2771 1017 986 83 33648 3272 2756 22777 1599 23331 682
NM_003324chr12129 --31401 1398 387 --
NM_003326chr182521 2475 2078 1960 915 546 298 75 22545 2193 12144 --
NM_003336chrX1128 1406 1927 --
NM_003337chr541442 1237 688 449 1128 ----
NM_003339chr521404 110 ------
NM_003340chr431191 331 63 ----1179
NM_003342chr1792569 2098 1289 1214 1017 998 984 965 431 1976 22692 2542 11101
NM_003345chr163497 416 196 1133 1199 --
NM_003348chr1261704 1597 1566 1377 1209 34 --21396 55 --
NM_003350chr82921 208 ------
NM_003352chr21875 ------
NM_003359chr43938 913 206 21378 1282 ----
NM_003363chr3----2554 522 --
NM_003369chr1162571 691 583 529 370 118 ------
NM_003370chr194738 587 228 29 --1216 --
NM_003371chr921320 77 1115 ----
NM_003373chr1071581 1492 1385 625 612 370 363 1390 21496 498 21810 1761
NM_003374chr51798 1776 1581 --
NM_003376chr621518 603 ------
NM_003376chr621518 603 ------
NM_003383chr9----296 93 --
NM_003385chr21272 ----1276
NM_003387chr272188 1811 1150 947 402 380 73 31881 1863 198 52419 1855 930 372 84 --
NM_003390chr1141061 887 801 90 ------
NM_003392chr3113934 3610 3416 3388 3314 3151 2709 1521 1311 626 357 11545 21049 1022 --
NM_003394chr123595 274 178 --2666 79 --
NM_003400chr23669 167 28 ------
NM_003403chr14--144 ----
NM_003404chr2021361 591 --21443 594 11365
NM_003406chr841811 1733 1595 540 --31747 1744 1737 --
NM_003407chr191221 --1577 --
NM_003409chr183921 326 176 ------
NM_003410chrX53078 2591 2077 2000 411 ------
NM_003411chrY21502 673 --1368 --
NM_003412chr342843 2710 1034 188 ------
NM_003413chrX3793 455 181 1290 2256 247 --
NM_003418chr33313 64 54 ------
NM_003439chr762767 2156 597 437 185 131 1811 --1771
NM_003445chr19----1733 1703
NM_003453chr132681 94 ------
NM_003454chr1641365 1196 1132 237 ------
NM_003457chr173494 118 46 ------
NM_003458chr3143962 3852 3732 3452 3241 3050 2920 2510 2493 1302 945 931 722 191 23932 3198 43844 3820 1289 1016 23785 527
NM_003463chr623133 2358 --1983 23232 446
NM_003466chr242345 1716 694 546 22014 198 --1553
NM_003468chr253039 3029 3016 2726 497 1175 42952 1398 1395 1127 11492
NM_003469chr2162 --2161 35 --
NM_003470chr1661729 1618 1163 540 531 501 1547 21733 1333 1423
NM_003472chr631129 230 86 --1523 --
NM_003473chr1031096 829 230 --1181 --
NM_003474chr1022264 780 ----11988
NM_003478chr1121209 338 12739 1349 13081
NM_003481chr124506 497 361 107 ------
NM_003482chr1272601 2489 2123 1996 573 196 51 --2923 540 12759
NM_003483chr12102876 2785 2127 2065 1182 1051 1039 880 539 499 12195 22776 1054 --
NM_003487chr173200 76 21 ------
NM_003489chr2173366 2782 2554 2191 1117 928 747 11052 ----
NM_003505chr771666 1568 1280 1213 593 571 103 --2698 386 1778
NM_003507chr231805 1680 571 --3599 326 104 --
NM_003508chr7----1303 --
NM_003557chr181228 1191 523 440 396 317 176 91 1144 2180 153 --
NM_003558chr9----167 --
NM_003559chr17103435 3115 2988 2743 2735 2406 1289 1008 841 485 23835 3546 52504 997 994 990 246 32757 644 600
NM_003563chr1751425 1298 1028 496 436 --11011 11032
NM_003564chr13428 233 168 ------
NM_003566chr1273240 3185 2542 2275 2126 974 502 --2491 361 --
NM_003574chr1894749 4143 3714 3498 1772 1238 693 437 41 --1475 --
NM_003575chr731464 1034 974 11557 11369 --
NM_003576chr1372725 2015 1871 753 214 53 34 --32804 839 43 --
NM_003581chr23958 242 77 --1669 --
NM_003582chr11158 ------
NM_003583chr1263208 1338 1202 1099 783 367 --4852 807 794 775 41239 856 673 547
NM_003587chr6----143 --
NM_003590chr273689 2868 2722 1527 1112 952 228 11151 1633 --
NM_003591chr10----1279 --
NM_003597chr232298 1704 615 11886 21723 73 --
NM_003603chr432119 449 388 ------
NM_003607chr1114251 4083 3852 3466 3029 1586 1190 964 395 70 54 --21424 1375 --
NM_003615chr343851 2980 2711 979 13720 13698 23004 2570
NM_003617chr194641 3618 3106 1592 1519 672 657 551 83 44289 3809 3100 1781 54553 4545 4524 1480 211 21132 45
NM_003620chr1731107 925 805 ------
NM_003622chr1232345 711 217 ----1652
NM_003629chr163189 1327 910 827 814 437 22942 2526 --12292
NM_003631chr103895 227 26 1141 2646 329 --
NM_003633chr562612 2302 1755 1652 1024 943 12088 ----
NM_003634chr226870 839 337 292 34 25 ------
NM_003644chr17206378 5793 5672 4906 4899 4176 2170 2144 2025 1698 1475 1356 1200 751 735 714 598 545 498 353 64505 2478 2471 2065 1379 1271 55084 4345 2460 2180 1349 36363 4484 357
NM_003648chr272637 709 700 693 679 393 380 1687 2602 146 1239
NM_003651chr122572 488 ------
NM_003655chr171585 --2575 539 1487
NM_003656chr3128 --1167 --
NM_003657chr20496 68 52 31 1685 ----
NM_003659chr2----1317 --
NM_003660chr194671 638 259 42 ------
NM_003663chr392620 2524 2500 2176 2124 923 847 446 339 12548 1273 --
NM_003664chr5----1357 --
NM_003670chr311354 11054 21000 35 --
NM_003671chr963078 2763 2297 1071 921 734 43157 3132 747 556 42755 2271 1204 817 --
NM_003672chr13783 50 31 11924 1503 --
NM_003677chr125861 742 736 539 420 11741 ----
NM_003679chr1103450 3144 3088 2945 2270 2119 1202 1120 758 36 43262 2780 1237 265 13160 --
NM_003685chr194931 364 226 23 --1803 --
NM_003688chrX1214 ------
NM_003692chr9------1319
NM_003701chr131703 ------
NM_003704chr42256 204 1448 ----
NM_003705chr22795 693 ------
NM_003711chr5----184 --
NM_003713chr131200 702 608 11184 ----
NM_003714chr533094 2683 2195 11098 22457 2276 133
NM_003716chr3----1717 1831
NM_003722chr3102096 1799 765 695 660 480 287 95 84 22 --1104 --
NM_003728chr42650 545 --1251 --
NM_003735chr5121796 1769 1718 1667 1392 1296 1238 645 540 501 361 58 31275 323 316 1385 --
NM_003736chr5121796 1769 1718 1667 1392 1296 1238 645 540 501 361 58 31275 323 316 1385 --
NM_003740chr62671 41 21271 191 ----
NM_003741chr32112 83 --1260 --
NM_003743chr242005 1610 580 106 --21614 922 --
NM_003746chr122257 241 ------
NM_003749chr1341594 653 347 336 12314 --12018
NM_003750chr101969 ------
NM_003758chr1561615 1525 1497 1357 1277 69 --11127 --
NM_003758chr1561615 1525 1497 1357 1277 69 --11127 --
NM_003759chr493510 3387 3370 3146 3054 2842 1268 320 42 12850 1816 --
NM_003763chr2052946 2649 698 484 148 11071 --1200
NM_003768chr131743 1634 1574 2734 64 2301 196 1318
NM_003774chr1273341 2690 2416 2339 2174 1187 785 --33312 1267 717 --
NM_003779chr12338 56 1311 ----
NM_003784chr183706 266 98 --2243 114 --
NM_003787chr1841700 1513 1487 619 ------
NM_003794chr33866 717 430 ------
NM_003795chr61486 ----1490
NM_003797chr111171 ------
NM_003799chr18104450 4107 3632 3530 3382 1412 1236 754 722 83 21613 1577 53352 1813 1508 1250 889 --
NM_003800chr692397 2281 2209 2054 2002 1584 778 422 182 11828 21532 918 --
NM_003822chr152841 2022 1268 1169 494 --22538 1975 1425
NM_003825chr1561393 1141 264 210 149 48 --1194 --
NM_003827chr194573 546 459 31 ------
NM_003829chr94453 195 163 144 ------
NM_003850chr132515 244 ------
NM_003858chr14--1704 --1563
NM_003861chr1492874 2708 2141 2025 1050 859 601 574 368 2592 379 12854 12572
NM_003870chr15112007 1994 1985 1705 1626 483 278 229 150 76 69 1541 12049 1240
NM_003872chr2112979 2174 1877 1194 1023 932 889 527 433 425 75 22367 881 12224 --
NM_003873chr1041833 744 311 127 --11836 --
NM_003877chr122696 688 ----2930 179
NM_003884chr32714 293 ------
NM_003885chr1762500 2307 1933 1694 1028 715 --21912 1903 --
NM_003887chr251693 1631 488 446 347 12059 1337 --
NM_003888chr1571304 1253 1152 1097 524 278 57 1423 51310 1236 382 365 343 21327 1315
NM_003895chr2121351 214 ----1775
NM_003896chr24878 708 679 153 ----177
NM_003902chr12669 124 --1594 --
NM_003908chr2031341 1004 442 1315 ----
NM_003909chr872977 2759 2096 2008 1884 969 118 --21019 922 --
NM_003913chr674169 4050 4031 3926 3526 1580 1570 11639 43743 3208 2691 465 197
NM_003916chrX31327 949 261 ------
NM_003919chr7--176 ----
NM_003921chr13723 337 226 ------
NM_003924chr441403 1209 664 201 11380 ----
NM_003927chr181724 --1775 1447
NM_003930chr721714 25 --1160 --
NM_003931chr62104 63 ----1128
NM_003932chr2241861 1851 1806 1800 --11935 --
NM_003934chr9----11166 --
NM_003941chr722031 534 32316 2252 187 ----
NM_003947chr31204 1885 --1417
NM_003948chr442621 2424 2197 1974 22678 2523 1113 --
NM_003953chr172565 2264 2200 2150 1036 575 306 12039 22346 877 --
NM_003955chr1781489 1482 1392 602 536 288 226 57 1281 ----
NM_003958chr683740 3029 2639 2506 1327 1005 866 684 13562 23104 513 43896 3660 877 747
NM_003966chr5187206 6787 6632 6419 6162 5856 5240 4781 2717 2710 2564 2335 1947 1858 1425 407 389 42 46951 2671 2549 1937 66017 2746 2738 2694 2691 2053 --
NM_003983chr16104456 4327 4299 3992 3690 2874 2789 1219 1145 401 11619 94396 4049 3841 3180 1301 1042 472 456 453 24274 3291
NM_003986chr112308 104 ------
NM_003987chr1071702 1628 1566 1542 906 878 751 1840 11595 --
NM_003988chr1061779 1705 1643 1619 955 828 1917 11672 --
NM_003989chr1071638 1564 1502 1478 842 814 687 1776 11531 --
NM_003990chr1071638 1564 1502 1478 842 814 687 1776 11531 --
NM_003994chr12103370 3000 2687 1723 1705 1684 1545 608 464 384 ------
NM_003998chr42496 157 ------
NM_004006chrX32137 2027 913 ----22050 594
NM_004007chrX32137 2027 913 ----22050 594
NM_004009chrX32137 2027 913 ----22050 594
NM_004010chrX32137 2027 913 ----22050 594
NM_004011chrX32137 2027 913 ----22050 594
NM_004012chrX32137 2027 913 ----22050 594
NM_004013chrX32137 2027 913 ----22050 594
NM_004014chrX32137 2027 913 ----22050 594
NM_004015chrX32137 2027 913 ----22050 594
NM_004016chrX32051 1941 827 ----21964 508
NM_004017chrX32137 2027 913 ----22050 594
NM_004018chrX32051 1941 827 ----21964 508
NM_004019chrX152 172 1332 --
NM_004020chrX32137 2027 913 ----22050 594
NM_004021chrX32051 1941 827 ----21964 508
NM_004022chrX32051 1941 827 ----21964 508
NM_004023chrX32051 1941 827 ----21964 508
NM_004024chr161227 1092 1047 447 128 69 --1131 --
NM_004027chr2172 ------
NM_004028chr1832874 2696 680 11359 5616 613 555 350 58 --
NM_004035chr1763828 3615 3319 3303 1075 250 14868 25188 4646 --
NM_004036chr23549 499 234 ------
NM_004040chr221165 1027 ------
NM_004050chr1462332 966 870 762 596 535 --12002 1747
NM_004055chr1191719 796 786 663 554 537 439 231 208 1111 ----
NM_004056chr81392 ------
NM_004059chr93164 126 53 ------
NM_004061chr53575 533 145 ------
NM_004067chr751584 1433 1414 1256 581 --11068 --
NM_004071chr2----1271 --
NM_004077chr121998 --21101 178 11236
NM_004080chr761482 1185 603 550 298 287 ------
NM_004081chrY41885 1473 255 95 1479 11396 --
NM_004082chr22230 111 ------
NM_004085chrX2805 280 ------
NM_004086chr141637 ------
NM_004087chr361509 1347 574 463 283 23 21519 158 21338 69 --
NM_004089chrX2457 362 ------
NM_004093chr132269 130 22177 599 11311 --
NM_004094chr1422843 2296 --2438 435 --
NM_004096chr10121675 1535 1341 824 792 780 694 642 455 437 185 137 11444 2652 140 --
NM_004098chr1031181 975 806 1227 ----
NM_004100chr642568 2539 2371 361 ------
NM_004103chr85805 759 712 698 32 187 1720 --
NM_004105chr231096 906 234 --1728 --
NM_004112chr1751765 1639 1335 555 434 --11213 --
NM_004113chr352016 1745 1589 763 150 11766 371 52 22 --
NM_004114chrX5927 794 368 257 63 176 ----
NM_004116chr22451 409 ------
NM_004124chr1442309 688 199 131 --1630 1234
NM_004130chr31457 ------
NM_004161chr241392 1363 509 22 11070 1459 11036
NM_004162chr331126 1001 265 --1467 21041 327
NM_004169chr173589 238 155 ------
NM_004170chr941346 750 419 327 11298 ----
NM_004171chr11239451 9332 9216 9199 8503 7814 7394 7148 7011 6578 6318 6301 6191 6071 5899 3180 3172 2776 2440 2047 1166 406 217 2557 419 109032 8241 8212 7817 6585 6425 3523 2805 1169 299 16863
NM_004185chr12634 165 ----182
NM_004187chrX71094 979 451 420 355 212 59 --31287 437 433 11341
NM_004193chr10149 1393 3404 401 195 --
NM_004199chr5173 135 ----
NM_004200chr1172884 2292 2074 1237 1055 790 782 42067 1185 1028 967 33231 923 244 11097
NM_004206chr3142 --1237 --
NM_004210chr1041606 579 265 91 --41867 1352 393 113 --
NM_004215chr82215 146 ----1370
NM_004229chrX52171 1637 1612 1529 695 11488 ----
NM_004230chr1952206 2086 1877 1682 451 1771 ----
NM_004232chr1831178 1065 276 --11513 --
NM_004235chr93749 580 72 ------
NM_004239chr141123 ------
NM_004252chr173509 223 189 --2153 64 1695
NM_004261chr12772 213 ------
NM_004263chr271637 1607 1519 1484 693 501 429 --1519 11413
NM_004268chr112835 485 1907 1301 21228 941
NM_004272chr531813 1754 471 1122 1587 --
NM_004274chr14123189 3119 3048 2988 544 389 330 318 259 158 143 80 --1161 1178
NM_004277chr621173 179 ------
NM_004279chr741897 1459 798 700 11989 31940 1738 538 --
NM_004281chr102408 175 ------
NM_004290chr561160 1119 411 373 106 49 --2879 300 --
NM_004293chr943793 3001 2460 27 12450 13463 --
NM_004295chr172440 127 --21176 1070 --
NM_004296chr1483952 3429 3030 2745 1509 1090 896 85 --13223 --
NM_004302chr1242458 2305 2286 483 22573 865 1390 --
NM_004304chr23377 287 27 174 ----
NM_004308chr1191894 1809 1688 1464 1447 1180 382 188 55 2613 263 158 --
NM_004311chr10102976 2946 2487 2479 2328 2255 2135 2051 1220 1191 1899 62952 2734 2730 1257 341 225 1850
NM_004316chr1211184 ------
NM_004319chr1152561 2549 2519 2488 2421 2393 2379 2237 2003 1996 1084 849 648 459 163 2865 179 62929 2541 2538 2424 708 558 12459
NM_004323chr992570 2469 2201 2168 2039 847 649 616 85 12387 42344 2067 2031 195 32349 867 820
NM_004326chr151035 991 924 759 356 --31151 1141 800 --
NM_004329chr1021444 112 --1555 --
NM_004331chr822614 903 ------
NM_004338chr18116559 5913 5133 4685 2663 2560 2311 1631 1148 994 147 1978 34705 2314 448 14689
NM_004342chr752308 2106 1959 1700 1454 11480 12288 11637
NM_004346chr41129 ----11023
NM_004349chr841265 915 288 58 ------
NM_004354chr42866 237 ------
NM_004364chr1941181 1125 379 215 1490 1165 --
NM_004370chr631827 677 592 --21830 649 11460
NM_004371chr13960 141 65 --1963 --
NM_004374chr8124 --1108 --
NM_004379chr231500 597 198 1655 ----
NM_004380chr1652409 2209 914 735 646 ------
NM_004384chr561878 943 474 415 309 180 ------
NM_004385chr52685 678 ------
NM_004389chr21676 --1589 --
NM_004391chr3101922 1885 1630 1586 1507 1434 1419 1332 602 230 ----11826
NM_004392chr1322654 1643 1426 2556 348 21833 171
NM_004393chr341829 1542 255 165 --12338 --
NM_004395chr55713 694 302 272 180 --2698 230 --
NM_004397chr1174168 3225 762 599 410 400 73 23900 369 21353 941 --
NM_004405chr23930 320 80 --1404 --
NM_004414chr212483 83 --1489 --
NM_004416chr125761 747 739 686 59 --11084 --
NM_004417chr51593 --1130 --
NM_004420chr1172198 2088 1874 1552 1540 840 425 22133 2023 ----
NM_004423chr352248 2180 1696 1094 1011 --72525 2521 2454 2443 785 220 56 1709
NM_004426chr1241614 790 462 195 1342 1539 --
NM_004427chr171037 779 495 459 444 288 41 1154 2412 408 2426 257
NM_004430chr8102585 2234 2194 2186 1756 977 961 952 895 621 1697 11066 --
NM_004432chr942051 1568 407 369 ------
NM_004433chr151726 1484 1293 549 198 --2631 314 --
NM_004436chr1--1521 ----
NM_004437chr1113266 2409 2397 1233 1112 1045 573 489 361 169 37 1374 --22665 2420
NM_004438chr22925 225 22959 1064 13202 --
NM_004439chr4123 ------
NM_004440chr661620 1567 438 412 386 108 ------
NM_004441chr361206 1194 497 451 429 170 --31273 415 387 --
NM_004442chr181600 1587 1557 1158 1151 672 356 28 1470 1635 132
NM_004443chr31303 1147 ----
NM_004444chr71570 --1549 --
NM_004446chr1133 ------
NM_004449chr2121109 586 11024 ----
NM_004450chr142324 251 1279 ----
NM_004454chr342011 1928 1547 660 11729 ----
NM_004457chr221632 98 --11083 --
NM_004458chrX32309 844 379 1471 11689 --
NM_004459chr1731659 1514 1337 ----11261
NM_004474chr12690 652 1958 1405 --
NM_004475chr1781128 1007 478 460 398 257 181 154 --3959 838 190 --
NM_004480chr141531 --1179 --
NM_004481chr192015 1821 1729 1692 982 735 528 256 206 1512 21732 259 1820
NM_004482chr23758 657 42 ------
NM_004484chrX3304 265 50 1119 ----
NM_004493chrX3140 42 32 ------
NM_004494chr171183 1081 969 491 343 241 119 --31067 815 272 --
NM_004496chr1431163 1152 281 --1309 --
NM_004497chr192590 70 ------
NM_004500chr1472028 1292 630 186 134 119 84 2742 532 ----
NM_004501chr173302 1623 1549 847 488 357 119 --23587 1249 136
NM_004504chr242842 2484 2006 499 --12826 --
NM_004505chr1722029 356 --11386 --
NM_004506chr61144 ----1259
NM_004514chr1762880 2807 2626 2321 586 270 22850 1199 ----
NM_004516chr191105 ----2848 52
NM_004519chr82192 161 --1164 --
NM_004520chr51536 1122 ----
NM_004527chr1761065 363 342 328 204 82 11017 2483 85 11069
NM_004529chr911034 11416 ----
NM_004535chr2041723 1581 1492 346 ------
NM_004554chr1461498 595 576 144 112 67 ------
NM_004561chr1131627 688 532 --11849 --
NM_004569chr141196 2532 34 ----
NM_004574chr17134 --143 --
NM_004575chr461259 266 190 57 51 36 11199 1580 --
NM_004583chr174750 490 250 35 --1260 2494 134
NM_004586chrX115152 5136 4911 4683 4515 4454 4017 3813 1939 1242 849 12178 21948 154 --
NM_004588chr11103672 3607 3451 3244 3178 2924 2641 1084 459 41 32948 837 183 53610 3247 3096 3093 2801 --
NM_004593chr31772 ------
NM_004595chrX2114 102 ------
NM_004598chr593105 3022 2785 2678 2561 1126 939 759 264 22581 101 32921 1052 1049 --
NM_004600chr151552 1507 1374 1041 540 11215 --1231
NM_004602chr201282 1565 11300 --
NM_004603chr75916 841 386 342 304 ------
NM_004606chrX2356 267 142 ----
NM_004612chr984808 3815 3245 1356 1271 443 113 35 24577 3935 1829 24552 1470
NM_004620chr11153 --1148 1566
NM_004630chr1151130 1033 959 939 255 --21047 892 --
NM_004631chr131256 1228 1024 --11068 --
NM_004637chr321328 1285 284 33 11156 --
NM_004643chr142727 536 ------
NM_004645chr172745 275 1834 ----
NM_004654chrY4995 473 63 24 ------
NM_004655chr172875 504 ----1995
NM_004656chr34956 938 394 60 --1153 1250
NM_004660chrY52207 2081 751 233 119 --11493 --
NM_004663chr1541456 1244 1204 243 ----11168
NM_004673chr111156 ----21495 479
NM_004685chr1352024 1978 1108 558 319 ------
NM_004686chr86725 678 613 568 434 308 --21779 636 --
NM_004687chr1761736 1385 515 130 77 54 2393 183 1275 --
NM_004690chr63808 667 608 ------
NM_004697chr941061 868 790 56 ------
NM_004703chr172528 282 --12346 21832 296
NM_004705chr114724 624 605 221 ----1190
NM_004709chrX31570 450 432 --2233 221 --
NM_004715chr182690 572 --198 --
NM_004718chr22644 54 ------
NM_004719chr1262725 2714 2452 1982 1111 186 --22533 190 --
NM_004723chr121030 857 1924 1238 --
NM_004725chr1041321 1289 1244 1204 --1478 --
NM_004726chrX73714 3640 3484 1737 1501 1227 143 12224 24491 1677 --
NM_004731chr121136 1284 ----
NM_004734chr13103117 2717 2426 2288 2280 2157 1045 654 74 31 ------
NM_004736chr151428 622 183 129 56 --11417 21858 460
NM_004739chr113669 660 453 --1539 --
NM_004742chr341256 655 361 263 1458 ----
NM_004744chr422931 708 --1317 --
NM_004745chr8146960 6920 6632 6496 6221 5172 4904 4295 2244 1923 1556 1479 1152 89 1641 56601 6179 2019 1482 278 36924 4908 4871
NM_004748chr1553935 3571 3425 1311 301 --11243 --
NM_004758chr1751128 1063 970 842 316 1165 1418 1758
NM_004760chr742432 2210 1611 625 ----1269
NM_004762chr1751482 519 282 96 54 --21857 232 --
NM_004764chr122212 164 ------
NM_004772chr551411 1402 1360 1351 506 1281 ----
NM_004774chr17102859 2688 2397 2146 1954 1117 1027 897 429 337 --22848 2488 12324
NM_004779chr58904 880 530 490 243 224 215 72 --1916 --
NM_004784chr4------1126
NM_004788chr1182042 1909 1862 966 284 96 86 66 31695 915 355 1288 --
NM_004789chr92374 360 ------
NM_004796chr1442249 2006 1815 1615 --22450 331 --
NM_004797chr3133378 3272 3231 3190 3119 2876 2754 2273 839 715 555 521 313 126 93261 3257 3253 3249 3220 3217 3204 3201 633 --
NM_004798chr2073131 2576 1262 863 338 332 305 1628 1290 --
NM_004801chr231446 175 81 --11162 --
NM_004805chr22912 114 ------
NM_004808chr1032322 2180 1068 11212 --1589
NM_004815chr184549 4036 3887 3760 3509 3242 886 146 --54431 4428 4378 3890 858 23902 3693
NM_004821chr53593 585 510 1322 3624 615 612 --
NM_004822chr1773913 3736 3715 2468 1389 925 282 32881 1254 587 23702 528 --
NM_004824chr621146 384 --2396 393 1488
NM_004831chr194925 754 696 168 --3763 760 720 --
NM_004834chr263418 3103 2686 325 150 66 22988 2893 32807 2732 160 1310
NM_004835chr32683 175 --161 --
NM_004835chr32683 175 --161 --
NM_004836chr22725 99 ------
NM_004839chr153617 171 75 --1452 --
NM_004841chr1----51151 880 803 717 323 1980
NM_004845chrX173910 3716 3321 3204 3069 2952 2938 2912 2873 2867 2840 2830 1085 845 697 550 322 --43938 2923 2920 2887 --
NM_004856chr15152 2394 79 ----
NM_004857chr1484697 3305 1919 1719 1585 1126 909 365 33596 3456 955 13392 23666 1399
NM_004859chr1742660 2600 2154 854 --22406 252 --
NM_004860chr172372 231 130 ----
NM_004863chr14115094 4620 3687 3577 3545 1872 1030 671 628 418 187 --53926 3630 3323 715 650 14017
NM_004866chr584016 3544 1658 1478 1008 816 403 153 24008 236 --24757 49
NM_004869chr1811213 11251 --1161
NM_004871chr1793915 3752 3733 1721 1506 958 845 548 177 --44238 3586 3115 429 13461
NM_004872chr11299 ------
NM_004873chr1443067 2477 1194 755 22366 593 32935 2187 1143 --
NM_004879chr11----2655 305 --
NM_004884chr1531577 1416 418 11456 1224 --
NM_004887chr54970 947 298 123 --11005 --
NM_004891chr21170 ------
NM_004896chr103609 370 127 ----11426
NM_004897chr104927 639 143 77 --1264 --
NM_004898chr472842 2609 2589 2272 1957 695 627 22415 1141 12745 --
NM_004902chr201174 ------
NM_004904chr7136360 6123 5688 5472 5043 4709 2098 1963 1789 1435 1417 576 109 34786 4204 613 45865 1577 1574 663 1235
NM_004912chr721750 1391 ----11730
NM_004922chr1021003 663 2902 793 ----
NM_004924chr194901 345 159 112 ----176
NM_004926chr1471779 1494 1347 1317 558 213 71 --31748 680 547 --
NM_004930chr14590 273 177 49 --1276 --
NM_004932chr541476 1413 531 519 --1661 --
NM_004938chr961102 448 262 151 130 69 1293 198 11044
NM_004939chr21155 ------
NM_004947chr362598 1604 687 426 256 247 22002 553 3848 281 278 --
NM_004956chr763566 3074 2855 1838 889 41 --23146 3016 13042
NM_004964chr13523 486 82 1178 2204 49 --
NM_004968chr72642 456 ------
NM_004969chr10--151 ----
NM_004972chr941077 895 209 171 ------
NM_004973chr661334 1224 1160 1066 550 119 ------
NM_004976chr11165194 4864 4826 4762 4447 4194 4187 3882 3592 3567 3559 1747 1398 845 565 56 --21846 1355 --
NM_004978chr151578 1260 409 385 47 11273 2502 478 21285 224
NM_004979chrX81048 1034 1009 828 811 795 310 31 --2389 189 --
NM_004985chr1284204 3703 3687 2963 1585 896 665 478 ----21803 178
NM_004992chrX247980 7659 7523 7088 6783 6375 6169 6006 5699 5670 3059 2619 2567 2456 2292 2236 1828 1508 1378 1282 1221 1215 953 63 67753 5382 2609 1310 762 267 67048 6985 5775 5318 3079 1801 46313 2623 1276 935
NM_004992chrX247980 7659 7523 7088 6783 6375 6169 6006 5699 5670 3059 2619 2567 2456 2292 2236 1828 1508 1378 1282 1221 1215 953 63 67753 5382 2609 1310 762 267 67048 6985 5775 5318 3079 1801 46313 2623 1276 935
NM_004993chr142552 504 21361 181 1992 --
NM_005004chr10--129 ----
NM_005010chr731477 230 32 1651 32139 2034 282 --
NM_005011chr751752 1464 1454 1364 1270 11532 ----
NM_005020chr75565 528 177 71 64 ----2557 88
NM_005021chr64276 148 142 107 ------
NM_005023chr511425 ------
NM_005026chr161433 1308 791 550 436 310 31445 275 203 2794 330 --
NM_005028chr1012035 --12252 --
NM_005032chrX3720 259 184 ------
NM_005040chr112332 28 ------
NM_005044chrX43022 1355 123 95 14137 23714 3032 23727 3677
NM_005045chr72848 729 ----130
NM_005053chr193366 211 157 1408 ----
NM_005055chr11----128 151
NM_005056chr1285019 4942 2192 1981 1813 1786 1445 192 31639 1616 665 54154 2029 1582 705 390 1197
NM_005063chr1072453 672 386 235 210 199 23 23632 3525 73434 3244 2680 1390 1199 991 956 --
NM_005065chr1495343 4883 3685 2001 1977 1902 1857 1194 636 24833 642 35115 2031 1646 --
NM_005076chr1104231 4158 3610 3586 3214 2914 2764 2641 1257 503 34024 1369 452 13737 --
NM_005078chr1541451 1170 1146 223 --31472 1173 327 --
NM_005079chr853120 1217 370 212 124 --12271 --
NM_005080chr223736 299 230 ----1946
NM_005087chr31785 1861 --1118
NM_005088chrX1268 2813 628 --1183
NM_005093chr20145385 4857 4749 4514 4453 4116 3411 1887 1729 1468 1092 800 711 444 23335 235 41332 1258 1164 258 --
NM_005095chr142048 1373 873 96 --1246 --
NM_005096chrX31018 448 285 --1170 --
NM_005099chr131311 878 133 --1517 --
NM_005105chr171981 1910 1805 1533 758 745 369 --1684 --
NM_005109chr372565 2112 1969 865 620 364 247 1709 52528 2476 2037 156 141 1251
NM_005110chr52639 181 3671 628 250 1530 --
NM_005112chr441035 859 172 74 ------
NM_005116chr20124316 3859 1487 1002 983 968 445 406 374 304 267 54 13846 11470 13444
NM_005119chr131307 1066 255 ------
NM_005121chr1722993 892 11509 23259 2387 --
NM_005124chr62217 139 --1133 --
NM_005126chr321951 848 --12208 --
NM_005128chr213659 652 640 --1511 --
NM_005133chr112373 294 ------
NM_005134chr185762 311 273 265 228 --2353 109 --
NM_005135chr15123639 3630 3448 3331 2699 2612 1274 1001 898 752 659 583 154 13417 --
NM_005146chr111216 1206 2220 70 --
NM_005156chr9104706 4320 4076 3797 3642 3512 1624 1510 1417 1150 --24102 21 --
NM_005157chr971955 1748 1331 603 404 386 369 1417 21584 202 1409
NM_005163chr144972 232 120 88 ------
NM_005166chr192342 47 ------
NM_005168chr221761 1299 ------
NM_005180chr102363 240 ------
NM_005181chr84778 652 69 60 ------
NM_005184chr1951157 1146 1121 1097 213 4332 312 246 233 3350 181 174 --
NM_005186chr115567 507 146 131 105 ------
NM_005187chr1661654 1496 1322 523 409 380 21626 1310 1344 11440
NM_005188chr11247928 7870 7129 6788 6647 6032 5972 5742 5724 5659 5551 3282 3140 3127 2789 2617 2464 2310 1683 1426 1227 639 629 85 67264 6898 5715 5254 3080 228 96912 5587 5489 5457 2923 1383 1372 1364 1142 27989 1644
NM_005190chr611012 11162 ----
NM_005197chr14146095 5506 5377 4991 4946 4807 4373 1737 1585 1493 1470 1456 1261 140 26196 2238 14532 25082 308
NM_005202chr171959 1785 1646 1598 1584 886 35 21617 423 31802 894 147 21576 482
NM_005203chr101163 ------
NM_005206chr171413 ----1983
NM_005215chr181510 --1170 --
NM_005219chr561627 489 412 338 288 130 --192 --
NM_005220chr1711253 1316 21290 449 1135
NM_005222chr75613 389 258 219 213 --2202 186 1195
NM_005224chr192577 245 ----1701
NM_005229chrX3929 879 411 1171 ----
NM_005230chr12----1392 --
NM_005233chr362164 1800 1780 1763 588 255 --12185 --
NM_005235chr2187709 7611 7586 7573 7024 6735 5764 5561 5511 5471 5441 1587 743 677 223 216 79 67 27593 2197 95977 5366 3036 2809 2444 1911 352 349 82 1896
NM_005238chr1172962 2577 2547 2480 2434 2174 1398 22871 1193 12658 --
NM_005241chr341316 1086 957 456 1297 1983 --
NM_005244chr20--1481 ----
NM_005252chr144541 304 198 84 --1311 --
NM_005254chr1521086 328 --2979 453 --
NM_005256chr111245 154 ----
NM_005257chr1851269 884 552 382 351 --11173 --
NM_005259chr21298 ------
NM_005261chr82417 269 ------
NM_005271chr1041001 93 32 22 ------
NM_005275chr6124 ------
NM_005276chr1251522 705 624 587 263 ----1255
NM_005276chr1251522 705 624 587 263 ----1255
NM_005277chr441602 1418 640 240 ------
NM_005279chr22176 49 ------
NM_005281chr12657 301 --1754 --
NM_005302chr72301 78 ------
NM_005308chr103346 161 51 ------
NM_005311chr752883 781 733 710 407 1542 31909 1905 1792 --
NM_005312chr972658 2579 2477 2405 1949 1006 180 1906 21816 184 --
NM_005313chr152394 147 139 11124 --
NM_005316chr111957 --1943 --
NM_005318chr2241163 171 142 72 --3876 860 63 --
NM_005324chr1751745 1587 1456 633 462 11900 ----
NM_005328chr82698 249 --1590 150
NM_005329chr1682262 2242 2068 1977 1578 936 384 276 --1884 11721
NM_005334chrX6544 488 241 144 138 128 21548 33 2454 247 --
NM_005336chr252028 1797 845 404 113 32170 477 172 22153 1879 --
NM_005339chr453540 812 754 663 426 ----11595
NM_005342chrX52851 2722 2541 1928 266 ----12046
NM_005347chr921649 536 ------
NM_005349chr41486 1568 ----
NM_005359chr18136460 6197 6026 5102 5055 4382 4364 4304 2185 1895 1681 770 250 --36358 5346 185 1831
NM_005374chr1782427 2400 2262 1782 1773 656 426 387 --22363 2107 31536 702 692
NM_005375chr62390 66 --1806 --
NM_005378chr21827 1216 2758 324 --
NM_005380chr131063 859 260 --121 11318
NM_005382chr8185 ------
NM_005385chr332178 2151 1072 --22503 2105 22423 1987
NM_005387chr11--1601 --1205
NM_005388chr961666 1602 1343 557 72 28 ----1561
NM_005389chr62208 22 --1673 127
NM_005392chr971670 1362 1191 493 205 114 23 1350 11181 --
NM_005397chr783598 3525 3393 3067 1273 975 711 585 --31400 555 189 --
NM_005398chr10--21436 1008 3952 268 265 --
NM_005399chr1104345 4242 3782 2800 2794 1316 1209 1082 1067 902 21448 594 2577 561 --
NM_005400chr2112971 2751 2674 2668 2259 2249 883 656 480 164 96 ----12805
NM_005402chr731867 1602 1426 --31747 1373 334 --
NM_005407chr1491506 1383 1283 1276 409 307 300 249 99 --31286 291 201 --
NM_005409chr421076 197 ------
NM_005412chr123490 181 46 ------
NM_005413chr26362 74 50 39 30 21 1102 292 83 --
NM_005415chr21266 --1237 --
NM_005418chr113695 570 95 1118 1579 --
NM_005430chr1251039 997 947 862 415 --6950 899 822 406 385 151 --
NM_005433chr1832374 2166 308 --12194 12752
NM_005435chr71571 ------
NM_005436chr1063473 2888 2808 1636 417 323 1658 175 13797
NM_005437chr1051105 1033 915 224 115 ------
NM_005439chr123495 468 388 --2184 74 --
NM_005440chr1752481 826 186 176 167 22411 192 33267 2330 393 23285 2938
NM_005443chr42466 125 ------
NM_005455chr141434 1222 1157 742 ------
NM_005458chr952417 2232 1669 247 214 1465 --11706
NM_005461chr2021532 1225 ------
NM_005465chr122041 1596 --21634 821 --
NM_005474chr1771408 1269 1263 1228 559 417 212 3510 425 130 41235 1231 569 272 --
NM_005475chr1282993 2607 2148 2050 2031 1301 778 432 1998 3205 90 86 23018 2757
NM_005479chr1031588 360 303 --21208 1014 --
NM_005487chr2241910 1637 1575 1485 --21568 259 179
NM_005488chr223715 657 76 --3669 661 122 --
NM_005494chr7----1663 --
NM_005497chr1775322 4936 4801 1860 1572 1315 710 21518 243 --24163 2118
NM_005501chr172172 28 1747 148 --
NM_005502chr942801 2208 2179 53 --22250 2140 --
NM_005504chr12186591 5805 5604 5394 5367 5190 4753 4494 4347 4271 2521 2445 2053 1766 1626 1545 268 151 21278 515 44283 1684 548 489 --
NM_005505chr122334 79 --1382 1689
NM_005507chr111325 --2441 171 --
NM_005509chr521708 400 ----1325
NM_005512chr1151921 1522 1478 1258 133 1818 --11302
NM_005513chr351465 603 356 204 27 --2562 21 --
NM_005515chr72622 58 ------
NM_005517chr131367 1334 350 --1251 --
NM_005522chr71284 --1108 --
NM_005523chr731337 1301 603 ------
NM_005524chr33325 50 24 ------
NM_005530chr1561448 1197 1185 995 387 312 --21470 1188 --
NM_005537chr131129 ----1849
NM_005539chr1031055 499 348 --11109 --
NM_005541chr241190 1061 1025 90 1753 1995 --
NM_005542chr721709 194 --1639 --
NM_005544chr23755 118 54 1915 --1956
NM_005562chr121457 492 1554 2521 422 --
NM_005563chr11619 --125 --
NM_005565chr54469 192 136 32 ------
NM_005566chr11------1434
NM_005570chr1811040 --1821 --
NM_005573chr55662 600 253 144 100 ------
NM_005578chr3155111 4787 4672 4369 3776 1974 1920 1735 1603 1448 1146 952 853 484 103 22063 1588 94806 4802 4796 4793 4780 4777 4764 4761 3873 --
NM_005581chr192104 97 --2136 132 --
NM_005584chr131110 --1573 --
NM_005587chr152341 276 ------
NM_005593chr122437 195 ----131
NM_005595chr13363 305 177 ------
NM_005596chr975917 5811 5182 4915 4106 2509 2281 35567 1801 927 12464 193
NM_005599chr131045 528 336 --11313 --
NM_005604chr62707 575 --2775 582 --
NM_005607chr84881 868 713 148 ------
NM_005609chr111255 ------
NM_005610chr13286 215 44 ------
NM_005611chr163920 157 83 1830 ----
NM_005613chr152132 1842 1606 1597 867 1395 1306 --
NM_005614chr73674 96 66 1887 ----
NM_005618chr63629 143 33 ------
NM_005625chr851058 1012 998 791 255 --2343 47 --
NM_005626chr11205 --1152 --
NM_005627chr62940 176 --2215 212 --
NM_005634chrX2624 454 ------
NM_005637chr1841724 834 490 89 ------
NM_005638chrX41720 1404 1299 608 --1508 --
NM_005644chr1----1349 --
NM_005647chrX6868 842 822 792 638 407 177 23224 641 --
NM_005652chr1641168 1028 434 191 1915 11110 --
NM_005653chr12135 ----140
NM_005655chr841182 1090 365 241 ------
NM_005659chr221373 ------
NM_005662chr82134 80 ----1117
NM_005669chr522202 349 12290 ----
NM_005686chr12287 30 --21547 1136 --
NM_005688chr351020 482 402 100 79 ------
NM_005707chr151318 --1142 --
NM_005708chr132376 337 ------
NM_005711chr53440 249 29 ------
NM_005717chr12943 102 ------
NM_005721chr21859 ------
NM_005722chr24686 514 251 48 1823 1458 --
NM_005725chr141584 668 437 389 --1671 1885
NM_005730chr1293405 3063 1180 1133 1083 684 424 345 325 1508 43287 2951 1153 730 --
NM_005731chr21109 --2356 272 --
NM_005734chr112710 643 ------
NM_005736chr1011420 --1989 --
NM_005737chr252894 2860 2808 2264 2055 1788 21796 383 --
NM_005738chr72201 40 --11785 --
NM_005746chr722661 1955 12336 12697 --
NM_005748chr1273244 2547 2297 1255 1236 1072 473 ------
NM_005749chr171513 ------
NM_005752chr1641127 851 275 262 123 ----
NM_005754chr53466 269 172 ------
NM_005756chrX1484 --11029 --
NM_005759chr284698 3891 3516 1892 1722 389 327 46 --43635 3023 534 357 2941 453
NM_005761chr12137 ------
NM_005766chr133945 281 53 --1352 --
NM_005776chr142850 295 ------
NM_005779chr573422 3399 3146 798 771 727 318 12419 4849 731 434 27 --
NM_005786chr1841267 989 890 92 ------
NM_005789chr1792166 1895 1575 1531 1419 792 486 439 302 32174 1338 597 62064 1949 1945 467 343 206 --
NM_005795chr262744 2382 2121 760 581 39 ------
NM_005796chr16145 170 135 --
NM_005801chr17139 1151 ----
NM_005802chr92528 108 --1111 --
NM_005807chr1----2222 210 --
NM_005808chr363377 1346 992 949 316 303 12880 23574 799 --
NM_005811chr12196 ------
NM_005813chr231928 311 303 1269 1992 --
NM_005814chr151262 1242 90 71 49 --21093 129 --
NM_005822chr651696 819 684 451 36 11770 1117 --
NM_005826chr1161 --1174 --
NM_005828chr17194224 4152 3750 3743 3668 3271 1966 1928 1678 1646 1601 1505 1100 737 582 576 559 260 233 --64589 3778 2025 445 339 244 --
NM_005832chr341272 976 254 60 ------
NM_005839chr12375 297 1741 --1804
NM_005840chrX207206 6898 6521 6187 4803 2687 2155 2097 922 721 680 620 598 565 526 501 463 397 202 180 26528 2323 6915 584 576 573 494 33 11438
NM_005841chr45928 457 158 151 117 --1734 --
NM_005843chr251772 1587 1324 512 264 --11939 --
NM_005845chr1321335 658 --1137 --
NM_005851chr113315 293 62 ------
NM_005852chr1721168 150 1263 21045 276 1179
NM_005857chr11602 --31445 1441 570 --
NM_005859chr531488 523 182 11445 ----
NM_005863chr1051422 572 492 282 68 ------
NM_005871chr1031020 279 185 ------
NM_005876chr21622 --1702 --
NM_005882chr41967 --2357 67 --
NM_005884chr193626 262 89 ------
NM_005885chr52226 167 --11073 --
NM_005895chr1294157 4038 2978 2965 2576 1086 1031 654 394 --32822 1089 1071 --
NM_005896chr25810 776 642 631 282 --1649 --
NM_005898chr1172228 2073 1294 1242 831 252 92 ----1956
NM_005900chr431192 822 802 --11121 --
NM_005901chr18178411 8246 8172 7878 7306 6830 6315 6294 6128 5912 5577 5334 3455 2921 2224 1500 937 27499 2365 18494 15975
NM_005903chr594506 4474 4168 4086 1931 1791 1645 670 623 23381 405 13498 13557
NM_005904chr1831053 594 139 --174 --
NM_005906chr631310 385 56 ------
NM_005907chr651627 1283 440 175 60 --1351 --
NM_005909chr5104089 3329 3284 3255 2912 2711 1293 524 161 53 34259 3222 693 --12832
NM_005910chr17134009 3884 3684 3526 3221 3204 2983 2878 1424 1123 865 296 284 23794 3283 33001 868 314 --
NM_005911chr261199 1181 945 493 100 81 ----11034
NM_005916chr7131 --1104 --
NM_005920chr1173706 3591 3491 3224 2971 2902 2435 2419 2373 1474 1443 1176 1163 846 103 83 21 13604 43056 3053 2422 1139 --
NM_005922chr61142 ------
NM_005924chr7----2981 836 --
NM_005927chr53913 294 201 1794 21004 176 1314
NM_005928chr152705 27 ------
NM_005933chr1162480 2353 2132 2070 1947 515 --52835 2761 2422 728 224 1343
NM_005934chr19102130 1826 1723 939 926 739 504 479 147 73 12157 21969 945 --
NM_005935chr465279 4192 4138 3852 3565 2099 23391 1770 21528 883 24073 1758
NM_005938chrX1222 11263 11081 --
NM_005941chr863606 3590 3323 859 326 213 21452 841 2354 257 12947
NM_005943chr651321 1243 1144 1138 397 1162 31398 1121 60 1109
NM_005955chr1155031 4965 4838 4649 4608 4492 4266 4149 3399 2083 1815 1490 813 770 419 --34564 4343 905 12038
NM_005962chr1062272 1939 1799 1773 320 95 ------
NM_005962chr1062272 1939 1799 1773 320 95 ------
NM_005964chr1721297 998 11033 21043 99 1497
NM_005966chr222045 1579 11977 12316 --
NM_005967chr122115 101 1638 2556 105 --
NM_005969chr113989 227 220 1923 1475 --
NM_005977chr131867 ------
NM_005982chr141195 --1230 --
NM_005986chr1362559 2259 2171 1798 1785 733 1556 1379 1807
NM_005990chr582583 1966 1859 917 634 543 333 240 22420 55 22641 535 --
NM_005996chr1241358 1254 1049 104 ----1377
NM_006007chr923733 1592 33510 1767 101 14149 14470
NM_006010chr3----1181 --
NM_006011chr1584158 3455 3364 3324 2963 2829 1315 1026 24079 2975 74047 3926 3827 3701 3677 3186 3020 11530
NM_006015chr161257 912 206 162 154 127 --11246 --
NM_006016chr622183 270 --11835 --
NM_006020chr1461307 1231 1125 1089 1072 296 1489 --1265
NM_006033chr1852277 829 427 314 103 ------
NM_006036chr232291 2058 819 3978 384 131 1426 --
NM_006037chr2124822 4770 4696 4328 4107 4096 3559 3091 1647 1598 1354 644 13003 23523 3125 13081
NM_006038chr2031456 1401 320 22220 864 11824 11614
NM_006039chr1721049 419 --1310 --
NM_006040chr1651106 886 508 453 114 1121 21393 568 11068
NM_006047chr2032574 2516 1404 --32745 2530 920 --
NM_006048chr161231 1205 1115 914 895 268 ------
NM_006054chr1151380 1058 486 452 339 21368 1143 1140 11115
NM_006060chr7104288 3775 3307 3240 3124 2723 1068 957 926 781 34100 1511 304 23887 960 --
NM_006062chr241231 1102 363 58 21212 938 1317 1264
NM_006064chrX5396 373 327 307 109 ------
NM_006067chr1621021 888 1250 ----
NM_006079chr6145 ----1302
NM_006080chr743022 2986 887 288 ------
NM_006089chrX71782 1362 587 575 488 445 72 ----11427
NM_006090chr11689 ------
NM_006094chr851913 1757 1558 668 420 ------
NM_006095chr494358 3843 3520 3183 2848 2803 1655 1618 1523 14502 23006 915 --
NM_006096chr851401 669 460 270 56 1240 31275 1258 411 --
NM_006106chr1173475 2504 2399 421 412 310 153 33274 2896 141 21244 560 --
NM_006113chr141890 434 317 124 --1269 --
NM_006133chr1152359 2273 1739 703 605 12164 21935 874 --
NM_006134chr2141579 1466 1344 27 --21315 1117 11378
NM_006135chr161251 1042 1005 490 392 21 11412 ----
NM_006136chr731174 1009 261 --1467 --
NM_006139chr2102439 1904 1865 756 689 559 405 322 315 134 ------
NM_006142chr1189 --1473 --
NM_006147chr15496 476 447 408 98 1127 224 21 --
NM_006148chr17122574 2266 2207 1953 926 766 507 329 221 184 158 76 1130 42955 2597 2071 624 --
NM_006154chr1552226 1920 745 632 105 --1820 --
NM_006156chr14159 ------
NM_006158chr821582 37 11819 2570 172 1574
NM_006159chr122645 565 ------
NM_006160chr1751384 1234 634 340 233 1257 21577 328 --
NM_006166chr1212550 --12590 --
NM_006167chr882039 2028 1681 970 616 606 346 143 --2944 941 1204
NM_006176chr112299 272 1687 1275 --
NM_006178chr1741289 1038 452 161 --31499 1395 255 21479 1060
NM_006180chr961782 283 240 213 167 26 1104 --11591
NM_006185chr11161 1168 1658 --
NM_006186chr22910 820 ------
NM_006190chr21951 160 21094 904 --
NM_006191chr122716 693 186 --1642
NM_006195chr961397 1360 1266 1145 579 514 ------
NM_006196chr2142 ------
NM_006197chr832040 1832 497 1457 1138 11767
NM_006198chr212247 214 --1231 --
NM_006201chrX4850 820 427 79 1223 1854 11100
NM_006202chr19101974 1885 1292 618 598 473 460 95 70 37 31833 780 410 11390 11245
NM_006203chr585119 4198 3742 3491 1617 945 504 344 14085 --13982
NM_006206chr432427 1115 802 --124 --
NM_006212chr193784 1879 1843 1648 1326 1008 642 460 189 --5948 660 652 487 103 1431
NM_006224chr1791966 1913 939 913 907 864 225 135 116 12523 22141 1618 11802
NM_006226chr22357 52 ------
NM_006237chr1332132 1423 727 --42146 2114 738 68 1145
NM_006239chr41707 179 --1501
NM_006241chr351585 970 903 598 75 11526 12177 --
NM_006242chr2061594 789 757 323 113 94 ------
NM_006243chr12962 312 2785 662 3897 738 729 --
NM_006245chr63833 381 177 2974 335 1342 --
NM_006246chr144518 468 446 321 ------
NM_006251chr553350 3019 2853 1283 599 1454 11036 1485
NM_006252chr1107460 6702 6253 6176 5538 4803 2860 2640 960 792 --47496 6544 5344 1540 12462
NM_006256chr142732 2382 1810 165 ------
NM_006257chr10277 40 ------
NM_006265chr831312 467 335 --1129 --
NM_006267chr251842 1787 751 660 329 11177 1581 --
NM_006268chr1141028 323 243 44 3398 96 51 4980 867 87 84 --
NM_006279chr11934 1302 ----
NM_006282chr20104725 4714 3789 3393 3140 1518 1131 1001 935 314 --14729 14641
NM_006283chr8124605 4030 4015 3105 3085 3014 1883 1285 1096 894 602 348 44060 3861 1895 363 24416 3569 --
NM_006292chr113183 53 47 ------
NM_006293chr151121 2756 663 1174 --
NM_006298chr642987 994 842 634 21103 689 42729 2068 560 363 12845
NM_006300chr1952341 1809 1658 611 501 1410 22286 217 --
NM_006306chrX105914 4989 4780 4417 4398 4365 2091 1526 1464 909 14554 1267 15882
NM_006307chrX----130 --
NM_006310chr1731278 1158 972 ------
NM_006313chr1241373 1051 497 296 ------
NM_006315chr4134219 3583 3428 3370 3361 3192 1507 1498 1396 1250 1186 418 223 11351 ----
NM_006317chr55667 118 104 91 48 3786 597 361 2607 604 --
NM_006320chr42321 310 --2303 291 --
NM_006321chr342186 1858 1647 162 --21628 878 --
NM_006323chr41487 ------
NM_006325chr122314 232 ------
NM_006330chr831345 647 256 ------
NM_006336chr93403 274 148 11127 41426 1335 1241 1231 --
NM_006345chr431032 492 329 --173 1517
NM_006350chr5133 ------
NM_006352chr121925 217 --11946 --
NM_006354chr32329 262 --2265 64 --
NM_006358chr2241162 946 412 74 --2452 51 --
NM_006359chrX72326 832 496 434 408 302 181 12033 12027 1680
NM_006361chr1791991 1694 1387 766 687 569 524 415 150 11645 3745 691 572 --
NM_006364chr142373 63 1856 1907 --
NM_006367chr12778 440 --1782 184
NM_006369chr12118 98 --3358 133 129 --
NM_006371chr353216 593 572 513 213 24584 3615 2775 27 1818
NM_006375chrX41402 616 442 100 --21479 221 --
NM_006378chr941029 181 153 140 21340 576 170 1466
NM_006379chr752026 1775 624 343 264 ------
NM_006380chr1754257 3973 3546 3313 2742 11124 --1406
NM_006382chr171270 ------
NM_006386chr22112242 2232 1858 1659 1511 638 545 458 188 99 64 --3790 285 76 --
NM_006389chr1151218 879 855 212 111 11129 51062 503 410 397 174 --
NM_006393chr1094108 3982 3230 3223 2831 607 573 254 115 24273 2962 1868 23660 872
NM_006401chr9----1165 --
NM_006405chr14141 ------
NM_006407chr331120 895 558 --11113 --
NM_006408chr7------2981 267
NM_006411chr66689 334 121 93 41 23 --2902 44 --
NM_006416chr61672 ------
NM_006420chr2043342 2584 2360 762 --12770 --
NM_006421chr83827 254 91 1265 ----
NM_006431chr121211 ------
NM_006434chr1043194 2972 2016 427 ------
NM_006439chr43510 447 353 ----1217
NM_006449chr251576 1526 1481 793 22 1468 11546 --
NM_006451chr531033 724 345 ----11107
NM_006454chr431943 872 552 169 ----
NM_006457chr4113781 3163 3007 2930 2777 2591 1632 1529 1110 923 347 --1932 12705
NM_006459chr1041942 1647 633 225 2530 24 --11313
NM_006460chr1741406 539 241 222 11340 1173 --
NM_006463chr2------1603
NM_006464chr2114476 4423 3239 2943 1875 1617 1606 1114 448 251 100 31744 1384 170 22968 294 22992 1119
NM_006465chr15102268 1994 1940 1909 1785 1425 853 843 831 421 ----1272
NM_006469chr131441 1292 332 1294 --11408
NM_006471chr183221 62 31 ------
NM_006472chr13828 271 55 ------
NM_006482chr1263208 1338 1202 1099 783 367 --4852 807 794 775 41239 856 673 547
NM_006488chr26921 621 286 227 210 61 ------
NM_006489chr141660 1608 ----
NM_006496chr121892 1247 --1490 --
NM_006497chr173757 522 281 1796 1565 --
NM_006503chr191112 ------
NM_006509chr192379 102 1275 ----
NM_006510chr62867 743 --2351 163 1860
NM_006516chr141472 1028 532 363 21515 1479 11433 1128
NM_006517chrX3580 181 39 --41970 1497 588 216 22159 601
NM_006519chr6185 151 128 --
NM_006520chrX11730 --1458 --
NM_006526chr2041887 1481 820 459 11417 1716 --
NM_006527chr42101 37 2278 244 ----
NM_006532chr1941772 1537 588 241 22069 1509 ----
NM_006534chr2053207 3201 2391 409 206 --32805 1174 561 11285
NM_006540chr8125 ------
NM_006544chr1486001 5342 4278 2209 1459 1363 433 36 15688 ----
NM_006546chr17146515 5958 5937 5829 5215 5121 4645 4595 4379 4220 2286 2143 1672 1420 16198 76519 6277 4351 2644 2439 2152 421 26226 335
NM_006547chr762075 1851 1743 1672 605 316 ------
NM_006548chr321489 1198 ----11710
NM_006549chr1242863 2579 722 143 32662 2309 306 32443 2022 699 22341 2056
NM_006558chr82495 388 ------
NM_006559chr141134 397 134 119 ------
NM_006560chr112470 206 ------
NM_006561chr10155522 5238 4920 4657 4042 3957 3829 2451 2386 2211 1669 1389 1287 581 167 35494 4423 1545 95924 4980 4800 4339 2365 2214 1712 1109 393 12445
NM_006562chr102114 95 --1292 --
NM_006565chr1611104 --2361 71 --
NM_006570chr92385 307 --1134 --
NM_006572chr1732982 744 323 --22187 605 --
NM_006574chr3167 ------
NM_006593chr210753 663 652 646 623 298 270 254 90 64 ------
NM_006595chr1142064 1860 1351 75 --1435 --
NM_006599chr16267849 7564 7546 7410 7292 7070 7063 6926 6834 6433 5585 5381 3153 2577 2561 2242 1786 1745 1736 1701 1436 1153 815 773 378 294 17577 67390 7183 5865 5151 1757 1678 38055 6402 5143
NM_006601chr1241126 776 453 322 --1981 --
NM_006602chr202275 202 --144 --
NM_006603chrX31918 1717 100 11816 1757 --
NM_006609chr262979 2886 2387 1928 511 130 ----12357
NM_006614chr362677 2561 2257 1306 849 161 --1362 --
NM_006618chr1111381 1318 1152 1111 990 523 508 500 211 130 64 --1527 --
NM_006621chr171698 1663 1604 785 415 210 80 1675 195 1603
NM_006622chr53485 219 34 ------
NM_006624chr101171 11389 ----
NM_006626chr941701 985 958 837 11682 41890 1791 792 255 1913
NM_006628chr15124237 4219 4094 3991 3856 3540 1807 1740 1307 1288 387 79 13957 21279 46 --
NM_006629chr1832511 2445 1049 22583 325 11769 --
NM_006640chr1711830 --11780 198
NM_006644chr131568 ----127
NM_006646chr1352588 2184 1868 1140 443 1403 2744 265 22552 2482
NM_006650chr583821 3253 2663 1035 706 548 141 123 33554 3317 2518 1304 1553
NM_006651chr471476 1446 1371 1299 249 204 56 --2959 558 --
NM_006654chr12104343 3970 3553 3378 3034 1566 1325 1279 1211 535 11091 34167 1844 780 --
NM_006660chr15----139 --
NM_006662chr161125 --1133 --
NM_006670chr62159 142 190 ----
NM_006681chr4171 ------
NM_006682chr722871 1031 --11034 157
NM_006690chr2042198 1971 1663 52 2930 487 ----
NM_006694chr14343 271 258 126 ------
NM_006698chr2081141 1125 955 564 557 460 444 389 --21255 393 --
NM_006699chr172740 2505 2359 2290 1971 696 654 --32726 2723 399 22448 456
NM_006700chr122781 576 ------
NM_006703chr63182 99 59 ------
NM_006704chr13------1148
NM_006706chr51619 --1296 --
NM_006708chr6101270 1195 1083 991 977 534 387 282 151 117 ------
NM_006709chr62292 57 ------
NM_006710chr23949 322 113 ------
NM_006713chr5--188 ----
NM_006717chr943127 2534 2441 1163 13066 12276 --
NM_006722chr382395 2213 2139 776 712 356 96 40 ------
NM_006724chr61142 ------
NM_006726chr431081 916 447 ------
NM_006732chr1971526 818 659 556 413 177 125 --11797 --
NM_006734chr621230 348 ------
NM_006735chr72359 96 ------
NM_006736chr241762 1190 742 527 --3613 609 606 --
NM_006738chr1594558 3870 3461 3012 1833 1788 1199 629 121 14064 13209 13750
NM_006742chr1651984 1713 588 439 137 ----31497 592 425
NM_006746chrX51436 1077 537 521 404 ------
NM_006749chr831108 980 888 ------
NM_006750chr16156255 6071 5413 5190 4903 3183 2771 2679 2066 1744 974 815 681 517 368 45570 3101 1726 95 67820 7331 7305 5468 3163 1803 16737
NM_006751chr24892 748 237 39 ------
NM_006761chr175744 736 723 697 45 ------
NM_006763chr131603 1445 860 2463 176 11300 21589 1438
NM_006766chr861843 1795 1757 734 604 203 --12626 1448
NM_006772chr6121720 1646 1639 1616 1286 1205 1104 675 558 519 306 29 --21448 203 11701
NM_006775chr621210 409 22001 177 --11170
NM_006777chrX42871 2437 1054 814 12334 12837 --
NM_006778chr611923 21679 27 --1391
NM_006783chr131250 152 181 --
NM_006788chr1881755 1518 830 712 568 561 361 127 1151 1130 --
NM_006791chr151174 ------
NM_006802chr13930 287 83 1981 169 --
NM_006805chr5------1162
NM_006807chr17----1360 --
NM_006811chr20--148 1923 1838
NM_006814chr2052138 2011 262 241 42 1686 22252 829 --
NM_006815chr1241018 300 292 237 ----2392 81
NM_006818chr18932 868 667 648 364 176 62 44 --1243 --
NM_006819chr11--1388 --1338
NM_006823chr82993 867 --1312 --
NM_006826chr261249 470 432 162 61 23 ----132
NM_006827chr1483394 2590 2260 1063 468 445 344 22 1827 22263 966 13201
NM_006832chr141216 ------
NM_006833chr72140 71 ------
NM_006846chr5189 ------
NM_006851chr1292775 2751 2199 1161 938 887 846 751 646 --22806 2407 --
NM_006852chr1762564 2352 1920 1110 932 844 --42634 2364 2361 691 22730 2227
NM_006854chr741788 1556 681 546 133 11839 1415
NM_006856chr1271138 965 886 874 402 369 354 ------
NM_006861chr1261500 1384 1374 545 220 69 --1152 --
NM_006870chr20149 1814 ----
NM_006873chr2113243 3064 2867 2676 2505 1282 1130 1045 728 709 553 --1363 11329
NM_006874chr411216 ------
NM_006875chrX4884 877 799 755 --1215 --
NM_006884chr32113 76 11821 11360 --
NM_006885chr1683866 3519 3408 2935 1697 1327 1093 1066 --63441 3114 1515 1365 1101 1041 13513
NM_006887chr2----1198 --
NM_006888chr1443069 3031 1195 548 12714 13129 13299
NM_006894chr12311 304 ------
NM_006898chr22736 223 1682 ----
NM_006906chr112168 127 --1101 --
NM_006908chr721307 1103 ------
NM_006915chrX52471 2222 1816 350 249 ------
NM_006920chr221964 1957 ------
NM_006922chr212598 1663 ----
NM_006924chr1763765 3527 1380 870 577 50 12808 --11210
NM_006930chr531916 1280 558 --21869 1848 --
NM_006931chr1272096 1528 866 485 429 204 115 1802 1291 --
NM_006937chr172149 118 ------
NM_006939chr141915 1174 ----
NM_006940chr1281597 1386 758 637 542 487 471 88 1565 11249 --
NM_006947chr441253 1179 503 150 --31679 1450 1282 --
NM_006950chrX4687 169 133 64 1112 1314 --
NM_006958chr8153 --142 --
NM_006965chr1851168 1149 978 459 45 1269 --11103
NM_006979chr62618 553 ------
NM_006981chr972912 2632 2171 502 160 96 33 22922 2641 32789 518 514 --
NM_006988chr211783 --11126 --
NM_006990chr182155 2081 1875 1780 1622 1567 614 298 --2184 39 2248 164
NM_006996chr1122 ------
NM_006997chr101123 ----169
NM_006999chr51143 --2326 242 2401 246
NM_007005chr9131 ------
NM_007007chr1244730 3543 2944 1545 --24333 4329 --
NM_007010chr1731469 1180 261 ----11215
NM_007011chr1595881 4356 1986 1921 1907 982 532 163 38 36694 4744 823 85847 4581 4535 4531 2678 2653 1560 1439 22658 208
NM_007013chr81410 --11010 1137
NM_007015chr131270 1287 ----
NM_007017chr52811 193 ------
NM_007026chr172470 103 ------
NM_007033chr162279 2074 1471 1436 220 72 ------
NM_007034chr1----1220 --
NM_007036chr52844 822 ------
NM_007039chr1411680 --22051 1563 --
NM_007040chr194922 886 421 72 --4909 277 266 162 146
NM_007045chr6----1543 --
NM_007050chr20206865 6487 5940 5905 5734 5629 5347 5301 5132 2718 2348 2320 1631 1519 1505 1452 1159 753 382 217 67779 6805 5075 1427 483 420 26331 1616 11739
NM_007067chr1771359 1218 1153 1130 533 317 74 21296 1123 ----
NM_007073chr643814 3651 1129 353 13270 33775 3277 927 13419
NM_007078chr1041147 494 150 83 ----11976
NM_007084chr1331196 408 401 --1412 --
NM_007106chr1382837 2726 2651 2402 2371 675 387 150 ------
NM_007107chr352082 757 514 428 285 ------
NM_007111chr133874 618 83 ------
NM_007114chr342779 2070 539 249 ----22996 1073
NM_007118chr52693 21 --1674 --
NM_007124chr621766 214 11835 2409 218 --
NM_007125chrY3381 347 289 ------
NM_007129chr132663 366 --2856 373 --
NM_007144chr1751128 480 468 98 47 ----126
NM_007145chr1931257 952 78 1539 ----
NM_007146chr172379 219 --11097 22189 142
NM_007147chr1921071 215 --1252 --
NM_007158chr131113 436 146 --1444 11192
NM_007159chr3131 --288 85 --
NM_007166chr1121408 532 --1980 2447 115
NM_007170chr1----184 --
NM_007172chr2252994 2031 507 284 78 31326 1125 331 ----
NM_007174chr1252324 1713 925 420 405 11555 1783 --
NM_007175chr853303 3255 2782 2219 736 1104 22447 73 --
NM_007185chr13793 432 52 --2808 221 --
NM_007187chr134991 931 887 699 ------
NM_007191chr121156 ------
NM_007192chr1441001 280 272 84 1415 31113 1044 33 137
NM_007195chr1893149 2891 2488 1495 1271 1140 893 818 532 23621 1407 33437 919 899 22995 2545
NM_007200chr1594558 3870 3461 3012 1833 1788 1199 629 121 14064 13209 13750
NM_007202chr17171 --3648 612 605 --
NM_007203chr993982 3387 3031 2509 1038 788 634 557 515 ----33352 1384 488
NM_007207chr12810 286 --3796 602 275 --
NM_007212chr152298 2292 1619 214 172 ----1543
NM_007217chr31280 ------
NM_007218chr81325 174 ----
NM_007221chr1------1430
NM_007222chr851409 1239 1152 269 36 1643 ----
NM_007224chr123467 171 107 --1637 1507
NM_007232chr202977 720 --1327 --
NM_007236chr15122132 1715 1580 950 835 680 506 402 253 233 99 59 1445 ----
NM_007238chr2094756 4326 4288 4085 3656 3146 1342 416 337 13787 ----
NM_007245chr162757 364 ------
NM_007246chr41381 188 ----
NM_007249chr13199106 8614 8016 7879 7359 6959 6951 6880 6308 5744 3750 2793 2605 2503 2424 1396 1289 849 267 27462 6022 68984 7409 7271 6211 5821 1355 38947 7732 7550
NM_007250chrX2598 370 1193 178 --
NM_007269chr1------1439
NM_007271chr641171 1141 639 420 --162 1156
NM_007275chr32438 310 1818 --3445 396 330
NM_007276chr741141 795 695 219 --1262 --
NM_007278chr173341 140 74 181 ----
NM_007281chr41187 ------
NM_007285chr161154 --1459 --
NM_007286chr552124 855 721 332 214 12040 --1749
NM_007287chr373081 2805 1971 655 482 274 217 1473 22038 1292 --
NM_007288chr373081 2805 1971 655 482 274 217 1473 22038 1292 --
NM_007289chr373081 2805 1971 655 482 274 217 1473 22038 1292 --
NM_007292chr1763828 3615 3319 3303 1075 250 14868 25188 4646 --
NM_007294chr1751276 1153 998 99 83 --11054 --
NM_007295chr1751276 1153 998 99 83 --11054 --
NM_007296chr1751276 1153 998 99 83 --11054 --
NM_007297chr1751276 1153 998 99 83 --11054 --
NM_007298chr1751276 1153 998 99 83 --11054 --
NM_007299chr1751276 1153 998 99 83 --11054 --
NM_007300chr1751276 1153 998 99 83 --11054 --
NM_007302chr1751276 1153 998 99 83 --11054 --
NM_007303chr1751276 1153 998 99 83 --11054 --
NM_007304chr1751276 1153 998 99 83 --11054 --
NM_007305chr1751276 1153 998 99 83 --11054 --
NM_007308chr4195 1127 ----
NM_007313chr971955 1748 1331 603 404 386 369 1417 21584 202 1409
NM_007320chr19----1238 1315
NM_007331chr462508 2341 1900 1777 828 811 11970 12255 --
NM_007345chr1852169 2083 893 494 262 --21676 250 1384
NM_007349chr7------183
NM_007350chr12134461 4394 4086 3643 3616 3417 3233 1616 1425 1339 961 483 159 ------
NM_007358chr131949 1267 727 ------
NM_007362chr331197 1090 1078 ----11479
NM_007363chrX2752 23 --195 --
NM_007365chr182043 1660 586 554 544 524 176 31 144 3866 843 728 1378
NM_007371chr92614 223 1136 ----
NM_007373chr1031220 563 325 ------
NM_007375chr12631 416 12040 22363 290 --
NM_009585chr32683 175 --161 --
NM_009585chr32683 175 --161 --
NM_012064chr1231105 339 152 --21174 214 --
NM_012069chrX102703 2564 2522 999 946 893 621 226 132 82 11928 22550 403 --
NM_012074chr1431020 814 768 --2824 240 --
NM_012081chr553636 3160 897 289 191 ------
NM_012082chr81942 ------
NM_012090chr111066 ------
NM_012095chr1073510 2500 2193 2138 1404 1313 1045 --11415 33515 3437 1111
NM_012096chr373339 3023 2402 1477 1234 604 351 --12567 --
NM_012102chr182428 2194 2156 2042 1871 1787 313 305 2924 877 52399 2387 2249 1981 989 22283 570
NM_012104chr1172463 2398 1381 1032 998 337 310 32673 1391 321 31442 1160 1035 --
NM_012104chr1172463 2398 1381 1032 998 337 310 32673 1391 321 31442 1160 1035 --
NM_012120chr672112 2007 1940 1835 939 916 528 11827 1949 --
NM_012129chr782164 1841 1835 1005 981 875 550 91 1756 1722 --
NM_012134chr141415 1228 654 183 21812 1585 ----
NM_012137chr192552 2378 2136 1930 1910 588 444 435 80 --32163 938 542 12744
NM_012141chr13144164 3679 3296 2999 2929 2911 2859 2709 2683 2546 860 841 168 40 11143 13194 23056 247
NM_012153chr1182453 2436 2417 1610 871 684 406 94 11772 22375 691 22463 1791
NM_012154chr81133 ------
NM_012156chr20153356 3329 3161 3146 2913 2906 2888 2834 2549 1272 888 778 725 272 81 1464 32825 2487 658 --
NM_012158chr1331672 1608 190 ------
NM_012161chr431179 465 175 --11033 --
NM_012164chr9137145 6282 6192 6163 5690 5355 2312 2039 1545 1213 1191 807 448 36216 863 550 56677 5693 2859 1793 1146 17040
NM_012175chr11157 2922 225 1799 --
NM_012180chr43542 536 167 ------
NM_012188chr52932 809 2902 61 11043 --
NM_012193chr11164699 4693 4631 4344 4032 3457 3451 3347 1879 1872 1555 1488 729 682 672 26 --43575 3352 1817 685 14422
NM_012199chr1174230 4079 3301 3268 2964 2952 2923 2878 1802 1541 1482 1437 1304 939 749 670 601 --144610 4055 3956 3828 2930 1871 1525 1441 1152 1085 1075 752 637 131 --
NM_012210chr961131 1045 1011 966 422 25 --21226 388 --
NM_012214chr2146366 6213 5452 4925 4074 3952 2519 2167 2003 1991 890 732 701 529 15472 26437 859 --
NM_012215chr1051674 1665 374 338 227 ----21299 731
NM_012223chr221074 37 --1247 --
NM_012232chr1792057 2039 1674 1619 1453 1441 382 39 31 --42026 1887 1806 51 --
NM_012234chr333533 3337 1275 --31385 1181 1065 1439
NM_012236chr17905 694 617 265 223 171 52 ------
NM_012238chr1021705 1238 --11353 11709
NM_012242chr10----1288 --
NM_012244chr1451640 1291 1160 574 31 11667 21658 35 11649
NM_012249chr272522 2229 1365 1287 1243 162 38 ----23227 1114
NM_012250chr112224 56 ------
NM_012252chr773611 3559 3350 822 730 420 211 --13720 21005 462
NM_012255chr20173 ------
NM_012257chr711017 ----3872 231 172
NM_012259chr641294 941 426 174 142 1952 --
NM_012262chr1154402 4286 3905 3711 3368 3342 2061 2006 1939 1680 1533 1286 1074 872 652 11550 --1776
NM_012266chr941078 434 343 315 ------
NM_012281chr732152 651 516 ------
NM_012286chrX2448 177 ------
NM_012287chr394142 4092 3791 3115 2755 1581 1340 1318 746 --11550 1345
NM_012288chr6195384 5069 4931 4923 4667 4644 4152 3966 3932 3739 3638 3489 2027 767 432 346 218 82 29 33882 3669 1829 85442 4521 3935 2229 2018 225 174 159 2866 184
NM_012290chr231709 459 154 11682 ----
NM_012294chr743397 3025 1475 1433 ----1193
NM_012296chr11113376 3360 3196 3018 1529 1471 844 395 292 193 100 32848 423 283 63429 3426 2680 2642 86 83 --
NM_012297chr432349 821 806 21856 1680 ----
NM_012298chr31219 2668 156 1707 1308
NM_012300chr582083 1811 1659 590 551 478 404 167 --21815 245 --
NM_012301chr741871 876 807 48 --21771 317 --
NM_012302chr1--11087 11096 --
NM_012304chr5132362 2325 2178 2092 1756 943 604 445 300 277 234 153 146 22261 791 42476 2333 923 109 --
NM_012306chr12133421 3123 3064 3011 2934 2403 2271 2241 2226 827 444 434 267 42263 841 236 28 33067 2295 374 13050
NM_012307chr182870 174 11020 1681 --
NM_012308chr1142300 350 192 39 2971 459 1587 21766 141
NM_012309chr11144956 4489 4069 4019 3742 3630 3132 1948 1608 1500 1051 608 445 394 --34194 3370 497 24240 1984
NM_012310chrX2620 580 1201 ----
NM_012316chr1175406 4493 4273 3732 3688 3540 3487 1965 1682 1640 1283 1086 973 745 604 410 362 14184 101923 1919 1316 1102 1099 981 943 401 378 243 --
NM_012318chr441280 1061 504 27 21212 875 ----
NM_012323chr2241076 987 148 95 --1151 --
NM_012325chr2041544 1293 1250 35 ------
NM_012327chr186584 574 275 258 240 41 1625 ----
NM_012329chr1731196 1046 360 ------
NM_012330chr1021693 193 ------
NM_012333chr141538 1246 1191 335 --2615 572 --
NM_012334chr573891 3567 3421 2885 1582 1408 531 13080 ----
NM_012338chr721220 453 1975 1915 11038
NM_012342chr102494 147 ----1536
NM_012345chr1341889 1858 501 154 11868 ----
NM_012382chr574438 4041 3394 2885 1458 581 201 23664 644 23343 3047 --
NM_012395chr7113194 3116 3056 2810 2370 2354 2331 2285 2127 403 175 --12292 --
NM_012398chr1972920 2649 2171 1894 784 731 131 32587 981 791 12784 1848
NM_012402chr111206 1420 1241 --
NM_012412chr7126 --3826 222 29 --
NM_012414chr11114 ------
NM_012416chr91158 2184 125 2819 97 1135
NM_012417chr17--1397 1111 --
NM_012420chr1072273 2030 1965 1426 599 309 53 1372 21752 774 --
NM_012428chr153700 285 249 ------
NM_012432chr1259 43 ------
NM_012433chr21275 ------
NM_012448chr1762167 946 912 685 500 30 --42554 1021 732 240 11572
NM_012453chr731415 516 194 --61425 476 226 223 136 76 --
NM_012454chr62567 33 ------
NM_012461chr143269 192 65 --1585 --
NM_012463chr123599 336 149 11612 ----
NM_012465chr10123031 2984 2868 2844 2746 2336 842 624 476 302 290 110 ----33036 2800 357
NM_012471chrX51799 1388 318 304 52 21202 154 11840 --
NM_012473chr224674 264 243 216 ------
NM_012478chr173407 296 100 1327 2832 696 --
NM_012479chr792706 2663 2369 2020 1972 1752 828 785 648 12209 1793 --
NM_013227chr154758 664 261 82 ------
NM_013230chrY2484 283 --1589 --
NM_013231chr1494327 3873 3861 3622 3301 3236 3211 1426 319 11144 23435 1199 11448
NM_013233chr2----2396 88 --
NM_013236chr2221056 434 --1387 --
NM_013243chr154959 468 308 232 --1164 1313
NM_013245chr163573 252 216 --3649 646 226 --
NM_013253chr111926 21463 178 2106 93 --
NM_013254chr122719 610 1285 ----
NM_013255chr7168655 7965 7604 7164 6968 6869 6805 6405 6129 5937 5694 5482 2575 2118 2003 153 --26923 6259 47547 6530 5842 157
NM_013257chr842387 2167 2070 146 --1954 --
NM_013259chr32288 92 ------
NM_013261chr483015 2922 2773 2283 1517 787 677 62 1917 1100 13243
NM_013269chr12114516 4260 4241 4162 4029 3989 3965 1300 1257 773 198 11157 13460 --
NM_013277chr1241013 972 348 308 1107 1173 --
NM_013281chr201263 --11189 --
NM_013293chr7----292 39 --
NM_013296chr1265 26 ----1482
NM_013305chr183916 868 619 --2919 858 --
NM_013309chr1532679 2431 826 11820 ----
NM_013316chr731042 796 788 --2133 54 --
NM_013323chr1761123 1116 1093 1005 991 818 2968 173 ----
NM_013341chr262794 1953 1174 1161 1125 796 ------
NM_013351chr172714 222 ------
NM_013357chr8----2867 88 --
NM_013364chrX51992 1944 1642 1436 1420 ------
NM_013365chr222158 126 1721 1534 --
NM_013368chr194466 442 200 27 ------
NM_013372chr15113179 2963 2919 2822 2362 2280 2140 1039 936 464 393 12408 22806 472 --
NM_013374chr342216 1020 750 386 1804 ----
NM_013377chr121604 1691 ----
NM_013381chr124955 852 270 198 --22113 214 --
NM_013382chr1461920 1902 1798 1752 873 727 --11770 12119
NM_013396chr2131045 336 307 ------
NM_013400chr76966 842 761 753 343 46 ----1849
NM_013411chr132481 1987 1750 12132 11850 --
NM_013423chrX2971 96 ------
NM_013427chrX2971 96 ------
NM_013433chr1951945 1877 1784 1773 1662 --11344 --
NM_013434chr231741 695 452 1399 1585 --
NM_013434chr231741 695 452 1399 1585 --
NM_013438chr911352 --11295 --
NM_013444chrX31138 1000 265 --6989 276 254 250 217 186 --
NM_013446chr721348 1255 ------
NM_013448chr142649 604 ----1641
NM_013449chr12142716 2438 2298 2262 1185 842 830 709 644 638 588 224 187 154 --52113 627 338 324 175 --
NM_013450chr22349 115 1845 131 --
NM_013937chr64899 724 304 297 158 ----
NM_013943chr192240 2142 2083 1146 1104 716 704 72 36 1641 ----
NM_013951chr242345 1716 694 546 22014 198 --1553
NM_013952chr242422 1793 771 623 22091 275 --1630
NM_013953chr242422 1793 771 623 22091 275 --1630
NM_013958chr81475 --1146 --
NM_013959chr81475 --1146 --
NM_013961chr81475 --1146 --
NM_013962chr81475 --1146 --
NM_013979chr51413 ------
NM_013989chr1434537 3364 1452 14631 33979 1272 1076 --
NM_013992chr242422 1793 771 623 22091 275 --1630
NM_013993chr62268 176 1281 4525 522 219 216 --
NM_013994chr62268 176 1281 4525 522 219 216 --
NM_013999chr1761102 400 379 365 241 119 11054 2520 122 11106
NM_014000chr1071581 1492 1385 625 612 370 363 1390 21496 498 21810 1761
NM_014005chr592932 2498 2458 2100 1965 1042 635 615 320 12213 1824 1656
NM_014010chr93555 204 61 --1152 --
NM_014011chr231754 569 482 ------
NM_014015chr162648 26 1628 ----
NM_014021chr163346 3257 2328 1146 917 137 --1282 --
NM_014023chr1041952 1847 844 222 ------
NM_014028chr663265 3012 2581 1229 861 161 11288 ----
NM_014030chr171870 --11138 --
NM_014031chr52238 118 ------
NM_014034chr641128 969 257 196 --2980 405 --
NM_014044chr21163 ------
NM_014048chr1654922 4779 3458 2029 1120 ----1257
NM_014055chr121462 ------
NM_014057chr931495 477 452 --21114 503 --
NM_014079chr34839 717 333 167 21048 86 ----
NM_014089chr1331447 401 145 ------
NM_014106chr1551906 1894 957 675 333 --22039 937 11922
NM_014109chr851203 453 439 410 356 ------
NM_014112chr885150 4815 4700 4379 3333 3323 1900 977 ------
NM_014117chr1652717 1968 845 766 93 --12264 --
NM_014141chr794198 3928 3903 3500 3494 1893 1183 497 431 14715 45054 3503 3455 1533 --
NM_014145chr202689 141 --1580 --
NM_014149chr71556 --1593 --
NM_014155chr11117555 5785 5660 5629 5372 4689 2338 2156 1490 1353 83 26651 1833 35973 2780 546 1551
NM_014157chr16123172 2686 1564 1457 1433 1170 923 685 624 614 500 78 24028 865 ----
NM_014166chr1311154 --2822 808 --
NM_014181chr232195 875 858 1691 1826 --
NM_014182chr12170 2245 82 1724 --
NM_014184chr1----1112 --
NM_014186chr1171812 1802 1719 601 580 456 202 --22164 2120 22247 605
NM_014189chr421359 205 --11261 11499
NM_014190chr431711 1153 557 --11613 11851
NM_014191chr12--1835 ----
NM_014212chr122900 616 ------
NM_014216chr1451430 1351 658 481 110 --1492 --
NM_014217chr131857 1503 578 --2525 270 --
NM_014223chr13507 212 194 1164 2638 79 --
NM_014231chr1292042 1907 1794 1712 1702 1581 735 235 52 3640 119 99 51956 1484 1480 475 133 --
NM_014232chr1781633 1377 1254 1213 1031 499 400 380 --81492 413 406 384 359 352 292 276 163
NM_014232chr1781633 1377 1254 1213 1031 499 400 380 --81492 413 406 384 359 352 292 276 163
NM_014233chr1731730 1397 1360 1223 31780 415 74 --
NM_014234chr61168 ------
NM_014238chr1721293 310 --41707 1372 39 36 --
NM_014240chr3123364 2919 2875 1243 1049 804 507 410 299 223 205 148 11158 34087 2665 636 1418
NM_014243chr432092 169 57 ------
NM_014245chr33810 224 101 ------
NM_014250chr2241910 1637 1575 1485 --21568 259 179
NM_014252chr132412 125 ------
NM_014253chrX1812 --2554 540 --
NM_014267chr112336 240 ----1326
NM_014268chr1841316 1233 279 50 --1564 --
NM_014270chr19----170 --
NM_014271chrX3589 343 179 ------
NM_014279chr92630 358 --2248 162 --
NM_014280chr13801 712 266 1616 175 --
NM_014283chr13995 323 289 ------
NM_014284chr13906 426 64 --1106 --
NM_014288chr11213 ------
NM_014289chrX31151 1077 121 21245 1217 1124 --
NM_014299chr1962042 1801 578 382 283 122 32078 1762 863 3653 83 50 --
NM_014305chr13----1220 --
NM_014309chr22155318 5083 4916 4702 4454 4369 4118 3907 3895 3582 1501 814 611 469 180 21286 1211 2803 589 24976 3926
NM_014316chr1661996 1826 1785 1749 652 366 1441 22194 369 2324 85
NM_014319chr1231641 1377 69 ------
NM_014323chr222408 161 2424 148 ----
NM_014331chr4177516 7245 6122 6087 5389 5166 4928 3090 3043 3005 2744 2625 2467 2423 2346 2096 1061 16062 46459 6197 5855 2100 --
NM_014332chrX2368 154 --1157 --
NM_014333chr1161102 895 850 577 424 326 --3439 359 237 --
NM_014335chr1521102 284 11004 ----
NM_014342chr1121383 1321 --11480 --
NM_014344chr111174 --2701 698 --
NM_014345chr62947 167 --1274 1939
NM_014351chr2241453 1092 578 81 ------
NM_014363chr132471 453 ------
NM_014368chr951915 1795 400 288 210 --11614 --
NM_014372chr141629 378 372 115 11941 ----
NM_014374chr76966 842 761 753 343 46 ----1849
NM_014376chr552170 1937 1791 520 346 --32253 1836 258 3778 301 196
NM_014381chr1482539 2411 2242 2019 1254 1205 530 477 --43318 3307 3303 2110 --
NM_014382chr331338 487 199 ------
NM_014388chr1135885 5519 4987 4703 4389 4187 4030 3739 1668 1507 1218 1047 368 15863 46032 4121 3742 3707 25688 340
NM_014392chr421342 1173 --1440 1380
NM_014393chr862310 947 370 259 173 50 2314 221 2753 230 --
NM_014397chr911078 --11425 21438 331
NM_014400chr191456 --1344 --
NM_014405chr1762268 2140 1898 1590 703 339 --21942 526 --
NM_014408chr12600 561 1136 1535 --
NM_014409chr11107 162 1972 --
NM_014410chr18----1344 --
NM_014411chr741993 1327 1304 111 --31549 1482 759 1781
NM_014415chr331631 1217 395 ------
NM_014417chr193952 384 89 ------
NM_014421chr411704 --22139 1391 2739 347
NM_014423chr563689 2170 2130 2104 1954 597 --34688 1134 115 135
NM_014426chr202251 207 ------
NM_014437chr1153 --1598 --
NM_014445chr351959 1695 1550 153 31 ------
NM_014447chr441384 1116 1109 222 --11557 11597
NM_014452chr6166 --1178 21002 299
NM_014454chr62684 126 --11100 --
NM_014455chr11143 1350 ----
NM_014458chr141270 1180 881 252 --2256 33 --
NM_014462chr81265 1221 ----
NM_014469chr11--1759 1294 --
NM_014478chr741783 782 552 484 1529 --1270
NM_014491chr71191 ------
NM_014494chr1652073 1909 1847 1617 345 1799 32050 315 306 --
NM_014504chr762032 1992 1836 1513 1378 803 22176 380 1278 11383
NM_014515chr1241047 254 215 116 ------
NM_014517chr351799 1733 1616 1225 778 11252 11235 --
NM_014521chr231742 1471 623 1159 11666 --
NM_014552chr251136 597 575 561 128 ------
NM_014554chr1262017 1681 1661 1606 263 165 ----1554
NM_014562chr2--1102 1562 --
NM_014563chrX61806 1392 688 357 200 136 ------
NM_014570chr221307 --2209 40 --
NM_014572chr1361743 1502 1376 1266 1128 671 ------
NM_014573chr1741738 1563 1275 283 ----1171
NM_014574chr1431360 325 319 11587 ----
NM_014575chr32536 492 ------
NM_014584chr1441613 1355 1265 1038 ------
NM_014587chr1621415 267 11190 ----
NM_014588chr206752 738 601 206 107 46 ------
NM_014591chr10179 ------
NM_014604chr172193 157 --2637 149 --
NM_014606chr491259 984 974 962 382 375 362 267 37 --31115 1032 466 1403
NM_014607chr2138 12065 ----
NM_014613chr562304 1224 888 587 493 435 --42696 2310 1908 951 22678 2658
NM_014614chr211320 --1405 --
NM_014615chr1673654 3093 2812 2736 2342 2276 541 11138 33249 446 265 --
NM_014618chr92443 404 ------
NM_014620chr123194 125 119 --1128 --
NM_014623chr6194 ------
NM_014630chr1563820 3673 850 532 420 268 33856 2506 51 1928 11221
NM_014634chr22103578 3515 3208 2752 2263 1107 737 641 450 47 22666 2594 133 12729
NM_014636chr964178 3113 1363 1356 873 472 --31730 837 650 24142 3497
NM_014644chr11661 ----1129
NM_014646chr1852202 645 485 288 137 ------
NM_014647chr1621556 190 --1194 11573
NM_014653chr1232063 1733 93 --1541 --
NM_014659chr154849 366 154 55 --1738 --
NM_014665chr853516 3315 3290 2285 704 22757 1163 33689 3293 364 --
NM_014667chr341678 682 375 324 --12313 --
NM_014670chr2184 ------
NM_014674chr3123667 3505 3324 3291 3183 2654 2508 1086 941 639 460 174 --43670 3257 3165 1602 12927
NM_014676chr131487 1366 440 1134 ----
NM_014677chr861165 1109 1034 500 349 342 --21057 1011 --
NM_014682chr81250 --1537 12272
NM_014683chr1752012 1885 1657 1359 807 1578 11896 --
NM_014686chr1962264 1851 819 658 417 136 1425 --12105
NM_014689chr21538 ------
NM_014690chr7132739 2570 2116 2100 2061 1169 1136 1127 982 961 449 356 132 52865 2830 2732 2071 377 52777 2246 2041 1226 1223 2835 416
NM_014701chr1533237 2535 2359 21354 376 13240 --
NM_014702chr673291 2332 1010 993 524 161 92 23024 2726 12461 13193
NM_014705chr751913 1904 766 223 107 ------
NM_014707chr742288 1879 1708 60 --2481 477 11780
NM_014709chr21473 ------
NM_014711chr1621957 809 --1160 11503
NM_014720chr102355 126 ------
NM_014721chr6117492 7163 6825 6505 5377 5359 5032 1958 1428 538 259 14512 15337 --
NM_014726chr174412 186 153 38 11225 21009 31 1495
NM_014729chr82881 211 21576 86 1215 --
NM_014730chr12195057 4867 4762 4284 4222 4158 3515 3416 3379 1328 1309 894 810 785 757 552 342 274 210 13838 65192 4854 3948 3648 3423 244 --
NM_014730chr12195057 4867 4762 4284 4222 4158 3515 3416 3379 1328 1309 894 810 785 757 552 342 274 210 13838 65192 4854 3948 3648 3423 244 --
NM_014731chr2071798 1443 1352 701 342 279 83 --21355 144 --
NM_014733chr521931 585 --2808 800 --
NM_014742chr2071513 1470 1254 1119 575 399 238 1588 1320 --
NM_014743chr4123204 3058 2954 2830 2719 2615 2461 2423 2010 1178 591 140 1422 31114 319 101 --
NM_014746chr284378 3979 3218 1639 888 780 716 285 14003 34064 3046 3043 --
NM_014747chr1225774 5472 5417 5286 5141 4887 4117 4048 3968 3771 3732 3685 2104 2029 1302 901 790 720 699 589 415 63 34005 3983 3652 15123 25022 728
NM_014751chr83860 762 675 --2779 767 --
NM_014752chr1121565 404 --128 1449
NM_014755chr283441 3367 3067 1532 1283 1184 1107 211 168 --11692
NM_014757chr592364 2315 1542 947 916 850 714 701 542 12046 51802 1761 1620 951 750 --
NM_014759chr861272 1091 591 278 167 83 1620 31499 527 269 --
NM_014761chr1621055 150 1160 2284 70 --
NM_014764chr124462 354 274 265 1507 1515 --
NM_014765chr132532 2499 1862 --22076 541 --
NM_014767chr10113572 2730 2647 2620 2333 1283 1166 953 583 489 319 1407 32250 1352 1286 --
NM_014772chr1883310 3009 2211 1457 955 925 605 273 --43437 3129 2841 2218 --
NM_014774chr1113298 3121 2839 2322 2200 1279 1140 1076 774 282 275 32289 94 86 12143 --
NM_014776chr1292962 2450 2425 2230 1243 1111 969 575 24 11988 22624 1058 --
NM_014779chr311006 --2816 157 --
NM_014781chr821203 274 ------
NM_014782chrX1282 ------
NM_014784chr141159 811 95 23 143 31114 388 385 1400
NM_014786chr1141229 1123 821 191 ------
NM_014787chr132101 1800 143 ----1176
NM_014795chr241277 1045 483 423 --1472 --
NM_014798chr1771954 1781 1691 1509 711 663 585 --1654 --
NM_014800chr751139 882 744 458 200 --1326 --
NM_014803chr103858 439 396 1833 12096 1365
NM_014810chr133155 2636 2625 --33392 2928 2605 32651 2640 542
NM_014812chr131934 1588 405 ------
NM_014819chr552210 1814 1780 1726 1665 21946 949 2775 54 --
NM_014820chr351904 1893 1471 625 587 ------
NM_014822chr4151 ------
NM_014824chr1151329 630 501 407 154 21531 598 1212 --
NM_014826chr1114251 4083 3852 3466 3029 1586 1190 964 395 70 54 --21424 1375 --
NM_014827chr131227 348 158 11476 --11079
NM_014829chr542389 1897 840 714 11959 21916 765 --
NM_014830chr1253752 3417 3400 2873 726 --53407 3404 2654 1573 734 --
NM_014832chr1332093 1761 1453 --1604 1450
NM_014836chr1041480 1231 224 128 ----1132
NM_014838chr2252741 2733 1862 1083 701 1171 ----
NM_014839chr192567 959 924 881 743 671 654 530 293 --22317 1785 --
NM_014840chr1272924 2738 2514 2200 1011 833 329 22364 1092 42440 2298 2295 418 --
NM_014841chr62420 401 2975 132 --1968
NM_014846chr8146 ------
NM_014847chr11376 --1206 --
NM_014849chr151106 913 886 276 56 1195 160 --
NM_014850chr3144925 4852 4803 4685 4523 4302 3926 3884 3657 3571 3549 1480 1460 291 --84700 4696 4555 4043 4040 3497 1613 318 --
NM_014858chr16848 812 782 410 297 167 21206 56 ----
NM_014860chr251908 1649 737 637 77 --21793 743 --
NM_014862chr15164084 4077 4005 3465 3403 3055 3010 2595 1452 1422 1271 1159 930 892 870 398 33432 2906 1624 21471 896 11136
NM_014868chr122293 230 127 ----
NM_014871chr12--1572 1202 --
NM_014872chr951929 1674 1552 953 224 2946 862 ----
NM_014873chr144849 3752 1307 667 21610 1188 ----
NM_014874chr131853 1710 284 --1455 1385
NM_014876chr2252203 2124 2050 1936 45 --11602 1765
NM_014877chr17187600 7367 6993 6837 6776 6290 6009 5916 5620 2890 2554 2452 1865 1564 1439 1153 955 865 1910 ----
NM_014881chr102131 37 ------
NM_014887chr134879 849 638 591 ------
NM_014892chr62552 135 ----1526
NM_014893chrY1772 --1881 1751
NM_014897chr17103101 3071 2568 2257 1093 524 366 338 100 81 2924 26 12080 --
NM_014898chr1931903 421 21 ----1282
NM_014900chr221013 283 ------
NM_014902chr2041389 1215 461 77 --21528 249 --
NM_014903chr1231790 954 366 1522 2377 326 12396
NM_014904chr1083144 2452 747 638 375 327 245 115 --13303 23158 1254
NM_014905chr251626 1444 717 656 133 1279 ----
NM_014906chr1723937 2930 24063 268 13371 --
NM_014909chr1493902 3748 3730 3656 3593 3161 2772 2751 525 ----23168 465
NM_014912chr1053253 3104 2883 2671 1124 12791 --1614
NM_014917chr12868 832 ------
NM_014918chr1531321 1281 1066 --1530 --
NM_014920chr683548 3223 2531 1341 539 336 126 28 1956 12534 --
NM_014921chr19112936 2846 2802 2755 2494 2026 1062 881 870 601 435 --72897 2740 2478 1180 1020 874 505 --
NM_014923chr131593 12278 ----
NM_014924chr1422173 46 ----11970
NM_014925chr128776 682 655 611 365 246 198 174 --1238 --
NM_014926chr311031 --1743 --
NM_014931chr194668 127 40 33 ------
NM_014932chr341575 1464 676 64 ----1712
NM_014934chr1353842 3638 2530 1320 273 ------
NM_014936chr662796 2772 2724 2573 2131 147 --2921 302 --
NM_014939chr1821282 464 --11353 --
NM_014944chr151075 1068 520 222 59 11324 ----
NM_014945chr551285 618 484 177 79 --11337 --
NM_014946chr243063 3018 1143 575 11906 31083 819 418 --
NM_014947chr132046 1018 445 ------
NM_014949chr121013 153 ------
NM_014950chr1421082 110 --21777 602 --
NM_014952chr1552027 1800 1372 574 503 --3832 586 551 --
NM_014953chr1344148 3861 3845 3835 13678 ----
NM_014964chr1762372 1705 972 777 365 246 21538 217 --12062
NM_014969chr11322 1187 2820 412 --
NM_014974chr1051750 709 417 310 52 11477 ----
NM_014978chr1041575 1294 288 233 ------
NM_014982chr14105195 4097 4031 3615 2081 1414 671 596 524 449 --33754 3593 2139 14324
NM_014988chr432585 2499 979 32165 1137 816 ----
NM_014989chr621355 1276 1734 21716 561 --
NM_014990chr14----2275 151 --
NM_014991chr452502 2145 604 254 54 --22376 2249 --
NM_014992chr141728 ----1108
NM_014994chr154837 766 630 199 32098 1964 792 1782 --
NM_014996chr34869 416 146 75 --21047 209 1918
NM_014997chr7112861 1939 1872 1083 1031 968 861 797 653 317 250 11858 42892 253 209 192 --
NM_015000chr1253088 2395 1892 1139 1040 1461 22261 2219 --
NM_015001chr16968 925 906 631 263 34 --1271 1168
NM_015002chr1272243 2015 1921 1703 425 375 167 21665 45 2674 416 22163 797
NM_015005chr1451777 1599 1544 301 93 --21624 1332 --
NM_015008chr3113220 3141 2974 2487 1433 1298 898 812 531 239 145 12781 ----
NM_015017chr12328 130 ------
NM_015020chr1693723 3702 3676 2605 1132 787 607 355 211 --33507 3298 1385 --
NM_015023chr1111778 1567 1555 1522 1453 1424 1272 1214 1124 613 90 --21674 1434 --
NM_015024chr831123 973 269 --11373 21338 106
NM_015026chr1294619 4601 4553 4286 3756 3294 3167 1716 1341 11486 44566 4467 4442 3527 --
NM_015027chr1651502 1238 794 673 612 --1631 --
NM_015032chr1382799 2588 1947 1934 1837 978 516 24 --1898 --
NM_015033chr992890 2837 2691 2424 1062 941 892 799 307 --22695 505 --
NM_015039chr1103430 3344 1505 1338 856 678 398 359 320 60 --33514 3137 1524 2198 81
NM_015040chr253322 3033 2176 775 86 --12526 12468
NM_015042chr15164285 4262 4244 3680 3660 3636 3472 3431 2805 1489 1432 1334 1244 1080 608 196 --74297 3643 3639 3608 3441 2876 1118 14254
NM_015044chr1632990 801 267 2658 509 32626 2493 2066 1808
NM_015045chr1042165 1434 459 149 --21508 1505 --
NM_015051chr952849 1341 858 786 412 11264 33377 1123 143 --
NM_015052chr771233 1125 1099 1093 969 201 171 11217 1492 --
NM_015055chr1172885 2730 2262 1018 731 714 488 --3606 435 432 --
NM_015061chr9----1918 --
NM_015064chr1292701 2650 1050 1038 989 714 362 297 141 22719 1087 1821 --
NM_015068chr793946 3908 3874 2649 1477 1245 645 557 122 ------
NM_015069chr161492 ------
NM_015070chr1331567 1150 143 ------
NM_015071chr5104656 2313 2292 2085 1599 1270 1079 766 267 78 25273 1477 55166 4322 4152 790 654 22168 997
NM_015072chr14----2481 396 --
NM_015074chr1114524 4289 3787 3145 3128 1677 892 456 357 120 64 13678 23152 1745 --
NM_015075chrX62048 1959 1899 357 181 97 --22246 1572 21599 197
NM_015076chr683810 3661 3150 2960 2842 1459 978 318 11078 14476 --
NM_015080chr113932 384 373 --3394 391 176 --
NM_015082chr542504 2092 676 483 21873 789 12397 --
NM_015086chr1261458 1392 1369 615 96 80 11065 21048 66 1957
NM_015087chr1322275 79 22307 1833 12232 --
NM_015090chr1136036 5435 5163 4723 4620 2226 1787 1557 772 582 461 418 384 --24847 758 12100
NM_015092chr1684468 4322 3613 3528 3012 2982 1376 657 12847 23909 3621 13545
NM_015093chr63748 678 523 ------
NM_015094chr2254374 3934 3393 1804 1123 23478 1519 21230 609 --
NM_015097chr341519 1509 914 292 --12294 --
NM_015099chr174292 246 143 136 --1460 --
NM_015100chr131718 737 608 --31565 627 611 --
NM_015107chrX62442 1557 1539 577 312 163 31592 210 49 11519 11496
NM_015110chr942005 1756 895 199 --2496 412 --
NM_015115chr452797 2571 1017 803 792 ------
NM_015125chr193137 105 82 1218 1449 --
NM_015129chrX41442 323 140 77 --11465 --
NM_015130chr441265 1230 1194 60 2925 541 ----
NM_015132chr741750 1575 727 151 1301 --1277
NM_015137chr852528 2460 597 563 554 1952 32550 2370 1714 --
NM_015138chr1592600 1010 988 938 811 752 491 471 68 1391 32672 478 61 --
NM_015141chr371023 842 820 706 611 381 226 ------
NM_015143chr431129 1048 238 ------
NM_015149chr131753 1679 530 11671 11347 --
NM_015153chr64790 741 304 185 ------
NM_015155chr1033307 155 138 12390 ----
NM_015156chr14103632 3429 3359 3154 2994 1619 911 858 635 322 11115 12625 1177
NM_015157chr1141111 442 415 274 ----21007 928
NM_015158chr91770 1801 ----
NM_015163chr143385 183 133 --11876 --
NM_015170chr852355 2014 781 769 615 ------
NM_015171chr162486 110 1148 ----
NM_015172chr11435 11050 1598 --
NM_015176chr131417 1167 165 ------
NM_015178chr82712 66 22128 943 ----
NM_015180chr142884 123 --1182 --
NM_015184chr3------1691
NM_015185chrX52632 2241 2211 828 633 22391 566 22323 557 1592
NM_015191chr1152731 2569 1852 838 827 --1169 --
NM_015192chr2042911 1893 443 92 11105 --12989
NM_015194chr1791690 1677 1548 1350 751 627 616 347 172 11556 51819 1670 1327 175 143 --
NM_015199chr362705 2578 2171 1960 1953 1067 12233 ----
NM_015200chr482268 1990 1769 1610 517 234 177 155 --11993 --
NM_015202chr1641531 1172 612 28 --21708 1366 11391
NM_015206chr1533616 2442 832 --22612 616 --
NM_015208chr1843359 1255 505 448 1845 11363 --
NM_015209chr172291 2152 2022 1958 1694 388 302 --21891 377 --
NM_015215chr112127 12411 2333 309 1552
NM_015226chr16103454 3286 3276 3011 1240 921 880 873 345 179 --2329 326 33140 1372 828
NM_015230chr441762 1592 1436 655 ------
NM_015235chr1051875 837 787 162 113 1657 ----
NM_015236chr4--1114 1981 --
NM_015238chr5121 1108 ----
NM_015239chr91459 ------
NM_015250chr941859 1587 386 378 --21591 252 --
NM_015252chr26882 737 606 597 336 228 --1154 --
NM_015256chr55722 622 566 259 159 ------
NM_015260chr1951581 1550 1470 1302 470 11096 ----
NM_015263chr1531129 984 400 --1360 --
NM_015264chr22184677 4373 4313 4007 3919 3587 3334 1944 1804 1792 1562 1500 1251 911 886 828 503 190 14812 24545 3999 11306
NM_015265chr222465 2064 ------
NM_015268chr32257 119 --194 157
NM_015271chr483096 2787 1638 1265 700 609 151 60 --24350 2923 --
NM_015272chr1641929 514 191 178 1226 21682 517 --
NM_015275chr1262136 1778 1592 1581 816 557 ------
NM_015278chr683479 2962 2209 2203 1362 1127 536 164 22358 170 --23254 74
NM_015282chr241230 1108 721 654 --42038 931 411 408 22560 2489
NM_015284chr192100 1722 1675 1570 1534 1344 533 338 36 21897 1762 22088 1624 --
NM_015285chr1862598 2276 1608 645 527 70 ------
NM_015288chr5123615 3200 3001 2833 2752 2719 2687 2578 2509 2355 992 978 11319 83662 3391 967 862 858 854 205 176 --
NM_015289chr1531332 595 554 11829 21928 1925 11730
NM_015291chr173155 3055 2751 2279 1028 276 145 --33025 2579 214 --
NM_015293chr62514 497 1131 ----
NM_015294chr1731084 779 109 ------
NM_015296chr13----1401 --
NM_015299chr1493495 3400 3293 3271 3243 2815 1319 1272 1078 13794 23813 371 --
NM_015305chr1441893 1554 464 208 133 1270 1157
NM_015310chr8157959 7465 6678 6223 3188 3002 2820 2675 2620 2490 1532 1362 983 879 287 --85888 3234 2800 2739 1713 1517 1233 986 17791
NM_015313chr11124432 4075 3657 3634 3462 3448 3432 3327 3186 1470 1262 168 11442 33240 3123 685 1792
NM_015314chr731921 1651 432 ------
NM_015315chr5123219 2782 2768 2436 2335 2176 2169 1034 963 736 238 208 --22243 548 12187
NM_015317chr262868 2517 2370 2086 1115 458 --12126 12374
NM_015320chr21374 --41014 387 91 62 --
NM_015321chr19154877 4741 4339 4306 4291 4178 4128 4034 3651 3545 3392 3139 1410 920 438 13042 11890 --
NM_015323chr631370 1137 197 ------
NM_015326chr1122708 2482 2372 2297 2165 2026 1988 1138 936 855 727 64 22810 786 22071 1016 --
NM_015327chr121124 504 11259 1373 --
NM_015328chr792817 2780 2697 2547 2429 2009 1136 779 405 21223 94 1318 42325 673 623 56
NM_015335chr1242440 1002 400 99 --31913 135 37 12450
NM_015336chr1232446 915 68 ------
NM_015338chr2051845 1687 1265 767 418 2391 344 21851 753 --
NM_015344chr862154 1924 1616 677 402 192 ------
NM_015346chr1451608 1223 606 465 190 1342 31566 529 525 21736 82
NM_015349chr632128 2113 1920 --32257 2070 545 --
NM_015355chr1731516 614 588 162 ----
NM_015358chr213918 842 372 ------
NM_015359chr8122668 2584 2240 2048 1919 1836 927 821 741 310 290 236 12750 12209 --
NM_015361chr22750 335 ------
NM_015365chrX114117 4027 3741 3631 1387 989 464 397 319 259 47 13606 104121 4035 3028 381 378 374 362 359 355 332 --
NM_015375chr184846 3665 3540 3280 1690 1589 1492 576 14435 43831 1426 1410 41 --
NM_015385chr1043194 2972 2016 427 ------
NM_015388chr6129 --2269 265 --
NM_015393chr463726 2379 674 484 475 149 --31227 1127 140 --
NM_015394chr1242085 1635 745 197 11687 ----
NM_015396chr331485 269 190 --180 --
NM_015397chr961561 1495 737 308 292 53 --11279 11404
NM_015435chr81503 11027 --11330
NM_015436chr483050 2555 1313 747 474 420 233 58 32455 683 484 1966 1768
NM_015439chr61319 188 ----
NM_015441chr11324 ------
NM_015443chr1741450 1276 572 274 --1216 --
NM_015444chr31612 --1107 1659
NM_015446chr121455 343 ------
NM_015455chr594101 3350 1528 1369 1288 1245 1002 605 264 13337 --1388
NM_015457chr111234 --2353 70 --
NM_015458chr8114842 4350 3826 3622 1860 1819 1515 1506 636 313 141 13833 15266 --
NM_015460chr321870 582 11534 --1725
NM_015463chr21778 ------
NM_015464chr73257 177 92 1381 ----
NM_015469chr9171 ------
NM_015470chr241114 288 123 63 --1395 --
NM_015475chr22983 406 --1745 --
NM_015481chr1241073 1010 109 82 --11085 --
NM_015484chr12962 801 ------
NM_015488chr251516 524 349 296 73 21574 1183 11489 --
NM_015493chr1941687 1491 566 62 --22101 78 11432
NM_015508chr321548 1120 --11557 --
NM_015509chr1261538 1530 1369 1281 1151 1138 2561 136 2440 93 11542
NM_015511chr2061135 960 949 897 753 164 --3983 314 75 --
NM_015514chr141434 1102 ----
NM_015520chr342738 2537 1062 1029 ----12485
NM_015525chr62252 176 ------
NM_015530chr21343 --1919 --
NM_015531chr111127 ------
NM_015534chr131044 785 31 ------
NM_015535chr294053 3760 3598 2585 1487 1339 983 207 122 12968 33515 3512 1210 --
NM_015541chr311159 11149 11003 --
NM_015548chr63879 304 29 ------
NM_015550chr742910 2672 2260 151 43510 2984 2971 2716 63300 2728 2244 770 643 38 11414
NM_015553chr6165187 5051 4789 4683 4625 4412 4140 3850 3680 3607 1514 1488 734 679 509 79 44469 3561 1864 107 33406 1240 21 --
NM_015554chr1562673 2634 2625 1966 1175 500 12702 ----
NM_015564chr552867 2640 1041 739 548 ------
NM_015565chr2131776 1589 809 ------
NM_015567chr136521 513 365 219 168 128 --3414 380 368 --
NM_015568chr2084349 3205 2875 2745 1735 1505 870 310 13491 1785 13187
NM_015569chr164403 3397 1724 619 483 352 --21929 491 13687
NM_015570chr72733 238 ------
NM_015571chr63950 765 356 ------
NM_015575chr2112773 2516 2379 2346 2258 675 652 386 369 351 139 12808 ----
NM_015576chr352755 2401 2375 1034 232 2622 293 --1213
NM_015578chr1911921 --32092 1371 462 --
NM_015601chr102839 337 ------
NM_015602chr141362 455 358 248 11203 21591 695 11541
NM_015609chr172577 2458 2335 2092 1924 1084 189 --1480 --
NM_015634chr101402 ------
NM_015635chr952198 875 621 346 193 ------
NM_015638chr203670 558 511 --187 1240
NM_015645chr114359 323 306 297 ------
NM_015649chr191290 1384 --1124
NM_015651chr92782 444 1525 31791 1737 304 177
NM_015652chr103629 224 180 ------
NM_015660chr71272 --1220 --
NM_015670chr17295 77 --183 --
NM_015676chr142330 79 ------
NM_015678chr1351646 1296 1210 1200 539 --11456 --
NM_015680chr24607 589 479 116 1540 ----
NM_015686chrX52083 1776 1761 418 79 12222 12383 --
NM_015691chrX52944 2904 1109 367 194 ------
NM_015694chr73252 144 132 ------
NM_015695chr682151 1838 1823 557 546 531 323 177 11676 21802 132 --
NM_015711chr194683 651 146 35 --3695 654 268 --
NM_015716chr175695 589 482 197 180 ----1291
NM_015719chr191202 --3739 244 146 --
NM_015723chr71525 --1704 --
NM_015831chr74891 769 591 378 141 1106 --
NM_015833chr2141946 1631 777 326 2730 57 52303 1517 934 930 559 --
NM_015834chr211242 --2914 128 --
NM_015840chr1102711 2535 2490 2048 1753 857 631 479 336 71 12126 3706 302 101 --
NM_015841chr1102711 2535 2490 2048 1753 857 631 479 336 71 12126 3706 302 101 --
NM_015850chr852266 2130 1843 1730 185 --21797 351 --
NM_015866chr111029 ------
NM_015872chr161708 1452 1410 1335 465 449 --21455 132 --
NM_015874chr41486 1568 ----
NM_015879chr18117631 7059 6652 6257 5614 3306 2411 1483 676 500 133 17767 47030 5626 3059 2720 23115 1426
NM_015881chr111926 21463 178 2106 93 --
NM_015886chr865262 5190 1434 1363 1318 129 15171 45160 3599 2061 118 14788
NM_015888chr122912 2745 ----1517
NM_015891chr61824 ----1580
NM_015901chr102855 293 ------
NM_015906chr1124508 4480 4200 4032 3720 3662 1868 1741 1419 882 746 542 13261 --1886
NM_015912chr861940 1806 1738 1673 943 728 12098 ----
NM_015913chr11211 --3569 544 520 --
NM_015952chr61119 ------
NM_015955chr22157 129 ------
NM_015957chr111353 --1304 --
NM_015959chr113724 616 445 --127 --
NM_015960chr10187 ----1245
NM_015974chr132455 29 ------
NM_015980chr531473 1327 196 --11466 --
NM_015981chr572916 2496 2186 1078 246 101 76 22797 428 3639 552 549 --
NM_015984chr11383 --1160 --
NM_015987chr12151 ----2277 121
NM_015995chr15125129 4573 3449 1441 1349 1276 1254 1187 815 495 249 58 --43974 1499 1267 1145 --
NM_015999chr11186 ------
NM_016002chr12729 73 ------
NM_016009chr154245 1935 1733 1611 661 23811 85 23321 3111 --
NM_016018chr852675 2179 1998 765 38 11764 12812 --
NM_016019chr72334 161 --2387 384 1884
NM_016021chr682387 2160 2073 535 464 259 212 114 1712 12164 1766
NM_016022chr13876 727 102 --1774 --
NM_016025chr1611811 11408 12005 --
NM_016026chr1431065 992 565 176 2374 281 --
NM_016032chrX51002 890 500 379 299 21185 259 11335 21170 1059
NM_016037chr13885 455 320 ------
NM_016040chr152576 1811 757 701 488 188 1736 --
NM_016041chr171386 --2313 310 --
NM_016057chr1231029 187 31 11195 21123 374 1524
NM_016059chr63772 329 179 --1357 --
NM_016061chr2--140 21450 553 11547
NM_016063chr62631 569 --2768 765 --
NM_016071chr7195 --131 --
NM_016072chr1241932 1691 893 558 ------
NM_016073chr15----2421 150 --
NM_016075chr1382816 2644 2595 2415 1962 564 449 140 ------
NM_016076chr152966 2258 2227 2186 244 --2830 586 --
NM_016079chr241900 1440 789 37 --32063 1704 663 12153
NM_016083chr633839 3251 612 2239 188 33672 2795 1217 --
NM_016096chr831406 451 431 ------
NM_016099chr84964 365 97 80 ----1459
NM_016104chr61119 ------
NM_016107chr51991 11051 ----
NM_016120chrX1286 ----1152
NM_016131chr27946 794 740 544 184 107 45 --1758 --
NM_016132chr1552808 2524 2477 754 507 --11251 1307
NM_016133chr221065 460 11549 ----
NM_016139chr7----1276 --
NM_016141chr31100 ----168
NM_016146chr111257 --1170 --
NM_016147chr114382 358 321 85 ----1948
NM_016152chr32953 385 --1257 --
NM_016156chr1162216 2170 2035 1586 937 529 --12270 1464
NM_016162chr123670 316 129 1217 --2846 34
NM_016169chr10103262 3012 2986 2791 2315 1125 1002 494 454 343 22812 1159 73265 3248 2646 1290 729 498 474 --
NM_016185chr172695 159 ----2699 42
NM_016201chr372158 1450 1440 772 722 501 45 --1231 1838
NM_016203chr71697 ----1128
NM_016206chr3118110 8071 6837 3387 2354 2177 2080 1747 1604 1251 211 --108634 8051 7278 7275 7269 7210 6465 1594 785 611 11507
NM_016217chr673274 3044 2901 1269 837 392 93 ------
NM_016223chr112110 58 ------
NM_016224chr672108 1804 1528 1511 1470 740 487 22081 374 41787 756 288 40 --
NM_016226chr121349 1356 ----
NM_016227chr13995 323 289 ------
NM_016231chr1721079 670 ------
NM_016235chr1651527 1357 1216 323 33 ------
NM_016248chr13114016 3997 3579 3446 3170 2842 1300 1284 1273 1245 212 13467 --23226 1405
NM_016252chr2----1944 --
NM_016255chr663214 3157 2263 1238 973 660 ------
NM_016257chr182543 2331 2314 2205 1022 504 437 126 42442 1369 679 199 1143 11201
NM_016258chr12733 552 ------
NM_016260chr2147585 6589 5937 5676 4668 2709 2552 2463 2214 1256 1143 1048 477 82 14714 46308 6064 5075 2352 15975
NM_016269chr44949 872 862 765 --1321 --
NM_016271chr1812088 --22372 332 --
NM_016272chr2252529 2002 1955 1738 355 12442 42563 2425 790 363 --
NM_016277chr631571 1227 235 ------
NM_016279chr5176 ------
NM_016281chr121858 --3894 882 186 --
NM_016282chr931756 1480 674 21729 1308 ----
NM_016284chr163795 730 89 ------
NM_016287chr172062 1797 1652 821 517 266 197 --1107 1324
NM_016289chr221723 204 --12292 --
NM_016300chr3237 26 ------
NM_016301chr122416 59 ------
NM_016303chrX173 --1381 --
NM_016308chr121770 720 --1369 --
NM_016315chr251424 1348 220 146 132 ----11822
NM_016316chr2------1532
NM_016322chr942356 2147 1010 633 12640 22935 382 --
NM_016329chr3--155 ----
NM_016333chr16----2194 63 --
NM_016338chr54983 970 863 190 --1973 --
NM_016353chr83977 937 875 1272 2844 502 --
NM_016357chr122827 215 --1140 --
NM_016374chr121143 189 ------
NM_016374chr121143 189 ------
NM_016376chr1783848 3490 3013 1543 1078 500 369 104 33067 2905 2672 --13006
NM_016396chr1572527 2516 2384 2305 2063 527 363 --32884 2490 2049 1959
NM_016406chr1----1360 --
NM_016410chr93201 181 103 ------
NM_016418chr22103594 3525 2935 2320 1442 874 844 313 257 97 --33742 2513 2428 13024
NM_016422chr1163140 3054 2018 1053 880 676 32424 2198 174 1693 --
NM_016424chr1731477 727 51 ------
NM_016436chr202557 454 --3928 536 418 --
NM_016441chr242365 962 634 187 ----1693
NM_016442chr542185 2147 723 311 ------
NM_016448chr131373 685 425 ------
NM_016456chr15888 833 681 103 81 --1131 --
NM_016467chr24994 494 466 419 1136 ----
NM_016483chr31320 155 1221 1249
NM_016484chrX1602 1556 1444 --
NM_016485chr61783 --12166 --
NM_016486chr12353 183 ------
NM_016506chr111276 --1523 1443
NM_016507chr17123094 3065 2823 2811 856 790 756 684 456 139 47 32 --1555 --
NM_016513chr683548 3223 2531 1341 539 336 126 28 1956 12534 --
NM_016519chr42551 363 ------
NM_016522chr1121455 1093 --11078 11332
NM_016525chr95959 781 649 259 222 ------
NM_016530chr1583856 3427 3420 3384 3290 1326 587 246 --11504 --
NM_016531chr472787 1117 1011 529 519 338 181 1328 1755 --
NM_016544chr2112925 2836 2581 1443 1253 1215 1166 1132 580 482 256 22434 1222 53798 2845 1150 603 85 --
NM_016545chr11298 --2881 340 --
NM_016547chr14639 555 254 107 1548 ----
NM_016559chr331445 1428 1017 11292 11449 --
NM_016569chr1241358 1254 1049 104 ----1377
NM_016574chr114895 376 312 109 --3920 907 323 --
NM_016577chr394368 3989 3007 2927 1353 1013 701 396 119 24074 1282 34031 973 438 24303 3583
NM_016587chr741141 795 695 219 --1262 --
NM_016592chr20124 ------
NM_016603chr551658 405 361 220 46 --11910 11776
NM_016604chr53985 298 25 --2833 340 --
NM_016605chr572538 1877 1745 912 800 706 583 --21920 1863 --
NM_016607chrX31480 659 252 1396 --156
NM_016617chr1331733 712 161 ----11951
NM_016618chr24398 227 177 21 --1419 --
NM_016620chr111256 1974 ----
NM_016621chr11114117 4103 3867 3460 1689 1292 975 768 716 653 176 34235 3979 3027 74293 3838 3481 3478 3129 2878 720 --
NM_016623chr8----2127 119 --
NM_016628chr101627 1216 1589 --
NM_016631chr211153 ------
NM_016645chr151394 --1341 --
NM_016654chr1521086 328 --2979 453 --
NM_016656chrX5396 373 327 307 109 ------
NM_016819chr32517 192 2138 39 ----
NM_016823chr171283 ----1853
NM_016824chr103630 565 352 1299 ----
NM_016830chr124404 156 74 64 ------
NM_016834chr17134009 3884 3684 3526 3221 3204 2983 2878 1424 1123 865 296 284 23794 3283 33001 868 314 --
NM_016835chr17134009 3884 3684 3526 3221 3204 2983 2878 1424 1123 865 296 284 23794 3283 33001 868 314 --
NM_016841chr17134009 3884 3684 3526 3221 3204 2983 2878 1424 1123 865 296 284 23794 3283 33001 868 314 --
NM_016848chr91110 ------
NM_016929chr6154546 4449 4106 3938 3727 3070 1763 1585 1452 1363 1063 430 384 314 77 --13991 11074
NM_016931chr11----1348 --
NM_016936chr1671937 1821 1796 1601 714 409 105 11467 1573 --
NM_016946chr183021 2516 1386 565 526 495 403 131 1176 ----
NM_016950chr41201 1302 179 --
NM_016952chr1194041 3773 3610 3574 3383 2708 1062 543 275 12886 73577 2997 2903 2809 210 206 196 --
NM_017409chr125785 142 54 35 21 1313 3588 87 39 --
NM_017410chr1241107 793 786 289 1873 1468 --
NM_017412chr81902 --11403 --
NM_017413chrX42161 1822 967 228 2287 54 2681 354 --
NM_017415chr5144524 4216 4038 3497 3145 3134 1729 703 694 635 489 347 337 129 11065 ----
NM_017420chr1443304 3015 705 215 --32469 2462 2459 --
NM_017423chr421361 556 1832 --31580 878 496
NM_017425chr111329 --176 --
NM_017437chr1412097 --22339 612 12186
NM_017449chr181600 1587 1557 1158 1151 672 356 28 1470 1635 132
NM_017450chr1721441 1068 --2985 73 --
NM_017451chr1731015 744 173 1430 1896 --
NM_017452chr201282 1565 11300 --
NM_017453chr201282 1565 11300 --
NM_017454chr201282 1565 11300 --
NM_017455chr153700 285 249 ------
NM_017456chr1751482 519 282 96 54 --21857 232 --
NM_017481chr11----134 --
NM_017482chr231613 584 211 --21616 622 --
NM_017483chr261111 835 267 57 44 35 --21232 423 --
NM_017491chr441035 859 172 74 ------
NM_017519chr63286 231 116 --21286 1277 --
NM_017520chr132380 76 ------
NM_017522chr131256 1228 1024 --11068 --
NM_017550chr196948 895 842 747 119 75 --1845 --
NM_017551chr1042443 2201 1764 833 ----11998
NM_017553chr1541285 1224 430 412 ----126
NM_017554chr361941 1735 1549 644 425 145 22094 34 21725 87 --
NM_017558chr163400 295 99 ------
NM_017575chr1741624 1221 1184 641 1128 1302 1367
NM_017577chr351495 1365 1165 266 229 ----11270
NM_017580chr1021751 404 --62357 2039 909 906 546 251 --
NM_017582chr131823 1723 357 --2640 23 --
NM_017590chr2262650 2508 605 407 388 149 --11640 --
NM_017596chr1134291 4239 4220 3863 1397 1365 1190 985 894 708 114 49 27 64548 4424 3455 2854 510 445 54083 1492 1283 121 38 --
NM_017602chrX3770 130 96 --182 --
NM_017610chr1582021 1979 1865 1671 645 484 252 45 1450 ----
NM_017617chr93364 301 31 ------
NM_017622chr171272 1123 1260 --
NM_017626chr1031747 1472 1215 11413 41347 1099 1096 367 1589
NM_017629chr131797 1378 369 --11294 --
NM_017633chr643169 2975 281 217 ----11432
NM_017634chr871893 1851 1845 1471 1444 755 48 ----166
NM_017637chr9199057 9026 8231 8210 7401 6298 6285 5744 3470 3265 2597 2507 2303 1844 1345 1217 1144 369 161 67992 7214 6850 5751 2272 1655 48187 7507 7098 6604 18738
NM_017640chr64576 231 93 24 --3596 593 81 2268 235
NM_017643chr1773024 3004 2969 2535 1185 796 539 --12752 --
NM_017644chr351862 1671 1350 1101 362 1781 33507 1045 135 --
NM_017645chr963014 2967 2321 2013 1233 560 23144 979 1189 22217 2103
NM_017649chr1061158 1131 994 845 468 304 1949 1498 --
NM_017650chr795931 5568 5543 5072 5004 4465 4076 1132 55 31519 730 72 2930 858 --
NM_017657chr23935 299 36 ------
NM_017658chr1463554 3498 1540 1169 778 359 ----11754
NM_017660chr1942382 2372 937 38 --1250 22334 2153
NM_017664chr133792 708 38 11069 ----
NM_017666chrX61561 1407 396 389 256 81 1562 12052 2815 221
NM_017668chr164536 144 81 48 1106 197 --
NM_017672chr1521158 443 1867 ----
NM_017676chr531817 1810 226 ------
NM_017686chr121141 365 3811 770 310 --148
NM_017693chr1331283 1178 1076 21263 140 ----
NM_017694chr221793 284 11442 12040 --
NM_017709chr1123462 3265 2969 2819 1587 1313 1023 965 868 374 140 72 --64208 3528 2879 1627 1094 906 --
NM_017714chr202934 259 ------
NM_017715chr72706 185 --1690 --
NM_017719chr31643 --1819 --
NM_017724chr31693 ------
NM_017730chr32690 223 ------
NM_017734chr13614 467 63 ------
NM_017736chr1662579 2380 2079 1936 270 31 --12456 --
NM_017737chr122002 346 12178 ----
NM_017738chr931039 985 898 --1266 1818
NM_017739chr12514 206 ------
NM_017740chr1611344 21181 369 ----
NM_017742chr1851970 1866 1371 414 136 --2441 403 --
NM_017744chr141675 972 227 217 ------
NM_017748chr172714 160 --1312 --
NM_017749chr112927 705 1357 1292 --
NM_017753chr91318 2385 43 --1711
NM_017754chr694821 4472 4083 3272 3235 1342 1151 643 275 24668 1165 11461 1354
NM_017757chr1841135 983 883 344 ------
NM_017758chr1751415 1087 1000 948 140 2964 491 3546 543 213 --
NM_017762chr1521724 202 --31799 791 51 11803
NM_017769chr1472432 2048 1192 1166 404 374 215 ------
NM_017770chr672963 2891 2857 2521 1865 469 330 12144 22534 712 --
NM_017772chr681604 1580 1563 1474 1090 587 441 434 11639 21794 1592 --
NM_017776chrX11146 ------
NM_017778chr821002 146 --21191 537 --
NM_017779chr112278 1781 12728 --
NM_017789chr21215 1778 2697 218 --
NM_017798chr201344 --11189 11240
NM_017799chr1412012 11830 --171
NM_017801chr331592 949 518 ----12207
NM_017810chr163270 57 32 --2762 616 --
NM_017811chr962817 2715 2705 2605 1137 566 1632 11166 --
NM_017813chr875349 2046 1731 1374 1272 848 29 14223 23629 768 25728 2138
NM_017816chr4----145 --
NM_017824chr1062194 2058 879 765 415 378 1581 --1278
NM_017831chr18124748 4415 4137 3485 3401 3254 3089 1767 1671 1662 1525 1416 --31629 1625 1400 --
NM_017848chrX74448 4400 1395 504 496 470 281 12998 11768 23759 107
NM_017849chr282766 2039 878 844 538 322 56 22 21200 119 43098 3094 2031 470 33102 2945 287
NM_017851chr154471 373 243 230 11027 11138 --
NM_017864chr81196 ------
NM_017893chr1051448 538 348 318 115 130 1355 11030
NM_017896chr2093559 3352 2973 2967 2873 2343 2257 709 426 32400 1002 269 2790 108 --
NM_017902chr10135643 5202 4687 4548 3979 2227 2217 2002 1979 1392 1315 808 758 45391 4384 4208 1004 24059 377 --
NM_017906chr61283 --1102 --
NM_017910chr23325 303 266 ------
NM_017915chr124741 393 333 300 ------
NM_017919chr9145500 5046 5020 4929 4901 4846 4306 4183 4123 4104 2052 1585 1173 614 45518 4045 2079 587 43903 1142 617 262 1348
NM_017922chr141110 ------
NM_017923chr43327 103 23 --1110 1740
NM_017933chr231326 505 262 --1483 --
NM_017938chrX22212 551 11344 1555 --
NM_017944chr1152996 2049 960 934 885 --23024 3021 --
NM_017958chr262671 2485 2438 2064 1902 114 --22932 2885 --
NM_017982chr131329 1225 36 --11231 --
NM_017987chr1092186 1896 1506 849 790 711 652 482 310 1855 2546 168 --
NM_017988chr121219 --2733 206 --
NM_017994chr762831 2738 2731 1868 960 594 --21972 992 1524
NM_017998chr911427 --2895 336 --
NM_018008chr33354 260 158 --124 --
NM_018010chr331613 1130 277 --11569 11045
NM_018011chr13----1175 --
NM_018014chr231159 1073 145 ------
NM_018027chr1052801 1281 1057 835 591 12008 42290 2244 228 36 --
NM_018028chr1941216 912 511 73 1318 21023 278 --
NM_018037chr1--145 1261 --
NM_018043chr1161358 1175 377 368 359 151 --1536 --
NM_018045chr192989 2631 2385 2334 1967 791 633 450 75 --22714 2453 12344
NM_018046chr531387 576 116 --167 --
NM_018047chr51623 --184 --
NM_018048chr1272056 2045 1859 1811 1692 782 619 --1809 1435
NM_018061chr121777 289 21717 571 1130 --
NM_018063chr102468 320 ------
NM_018067chr14422 360 124 43 --1425 --
NM_018068chr8------1118
NM_018070chr11446 ------
NM_018071chr147762 568 347 338 262 195 36 1720 1106 --
NM_018078chr41325 --1658 --
NM_018079chr25429 186 152 140 37 ------
NM_018084chr253132 2329 191 152 60 153 23277 990 12286
NM_018085chr197172 6490 1961 1100 692 575 204 86 30 15570 36876 5934 248 47999 7722 6718 5586
NM_018086chr231426 1321 512 --11629 11507
NM_018092chr1671640 1330 1222 639 589 412 400 --191 --
NM_018094chrX2152 98 ------
NM_018095chr111276 --1523 1443
NM_018097chr152263 166 ------
NM_018098chr31146 ------
NM_018107chr144978 746 728 313 2722 65 3760 750 322 2257 81
NM_018110chr161296 1385 2939 531 --
NM_018114chr31200 ----1562
NM_018115chr41761 ----1773
NM_018116chr11466 ------
NM_018120chr831406 1114 435 ------
NM_018121chr1063214 3128 3011 2212 1221 302 --12004 22191 568
NM_018126chr421321 300 --