TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-767-3p
miRNA Sequence: UCUGCUCAUACCCCAUGGUUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000109chrX32520 1018 655 182 --135
NM_000189chr222310 620 1947 --1822
NM_000212chr171393 11876 1324 11616
NM_000264chr932748 1283 1228 12814 --1541
NM_000398chr221169 --2825 143 1929
NM_000448chr1121219 280 12949 ----
NM_000533chrX11284 ------
NM_000555chrX116820 5956 5680 5368 5039 3111 2464 2300 2242 2107 239 17614 ----
NM_000627chr21847 ------
NM_000633chr1864751 4654 1880 1128 1067 854 23290 410 ----
NM_001001433chr2062703 2689 2586 1156 1084 121 ----2458 378
NM_001001890chr2144117 3086 3068 926 --24204 999 --
NM_001003407chr1054370 3570 1205 558 229 --14949 12032
NM_001003652chr1848223 2999 1099 256 12503 38166 2700 2683 12385
NM_001003712chr1243004 2479 1068 259 ------
NM_001003789chr2211279 ----1840
NM_001003800chr963485 3001 2849 2789 2772 593 1370 12497 11154
NM_001004051chrX----155 --
NM_001004065chr962460 1314 1158 912 813 380 --11529 --
NM_001004127chr133769 706 679 1888 11021 --
NM_001004317chr653202 2879 1467 945 611 11207 1170 --
NM_001004360chr251985 1640 268 122 98 ------
NM_001004419chr1264637 3797 3030 528 301 143 12953 --11029
NM_001005404chr1753726 867 738 595 355 23820 2888 1690 --
NM_001005474chr311481 --1285 --
NM_001005609chrX93716 3583 3419 3278 2879 2364 1106 923 339 --11366 --
NM_001007097chr954820 4670 1856 1786 1182 23708 1000 24230 1022 --
NM_001007237chr132063 1041 566 21761 699 3958 829 263 --
NM_001008407chr74668 590 573 216 --31599 1459 645 --
NM_001008495chr821549 378 --1343 175
NM_001008701chr1952347 1112 555 476 382 21028 797 42364 760 372 56 --
NM_001009554chr454274 4104 4008 3356 1320 21695 1302 ----
NM_001010971chr11380 ------
NM_001012393chr1164226 4218 2003 1627 356 25 --33764 3577 199 --
NM_001013693chr192417 2399 2339 2028 1113 1092 823 264 185 12209 12789 --
NM_001013839chr1772154 2084 2013 1885 1838 1740 329 21869 338 21926 1899 --
NM_001025077chr1067297 6966 5914 4699 943 214 ------
NM_001025105chr52562 45 133 1162 --
NM_001025580chrX84209 4167 4020 4002 3825 3597 1033 653 1854 22943 832 --
NM_001033025chr1----149 --
NM_001033057chr3----12004 --
NM_001033518chr742851 2718 2551 965 133 12249 1484
NM_001033925chr1032012 1596 620 --11349 11377
NM_001034845chr4----1326 --
NM_001039577chr1104402 4251 4103 3310 3017 2901 2744 1602 1520 900 --23003 391 --
NM_001040152chr741802 1775 583 372 1101 --14447
NM_001042599chr266823 6693 6679 5109 5072 2420 1940 --25290 4769
NM_001042603chr12105001 4995 4486 4457 4272 4078 940 783 632 384 ------
NM_001042604chr364469 4445 1943 1586 1276 693 13893 ----
NM_001043318chr1482517 876 637 461 439 347 274 152 13083 22731 1333 --
NM_001099678chr332431 298 42 --22107 320 --
NM_001106chr3139064 7452 7446 7053 6460 3758 3361 2146 1689 1023 875 789 702 38517 8268 6511 --13510
NM_001140chr17----1484 --
NM_001257chr1631142 367 269 ------
NM_001259chr766055 5717 5544 3979 1581 1018 --25554 1349 24810 2430
NM_001271chr1583282 2961 2088 869 832 778 540 393 11137 --11165
NM_001284chr5----1204 --
NM_001530chr1411011 ----1872
NM_001663chr1432526 971 640 --21723 745 --
NM_001826chr1------1166
NM_001830chrX33586 1210 1203 12711 23749 181 --
NM_001967chr3------1412
NM_001969chr1473589 2961 2516 1454 1364 638 389 13685 --1198
NM_002006chr4----15800 --
NM_002025chrX78127 7658 7214 6399 2828 575 182 38709 2804 2205 16693 --
NM_002137chr7--1161 --12176
NM_002140chr94854 842 826 431 ------
NM_002141chr7------1459
NM_002214chr715149 13502 24776 1288 --
NM_002268chr311631 ----11327
NM_002336chr1253828 1856 1162 416 308 --13212 --
NM_002481chr167986 7906 5792 5117 1478 1428 25716 2764 26914 4912 15907
NM_002655chr843548 2023 1841 1704 ------
NM_002698chr1942693 2023 402 29 22477 2047 32520 2470 1044 22929 848
NM_002709chr221437 655 ----11332
NM_002731chr132271 2256 688 --2466 344 --
NM_002827chr2021706 212 ----11201
NM_002886chr355079 4283 1559 557 515 ------
NM_002912chr6------1290
NM_002959chr154135 2875 742 728 185 --13341 11570
NM_003011chr921140 565 --11350 1183
NM_003108chr276748 6132 5015 4595 2730 2498 2357 16834 1234 14659
NM_003262chr343334 1220 931 855 1952 14102 --
NM_003292chr141733 683 659 242 1886 ----
NM_003298chr352099 1963 1036 949 764 23797 718 34525 1134 470 --
NM_003341chr3198 --1502 --
NM_003348chr12------21229 195
NM_003410chrX31212 583 575 ------
NM_003458chr373224 3164 3025 2709 1073 792 432 21191 603 11280 13310
NM_003463chr612922 ----11035
NM_003468chr254107 3609 3093 2711 1288 ------
NM_003478chr1132405 1266 1117 --12899 154
NM_003482chr1281794 1698 944 850 644 272 180 138 32230 2136 152 ----
NM_003489chr2121350 46 --1254 --
NM_003603chr421434 151 --11795 --
NM_003629chr153060 3010 2510 963 142 ----12194
NM_003692chr9------1904
NM_003861chr1431105 625 258 1982 32402 1140 743 --
NM_003884chr3----1554 11646
NM_003913chr623218 31 --23472 298 --
NM_003939chr1083872 3661 3371 3076 936 517 136 82 ------
NM_004035chr1735034 1978 1849 --33635 1566 316 13690
NM_004050chr14102363 2233 1848 981 810 722 579 284 103 49 12520 31840 180 151 1121
NM_004077chr12----1270 --
NM_004263chr21114 ------
NM_004397chr1163490 3294 1620 1273 1105 809 11182 11458 1775
NM_004430chr862708 2464 1960 853 828 804 ------
NM_004432chr932365 1540 340 1857 ----
NM_004458chrX11676 32318 334 243 ----
NM_004504chr222585 1071 --21911 688 --
NM_004586chrX53744 1622 1432 1196 1174 23563 3510 --14637
NM_004588chr1151214 911 869 711 480 24012 2537 33535 863 316 --
NM_004612chr911456 ----22943 683
NM_004742chr3------1685
NM_004745chr856209 6147 5791 1694 517 22436 1713 21996 1767 16426
NM_004748chr152346 180 23154 1575 ----
NM_004774chr1763002 2906 2828 2128 1265 492 ----1405
NM_004776chr2053147 2202 1316 971 433 1412 13096 --
NM_004779chr52957 98 ----1127
NM_004834chr242606 2087 403 280 2457 437 --12341
NM_004958chr1------2842 663
NM_004973chr611319 ----1409
NM_004984chr12------1359
NM_005076chr173793 3541 3509 3327 1650 512 377 21632 1062 1891 11541
NM_005188chr1197764 6326 5844 2888 2717 2295 1869 175 76 35607 5235 1987 15212 15290
NM_005228chr72617 439 --11276 1254
NM_005229chrX------1466
NM_005406chr1821086 339 177 ----
NM_005433chr1822368 891 ----12793
NM_005596chr915985 14486 25680 3880 11392
NM_005668chr554487 3517 3423 783 432 --22794 1777 11731
NM_005690chr12------166
NM_005801chr17------151
NM_005828chr17104941 3856 3693 3593 3546 1906 1571 1462 1062 311 14050 21339 626 --
NM_005923chr6------1445
NM_005937chr17114138 3970 3730 2896 1307 979 851 841 651 584 75 52849 2820 2672 476 306 ----
NM_005955chr185324 4643 3375 1969 1742 1500 490 388 1915 142 --
NM_006047chr2033286 2450 2290 ----1610
NM_006122chr153720 529 291 1202 3914 467 247 12770
NM_006136chr71898 ----1878
NM_006186chr231122 1066 840 --193 176
NM_006237chr1342244 1873 309 293 ------
NM_006315chr434090 4061 3625 13127 43097 2760 1753 1083 --
NM_006357chr21399 2174 34 ----
NM_006575chr142589 538 --11025 --
NM_006577chr2----1941 --
NM_006599chr1668024 7057 2176 2014 1170 115 1985 27775 6737 --
NM_006750chr16107929 6834 5992 5874 5102 3127 1587 1547 467 259 11049 48008 2548 2073 1230 11684
NM_006873chr22987 747 ----22742 887
NM_006885chr1613032 ----2861 624
NM_006888chr1442738 2682 765 337 ----12417
NM_007038chr2146108 5665 5159 4731 11958 --1137
NM_007249chr13106942 6578 3470 3433 2942 1175 712 448 131 25 1705 16718 --
NM_007347chr1532803 2126 548 12725 12842 --
NM_012120chr632241 1972 113 ----12579
NM_012238chr10------1575
NM_012262chr165141 4945 4153 3935 1253 1183 --11608 --
NM_012288chr675492 2075 1692 1152 514 502 46 1789 --21583 1413
NM_012301chr722134 1606 --11576 --
NM_012308chr1152094 1948 898 386 215 1154 ----
NM_012316chr145085 4124 3726 57 45521 4981 2224 1811 --1451
NM_012347chr632623 738 376 ----1343
NM_013396chr2111024 ----11483
NM_014155chr1187358 6780 6153 5864 1372 862 205 194 --37485 1911 272 1677
NM_014342chr1111233 1339 1938 --
NM_014421chr411330 1857 1297 --
NM_014572chr1321423 604 ----1664
NM_014586chr21104607 4465 4391 1901 1893 1628 1099 513 212 78 13900 14455 --
NM_014707chr71903 --1231 11964
NM_014729chr832226 1897 1453 --12157 --
NM_014730chr12104905 4420 4381 4276 3923 3867 1983 1604 1011 163 1157 13698 --
NM_014746chr243696 3063 2829 1520 --1512 --
NM_014747chr1115462 5245 4758 4564 4324 4272 4182 2191 1903 1516 952 23534 400 35806 4073 857 --
NM_014755chr223645 3397 13008 24259 3424 1152
NM_014787chr122774 365 --2962 439 --
NM_014832chr131124 11497 --1273
NM_014873chr174161 4148 3798 3157 1713 1327 395 --33873 3474 1643 --
NM_014897chr1763269 2588 2220 2111 74 51 --12794 --
NM_014910chr19121 ----1688
NM_014912chr10--136 23570 460 --
NM_014962chr2031852 992 470 ------
NM_015020chr1653397 3186 2939 1266 231 --1644 22889 2808
NM_015076chr653730 2862 1069 999 141 13821 ----
NM_015077chr17114569 4298 3661 1869 1817 1435 963 731 426 412 208 --14346 --
NM_015172chr1----1658 1614
NM_015230chr411877 ----1312
NM_015393chr463403 2918 2864 1169 882 466 22534 627 --12660
NM_015569chr113750 21515 1101 33175 1375 85 --
NM_015879chr18118126 7580 7147 7070 6631 6531 6511 6311 5894 2027 384 --22688 1411 11373
NM_015906chr123885 115 23330 1638 13468 --
NM_015945chr201660 ------
NM_016037chr12905 375 --1340 --
NM_016083chr643304 1437 1423 841 --23449 3163 1711
NM_016120chrX31089 474 45 1869 --11128
NM_016173chr384075 3766 3678 1696 1121 800 461 186 --23090 1040 14474
NM_016297chr253059 2667 528 489 328 --11150 22638 73
NM_016929chr673636 3126 3001 1596 814 754 563 ------
NM_016937chrX1318 ------
NM_017423chr41387 ----21825 1445
NM_017628chr474702 4578 4413 4094 3949 3484 1811 14016 11598 --
NM_017637chr948294 7344 6834 3166 17613 15892 --
NM_017728chr17102690 2602 2595 2470 2266 990 955 663 201 102 32743 2233 2076 12545 --
NM_017919chr944835 1434 1422 935 1254 15611 --
NM_018364chr153807 2864 1096 891 486 12710 ----
NM_018403chr374075 3981 3593 2494 1295 1050 353 1458 --177
NM_018489chr12937 105 ----11565
NM_018566chr154909 1725 397 379 290 --1785 --
NM_018638chr1224422 34 --11351 --
NM_018970chr762979 2782 2717 1997 122 53 --1788 --
NM_019087chr51527 --11682 11531
NM_019114chr9------1508
NM_019604chr113837 249 160 --1292 1932
NM_020673chr2046661 5590 4966 1476 --35661 5162 296 --
NM_020699chr185329 5113 4999 4430 3969 3834 2013 1912 21926 564 ----
NM_020830chr243061 2279 1149 417 --12308 13005
NM_020935chr254550 3735 1259 1108 867 --1487 --
NM_021003chr141635 ------
NM_021132chr104935 479 224 218 ------
NM_021183chrX11749 135 --11692
NM_021813chr664592 4039 1745 1482 755 171 --21936 1863 --
NM_021964chr362667 2564 2240 2096 1152 413 --11457 14400
NM_022048chr1586067 5467 4699 4073 2542 2314 629 160 45088 2393 2029 1850 24835 212 14374
NM_022058chr211849 --21304 258 1279
NM_022763chr322274 2041 --1930 --
NM_024312chr1231507 474 44 11496 21242 204 --
NM_024411chr2031381 1040 420 2465 22 1987 --
NM_024665chr323549 2972 --1411 13483
NM_024884chr1451732 801 684 632 419 1248 21523 1048 --
NM_024920chr421158 1087 ----11077
NM_024949chr474070 3929 3789 3761 1705 716 476 13947 2772 393 --
NM_030915chr241618 814 618 198 --12094 1459
NM_030934chr121814 699 --1140 11461
NM_031271chr8------1519
NM_031438chr5123 --11513 --
NM_031442chrX52898 2049 1127 921 348 22015 1270 ----
NM_031469chr643694 3307 2554 1122 33367 1456 1251 11428 --
NM_031915chr13----1229 --
NM_032131chr6----1131 --
NM_032144chr24543 422 204 185 ------
NM_032199chr1053711 3461 1246 987 346 --1763 --
NM_032221chr2022029 1563 --1521 --
NM_032256chr122931 842 ----1429
NM_032440chr1042611 2507 834 42 ------
NM_032466chr821524 1147 ----1100
NM_032804chr1052549 2312 1851 252 22 1761 1105 --
NM_032846chr1451045 581 518 186 92 ------
NM_033105chr8------1183
NM_033224chr737872 7731 1817 25942 752 ----
NM_033296chr4----1921 --
NM_033505chr2136409 5919 5869 5708 5151 5101 5023 4736 4599 4347 2187 1064 410 ----25240 222
NM_033656chr2125382 312 25670 226 --1539
NM_052879chr1244051 3688 3581 2926 11067 1961 1611
NM_052885chr1254394 4256 3995 3715 464 13750 ----
NM_052898chr8186 ----11220
NM_052906chr22144829 4668 4403 3779 3644 3224 3191 3162 1942 1892 1325 1014 929 425 33205 399 87 24634 1827 --
NM_053042chr442640 2620 449 311 22627 347 --33066 2436 2044
NM_058172chr421495 109 ----11310
NM_133445chr923694 485 1496 12450 --
NM_138288chr1431895 1652 323 ----1137
NM_138459chr631396 1217 269 1550 23370 919 --
NM_139072chr22789 711 ----1362
NM_139283chr1232145 1571 329 ------
NM_144571chr435806 2236 1075 --36161 5677 5103 --
NM_144590chr1042610 839 555 346 11093 --1564
NM_144664chr112338 314 --1277 --
NM_145117chr1133131 3000 740 --12288 12312
NM_145307chr1044498 4302 3351 3245 11130 1777 --
NM_145309chr11----1453 182
NM_145891chr16161 --11513 11097
NM_152253chr22133738 3589 3159 3111 3088 1522 1449 872 784 589 339 264 167 21550 1282 --34095 3070 1004
NM_152381chr221545 407 11511 ----
NM_152409chr512773 --43356 2738 645 186 --
NM_152470chr1863268 3049 2801 2624 1370 1214 11620 23391 226 --
NM_152622chr523458 3349 --12729 --
NM_152636chr1142548 2255 664 459 ------
NM_152658chr19------1413
NM_152745chr71431 ------
NM_152787chrX53645 3482 2847 1463 43 22944 403 ----
NM_153810chr1043833 3461 1631 1287 23111 340 13612 --
NM_170665chr1254578 3430 3404 1455 1328 --12898 33260 3162 483
NM_172069chr231527 528 233 22183 472 ----
NM_172071chr177169 7036 4630 2655 1839 1408 99 --22320 1605 12845
NM_173476chr1642088 1905 482 189 12249 42117 1985 1416 502 11994
NM_173511chr233277 1392 1263 ----13722
NM_173595chr12115096 4922 4744 4598 4230 3837 1328 1117 519 484 139 35057 4088 799 15043 --
NM_173667chr5----1815 --
NM_173814chr151577 ----183
NM_175061chr711571 ----1491
NM_175736chr1295582 5166 2568 2465 1444 1258 1248 1098 161 1604 12278 22601 596
NM_175866chr131228 255 231 --1179 11363
NM_181356chr6--1764 --1283
NM_182830chr1411868 ----1226
NM_182970chr20104205 4076 3942 3694 3533 3385 3368 2863 1478 468 21041 291 33850 3633 2943 --
NM_194314chr175601 5321 4374 4034 3560 873 716 --24228 3853 --
NM_198066chr1432085 2008 1976 --11053 --
NM_198270chrX----1956 --
NM_198581chr247117 6534 2854 511 --35591 5262 2896 --
NM_198686chr1441970 1770 298 259 12382 22628 2171 1201
NM_205848chr122144 394 ------
NM_207371chr1031401 575 185 --1994 --