TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-767-5p
miRNA Sequence: UGCACCAUGGUUGUCUGAGCAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX----1272 --
NM_000052chrX----13005 --
NM_000081chr1----11280 --
NM_000084chrX36467 4516 100 --1939 25103 4508
NM_000092chr213659 --24406 87 13687
NM_000314chr101681 ----12357
NM_000484chr21----11087 --
NM_000533chrX11344 1449 ----
NM_000828chrX3811 565 94 --11621 1125
NM_000868chrX----11933 --
NM_000919chr51554 ------
NM_000921chr12----1437 --
NM_001001787chr11403 ------
NM_001003674chr1834315 1255 1246 --14943 26944 6169
NM_001004419chr1274154 3644 3429 2959 1698 495 408 1740 1253 --
NM_001005386chr22895 139 ----12034
NM_001005473chr514946 16538 14647 14253
NM_001006932chr6----12934 --
NM_001008777chr17----1441 --
NM_001010867chr176261 4509 4464 2692 2563 1648 409 22568 2425 16503 --
NM_001010971chr11991 ----1847
NM_001011537chr332312 2248 643 ------
NM_001011722chr11377 ----1409
NM_001013438chr3----1147 --
NM_001014794chr11----1204 --
NM_001018067chr133778 1703 1664 12029 ----
NM_001025105chr5--1126 1235 --
NM_001025579chr17----11122 --
NM_001029875chr511003 --1839 1761
NM_001030272chr11----1347 --
NM_001033026chr191170 ------
NM_001033507chr1----1703 1148
NM_001033925chr10----1728 --
NM_001037164chr71678 ------
NM_001039618chr11----22030 1256 --
NM_001040152chr71139 ----34304 3364 1901
NM_001040152chr71139 ----34304 3364 1901
NM_001040402chr41132 ------
NM_001042510chr8----11999 --
NM_001199chr8----1217 --
NM_001206chr9--1401 ----
NM_001220chr7137 ------
NM_001237chr41835 ----156
NM_001364chr11----11595 --
NM_001455chr694945 4883 3760 3664 3548 3413 1750 341 252 --24651 1317 --
NM_001564chr4------1124
NM_001616chr243047 2876 2491 1173 --22549 815 --
NM_001635chr7------11024
NM_001759chr1255181 4417 1127 911 195 11296 ----
NM_001854chr141166 279 203 48 --1327 --
NM_001858chr641903 1347 850 414 --23408 1805 --
NM_001918chr186954 2456 2368 1936 1713 439 394 304 18584 28343 242 1183
NM_001938chr1----1236 --
NM_001949chr6--12346 ----
NM_002048chr9--1149 ----
NM_002063chrX----1931 --
NM_002107chr1----1378 --
NM_002137chr712000 12246 --1417
NM_002293chr1--12052 ----
NM_002356chr6163 1449 11790 1487
NM_002442chr12----11685 --
NM_002500chr221020 270 ----11269
NM_002648chr6----11191 --
NM_002715chr51895 ------
NM_002748chr15----1100 --
NM_002816chr17------167
NM_002897chr2----1483 --
NM_003010chr171122 --21734 352 --
NM_003016chr1712031 11447 --11960
NM_003042chr3----12206 --
NM_003079chr17----169 --
NM_003099chr1595460 5377 5139 4589 4398 4212 2427 728 239 45694 4594 4013 1415 1350 --
NM_003105chr11------133
NM_003161chr171605 ----1174
NM_003291chr13----1199 --
NM_003292chr1----11649 --
NM_003505chr71427 --11962 --
NM_003629chr143216 2456 893 864 --1904 --
NM_003701chr13----1196 --
NM_003766chr17----1554 --
NM_003913chr61560 1437 11590 --
NM_003916chrX21408 1377 ----2212 86
NM_003968chr32177 171 --1526 --
NM_004171chr1149180 8430 7841 2326 21360 852 17328 18113
NM_004274chr14----1636 --
NM_004491chr1934129 1260 1147 22765 1544 --14326
NM_004498chr15----1384 --
NM_004540chr21----1829 --
NM_004569chr14----1607 --
NM_004772chr5----1559 134
NM_004824chr6----11107 --
NM_004852chr18513201 13052 9611 3279 2952 15270 1317 12889
NM_005096chrX----1780 --
NM_005542chr7----1396 1420
NM_005585chr15--1381 ----
NM_005596chr911765 16319 11327 --
NM_005610chr1----1634 --
NM_005715chr6----22796 1096 --
NM_005785chr12----11906 --
NM_005822chr6----21764 801 --
NM_005911chr231347 1313 1286 11009 ----
NM_006154chr15----12748 --
NM_006186chr2------11216
NM_006255chr14----1743 --
NM_006265chr8--1283 --1403
NM_006267chr2--2444 204 1178 --
NM_006317chr5------1904
NM_006496chr1--11331 11987 --
NM_006534chr2033394 1100 847 12496 32319 521 224 --
NM_006547chr7----1526 --
NM_006644chr13----1683 --
NM_006769chr1--1167 --1753
NM_006852chr17----22280 490 11058
NM_007005chr9----11415 --
NM_007207chr11938 ------
NM_007214chr6----1956 --
NM_007238chr20114656 4372 4225 3874 3761 3676 3342 1629 630 175 105 13805 13526 --
NM_007249chr1349122 8639 8485 8063 19265 29242 1344 --
NM_007347chr15----21978 1098 12285
NM_007349chr7------1318
NM_012180chr4------1294
NM_012288chr695484 5228 4495 3782 1457 1299 1075 828 542 --1670 --
NM_012293chr251727 1521 514 284 133 ------
NM_012296chr11133937 3890 3775 3605 3165 2482 1454 1287 1278 1156 984 763 549 --13086 --
NM_012334chr554325 4217 3797 1766 1174 --14309 1679
NM_012464chr422352 539 --21098 665 --
NM_013377chr12----1529 --
NM_014243chr41791 ----166
NM_014331chr445562 4950 1488 1355 17692 17579 17422
NM_014552chr21189 ------
NM_014689chr2----1104 --
NM_014755chr2--24076 1605 --1725
NM_014803chr10----11890 --
NM_014903chr1232346 1836 1539 --1812 --
NM_014906chr1712688 --23706 718 12561
NM_015025chr2------1616
NM_015093chr6----1122 --
NM_015176chr1----188 --
NM_015194chr172298 223 12066 21836 285 --
NM_015355chr17----11332 --
NM_015359chr81687 ------
NM_015542chr10----1367 --
NM_015548chr6------172
NM_015553chr675158 3268 1902 1153 635 529 489 --14946 --
NM_015886chr845453 5399 4005 1852 13590 35638 4019 3900 --
NM_015904chr2------1549
NM_015948chr6----1381 --
NM_016041chr17------1338
NM_016045chr20--1130 ----
NM_016231chr1741718 1633 1332 590 ----11519
NM_016275chr3----12690 --
NM_017553chr15----1151 --
NM_017658chr1444123 4048 3762 30 --1927 --
NM_017778chr8----1597 --
NM_017869chr161222 ------
NM_017919chr955819 5718 5268 1135 26 --23808 1231 --
NM_018176chr4------11351
NM_018237chr10----130 --
NM_019091chr221116 462 ----1253
NM_020177chr512877 --2925 318 --
NM_020443chr166322 5782 2501 2262 193 159 --36609 2291 1303 --
NM_020529chr14------1432
NM_020747chr5----177 --
NM_020760chr2----1508 --
NM_020774chr1814469 --1169 15498
NM_020808chr11224 ------
NM_021101chr331856 1643 1615 ------
NM_021945chr61127 --23525 3363 --
NM_022118chr13------1552
NM_022133chr8----1290 --
NM_024415chr5----1206 --
NM_024617chr91812 --1337 --
NM_024665chr313689 23238 650 --13257
NM_024953chr12----11094 --
NM_024989chr268194 8165 5140 1716 243 191 ----18099
NM_030625chr102405 288 11672 1456 --
NM_030640chr121307 ----1124
NM_030753chr17----1220 --
NM_030809chr1242244 1553 598 436 ------
NM_030963chr6----1561 --
NM_030984chr7----134 --
NM_031216chr1811584 --1763 --
NM_031442chrX22149 656 --11075 --
NM_031445chr211062 ------
NM_032439chr10----1347 --
NM_032505chr331716 797 721 ------
NM_032552chr921909 1225 ------
NM_032765chr5----1292 --
NM_032786chr12----1160 --
NM_033389chr1744351 3945 3898 1338 23008 126 13872 --
NM_033394chr2----11250 --
NM_053042chr422086 408 1458 ----
NM_080867chr141100 1594 13750 14838
NM_133646chr275533 4538 3930 3885 1254 1058 232 --23648 1930 --
NM_138782chr5------12156
NM_144642chr3--1410 ----
NM_144664chr111117 12346 12340 --
NM_144723chr51666 ------
NM_145049chr5--11081 --11048
NM_145808chr7----11226 --
NM_152390chr2----1447 --
NM_152622chr522809 2724 23494 234 1398 --
NM_152624chr586941 6923 5298 5251 4636 4596 1925 1541 --12004 --
NM_152678chr372544 2288 919 874 784 342 196 --12394 --
NM_152756chr514102 ----13980
NM_153367chr1063246 2876 1590 1128 1075 860 --12465 --
NM_172373chr13----1457 --
NM_173172chr21258 ----11524
NM_173491chr5--1426 ----
NM_173505chr18----21116 221 --
NM_173552chr3----1676 --
NM_173602chr1211278 1755 23313 2678 --
NM_173808chr1--12997 ----
NM_173822chr221844 856 --12012 1348
NM_173825chr3----21011 495 --
NM_173829chr532459 2082 1861 --45132 4780 1372 583 --
NM_175736chr1277377 6109 2866 2561 1228 733 184 --36860 2829 1493 --
NM_178496chr321314 1293 1328 --1150
NM_178539chr12------1487
NM_181532chrX----1228 --
NM_181672chrX1769 1523 --1240
NM_183397chr20154880 4596 4449 4098 3985 3900 3566 3194 3183 1853 854 399 329 87 74 14029 13750 --
NM_198465chrX--12502 --1212
NM_198513chr81395 ------
NM_198715chr115782 25704 1193 14994 --
NM_198935chr2032452 211 196 13246 12627 --
NM_203459chr112262 --22506 571 12163
NM_207422chrX----145 --