TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-769-5p
miRNA Sequence: UGAGACCUCUGGGUUCUGAGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr544635 1648 608 488 31985 1962 211 14962 15549
NM_000141chr101496 --1203 --
NM_000217chr1233843 1292 347 1737 1764 --
NM_000259chr1536018 4977 1006 --22481 1380 --
NM_000264chr923127 2506 12551 1433 --
NM_000289chr12----1103 --
NM_000314chr1022486 2291 --1459 --
NM_000332chr6127071 6501 6366 4882 4690 2465 2274 1708 1601 1162 864 424 --1114 26567 1741
NM_000337chr576451 6371 5136 4825 4152 2022 1698 14314 --1224
NM_000533chrX31360 795 473 11625 1160 --
NM_000693chr1541745 605 510 420 ----11730
NM_000793chr1473899 3275 1475 1125 1069 1054 955 ----14316
NM_000809chr488816 8748 7045 5786 5754 3221 2318 1298 --13549 39133 6245 5895
NM_000813chr544876 4736 919 515 14236 --13405
NM_000844chr32904 366 --1727 --
NM_000876chr61412 ----1913
NM_000891chr1743535 2857 2521 2419 1142 ----
NM_000899chr1254359 3555 1150 592 419 23104 271 ----
NM_000901chr452243 1820 1573 562 146 ------
NM_000944chr4----1650 --
NM_001001323chr1232278 745 346 12603 --12145
NM_001001669chr512346 1899 --22194 1911
NM_001001890chr2153924 3613 3295 3117 2995 11096 ----
NM_001001994chrX----182 --
NM_001001995chrX------1203
NM_001002255chr6------1323
NM_001002838chrX2516 32 --11239 --
NM_001003652chr1847382 3431 3117 280 ----1127
NM_001003698chr631912 1350 67 1626 1613 --
NM_001003800chr943530 3207 750 676 --11043 --
NM_001004360chr21232 --11767 --
NM_001005739chr2----1264 --
NM_001006617chr9------1550
NM_001007024chr1753595 3506 474 457 236 --1366 1337
NM_001007257chr1------1399
NM_001007277chr1131116 946 358 ------
NM_001007559chr1841924 1833 1594 1536 1537 11810 --
NM_001008701chr1972973 2816 2736 2729 2336 807 199 11902 ----
NM_001008800chr1----1191 --
NM_001008895chr1311264 --1303 --
NM_001009899chr385255 4077 2520 2190 2117 1635 1544 893 22168 1522 25098 685 --
NM_001010867chr1116357 6052 5739 5468 5365 1687 1256 509 419 119 71 22196 892 11906 --
NM_001011537chr32380 137 ----12384
NM_001011657chrX1130 11155 ----
NM_001011666chr722015 1530 34189 1556 297 --15189
NM_001013399chr61801 ----1897
NM_001013615chr12417 56 2441 241 --11009
NM_001014797chr10107385 7279 7060 6786 6467 2872 2255 2041 1035 850 28220 7181 37948 7404 1540 --
NM_001015877chrX11965 ----1874
NM_001017368chr1742455 2106 674 441 1961 12335 --
NM_001017396chr231432 616 222 21736 1713 2807 675 --
NM_001017415chr12125 116 ------
NM_001017999chr111667 --12289 --
NM_001018108chr1531985 1733 901 11998 11418 --
NM_001024455chrX32400 1639 966 --32593 1651 1011 --
NM_001024649chr5----11832 --
NM_001024660chr321506 157 125 --1501
NM_001024808chr12----11792 --
NM_001024948chr131301 539 425 --11246 --
NM_001025366chr6135 ----11533
NM_001025580chrX44243 4233 3682 588 --1303 11096
NM_001029863chr61285 ----12240
NM_001029875chr51313 ----12270
NM_001030007chr1611304 --12928 11253
NM_001032282chr8--2381 40 --2263 200
NM_001032288chr2041408 1155 523 369 ----1462
NM_001032380chr10----1113 --
NM_001033045chr234017 3972 163 --13936 12778
NM_001033566chr172361 279 ------
NM_001037131chr22843 492 ------
NM_001037164chr73725 195 36 ------
NM_001037631chr2----11083 --
NM_001037639chr3----1194 --
NM_001039547chr357220 5017 3156 3034 1804 22829 600 15870 16878
NM_001039590chrX33732 3572 3180 23667 1204 12810 --
NM_001039618chr1154551 3882 2048 1655 1648 12157 13941 --
NM_001039840chrX44315 3772 1870 80 ------
NM_001040142chr2191 --32209 1721 212 --
NM_001040214chr61835 ----11964
NM_001040402chr421227 398 23250 2779 --13194
NM_001042404chr121642 1376 ------
NM_001042537chrX12358 1818 12242 --
NM_001043318chr1454169 3670 2828 2805 128 --33471 3354 1505 --
NM_001046chr542164 1094 1025 611 11861 12806 --
NM_001148chr411691 --11811 --
NM_001204chr237743 2243 389 1287 ----
NM_001271chr1542988 2731 2203 717 1816 1762 --
NM_001289chrX21520 69 --1182 --
NM_001304chr1783250 3208 1140 1079 711 651 504 438 ------
NM_001351chr321437 1181 --163 --
NM_001356chrX32080 850 831 ----12335
NM_001364chr1111547 ------
NM_001396chr2182839 2736 2201 2018 817 804 743 323 12615 ----
NM_001400chr11278 --11314 --
NM_001402chr611378 31403 794 57 ----
NM_001420chr1941225 448 283 176 ----12970
NM_001438chr112464 --1554 --
NM_001495chr811031 --1151 --
NM_001584chr11137 ----1891
NM_001659chr1252523 2259 1003 687 292 1256 11726 --
NM_001677chr11417 ------
NM_001686chr12----1124 --
NM_001690chr31834 1812 1390 1161
NM_001695chr874082 3859 3751 3577 3089 1035 210 --32895 767 277 13067
NM_001699chr1921574 279 1605 --1311
NM_001743chr2----186 --
NM_001759chr1265140 4643 3465 1994 1642 48 1685 14408 15216
NM_001760chr61932 --1913 --
NM_001801chr5124 ------
NM_001810chr20----1620 --
NM_001829chr4--1903 --1655
NM_001830chrX33142 2453 1265 ----1989
NM_001842chr9178 ------
NM_001895chr201774 ----1937
NM_001938chr1----11480 --
NM_002010chr13------155
NM_002025chrX99253 7516 7419 6878 6360 6300 6103 1110 877 29062 373 ----
NM_002076chr1223014 219 12792 32020 1180 253 --
NM_002126chr1743457 2575 896 310 13707 13800 12683
NM_002167chr13408 350 342 ------
NM_002214chr725273 4539 --24942 4880 --
NM_002268chr321320 100 ------
NM_002271chr1332468 2180 893 --166 --
NM_002293chr112377 --1940 --
NM_002298chr13----1213 11259
NM_002359chr1764296 3999 2946 2766 1180 26 --23004 1666 --
NM_002408chr14191 ----1187
NM_002577chr342702 1452 958 952 --1242 --
NM_002578chrX----1306 --
NM_002594chr2012270 1393 11708 --
NM_002687chr141946 --1493 --
NM_002736chr732085 258 107 ----11416
NM_002738chr1611000 ------
NM_002874chr911003 1369 1251 1293
NM_002886chr374172 4052 3704 3406 3329 3310 2005 14186 ----
NM_003011chr911088 --21658 130 --
NM_003026chr921250 285 --1370 --
NM_003074chr331669 1445 88 --11982 --
NM_003076chr123490 333 85 1147 ----
NM_003108chr266825 6123 5048 2451 1354 465 ------
NM_003112chr722880 1294 11281 11985 --
NM_003115chr1----1380 --
NM_003150chr1722337 1824 12096 1507 --
NM_003155chr852849 2610 1003 723 529 ------
NM_003189chr153254 3113 2542 2181 246 --12767 --
NM_003272chr1----2574 125 --
NM_003298chr396237 5972 4928 3936 3920 2103 755 292 124 --24025 2295 11194
NM_003348chr1211266 --1456 --
NM_003374chr5----1249 --
NM_003392chr323859 3012 --22659 479 --
NM_003405chr22------1524
NM_003468chr2--1384 31537 365 170 --
NM_003473chr10----1887 --
NM_003478chr1142335 1031 464 85 --12368 11004
NM_003507chr242017 1857 1437 565 --1618 --
NM_003566chr121863 11069 172 --
NM_003583chr1253491 3480 3051 1491 584 12597 ----
NM_003590chr263901 3333 1426 682 630 501 --22848 350 --
NM_003620chr17123 ----1755
NM_003629chr163453 3034 2949 2359 1255 463 --12515 --
NM_003750chr10142 1930 ----
NM_003783chr1----1188 --
NM_003791chr161116 --1623 --
NM_003884chr32647 290 11235 ----
NM_003972chr1021194 261 ------
NM_004060chr51440 1131 ----
NM_004114chrX----11043 --
NM_004124chr1442427 2320 1267 527 13509 11404 --
NM_004171chr1189008 8474 7469 6998 3700 3067 2156 1853 12134 29509 6422 --
NM_004236chr151524 ----1570
NM_004238chr2----1215 --
NM_004294chr13----1184 --
NM_004319chr1--11987 --12860
NM_004385chr5--1488 ----
NM_004392chr1332332 685 298 12607 11641 --
NM_004411chr7----1666 --
NM_004432chr911553 1886 12161 --
NM_004559chr11266 ----1394
NM_004586chrX35434 4052 3805 ----13872
NM_004598chr533089 2979 131 --21045 94 --
NM_004612chr964573 3940 3181 3077 1519 1463 1292 --11315
NM_004630chr11148 --1804 --
NM_004643chr14----1580 --
NM_004654chrY------147
NM_004660chrY32005 1473 813 ------
NM_004738chr2011676 --1116 --
NM_004742chr321808 1621 --1325 --
NM_004748chr1521266 1056 --13870 --
NM_004788chr1122414 64 --11061 --
NM_004840chrX1615 --32114 815 336 --
NM_004849chr6181 1171 1255 --
NM_004850chr21509 ----1357
NM_004857chr1443947 1695 599 362 22985 1673 12907 14769
NM_004859chr1721184 775 --1607 --
NM_004887chr5------11124
NM_005020chr7------1214
NM_005121chr1753789 3366 3255 518 108 ----1795
NM_005156chr955054 3483 2002 907 214 --2955 191 --
NM_005171chr122929 354 ------
NM_005455chr1----11220 --
NM_005465chr1--1763 --1228
NM_005596chr936231 4798 4309 11828 35809 4746 3944 --
NM_005647chrX43120 2503 294 232 ----1894
NM_005748chr1272892 2529 1244 722 622 454 205 ------
NM_005759chr254421 3757 3691 1559 1025 --144 --
NM_005797chr111255 ----1212
NM_005880chr1631656 1484 1421 --1611 --
NM_005920chr143884 1042 938 529 --23154 2969 --
NM_005933chr1122503 492 --22910 195 12091
NM_006121chr12------1410
NM_006176chr111529 --1759 --
NM_006251chr542764 2242 709 557 1687 --1248
NM_006277chr2----1262 --
NM_006301chr12----1460 --
NM_006315chr421745 841 --33561 537 331 1377
NM_006329chr141315 --1788 --
NM_006420chr2022530 375 12947 ----
NM_006494chr191222 ------
NM_006534chr202573 407 --23446 760 --
NM_006546chr1765330 5029 2139 1960 340 125 ----1801
NM_006551chr11126 ----177
NM_006552chr11------179
NM_006558chr8----1337 --
NM_006593chr21743 --1153 --
NM_006651chr41574 --11015 --
NM_006670chr6------1264
NM_006717chr932708 2262 2163 --13199 --
NM_006750chr16117439 6440 5701 2620 2437 2162 2137 1492 971 755 268 11648 27630 2676 --
NM_006807chr17--21098 44 ----
NM_006811chr202888 129 --143 --
NM_006851chr1211911 ----12759
NM_006852chr172830 704 22757 2249 ----
NM_006854chr721814 1639 11464 1168 --
NM_006874chr421138 1097 ------
NM_006965chr18----138 1222
NM_007011chr1596317 6035 5766 4353 1738 1608 1071 837 671 11833 21918 74 11423
NM_007035chr122265 75 ------
NM_007146chr17----12818 --
NM_007174chr1232117 1935 889 12167 22302 521 --
NM_007249chr1368795 6613 5929 3187 2239 733 17532 27296 1731 12057
NM_007372chr173662 308 280 --1864 --
NM_007374chr14----1446 --
NM_007375chr112275 --1287 --
NM_012096chr322303 167 13111 --1545
NM_012098chr91413 1552 ----
NM_012153chr1132082 966 638 1476 22601 869 --
NM_012215chr1021841 1537 1448 168 --
NM_012234chr323521 1094 ----13588
NM_012293chr22778 251 11930 ----
NM_012309chr1144235 1626 1531 167 --21339 847 --
NM_012316chr134384 4298 2106 11208 --15622
NM_012412chr7----2823 219 --
NM_013437chr8--11023 --1890
NM_014023chr1031899 926 761 1946 11115 1664
NM_014071chr20----1212 --
NM_014117chr1642361 2349 897 482 ----12104
NM_014155chr1197535 7401 6648 2443 1465 1165 1029 325 152 --25237 112 11443
NM_014212chr12----1647 --
NM_014213chr22233 165 ------
NM_014231chr1232070 1835 1531 1530 11691 --
NM_014319chr12----1462 --
NM_014323chr221171 1940 ----
NM_014361chr11----1175 --
NM_014372chr11430 11435 1538 --
NM_014445chr342076 1523 769 343 1726 1150 --
NM_014517chr311808 11744 ----
NM_014649chr19----1197 --
NM_014667chr332422 845 286 --22121 678 --
NM_014679chr111345 ----180
NM_014683chr1711873 --22036 1460 --
NM_014686chr1952413 2335 639 556 486 --1964 --
NM_014701chr1512656 ------
NM_014727chr19----1232 --
NM_014787chr152535 954 406 172 69 --12091 --
NM_014790chr5----1138 --
NM_014810chr122825 1394 --12944 --
NM_014813chr1--2458 158 1498 --
NM_014830chr1243378 925 394 336 --1724 --
NM_014841chr61995 ----1363
NM_014877chr1797686 6119 5607 5395 1759 1464 1292 942 408 16097 46546 5543 5257 4960 --
NM_014897chr1743121 835 805 363 22678 2655 ----
NM_014949chr121019 757 ------
NM_014991chr422419 595 ------
NM_015002chr1211578 ----2861 297
NM_015009chr33618 158 106 ------
NM_015039chr164165 4044 3219 1664 1361 1025 11575 22830 1174 --
NM_015073chr1921991 1410 1210 1393 22123 2105
NM_015076chr674448 4370 2951 1137 990 975 576 22929 802 ----
NM_015082chr52910 132 12250 --12190
NM_015092chr1623228 810 --11373 --
NM_015097chr331728 1711 760 --128 --
NM_015107chrX22133 520 11946 1239 --
NM_015172chr111399 ----11614
NM_015178chr812597 --12155 12681
NM_015267chr1211366 ----21565 806
NM_015275chr12----1813 --
NM_015299chr1433278 2991 245 1537 ----
NM_015310chr868023 7070 5422 5365 3276 841 27210 5866 25457 981 --
NM_015326chr13984 604 264 12677 23009 1153 --
NM_015335chr123808 578 500 1488 1996 --
NM_015455chr533812 3707 3219 ----12539
NM_015460chr341520 1320 768 192 --21867 564 --
NM_015465chr51202 ----1296
NM_015530chr2----1323 --
NM_015534chr1----1213 1313
NM_015564chr523354 2738 --1301 1688
NM_015569chr123187 239 --13902 24347 1425
NM_015576chr312396 22595 2460 31997 1847 941 --
NM_015635chr921891 618 11696 ----
NM_015680chr2----1571 1670
NM_015906chr144504 3982 3307 3160 1564 13258 --
NM_016009chr131859 1303 612 1428 24917 4394 1238
NM_016045chr20--1592 21478 40 --
NM_016083chr652768 2588 1417 975 657 --13426 --
NM_016100chr20------1110
NM_016121chr12895 432 11133 1999 --
NM_016144chr51611 --1682 --
NM_016172chr9------1353
NM_016173chr353130 2826 1745 602 337 22839 742 23778 611 --
NM_016248chr131267 --1597 --
NM_016289chr222193 1624 --1765 --
NM_016308chr121537 194 --11644 --
NM_016339chr17----11227 --
NM_016374chr11598 11446 1618 --
NM_016410chr9----196 --
NM_016442chr51187 ----11468
NM_016470chr202519 340 --1486 --
NM_016490chr21301 --1362 --
NM_016494chr2----2135 68 --
NM_016598chr321379 262 ------
NM_016604chr511031 --139 --
NM_016626chr182460 184 ------
NM_017542chr111727 1734 ----
NM_017629chr131889 301 105 ------
NM_017633chr613108 --12565 1423
NM_017650chr746102 5978 5400 955 13824 1926 --
NM_017688chr9------11074
NM_017742chr1821450 190 11358 ----
NM_017848chrX43647 2959 1405 448 11504 --11167
NM_017944chr1122450 1926 12587 1932 --
NM_017988chr121227 --1924 --
NM_018105chr81185 1253 11072 --
NM_018121chr1012652 --12093 1549
NM_018128chr171955 ----11056
NM_018197chr20175 1289 1633 --
NM_018206chr16----2109 66 --
NM_018263chr212264 12591 --22605 104
NM_018287chr1031347 1252 477 --1909 --
NM_018293chr322059 113 --1579 --
NM_018362chr1112639 13363 --11244
NM_018364chr153966 3447 2973 556 219 --13871 --
NM_018403chr311564 11502 --1176
NM_018416chr1252179 1620 531 496 367 12599 1564 --
NM_018486chrX----123 --
NM_018566chr121492 846 --14146 --
NM_018584chr1----11144 --
NM_018955chr17----1132 --
NM_018959chr191167 --1274 --
NM_018999chr1054332 4324 4299 1222 1074 --24788 1878 --
NM_019004chr712083 --1577 --
NM_019006chr15159 --1638 --
NM_019012chr12----1716 --
NM_019084chr1031013 899 446 ----12290
NM_019091chr211084 ----1368
NM_019094chr1243684 3570 1426 118 33709 2826 1450 23799 2960 --
NM_019096chr62754 353 --11038 --
NM_019106chr2212113 ----1345
NM_019555chr311734 ----11530
NM_020135chr6------1437
NM_020144chr7----2845 681 --
NM_020148chr1842346 1130 1124 746 22399 976 1693 --
NM_020177chr543377 2407 829 161 11224 1744 --
NM_020193chr1141327 1069 341 257 ------
NM_020205chr13657 325 237 --11349 --
NM_020231chr3----1600 --
NM_020348chr1072585 2119 2101 1881 607 490 246 ----21974 822
NM_020382chr1231215 523 307 --1177 --
NM_020416chr441080 657 646 329 --1612 12172
NM_020423chr11212 --1452 --
NM_020443chr134819 1500 276 16352 46215 5325 2758 2314 --
NM_020653chr17----1420 --
NM_020752chr10----12713 --
NM_020760chr2----1522 --
NM_020771chr61142 ------
NM_020781chr722917 67 --1596 --
NM_020858chr151366 --11554 --
NM_020870chr411821 11678 --22234 1670
NM_020899chr1751728 1648 939 672 547 1527 --11800
NM_020925chr1----1909 --
NM_020935chr254454 4185 3566 3027 1518 1191 14324 --
NM_021033chr1331379 1194 774 13292 23347 3237 --
NM_021079chr1752781 1173 481 395 210 ------
NM_021116chr778890 8241 6765 5862 1906 1241 316 --33288 1373 697 --
NM_021155chr1942550 896 785 762 --11915 --
NM_021183chrX22215 733 --1166 --
NM_021809chr2042208 1595 313 50 11573 1131 --
NM_022166chr1654615 2363 1737 802 114 24892 3866 25108 1266 11388
NM_022719chr2253242 3221 3133 3019 559 ----22560 1088
NM_022898chr1464559 4292 4226 4017 3685 1292 14824 14394 --
NM_023071chr121141 --1272 --
NM_024646chr153576 1546 617 202 93 1605 ----
NM_024874chr1----1196 --
NM_024939chr1621260 1080 ----11182
NM_024958chr203907 823 745 ------
NM_025009chr41534 --1560 1792
NM_025054chr833044 2992 427 --13363 --
NM_025134chr1612401 ----12177
NM_025160chr113979 --11325 --
NM_025191chr1----11082 --
NM_030579chr1663385 2892 2642 2466 626 251 ------
NM_030625chr101939 --22289 1881 11038
NM_030647chr72449 250 ----15736
NM_030648chr435345 4515 155 11755 1644 --
NM_030768chr2----1119 --
NM_030780chr811252 1690 11479 --
NM_030913chr1----1577 --
NM_030964chr563609 2979 1323 1150 903 85 13505 ----
NM_031407chrX------1494
NM_032128chr41158 --1259 --
NM_032153chr332100 1842 512 --22403 2218 --
NM_032199chr1031516 1322 1280 12441 1680 --
NM_032289chr51449 --3507 379 325 1393
NM_032320chr111234 --1287 --
NM_032440chr1012372 1772 22822 890 --
NM_032457chr423240 890 13041 ----
NM_032458chrX12295 ----11204
NM_032846chr1411163 --171 11500
NM_032875chr17----1596 --
NM_033055chr1------21107 43
NM_033224chr766809 3078 2899 2559 2269 1833 16787 1492 --
NM_033389chr1774280 1824 1148 693 559 434 343 14742 ----
NM_033656chr2165443 5078 1951 804 581 175 22216 1506 1948 --
NM_052855chr17----1545 --
NM_052910chr132881 737 --11419 11589
NM_052911chr181799 2740 314 ----
NM_052948chr19----1110 --
NM_054027chr52653 201 11858 1139 --
NM_080927chr363381 2945 2683 2311 2059 1192 1646 --12556
NM_133445chr933608 1366 109 --43770 3137 189 116 --
NM_133468chr7--22213 1735 1473 --
NM_138473chr1224190 1752 --24610 1294 --
NM_139125chr33587 515 416 11571 ----
NM_139245chr32204 55 1136 ----
NM_144571chr446698 5593 2637 1026 1351 21994 111 --
NM_144703chr202960 273 1472 2295 225 --
NM_144963chr822509 1941 ----1610
NM_145274chr17----1811 1152
NM_145349chr1741967 673 312 68 11945 ----
NM_147156chr102531 328 --1446 --
NM_152261chr121206 --1185 --
NM_152271chr81976 193 ----
NM_152407chr53610 328 73 22353 174 ----
NM_152409chr53825 557 27 ----13099
NM_152608chr11695 1673 12238 --
NM_152622chr5164 --1534 --
NM_152624chr535990 1718 875 --35159 4814 2530 27045 5565
NM_152787chrX--13100 42704 1558 1394 174 --
NM_152994chr2----1248 --
NM_153619chr1522235 176 --12792 --
NM_170665chr1234088 3690 1816 14597 --1120
NM_170711chr192615 343 ------
NM_171998chrX32169 967 561 1766 11645 --
NM_172071chr167184 6399 5048 4637 1191 372 --17459 26211 5700
NM_173075chr411514 --1238 --
NM_173468chr445561 3972 323 105 13683 35074 823 667 15120
NM_173495chrX41910 1904 814 493 ----136
NM_173511chr243122 2927 2874 2462 11593 --1239
NM_173582chr1131964 1564 718 --26328 4445 --
NM_173602chr1233282 1329 718 --33296 3123 2951 --
NM_173631chr19----11170 --
NM_173808chr144195 3924 3496 1577 11529 --1542
NM_173822chr21165 11469 ----
NM_174911chr812621 ----1796
NM_175736chr1267225 6498 2102 1934 738 169 --33077 610 215 15202
NM_175861chr1256020 4629 3858 1479 217 --15952 --
NM_176792chr10----1150 135
NM_176814chr721082 28 ----11276
NM_181358chr122854 147 13805 ----
NM_182511chr18------1230
NM_182758chr1513741 --1774 11291
NM_194247chr243429 2750 1702 876 13024 1271 --
NM_194286chr12106187 6157 5242 4270 4118 2169 1125 835 306 287 14408 11209 14211
NM_197939chr17195 ----1113
NM_198243chr152312 227 ----1217
NM_198834chr17------22044 303
NM_199044chr122291 2049 --1195 12767
NM_199168chr101159 11108 11030 --
NM_201613chr121223 1180 ----
NM_206998chr11146 ----197
NM_207337chr121744 ----1782
NM_207362chr2------1680
NM_207647chr942230 496 454 97 --12362 12216
NM_213589chr244570 4278 4055 2126 24109 4086 21878 1736 --