TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-770-5p
miRNA Sequence: UCCAGUACCACGUGUCAGGGCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000141chr1021330 455 --1262 1385
NM_000202chrX53176 3089 2659 2575 1331 198 ----
NM_000216chrX54093 4035 2706 965 587 ------
NM_000240chrX12269 11422 --21536 105
NM_000245chr741912 1843 1653 124 2245 141 ----
NM_000248chr352939 698 486 472 213 ------
NM_000304chr171224 --11004 --
NM_000314chr1053121 1994 1038 678 395 1544 1717 --
NM_000321chr1311674 1578 11728 --
NM_000337chr545188 2497 1905 621 --11356 14039
NM_000461chr384208 3962 3775 2940 1852 1493 656 41 ------
NM_000489chrX82582 2455 2439 2309 1041 865 748 735 ------
NM_000599chr254368 3826 3153 1465 488 1815 --11211
NM_000826chr41611 22512 1877 --163
NM_000838chr61873 ------
NM_000933chr201167 ------
NM_000944chr412392 1375 11612 11864
NM_000959chr163969 3805 2855 2771 1525 872 13143 ----
NM_001001433chr2042612 2439 1287 1063 13168 12888 --
NM_001001481chr833447 442 307 ----13035
NM_001001484chr1021866 1725 1930 ----
NM_001001664chr21715 ----1450
NM_001001711chr112914 73 ------
NM_001002258chr2----188 --
NM_001003810chr43649 328 265 ------
NM_001004023chr1----1189 --
NM_001004342chr165526 5224 4630 4470 4289 1805 34315 4218 1550 15967 --
NM_001005386chr252409 2009 1835 484 400 11688 ----
NM_001006600chr531907 1780 750 145 1527 12403
NM_001007214chr131664 1519 70 1152 ----
NM_001007466chr694956 4775 4738 4700 4088 3995 2046 1668 397 ----11935
NM_001008239chr1821291 467 13590 ----
NM_001008392chr373544 3435 3342 3239 2555 554 222 13464 --13246
NM_001008408chr766341 5717 4647 4227 2047 1653 14624 --24593 699
NM_001008493chr111551 ------
NM_001008495chr832259 1755 1682 1413 1226 --
NM_001009899chr334519 804 166 --35899 429 307 12241
NM_001010852chr6----146 --
NM_001010942chr122970 314 ----1347
NM_001011513chr4------13968
NM_001011537chr341791 1619 821 587 22144 1635 ----
NM_001013031chr1022450 916 ----13191
NM_001013399chr62979 914 1119 ----
NM_001013746chr731826 863 126 71643 626 542 458 378 294 43 --1211
NM_001017415chr11112 1103 ----
NM_001018038chr9----1115 --
NM_001018065chr945647 5540 5180 5006 13760 --16016
NM_001018067chr155067 4680 2115 427 281 21485 419 21661 220 --
NM_001018090chr15--21085 620 1242 --
NM_001023567chr1572431 2413 2356 2307 1879 723 529 --1593 --
NM_001024847chr312136 1421 ----
NM_001025076chr1055779 3975 2433 1939 1360 16044 ----
NM_001025252chr81702 --12005 12581
NM_001025780chr941578 299 255 24 ------
NM_001030007chr1663992 3128 2853 1570 539 72 11427 --11031
NM_001030055chr1431784 1502 1065 --14237 12902
NM_001031695chr2255378 4184 1100 690 423 11392 14287 --
NM_001032280chr641657 1289 1069 537 11265 11300 --
NM_001033566chr172991 329 --1168 --
NM_001037174chr242303 1566 620 466 --1570 147
NM_001039091chrX----11352 --
NM_001039590chrX23772 1223 1949 13662 --
NM_001039840chrX44569 2288 820 632 34705 4398 396 ----
NM_001040142chr242410 1740 531 405 ----12392
NM_001040151chr1144562 3183 1262 950 13787 13741 23374 346
NM_001040159chr411081 11089 11342 --
NM_001040202chr422187 1687 ------
NM_001040214chr611877 21566 898 ----
NM_001040284chr1682320 2298 1617 1265 1215 1077 1056 887 13720 --15643
NM_001040712chr921066 514 --1381 --
NM_001042555chr1234069 1653 272 14680 13323 --
NM_001042601chr353027 2109 846 783 398 11085 ----
NM_001043351chr141955 1758 1661 586 --11801 1924
NM_001071775chr1331574 1268 650 --21959 458 --
NM_001078chr11115 --1615 --
NM_001121chr10--21634 1580 ----
NM_001149chr1021177 46 --11185 --
NM_001257chr16----21557 353 --
NM_001259chr735605 1869 285 13862 ----
NM_001284chr52430 128 ------
NM_001390chr1843529 3516 3480 2234 ----12988
NM_001396chr2141965 1042 999 525 --12325 --
NM_001497chr962668 2493 2386 900 397 72 --22573 1909 --
NM_001498chr621149 106 --1314 --
NM_001616chr263329 3073 2240 908 796 506 12458 1769 --
NM_001663chr14----11752 --
NM_001753chr721781 268 21485 1308 ----
NM_001759chr1295106 4839 4414 4212 3823 3725 1768 1292 913 12000 15170 23854 1860
NM_001830chrX31418 726 433 1713 23890 2474 --
NM_001859chr933949 3895 1239 --23437 1367 --
NM_002024chrX21512 271 --1157 --
NM_002025chrX59232 6317 1569 1537 1523 26607 6340 ----
NM_002061chr11197 1439 ----
NM_002107chr12486 71 --1168 --
NM_002239chr21148 --1828 --
NM_002247chr1032318 1882 540 ----12089
NM_002264chr3114717 3886 3144 1974 1964 1510 1350 1247 813 698 575 24038 3507 14855 --
NM_002270chr585623 5068 3802 1828 1209 1148 1081 148 ------
NM_002336chr1234789 4183 3650 1147 11579 --
NM_002356chr632763 2587 750 11094 22782 74 --
NM_002481chr1137883 5937 5746 5206 5027 3195 3156 3133 3104 3038 2616 2496 1189 12899 25813 2757 --
NM_002499chr1532380 2205 331 --1786 12479
NM_002508chr11701 ----11974
NM_002646chr122138 2073 1490 21654 731 1640
NM_002709chr242770 2192 1066 181 11410 11099 --
NM_002736chr721871 522 --1508 --
NM_002737chr1755421 4500 4324 1586 1026 14305 14941 11857
NM_002806chr14----183 --
NM_002828chr181787 1401 ----
NM_002852chr31407 --1145 --
NM_003016chr1771629 1286 549 458 326 317 116 11243 --1385
NM_003051chr12489 65 21248 811 11877 --
NM_003070chr9------1688
NM_003093chr6----1185 --
NM_003108chr255963 5661 5452 1289 908 ----11545
NM_003155chr872845 1953 1859 1717 760 659 77 --1463 12626
NM_003161chr173803 598 202 ------
NM_003202chr521906 1849 ------
NM_003298chr356146 5943 4227 2467 2429 15042 --15690
NM_003337chr521099 1061 11078 ----
NM_003340chr451438 1269 1080 1067 514 ------
NM_003453chr133632 613 606 ------
NM_003463chr63623 276 114 22965 25 ----
NM_003473chr102911 783 ------
NM_003489chr2132807 458 138 13255 1131 --
NM_003507chr241874 1716 606 76 ----11521
NM_003574chr1855666 4547 1805 1542 21 24597 193 ----
NM_003749chr1382404 2233 2132 1896 1632 1607 428 222 12355 1754 --
NM_003873chr1052320 809 531 359 240 --2768 546 --
NM_003884chr331664 1425 94 --11840 --
NM_003902chr11701 --1549 --
NM_003913chr654336 3675 967 757 307 22743 582 11330 --
NM_003941chr71629 ------
NM_003948chr442418 2090 788 71 --12027 --
NM_003972chr1031001 476 133 --1976 --
NM_004124chr1432527 459 206 33073 368 52 13576 --
NM_004136chr1513212 23229 2946 --158
NM_004161chr251420 1183 642 320 82 1610 1224 --
NM_004170chr931564 611 406 --1617 --
NM_004171chr1198305 8124 7330 6838 6100 3800 1487 1073 176 39606 6121 250 27901 2204 --
NM_004272chr541709 1313 813 246 ----1602
NM_004279chr732025 759 565 --11904 --
NM_004330chr1571119 886 876 851 80 53 39 --1172 --
NM_004342chr752115 911 611 537 197 ------
NM_004385chr5----1167 --
NM_004441chr31885 ----186
NM_004472chr52622 609 ------
NM_004497chr194459 247 216 173 --1701 --
NM_004504chr252963 2651 396 366 283 2448 23 --11009
NM_004505chr1732020 1913 1746 --11940 --
NM_004529chr9----11264 --
NM_004537chr121517 21178 1006 ----
NM_004540chr211753 ----1282
NM_004575chr421610 1452 ------
NM_004612chr954055 3998 3508 465 287 13539 --23569 318
NM_004690chr62723 679 ------
NM_004745chr844939 2669 2217 1129 16841 12066 --
NM_004788chr1142531 2282 2021 386 12238 12228 --
NM_004849chr61545 11073 ----
NM_004859chr1742413 680 395 39 2988 905 ----
NM_004866chr543934 3852 3406 645 23065 1771 14411 --
NM_004992chrX87998 7186 7082 6960 6926 5660 2038 685 ------
NM_004999chr663642 3203 2775 1234 1081 1072 13553 --14489
NM_005067chr31345 ------
NM_005121chr1732507 855 649 13587 ----
NM_005124chr62905 864 162 178 --
NM_005126chr322104 1716 ------
NM_005188chr1146688 3165 2477 768 37625 5840 317 1734 17968
NM_005233chr3191 1186 --11833
NM_005252chr142529 231 ------
NM_005259chr2----1390 --
NM_005277chr421629 1385 11248 ----
NM_005295chr7----1104 --
NM_005458chr921824 1638 ----12099
NM_005563chr12891 290 --3296 273 60 --
NM_005596chr9105086 4690 4604 2232 2017 1980 1366 1311 1137 459 16403 21891 545 14297
NM_005668chr553538 3387 3333 1477 560 --23514 921 --
NM_005746chr742188 741 705 254 2955 659 ----
NM_005751chr73483 394 81 ------
NM_005813chr251009 765 750 140 94 12435 --1845
NM_005822chr6----11581 11570
NM_005828chr1764896 4819 3866 1959 1059 190 --1606 11346
NM_005832chr31996 ----1239
NM_005906chr661685 1403 1274 1119 454 231 ------
NM_006106chr1152603 2558 2429 449 180 --12725 --
NM_006141chr1632797 2657 1717 --1749 --
NM_006216chr22640 207 ----1170
NM_006226chr2------1118
NM_006246chr14182 ------
NM_006380chr1744381 1723 1237 1015 13336 ----
NM_006401chr9----141 --
NM_006420chr2043319 2942 441 24 --22526 939 --
NM_006494chr19----1824 --
NM_006524chr71284 31034 873 201 ----
NM_006526chr2051998 1987 633 613 125 11863 ----
NM_006534chr2032555 920 64 --1844 1425
NM_006544chr1444780 3924 1712 1430 25543 4143 ----
NM_006546chr1754787 2198 2034 832 547 26474 2045 11497 --
NM_006597chr111191 ------
NM_006599chr1686498 6476 2887 2592 2006 1056 993 914 38234 2287 522 17343 --
NM_006601chr121437 2942 762 ----
NM_006628chr15104534 4390 3254 2975 2912 1708 1487 1202 379 134 --23699 268 --
NM_006743chrX--2767 295 ----
NM_006750chr1637288 5694 1203 --12212 15024
NM_006775chr632923 778 444 --1951 11132
NM_006777chrX32845 2746 965 12352 ----
NM_006832chr1411034 --1965 --
NM_006988chr21----11111 --
NM_007007chr1244825 3165 1180 263 ------
NM_007047chr672499 2300 1741 1646 1601 983 888 --1594 --
NM_007106chr1352121 2012 484 235 52 ------
NM_007212chr131993 1932 1883 --169 --
NM_007214chr611030 ------
NM_007282chr32879 203 ----1834
NM_007331chr452726 2607 2150 1924 381 12381 ----
NM_007345chr1842246 1878 1791 1594 21854 1649 11982 --
NM_007368chr1341533 1159 1097 455 11401 ----
NM_012081chr552958 1374 1358 1345 332 13210 1250 13454
NM_012082chr82758 177 1748 ----
NM_012164chr956959 2914 1942 1849 1322 --22471 298 --
NM_012234chr323666 611 13615 --1696
NM_012238chr1021666 1458 ------
NM_012262chr185252 4982 4702 3749 3219 681 159 113 23360 494 15161 25205 1188
NM_012338chr71495 143 ----
NM_012395chr743009 2935 2887 1325 2911 644 ----
NM_012421chr1----1156 --
NM_012479chr711100 11998 21003 200 1207
NM_013293chr7----1685 --
NM_013316chr71961 ------
NM_013381chr122478 204 ------
NM_013448chr142546 485 --2497 230 1219
NM_014057chr911250 1379 183 --
NM_014112chr854435 4396 4238 4019 1287 21965 1417 1272 1389
NM_014153chr162673 664 --1105 --
NM_014181chr242233 2091 851 833 1212 ----
NM_014251chr74740 598 42 25 ------
NM_014253chrX21985 589 --2768 71 --
NM_014278chr42458 304 ------
NM_014283chr121278 259 --11014 --
NM_014331chr4107557 7021 6598 6576 6142 5509 5179 4873 1499 256 12194 15448 --
NM_014341chr6----1753 --
NM_014423chr555452 5155 4288 4041 3884 11014 14842 --
NM_014494chr1622352 2226 ------
NM_014682chr862321 1821 934 447 102 77 1664 ----
NM_014683chr1711335 1192 --1624
NM_014711chr1631611 1430 632 ------
NM_014730chr1274924 3756 3258 1948 1849 979 59 --14482 15002
NM_014795chr22177 47 11203 ----
NM_014819chr531699 1675 309 ------
NM_014830chr1223772 3489 21183 1135 ----
NM_014840chr12103246 3207 3055 2917 2182 2112 1220 555 278 87 --1521 --
NM_014877chr1767084 6555 5602 2410 403 250 --27142 6609 --
NM_014897chr1743048 2851 2664 2049 --22790 2725 --
NM_014912chr1053144 3111 2968 2570 218 13331 --131
NM_014946chr212279 12730 --13123
NM_014962chr2042846 2201 1894 1836 11771 ----
NM_015000chr1272714 2701 2017 752 490 408 315 ----1240
NM_015097chr341603 1447 648 341 ------
NM_015110chr932102 867 590 11763 12163 --
NM_015132chr7----11467 --
NM_015144chr1634009 3706 1109 13752 13565 --
NM_015172chr151541 1470 1395 1075 71 11003 --21315 495
NM_015176chr14718 594 542 505 ------
NM_015191chr1172645 2522 2442 2363 1682 852 617 12243 --1211
NM_015199chr322647 2615 12998 11121 --
NM_015205chr1334514 4447 384 25209 5002 11422 --
NM_015252chr21829 ----1281
NM_015310chr866768 5353 3028 2973 1083 656 1584 2510 27 17947
NM_015378chr121177 254 1405 22041 227 --
NM_015441chr1------1422
NM_015446chr11393 --1587 --
NM_015461chr181113 1748 ----
NM_015509chr1221516 1295 --21647 594 --
NM_015550chr71509 --13202 1516
NM_015565chr21----11636 --
NM_015569chr164316 4308 4144 1591 1166 225 ------
NM_015570chr711701 11403 ----
NM_015852chr722345 1376 133618 1461 1296 1047 963 627 543 459 375 291 207 123 39 13492 11131
NM_015872chr141584 1310 246 110 --1171 11348
NM_015906chr144681 4589 1826 914 33805 1339 94 ----
NM_015912chr841876 1819 641 318 --11021 1986
NM_016009chr154357 3705 3184 1257 788 1296 11118 --
NM_016073chr1511063 11087 11098 --
NM_016083chr643690 3550 3301 955 1879 13778 --
NM_016120chrX1477 ------
NM_016258chr1------1140
NM_016284chr16----1908 --
NM_016441chr232236 1806 136 11579 --1101
NM_016559chr34991 623 563 50 --11238 --
NM_016605chr562458 2389 1986 984 746 680 ------
NM_016626chr1851525 1396 539 424 117 --11101 --
NM_017519chr61322 ------
NM_017610chr1541839 554 258 54 --1118 --
NM_017637chr9129280 8831 8077 8014 7655 5759 3633 3495 3281 2619 646 569 18940 1751 --
NM_017643chr1742710 2690 2443 90 ------
NM_017650chr735235 1722 787 12191 --11883
NM_017658chr1484362 4120 3778 3577 805 434 414 45 ----24019 406
NM_017672chr1521012 363 ------
NM_017742chr1811840 ----11917
NM_017780chr84842 618 347 181 ------
NM_017811chr993151 2810 2237 2045 914 891 424 414 26 ------
NM_017813chr855209 4422 4212 3722 202 160 12295 --
NM_017831chr1834763 4563 1124 --24178 3019 --
NM_017848chrX23829 3155 21776 1641 3691 662 598 --
NM_018011chr132569 466 1450 ----
NM_018018chr1221912 1801 132 11877 --
NM_018027chr102999 857 23159 2795 ----
NM_018048chr1211603 --172 --
NM_018061chr141640 1436 473 385 11153 ----
NM_018063chr10----162 --
NM_018078chr4----1698 --
NM_018084chr252703 2119 2063 1027 264 1212 1834 --
NM_018121chr101759 --11202 --
NM_018133chr362155 867 528 521 489 424 ------
NM_018159chrX51565 1486 1404 646 25 ------
NM_018184chr31352 --12040 --
NM_018260chr1921303 1053 3225 153 68 ----
NM_018287chr101882 ----11007
NM_018326chr7----1207 --
NM_018360chrX271 23 1132 ----
NM_018362chr1143914 3442 3066 1538 ----13434
NM_018371chr821587 1525 --11536 --
NM_018416chr121255 12348 12378 --
NM_018482chr852555 1830 1796 306 214 11707 ----
NM_018638chr1255263 4954 4824 3879 879 11438 ----
NM_018650chr121540 887 --168 --
NM_018717chr452384 2349 2177 780 736 1858 12112 --
NM_018898chr542366 1714 1652 447 ------
NM_018948chr12995 436 ----11404
NM_018970chr742099 743 577 483 1517 11185 --
NM_018976chr1222811 951 11085 ----
NM_018999chr1074832 4320 4045 3759 1562 1472 1055 ------
NM_019084chr1022434 2005 12414 ----
NM_019087chr541126 450 296 92 --11101 --
NM_019114chr941790 1729 750 434 11882 ----
NM_020130chr84919 540 532 212 ------
NM_020144chr741426 728 420 131 ------
NM_020337chr432686 1089 964 22232 59 --12346
NM_020346chr1141536 1493 518 393 ------
NM_020357chr351324 1187 1158 542 430 --1436 --
NM_020390chr374361 4140 3783 3343 3145 1450 365 33466 1626 439 21185 134 --
NM_020432chr731963 160 49 11668 ----
NM_020443chr1107035 6665 5491 2807 2537 2503 2293 1144 236 161 --15999 25951 5043
NM_020466chr623979 698 1254 --11731
NM_020640chr352013 1904 1863 646 77 11721 --1493
NM_020748chr1752158 1609 713 556 100 1279 11444 --
NM_020774chr1834223 2479 1602 15361 14893 --
NM_020856chr1941473 1171 1129 189 --1358 --
NM_020870chr422108 227 ------
NM_020871chrX31017 892 561 --12498 --
NM_020951chr1922114 855 21631 894 21892 1590 --
NM_021038chr322942 233 1888 1384 --
NM_021149chr1611175 --11181 --
NM_021238chr1222099 1995 --11877 --
NM_021239chr1431185 359 227 11391 ----
NM_021783chrX42441 2396 2312 1915 ------
NM_021943chr631603 874 147 21491 295 189 --
NM_021947chr173447 287 69 --1382 --
NM_021961chr1186951 6944 5568 5253 5037 2308 1287 784 14738 17142 --
NM_021964chr395853 4806 4139 2596 1795 1639 725 83 29 14694 ----
NM_022048chr1556412 5447 3919 2235 817 --12059 21958 1522
NM_022103chr1931008 940 241 1402 ----
NM_022491chr1233309 677 97 --1250 --
NM_022728chr71493 1231 ----
NM_022777chr7----1352 --
NM_022893chr232884 2603 1135 13112 ----
NM_022898chr1441527 1502 436 237 --24489 778 --
NM_024496chr14----1249 --
NM_024639chr652591 2118 1182 511 394 --12456 --
NM_024640chr14922 757 667 169 ----139
NM_024665chr364680 4544 4047 3151 1860 75 ----1218
NM_024721chr861682 1053 668 656 339 152 1560 ----
NM_025160chr154113 3991 3101 3009 1276 ------
NM_030647chr755999 5830 2508 2341 1025 --15722 15114
NM_031208chr162745 97 ------
NM_032121chrX2982 624 ----137
NM_032139chr192921 452 1763 ----
NM_032199chr1033220 2811 662 22929 1381 2966 69 --
NM_032217chr42557 304 11006 ----
NM_032360chr1----1104 --
NM_032440chr1042561 980 574 414 ------
NM_032547chr431212 1123 205 11205 11303 --
NM_032558chr941457 1374 1331 1294 ----184
NM_032632chr143661 498 136 ------
NM_032682chr352603 2247 1456 595 452 13268 2986 550 --
NM_032932chr1766443 5360 5337 5306 4851 4032 --56295 4772 4291 1865 332 1257
NM_032968chrX24244 4072 ------
NM_032973chrY24236 4064 ------
NM_033285chr844149 3488 2845 1075 --13414 13725
NM_033495chrX1251 1124 1295 --
NM_033505chr2116429 6417 5183 4721 4604 2552 2227 2074 959 508 30 14626 ----
NM_052900chr831572 1250 106 1291 ----
NM_052913chr6----178 11056
NM_054027chr561821 1738 1638 1454 1428 162 ------
NM_058172chr4----1647 --
NM_080546chr92862 839 --11612 --
NM_080743chr61585 1671 ----
NM_101395chr2142633 2143 1193 394 --12993 --
NM_133265chrX62765 2307 735 425 261 66 1134 --1556
NM_133367chr633378 2865 615 23161 2854 22260 1124 --
NM_133473chr1931633 498 35 31365 583 417 11696 --
NM_138423chr1552324 2041 902 857 36 ----1700
NM_138426chr732397 558 268 ----1889
NM_138459chr6--23026 2599 --22262 237
NM_138473chr1244479 3760 3456 1149 13486 ----
NM_138782chr51176 21958 1894 12080 --
NM_144571chr465616 5418 1183 768 644 160 1705 --12062
NM_144600chr1671667 1428 1363 1334 1178 421 205 31556 629 181 ----
NM_144979chr41650 ------
NM_145808chr74797 483 434 211 1607 --12753
NM_145891chr1641082 352 229 64 ------
NM_147156chr1021470 1379 ------
NM_152261chr123868 641 127 ----11900
NM_152390chr21636 ----1570
NM_152409chr543329 2518 1067 901 ----13343
NM_152446chr143947 345 122 ------
NM_152493chr131317 370 353 ------
NM_152608chr152297 1977 1871 1818 407 --1743 --
NM_152622chr542811 2492 1327 774 ------
NM_152653chr33511 494 481 ------
NM_152745chr731085 983 909 ------
NM_152758chr8----12577 --
NM_152860chr1211221 --1516 --
NM_153020chr611408 ----11532
NM_153261chr1621283 1048 ----11312
NM_153267chr91216 181 1355 --
NM_153367chr1043195 2902 1171 1034 1670 1351 --
NM_153607chr53792 320 213 ------
NM_170665chr1273686 3456 3449 1066 507 400 102 13831 14566 --
NM_172070chr211935 --12127 --
NM_172071chr186556 5878 5692 5079 2169 2085 1809 1715 ------
NM_173355chr2------1397
NM_173468chr455745 4133 1793 476 281 --23732 56 --
NM_173469chr153595 422 245 ------
NM_173475chr1631411 477 465 ----11721
NM_173822chr241523 1504 1404 93 1437 1859 --
NM_175607chr321713 687 21295 112 ----
NM_175736chr1287455 7143 5248 4938 1784 1364 1095 195 --22877 1498 --
NM_176812chr20----1534 --
NM_177968chr242233 1626 1540 246 ------
NM_178496chr321563 1170 --11277 11268
NM_181672chrX2825 519 11979 --1382
NM_182485chr443769 3113 1405 802 --13664 12597
NM_182515chr191488 51647 573 405 238 157 25807 1977 --
NM_182537chr3----1300 --
NM_182765chr1022327 502 ------
NM_198066chr142874 447 1106 ----
NM_198270chrX53234 2896 2749 1174 1003 --1150 --
NM_198904chr511439 --12024 --
NM_203282chr1921474 320 2220 63 ----
NM_203458chr173654 3050 3010 2971 843 721 172 13106 ----
NM_207406chr486257 5465 5287 4382 4275 2559 2460 1180 --12114 14548