TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-802
miRNA Sequence: CAGUAACAAAGAUUCAUCCUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5----1194 --
NM_000052chrX63347 3340 3032 2325 853 63 --1619 --
NM_000084chrX105004 4950 4734 1950 1855 1653 568 542 527 213 --2677 415 26505 2250
NM_000092chr274321 4215 3919 3416 1242 830 136 --23821 3654 --
NM_000109chrX42691 2204 2015 1803 --1238 --
NM_000112chr573905 2177 2071 1971 1542 827 426 25423 4518 35578 5111 1470 14580
NM_000142chr411267 11604 11435 11259
NM_000163chr5----12058 --
NM_000176chr553193 2843 2784 2485 592 ------
NM_000210chr231960 693 340 --1868 11894
NM_000259chr15115883 5687 5679 5517 4541 4394 4336 4025 1975 197 74 12366 --25233 1825
NM_000297chr411727 --1380 12032
NM_000314chr1043264 2622 2160 2102 1608 13229 12266
NM_000315chr11----1240 --
NM_000321chr1311502 --1192 11762
NM_000330chrX----12234 --
NM_000332chr655388 4614 1234 896 95 --25380 1868 11860
NM_000345chr41941 1672 2981 320 --
NM_000362chr2233599 1121 519 --13554 13515
NM_000408chr243027 2231 1115 629 --33413 3261 2812 2469 401
NM_000430chr1743589 3248 2585 144 21470 409 23719 1230 --
NM_000489chrX63348 2796 2785 2754 1320 194 --22224 863 --
NM_000538chr131295 --21178 274 11427
NM_000575chr241111 1076 1002 421 --1181 --
NM_000601chr7----1381 --
NM_000610chr1152824 2728 2144 1044 630 --32918 2912 1897 --
NM_000627chr21956 --1268 --
NM_000633chr1835017 4958 4949 --13951 --
NM_000635chr19------11286
NM_000684chr10----21075 980 --
NM_000719chr1266382 5215 5176 5064 988 741 --26690 2261 --
NM_000721chr112196 1262 11866 --
NM_000814chr1583072 2910 2838 2824 1122 972 924 917 --23714 3188 13087
NM_000826chr432350 1615 80 --11639 1761
NM_000844chr3147 --1812 --
NM_000845chr7----1321 --
NM_000859chr521708 1320 --21514 1408 --
NM_000875chr1566818 5069 2249 1614 672 565 --26940 5050 --
NM_000891chr173598 424 30 23593 2709 22944 2664 --
NM_000899chr1243035 1076 1043 858 --23765 26 --
NM_000901chr412289 12156 --1451
NM_000937chr17----1392 --
NM_000944chr432174 2082 1841 --1372 --
NM_000959chr173984 3962 2572 2499 1458 521 368 --12853 --
NM_000963chr141842 812 430 127 1607 2189 90 12383
NM_001001132chr214965 943 510 283 1211 ----
NM_001001323chr1212932 --11204 --
NM_001001395chr1272846 1093 893 878 622 378 344 ------
NM_001001433chr2022968 820 1749 13165 --
NM_001001481chr863455 3409 1206 1017 997 681 --1847 --
NM_001001483chr111366 ------
NM_001001664chr243003 2850 2703 1239 --24089 100 24140 3396
NM_001001701chr42913 525 --1897 1149
NM_001001890chr2144286 3942 3794 1712 --23803 1473 --
NM_001001971chr101916 11403 11029 1564
NM_001001974chr1012352 --1779 --
NM_001002026chr322502 201 11888 42480 2432 1621 425 --
NM_001002838chrX----11637 --
NM_001002860chr1443979 3425 710 194 --44656 4370 3071 1287 --
NM_001003652chr1857978 7837 7661 5595 2548 15483 31261 461 444 26234 1436
NM_001003674chr1896542 5902 5525 2705 2588 1340 1087 891 778 --56996 4569 4345 1310 881 16637
NM_001003712chr1233870 3639 2823 --23476 2888 --
NM_001003760chr652979 2855 2702 2495 39 --23636 2633 --
NM_001004065chr943977 469 311 290 --13791 13922
NM_001004317chr643563 1677 1462 486 --14162 13481
NM_001005335chr191204 --177 --
NM_001005377chr191235 ----2257 222
NM_001005473chr566515 5208 4295 1470 607 486 --14411 --
NM_001005474chr31443 --1530 1628
NM_001005845chr821453 478 --31903 745 681 --
NM_001006600chr592278 1774 1762 1583 1529 991 972 829 564 ------
NM_001006945chr11702 --1301 --
NM_001007075chr421015 759 --21084 387 11065
NM_001007099chr11751 --1825 --
NM_001007559chr1821325 296 11367 --12051
NM_001007794chr1----1731 --
NM_001008239chr1853764 3125 2858 1362 667 31370 1217 1186 13587 --
NM_001008388chr4----1351 --
NM_001008392chr322646 1038 --2868 416 12813
NM_001008401chr19--11154 11418 --
NM_001008708chr2----2496 211 --
NM_001008738chr582848 2546 2333 1839 1100 548 478 381 --11126 --
NM_001009569chr101228 --31619 1574 221 --
NM_001009899chr385380 5299 4131 3948 2555 1773 1364 648 1376 25995 1117 --
NM_001009959chr251849 1789 1739 653 581 1945 --12475
NM_001010853chr683057 3043 2700 2628 2029 853 544 361 ----12166
NM_001010861chr132154 582 389 --32379 1788 477 --
NM_001010888chrX44649 1720 448 93 33346 3153 1779 ----
NM_001010891chr595885 5602 4975 2534 2390 1645 1396 1093 40 1811 36606 2703 309 --
NM_001010922chr133015 951 138 --33308 2592 793 --
NM_001010934chr7------1938
NM_001011666chr796470 6447 6048 5204 4992 4278 2541 1542 255 1139 14082 --
NM_001012393chr1125125 4605 --24677 110 --
NM_001012968chrX42645 1962 1062 644 12103 42741 2450 2160 921 --
NM_001012989chrX1128 --1689 --
NM_001013620chr1267844 7666 6974 1835 1714 616 11207 48413 7430 6531 2153 --
NM_001014434chr12816 684 --1310 --
NM_001014797chr1086597 6398 6332 2584 1878 1255 1230 976 ------
NM_001015877chrX53032 3012 2404 1934 672 12681 22890 2486 --
NM_001015887chr331216 1153 699 11264 2685 144 --
NM_001017371chr23471 389 33 --11313 --
NM_001017395chr312259 --12655 1847
NM_001018037chr921196 991 11245 ----
NM_001018067chr165053 3468 1991 1569 1559 594 --15065 --
NM_001024647chr1264793 4667 1560 1464 583 69 1531 15942 --
NM_001024649chr542258 2042 1987 957 12780 11800 12247
NM_001024680chr211298 --1217 --
NM_001024855chr3--11663 ----
NM_001024948chr143025 2947 2917 2723 23328 983 32863 2621 961 --
NM_001025076chr1044482 1259 780 766 --45468 3895 1283 1273 --
NM_001025077chr1085840 4948 2617 2138 2124 1352 904 127 --56826 5253 2641 2631 651 --
NM_001025079chr354076 3826 3574 1562 1082 --33056 744 249 13712
NM_001025108chr254199 3946 3835 2926 611 --22704 2655 --
NM_001025233chr12------21884 448
NM_001025252chr8----11259 --
NM_001025366chr611730 --1458 --
NM_001025580chrX43911 2660 1657 1310 ----14296
NM_001029858chr61544 --1319 2326 290
NM_001029863chr61146 4775 735 623 397 12762 --
NM_001030007chr1663553 2857 1424 1402 631 146 1878 11564 --
NM_001030055chr1464396 3908 3646 1610 1595 1356 11842 24743 402 --
NM_001031695chr2265262 4751 4488 4221 3856 1488 --35376 3888 2072 --
NM_001031709chr10----161 --
NM_001031801chr22------1190
NM_001031804chr1683790 3229 2952 1541 1188 742 692 545 ------
NM_001031812chr55879 705 680 470 32 --1534 11669
NM_001033059chr61585 --1490 --
NM_001033087chr2043259 1314 823 351 --23105 2318 --
NM_001033112chr52573 99 ----1164
NM_001034850chr531448 417 198 --1605 --
NM_001034915chr811227 --1545 --
NM_001035511chr142152 549 323 162 --21722 387 --
NM_001037132chr731984 1584 350 --3629 435 276 --
NM_001037174chr232051 1806 210 --2429 349 --
NM_001037334chr1841535 978 893 712 1853 2476 45 --
NM_001038493chr211343 --11064 21320 1305
NM_001039372chr7----1499 --
NM_001039465chr14----1521 --
NM_001039479chr14----22185 822 --
NM_001039538chr263595 3548 977 882 137 77 1526 23673 489 --
NM_001039570chr2213547 --24664 4614 --
NM_001039573chr171507 --1416 --
NM_001039577chr14882 771 590 380 --31179 1161 1143 --
NM_001039590chrX83639 3005 2779 2701 2589 1511 370 342 --13107 --
NM_001039618chr1155827 5381 4948 4268 750 --11563 11617
NM_001039840chrX55892 5436 2428 1889 29 --15391 14829
NM_001039937chr133676 434 369 --1502 13809
NM_001040101chr4199 --11182 --
NM_001040110chr7----11687 --
NM_001040202chr412275 ----12530
NM_001040284chr1695430 4841 4083 3813 3717 2107 1429 1330 1020 14503 24772 1860 --
NM_001040424chr2122253 776 1369 11820 --
NM_001040441chr195514 4324 4232 4055 3600 3527 1488 707 177 --44921 4841 4064 193 --
NM_001040445chr2105641 5449 4922 4777 4760 3946 3834 3555 2156 1131 1208 24819 107 --
NM_001040450chr1521869 205 1775 32291 1882 141 12299
NM_001040665chr744631 1309 1048 685 11005 1264 14057
NM_001040712chr963625 3594 2791 2336 881 667 --11440 --
NM_001042404chr121977 1951 --21970 1906 --
NM_001042413chr953709 637 552 188 124 13336 33454 281 45 --
NM_001042459chr3----1342 --
NM_001042533chr341202 1135 924 135 --2959 662 --
NM_001042537chrX62349 2230 1849 1789 1640 232 --1403 --
NM_001042550chr91738 11554 2107 99 --
NM_001042599chr237830 6575 5889 14880 47638 7504 7483 7269 --
NM_001042603chr1254819 3870 1248 523 470 --22038 95 --
NM_001042604chr354758 1707 1284 714 538 --23548 1521 --
NM_001042683chr61572 --11424 --
NM_001046chr553016 2997 2780 2757 149 12000 ----
NM_001071775chr1311757 --21654 1572 --
NM_001100108chr156710 5785 1824 1759 1525 --28200 5791 --
NM_001106chr358993 6827 3686 2441 443 --29351 7786 --
NM_001148chr442065 2031 1779 814 --11990 --
NM_001156chr10----1159 --
NM_001167chrX56555 6454 5544 1780 25 --22617 215 11705
NM_001198chr622334 160 --12397 --
NM_001204chr2137774 7484 6942 6554 6419 5555 5043 4711 2912 1644 1318 1030 247 12057 27122 6319 36049 6026 1885
NM_001206chr933063 2415 667 --12363 --
NM_001219chr712225 1547 --192
NM_001233chr712245 11652 1646 154
NM_001233chr712245 11652 1646 154
NM_001241chr252346 1674 1633 956 298 --41907 1788 450 200 --
NM_001259chr776166 5209 4919 4837 4141 1819 1334 15374 41399 960 941 478 13871
NM_001270chr521116 1008 --2842 124 --
NM_001304chr1753859 2984 2916 1411 890 ----13138
NM_001310chr1232975 2880 2190 --21946 694 --
NM_001316chr20----2441 140 2352 325
NM_001349chr2----1183 --
NM_001380chr10----11081 --
NM_001386chr852427 1651 694 187 122 --11853 --
NM_001407chr3----21114 257 --
NM_001429chr222793 209 1375 ----
NM_001430chr251826 1786 1723 417 409 11935 ----
NM_001448chrX21796 455 --21619 510 --
NM_001511chr4----1491 --
NM_001616chr253384 3341 3314 2969 2186 1610 31265 687 151 --
NM_001621chr71968 --32981 2546 2529 22935 796
NM_001627chr351821 1792 1693 1545 361 ------
NM_001635chr7------182
NM_001650chr1864114 3990 3725 3553 549 85 13515 24009 1289 --
NM_001659chr1252606 1844 1830 335 249 --12126 11029
NM_001660chr34687 671 135 57 186 1679 1166
NM_001695chr874232 3326 3279 3145 3076 629 415 ----33179 2851 321
NM_001729chr4------1152
NM_001742chr751581 1438 1259 738 156 --2470 171 11685
NM_001755chr1652144 2009 1693 1649 728 1644 21865 1586 11426
NM_001759chr1261287 1214 1082 948 363 245 --25043 850 1566
NM_001830chrX22751 598 11550 23469 460 2966 72
NM_001854chr11408 ----11177
NM_001875chr24327 201 125 51 --11053 11074
NM_001924chr14500 480 78 66 ------
NM_001931chr112135 104 11172 --2931 71
NM_001949chr653181 2494 2451 2330 652 --12779 --
NM_001962chr5----195 --
NM_001968chr41867 --1126 --
NM_002006chr434297 756 221 ----12258
NM_002009chr151404 --2966 951 --
NM_002015chr1332526 837 595 --2759 697 12611
NM_002017chr1111123 --1960 --
NM_002024chrX51892 1876 1541 1427 758 --1784 --
NM_002031chr62250 73 1733 ----
NM_002039chr41620 --1787 --
NM_002040chr2163149 2699 1014 841 743 551 --1418 12721
NM_002089chr4----1496 --
NM_002090chr41630 --2475 213 --
NM_002107chr1----169 --
NM_002136chr122511 201 ------
NM_002147chr171127 ----1193
NM_002165chr20------1396
NM_002187chr5----1288 --
NM_002196chr20----1774 --
NM_002199chr4------1910
NM_002211chr1021147 214 --1466 --
NM_002223chr1243963 2677 2534 1191 ------
NM_002232chr12530 439 1863 ----
NM_002264chr334519 3142 1541 --41951 1901 1725 811 --
NM_002267chr132818 568 --12352 --
NM_002270chr573515 3437 1978 988 973 171 89 14691 21603 845 12116
NM_002310chr576140 5594 5099 4934 4721 2346 1207 --26546 5635 160
NM_002355chr1211334 --21355 436 --
NM_002356chr622495 956 1527 11881 --
NM_002361chr19----1264 --
NM_002401chr1752497 2447 2415 1584 76 --32130 399 381 --
NM_002402chr7----11008 1790
NM_002430chr223560 415 243 --42518 2381 2255 393 --
NM_002480chr121411 --11213 --
NM_002486chr942431 2304 774 641 --21990 260 1579
NM_002515chr14----11825 198
NM_002524chr1--1929 41077 243 233 96 --
NM_002577chr374003 1331 1183 940 694 567 454 ----12892
NM_002581chr925101 4857 14416 33781 3724 1279 --
NM_002590chr13158 --1511 --
NM_002591chr201529 --1456 1538
NM_002595chr1211922 --31806 1431 1350 --
NM_002610chr213105 --22405 398 --
NM_002613chr1665092 4868 4402 4069 1203 978 --15131 --
NM_002618chr2----1103 --
NM_002623chr202485 300 ----1245
NM_002655chr865268 4657 4307 3953 1958 1203 --13371 14757
NM_002657chr20140 ----11075
NM_002667chr631232 508 156 --11284 --
NM_002721chr9----1426 --
NM_002726chr6----1416 --
NM_002731chr132459 400 350 --23064 387 --
NM_002734chr1752262 1844 1673 1600 139 --21514 231 1643
NM_002738chr1641138 988 869 429 --11006 1902
NM_002742chr141254 --1236 --
NM_002745chr2284352 3710 3515 3352 1456 1387 727 544 --21687 274 --
NM_002747chr1811889 ----11874
NM_002828chr181398 ------
NM_002852chr31491 --1405 1209
NM_002886chr345188 3352 853 658 --34225 3625 3338 --
NM_002948chr31911 --172 --
NM_002956chr1231437 521 347 --1101 --
NM_002971chr351192 1123 870 749 469 --1455 --
NM_003016chr1741653 1277 796 129 --11464 --
NM_003030chr321893 1875 11968 ----
NM_003071chr351863 1326 384 360 242 --1250 --
NM_003074chr312076 --12213 1415
NM_003092chr20----2323 38 --
NM_003099chr1584751 2161 2073 1889 1622 1600 161 149 12571 1339 --
NM_003105chr11----1103 --
NM_003108chr265457 5260 4908 4737 4573 1262 --1517 --
NM_003110chr1711044 --2952 688 --
NM_003112chr742697 2473 1132 373 --12894 --
NM_003128chr242447 1824 862 835 --1823 --
NM_003155chr832835 2742 450 ----12404
NM_003174chr101245 --1350 --
NM_003184chr81363 --1159 --
NM_003185chr2031262 1194 1051 ------
NM_003205chr1562052 1667 684 562 378 255 --11758 --
NM_003211chr1231778 1149 560 --21374 1131 --
NM_003221chr644147 3737 536 514 12935 --1815
NM_003244chr18----2299 131 --
NM_003336chrX4905 318 279 215 --1360 --
NM_003348chr12----21454 679 --
NM_003369chr1162707 2542 1127 777 313 166 12383 ----
NM_003392chr363078 1517 1276 1260 756 139 --22819 862 --
NM_003410chrX42864 2732 555 231 --13031 --
NM_003411chrY1220 ----11392
NM_003418chr31210 --1735 --
NM_003442chr111640 --1251 --
NM_003463chr663057 2538 2441 799 485 57 --1879 --
NM_003471chr321700 733 1476 2673 614 171
NM_003528chr11141 ----11778
NM_003557chr111662 ----11574
NM_003566chr123537 421 144 13369 43452 3036 2686 410 --
NM_003569chr6--1705 1125 --
NM_003574chr1865499 5427 4421 4239 4149 2288 --55239 4324 1540 365 334 24197 641
NM_003590chr243357 3070 3033 696 13296 1384 11347
NM_003615chr311027 --34007 3666 990 --
NM_003651chr12----1169 --
NM_003702chr81682 ----1689
NM_003713chr1----11519 --
NM_003718chr7----1497 --
NM_003758chr153659 128 35 1216 11156 1259
NM_003794chr331003 697 414 --11073 1845
NM_003850chr13----173 --
NM_003870chr152289 173 1456 22081 1956 1446
NM_003876chr17----1122 --
NM_003884chr3----11635 --
NM_003885chr171414 12357 12170 --
NM_003909chr842992 377 158 28 12934 11864 --
NM_003913chr644132 3349 1689 287 23508 2946 1574 --
NM_003930chr7--1478 22105 130 2531 227
NM_003941chr762523 2138 1620 1607 698 120 --41569 685 627 207 --
NM_003948chr431965 293 218 --1398 --
NM_003956chr10----1499 --
NM_004056chr811049 --11041 1325
NM_004075chr12270 26 ----1618
NM_004093chr1352798 2677 2424 916 513 ----22057 1257
NM_004124chr1413039 12471 196 22664 293
NM_004136chr1532394 1319 1054 1867 43267 1107 1060 881 1978
NM_004162chr32954 424 ----1982
NM_004171chr11167597 7551 6992 6957 6805 6764 6617 6509 6358 6281 3010 2264 1485 1106 639 435 --38146 1973 402 12988
NM_004227chr7----13016 --
NM_004293chr943648 3631 3505 3242 13219 33822 1324 812 --
NM_004316chr12------1991
NM_004349chr8----1296 --
NM_004354chr4----3702 295 133 --
NM_004379chr221425 1169 11263 21387 671 --
NM_004392chr1342593 2059 520 29 12505 32633 2230 778 --
NM_004397chr1154228 2961 1693 1578 1071 13943 13581 12784
NM_004405chr211026 ------
NM_004440chr6----11827 --
NM_004447chr1231028 998 323 --1965 --
NM_004457chr251408 1389 1293 1226 395 --1505 --
NM_004458chrX42691 1933 559 214 22167 145 11010 1234
NM_004504chr242165 1142 349 251 --1364 --
NM_004516chr1911193 11106 ----
NM_004535chr2011339 --21625 1358 --
NM_004598chr543029 2833 889 500 1382 1109 12113
NM_004612chr954768 4617 4409 3986 1239 11930 23978 1422 --
NM_004630chr111435 ------
NM_004637chr31961 ------
NM_004645chr171114 ----1756
NM_004709chrX41769 1587 476 42 ----11662
NM_004745chr844990 2587 2574 811 --36859 2389 343 --
NM_004768chr121043 152 --31005 408 139 --
NM_004781chr1192 --21404 580 --
NM_004788chr1152703 641 504 451 434 22499 2446 ----
NM_004797chr322872 2629 --13617 --
NM_004804chr242553 1899 1735 220 1640 12802 --
NM_004834chr263206 3151 3116 2661 2465 1313 22774 586 ----
NM_004842chr611103 --11308 31263 653 496
NM_004852chr181413036 11832 10649 10507 8941 8708 8635 5730 4786 4601 3660 3184 1056 529 15591 411937 9083 5188 1187 211946 9834
NM_004865chr6----1316 --
NM_004866chr554719 3452 3184 55 25 --14821 11222
NM_004869chr1811297 1430 --11618
NM_004874chr8----1497 133
NM_004906chr62599 267 ----1237
NM_004999chr634294 4151 100 13486 1680 --
NM_005027chr19----11213 --
NM_005032chrX1314 --21044 300 --
NM_005063chr1053788 3334 2965 1329 1317 ------
NM_005069chr2121791 247 ----11724
NM_005116chr2011312 --33520 917 869 --
NM_005121chr1763552 3229 3110 2600 1022 596 12424 --13046
NM_005126chr3--1573 11657 21712 646
NM_005128chr21----1691 --
NM_005156chr965203 3931 3306 1506 1330 941 2529 441 11563 --
NM_005160chr2256769 4591 4176 1493 1439 --25663 1584 --
NM_005180chr1041380 1188 1146 200 11119 11539 2551 382
NM_005188chr1132879 2870 2559 152 18259 1774
NM_005221chr7----1263 --
NM_005238chr1143271 3206 2723 879 --21227 84 --
NM_005256chr112874 657 --1781 --
NM_005302chr71357 ------
NM_005339chr483856 3739 3468 1669 1106 841 388 119 --43657 3198 1440 64 --
NM_005342chrX42569 2218 361 87 --22636 790 11785
NM_005359chr1896118 4222 4120 4009 2595 2115 1156 1086 259 24695 799 45397 709 438 419 --
NM_005388chr9----2376 260 --
NM_005400chr213030 --23013 1018 11942
NM_005406chr18------11452
NM_005415chr21666 --2618 137 --
NM_005436chr1063674 2728 2558 1228 579 409 --2809 593 --
NM_005476chr911088 --11401 --
NM_005502chr942963 2742 2392 722 1498 11049 12903
NM_005504chr1276624 6484 5517 5348 2535 133 67 15414 25229 2632 --
NM_005522chr7--1575 1930 --
NM_005561chr13----1820 --
NM_005578chr344639 4004 3978 165 --34853 3715 3395 --
NM_005596chr986167 5994 5262 5170 4390 4277 4190 359 11897 16349 --
NM_005611chr161842 11198 11071 --
NM_005618chr61239 --2592 422 --
NM_005639chr12------11386
NM_005665chr154648 4610 4312 1727 1107 11004 --13766
NM_005668chr574086 4024 3825 3764 3648 3406 693 24178 3900 33327 1399 1002 --
NM_005715chr612642 --12421 --
NM_005746chr732539 1758 994 1684 1546 --
NM_005748chr1233318 2216 2166 --1258 1523
NM_005754chr531179 941 101 --21217 1091 --
NM_005786chr182930 797 --2179 99 --
NM_005804chr19------1112
NM_005807chr1----1179 --
NM_005860chr19----156 --
NM_005880chr1621585 1141 ------
NM_005881chr16------1281
NM_005895chr1244016 3242 584 264 --31056 881 57 --
NM_005898chr1142262 386 312 64 178 12611 --
NM_005937chr17----14124 --
NM_005941chr874112 4061 3943 2981 971 145 73 --21216 347 13472
NM_005955chr174934 3594 1882 1290 1264 1222 297 --34658 1762 414 --
NM_005966chr251497 885 490 200 89 ----11733
NM_005967chr12----1725 --
NM_005977chr132777 71 ------
NM_006040chr1611418 ----21378 1017
NM_006047chr2053456 984 571 437 193 --22217 1092 --
NM_006094chr8--1656 21476 476 --
NM_006106chr1153413 3348 3213 843 471 --22988 2827 --
NM_006135chr1----2981 202 --
NM_006141chr16----22486 2209 --
NM_006158chr821514 1224 11474 1456 11558
NM_006159chr123527 493 454 ------
NM_006185chr11------1632
NM_006197chr831936 1738 429 21887 577 1475 --
NM_006251chr562450 2431 972 696 356 342 ----12628
NM_006252chr167388 5420 5194 4758 2627 2335 15945 46013 2353 1385 26 --
NM_006264chr41365 --1539 --
NM_006310chr171896 ----11209
NM_006313chr1221068 589 ----11350
NM_006315chr444393 1686 470 428 --12973 12954
NM_006330chr8----11559 --
NM_006348chr71673 --1925 1690
NM_006380chr1774315 3475 1352 1274 1063 982 749 13331 21654 1455 --
NM_006449chr24857 802 628 146 ------
NM_006469chr131452 597 225 ----1101
NM_006475chr13----1517 --
NM_006480chr5------1500
NM_006496chr121363 573 128 11869 1615
NM_006504chr1022481 120 --22876 2702 12798
NM_006526chr2031729 1509 869 ----12180
NM_006536chr13898 676 374 1689 1744 --
NM_006538chr233961 1632 627 --1922 1870
NM_006539chr16------1525
NM_006540chr81638 ----11574
NM_006544chr1465732 3721 1882 1483 1081 325 11442 41874 1677 429 301 --
NM_006558chr81354 --1197 --
NM_006574chr3----1273 --
NM_006577chr2----11129 --
NM_006599chr16106661 5940 5899 3279 3070 2920 2760 2162 1293 168 27877 336 12414 22421 272
NM_006609chr221040 664 12674 ----
NM_006620chr644054 3082 2994 2981 172 24089 1231 --
NM_006626chr9121 12383 22650 1951 11764
NM_006628chr1523064 2959 --54489 4428 989 351 59 23040 944
NM_006699chr122425 826 ----2862 277
NM_006726chr4--1127 1956 1894
NM_006751chr2--1423 --1880
NM_006763chr151555 1333 707 508 228 12072 22140 643 --
NM_006775chr683074 2811 2767 2645 2339 2184 1009 380 --11238 --
NM_006823chr8----2483 472 11163
NM_006826chr221281 968 --1895 1926
NM_006851chr1252335 2138 2116 527 119 --1835 --
NM_006868chr1822084 418 1562 23178 2489 12354
NM_006885chr1663495 2971 1687 868 418 245 --34065 2648 1606 --
NM_006902chr112502 --22271 226 --
NM_006916chr221400 116 --1433 --
NM_006920chr231310 790 212 --11772 --
NM_006981chr942714 2100 1933 372 12650 32495 1959 1075 --
NM_006988chr211277 ----21269 1083
NM_007005chr911139 --21161 512 1524
NM_007007chr1241734 1501 1198 458 --24123 196 1517
NM_007010chr171697 --31829 1798 62 --
NM_007011chr1556886 4368 2353 277 197 --11992 11497
NM_007038chr2135610 3917 222 14959 35965 5273 2050 --
NM_007039chr1422263 468 --3896 587 515 1503
NM_007107chr311915 ----1327
NM_007114chr321156 710 12563 11082 --
NM_007137chrX115338 4413 4340 3671 3543 3504 3495 2039 1095 367 304 15317 11352 13701
NM_007187chr13----1274 --
NM_007214chr6----11356 1260
NM_007249chr1359467 9023 8704 1223 475 29442 2266 49228 7417 1686 325 11699
NM_007359chr171627 --11697 11118
NM_012074chr14----1800 1458
NM_012081chr553704 3067 2715 132 68 --33556 2977 861 23430 310
NM_012082chr81293 --2282 239 1959
NM_012104chr11----13764 --
NM_012115chr6------1135
NM_012120chr642935 2758 2701 2406 --42360 878 697 74 12155
NM_012158chr134511 413 342 303 11880 --1728
NM_012164chr9117357 7212 5320 5195 5140 1847 1788 1356 961 664 435 ----1372
NM_012207chr1031079 252 182 --11091 11114
NM_012214chr2155643 5414 5247 4452 4002 2571 2256 2232 1869 1855 1793 744 440 324 293 --14762 1998
NM_012215chr1021324 534 ------
NM_012231chr1----11334 --
NM_012234chr352872 2593 885 511 342 --13664 13688
NM_012247chr102237 178 --11038 1717
NM_012249chr263543 3535 2977 2323 971 420 13359 23083 3066 --
NM_012281chr732128 734 197 11901 ----
NM_012287chr333069 816 601 --1933 --
NM_012290chr241504 1436 1225 251 ----1356
NM_012294chr742757 706 95 72 ----13650
NM_012297chr41457 --22395 347 --
NM_012309chr1133139 1902 38 --33665 3303 3297 --
NM_012311chr10----1213 --
NM_012316chr125663 555 --35574 4473 4265 --
NM_012325chr2041571 610 300 79 ----11174
NM_012330chr101420 --1226 --
NM_012334chr522952 1512 14414 43385 3223 997 728 --
NM_012342chr10----1192 --
NM_012416chr91774 --11249 2486 279
NM_012464chr421849 880 --32857 1930 920 --
NM_013231chr1443959 1066 251 100 13897 24238 803 --
NM_013233chr231327 920 420 --3990 412 261 --
NM_013246chr11----1903 --
NM_013281chr2021249 183 --11219 11464
NM_013305chr181900 --1825 --
NM_013309chr1521809 1626 --1570 1694
NM_013357chr83897 681 157 ----1108
NM_013372chr1512743 --23012 2644 --
NM_013374chr332875 495 197 2737 610 1506 --
NM_013450chr23936 272 195 --11239 --
NM_014011chr242087 1686 893 299 1435 1149 --
NM_014023chr1032512 953 527 --32839 2660 1829 --
NM_014028chr663246 3194 2542 771 458 218 --12686 --
NM_014034chr6----1208 --
NM_014035chr511187 --1996 11421
NM_014112chr865487 4962 4443 2039 1873 431 1868 34322 1962 142 15293
NM_014154chr31201 11311 21134 294 1515
NM_014181chr232899 787 532 --12419 22886 911
NM_014240chr353463 3294 231 211 50 11028 12776 14134
NM_014271chrX----1804 --
NM_014279chr9----1637 --
NM_014319chr1231705 1547 1244 --31952 469 32 --
NM_014323chr22------1724
NM_014342chr111200 --2920 589 --
NM_014372chr161947 1713 1535 608 411 347 --21618 254 --
NM_014388chr165913 5142 1950 1801 1075 622 ------
NM_014393chr832156 1583 121 --22273 2179 --
NM_014409chr111140 ------
NM_014415chr311283 ----11641
NM_014423chr575670 5290 2092 2054 987 907 357 24091 3811 24541 860 1871
NM_014445chr332290 780 717 1300 22363 1540 --
NM_014504chr731949 1863 198 11705 ----
NM_014505chr12----1368 --
NM_014552chr221026 320 --31504 959 551 11245
NM_014572chr13----31702 1135 338 --
NM_014585chr23969 804 427 11162 --130
NM_014637chr831477 1318 431 --1314 1982
NM_014667chr321995 526 --22040 610 --
NM_014682chr831974 1680 1616 ----11609
NM_014701chr1542781 2303 1023 145 --13052 --
NM_014702chr662975 2314 2123 1320 1039 264 ----11327
NM_014705chr752121 1545 577 166 148 --21975 1843 --
NM_014707chr732277 539 200 --31605 1546 303 --
NM_014720chr1041841 1185 330 314 --11716 --
NM_014755chr283749 3059 2970 1646 1447 1204 507 262 --11260 11309
NM_014767chr10----13689 --
NM_014783chr15----11160 --
NM_014798chr17----11833 --
NM_014803chr1062467 2253 2238 1813 687 508 ------
NM_014841chr62434 191 --1264 11158
NM_014860chr262371 1834 1628 939 804 294 --21039 681 --
NM_014877chr17107328 6501 6357 6307 5939 2378 2188 2034 699 254 16222 26576 449 17247
NM_014905chr222024 1425 --22040 121 --
NM_014912chr1063390 2948 2770 1172 885 559 --13165 13423
NM_014934chr1362892 2875 1114 813 761 491 ----21141 744
NM_014937chr1021265 525 --21291 456 --
NM_014945chr5----11985 --
NM_014947chr161969 1217 1114 948 428 114 12624 23107 626 --
NM_014950chr14--1571 11102 --
NM_014953chr1323702 2846 --43783 3308 717 98 --
NM_014959chr1973550 3191 2437 2250 1275 1081 1059 --23081 1306 23607 530
NM_014962chr202388 353 --32840 1834 534 12266
NM_014969chr1----1165 --
NM_014982chr1424004 1028 11096 35312 3289 1154 --
NM_014989chr631600 1526 1483 --3500 391 152 --
NM_014991chr462946 2940 2787 2244 2233 1232 --12118 13008
NM_015000chr121992 1599 12650 --
NM_015025chr262727 2638 2286 1829 1048 116 --1932 --
NM_015035chr2045956 2286 1402 732 --14927 16003
NM_015039chr121489 1266 11567 --24334 3785
NM_015040chr232716 2275 384 1826 33362 2597 452 --
NM_015051chr922414 879 --11316 --
NM_015054chr12170 ----1477
NM_015057chr13----1461 --
NM_015061chr91676 --1719 --
NM_015076chr674210 4073 3352 3289 3241 3175 1024 --42765 1188 905 522 --
NM_015092chr1664333 3999 3344 3134 3008 843 11289 23025 485 --
NM_015097chr34653 609 314 197 ------
NM_015132chr721653 1480 11556 1644 --
NM_015156chr1452640 1318 923 650 43 --12814 --
NM_015202chr16------11734
NM_015213chr11------1772
NM_015216chr531434 547 492 --1587 --
NM_015238chr5280 67 ----1168
NM_015245chr6--22078 902 32736 2534 2493 --
NM_015265chr272621 2134 2112 1904 1760 850 174 --12164 --
NM_015268chr31607 --1115 --
NM_015291chr143118 2870 2240 1054 --33507 2860 224 --
NM_015328chr772867 2508 2206 2161 252 192 136 --22144 538 --
NM_015336chr1242084 1941 602 392 1461 22605 378 --
NM_015339chr201146 ------
NM_015349chr632986 264 139 --2973 517 12671
NM_015423chr1121708 1319 --11334 11550
NM_015446chr111293 1415 --1494
NM_015461chr182583 202 --1704 1711
NM_015464chr721015 1007 ----1672
NM_015508chr311446 ----1288
NM_015553chr684220 4070 3451 3437 1164 1156 493 59 --25182 1019 --
NM_015565chr2112152 11580 32291 2103 1563 12140
NM_015570chr721480 581 ----11859
NM_015578chr1932053 2031 174 ------
NM_015608chr101137 ------
NM_015634chr101397 ----1481
NM_015702chr2----1264 --
NM_015714chr1------1332
NM_015886chr834236 4205 4086 --34824 3831 2147 --
NM_015888chr132591 939 856 13204 11059 --
NM_015906chr174833 4754 4719 3697 1462 1336 789 1410 191 13298
NM_015938chr3----1217 --
NM_015957chr11----1163 --
NM_016040chr142509 2044 867 61 --22731 2001 --
NM_016061chr22594 416 --11186 --
NM_016072chr1211777 1652 142 --
NM_016073chr151200 --1219 1887
NM_016083chr653176 2565 1119 936 670 --11390 13792
NM_016087chr721179 1162 11266 11203 --
NM_016131chr211819 --21971 1808 --
NM_016133chr21619 --11561 --
NM_016147chr11----11152 --
NM_016230chr61464 ----1442
NM_016231chr1731363 1339 255 ----1164
NM_016248chr1343690 2904 2472 150 13795 13049 --
NM_016269chr4------1993
NM_016271chr18--1423 1309 1631
NM_016279chr5------151
NM_016289chr232215 2185 2114 11430 22026 835 --
NM_016306chr3----1382 --
NM_016315chr211432 --11734 1452
NM_016376chr1764297 3912 3626 3525 1573 1380 ------
NM_016396chr1531030 1002 939 --22416 408 --
NM_016422chr1112441 --12935 32541 455 27
NM_016436chr2032120 2102 849 --22669 1092 1978
NM_016441chr241832 876 435 400 2649 237 1864 --
NM_016451chr11----1285 --
NM_016470chr20----1496 --
NM_016499chr11----1513 --
NM_016531chr463884 3366 3210 2796 2776 1456 12754 24083 2622 12689
NM_016617chr1332217 2178 1988 ----12108
NM_016652chr2041653 1147 289 135 --131 11373
NM_017409chr12----1742 --
NM_017420chr1453551 3436 3121 1509 1332 --12328 --
NM_017423chr432208 1378 185 1476 --192
NM_017508chr1122378 349 166 32173 196 190 --
NM_017596chr154622 4012 1805 1254 1221 --11236 --
NM_017637chr977721 7417 6945 2623 1699 1385 404 12797 29318 2939 22114 1124
NM_017643chr1722565 930 ------
NM_017650chr785793 5616 5311 5256 4565 4225 2419 2326 --11923 --
NM_017658chr1454617 4180 1288 1109 172 --23258 3249 --
NM_017666chrX1872 --22202 170 --
NM_017752chrX52131 415 316 228 96 --21450 652 21835 373
NM_017769chr1432240 1071 455 --12942 1493
NM_017813chr8145658 5339 5301 4755 4636 1790 1508 1319 1218 1053 1038 916 297 185 --24708 518 --
NM_017848chrX43900 3558 1309 603 --24347 3868 --
NM_017893chr10----11263 --
NM_017905chr131140 ----1420
NM_017918chr4------1106
NM_017952chr244034 3891 678 90 --34394 1405 127 --
NM_017988chr12--1619 1338 --
NM_018017chr1032587 1792 680 --12896 --
NM_018018chr12----2775 89 --
NM_018028chr1921317 874 --21285 457 11350
NM_018046chr53492 458 251 --1519 1595
NM_018084chr222807 1058 1924 21025 881 13092
NM_018086chr241856 1419 466 343 --21494 717 --
NM_018092chr161546 --21446 1338 --
NM_018157chr1222374 1022 --12036 12917
NM_018171chr12----1204 --
NM_018211chr131854 1493 1354 --22175 1589 --
NM_018214chr6----1510 11083
NM_018227chr443173 1996 580 22 12321 32497 2269 982 --
NM_018263chr24793 676 665 488 1659 22087 129 --
NM_018298chr1----4904 727 306 103 --
NM_018312chr111679 --1499 --
NM_018351chr1223135 895 --23844 189 13815
NM_018361chr833748 1573 1404 1573 1362 13694
NM_018362chr1163845 3523 3199 1278 902 277 --33007 1596 1522 --
NM_018364chr121639 497 --33616 1160 618 11024
NM_018374chr774649 4511 4372 3882 2040 1158 462 24313 3860 25213 941 --
NM_018388chrX3392 279 108 ----1557
NM_018403chr311095 14057 1963 --
NM_018424chr92654 611 --1305 11549
NM_018431chr20--1440 ----
NM_018482chr842494 1874 968 93 11630 31704 556 395 --
NM_018566chr194606 3980 3321 3230 1767 1746 1436 1109 701 --23729 1484 --
NM_018650chr11582 --1364 --
NM_018704chr11824 --2805 85 --
NM_018841chr163750 3648 3611 3109 608 246 --12528 --
NM_018847chr931929 1915 246 191 1115 --
NM_018898chr522118 1924 22312 2305 22382 2000 --
NM_018964chr211907 --1967 --
NM_018979chr1252605 2566 1786 188 115 11725 42309 2244 1691 888 --
NM_019004chr741604 1518 909 749 --12298 --
NM_019035chr41600 --1499 --
NM_019555chr321589 261 ------
NM_019556chrX--1420 21058 284 --
NM_020122chr244376 4325 1199 114 14474 21582 415 --
NM_020133chr635975 2457 1317 --34738 2136 1339 12087
NM_020144chr71200 ----1426
NM_020150chr1021945 739 --1748 --
NM_020189chr8----1161 --
NM_020211chr15----11584 --
NM_020228chr1121763 379 --32482 2334 1922 --
NM_020297chr1253502 3241 2940 2915 410 --11101 --
NM_020342chr242646 2278 2128 38 1588 11635 --
NM_020390chr3114591 4526 4479 4322 4232 1830 1448 1399 517 499 447 ------
NM_020403chr1331779 1280 619 --21757 655 11156
NM_020426chr17----2210 97 --
NM_020649chr17----1221 --
NM_020718chr1675995 5341 2645 2584 1677 1103 958 --26462 4025 --
NM_020752chr1042905 2436 845 806 --1634 1726
NM_020753chr17----1606 --
NM_020755chr621509 389 --1153 --
NM_020774chr1876036 5994 4983 4675 4005 1826 1089 15011 36209 5616 3821 --
NM_020782chr1254390 3183 1914 1052 878 --1196 --
NM_020791chr1721315 1130 1491 1943 1537
NM_020830chr242858 2344 856 536 12061 1564 12899
NM_020859chr443968 1101 773 102 13487 33909 3346 476 --
NM_020871chrX82333 2221 2130 1942 1828 902 780 413 ------
NM_020872chr3136 --11566 --
NM_020873chr31700 ----1247
NM_020917chr1962767 905 578 551 343 33 1788 --1984
NM_020940chr1022644 335 --22913 2222 12628
NM_021012chr17----13153 --
NM_021038chr363286 3189 3006 2284 736 197 12170 32622 974 712 12103
NM_021097chr231080 956 949 --41236 1222 390 349 12856
NM_021106chr9----1773 --
NM_021136chr14--1627 --2756 246
NM_021141chr21390 --1224 --
NM_021183chrX42251 1733 438 137 --12280 11947
NM_021204chr41717 --1372 --
NM_021215chr20----11590 12063
NM_021220chr20----1408 --
NM_021252chr1051887 1691 1553 640 170 --11852 --
NM_021255chr1443399 416 181 40 13223 43321 1224 1174 710 13986
NM_021639chr11182 --2589 167 --
NM_021727chr11----1262 --
NM_021728chr14----1639 --
NM_021818chr14--1986 11022 1143
NM_021914chr1431996 896 607 --22244 196 1641
NM_021961chr1166547 6163 4939 4522 2715 1544 --26121 4605 --
NM_021964chr3105423 2547 2308 1717 1682 1500 1487 1290 1182 64 25166 1857 36185 6159 4937 --
NM_022045chr82236 118 ----1221
NM_022121chr61166 --1363 --
NM_022124chr101662 --1216 --
NM_022133chr851712 1188 692 246 155 1683 --1385
NM_022143chr7--11465 11428 --
NM_022162chr161784 ----11113
NM_022351chr843636 3435 697 328 --23283 1136 23875 3442
NM_022552chr21369 --1216 --
NM_022725chr11----11848 --
NM_022735chr111529 --31776 1252 1239 --
NM_022757chr31969 ----198
NM_022763chr342957 847 540 343 1836 ----
NM_022781chr942415 1299 623 190 13247 2571 290 --
NM_022825chrX----1306 --
NM_022840chr18185 --31428 1343 206 --
NM_022841chr1542395 2363 2352 270 1465 12255 --
NM_022893chr262628 2058 2046 772 412 381 --32882 2319 428 --
NM_022903chr3----1223 --
NM_024095chr12----11393 --
NM_024103chr19----11869 --
NM_024295chr851903 1867 1684 1494 1319 --2714 468 --
NM_024312chr1221155 460 1445 1516 --
NM_024345chr9105486 5162 5060 4895 4407 2087 1146 1071 804 523 --14276 --
NM_024420chr11134 --1376 --
NM_024511chr421067 966 --22758 1363 11100
NM_024524chr343017 2782 2683 2136 --42154 867 582 270 --
NM_024548chr3----11395 1107
NM_024612chr1721015 70 --3836 415 112 --
NM_024615chr51249 ----196
NM_024630chr6----1818 --
NM_024761chr964704 4384 2046 1284 1100 972 1717 34316 2027 1669 --
NM_024779chr12----1259 --
NM_024896chr962538 2433 1954 942 710 68 --12552 --
NM_024899chr181703 --186 --
NM_024921chrX11543 11826 178 11602
NM_024948chr101772 ----1752
NM_024949chr444970 4567 4539 249 14631 34989 4824 1550 --
NM_024953chr1222568 2018 --32709 2044 1034 --
NM_024993chr231346 1033 134 1540 21235 524 --
NM_025040chr19----1965 --
NM_025054chr833942 2706 699 --34238 656 128 --
NM_025074chr423073 201 12770 22964 2495 --
NM_025134chr1631625 586 117 12350 12370 --
NM_025138chr1321444 513 1420 --11112
NM_025146chr352736 2316 2010 619 529 --12049 1712
NM_025160chr143740 3026 2789 641 12855 34111 3001 339 13237
NM_025179chr114952 21353 931 14871 11853
NM_025182chr9----1333 --
NM_025222chr333042 2982 1017 --22031 456 --
NM_030579chr1633549 3318 2412 11318 22405 1331 --
NM_030627chr543847 3745 1136 1053 --22816 915 14080
NM_030791chr143578 200 44 ----1444
NM_030806chr199422 3416 2635 2248 2175 1780 982 242 205 1518 32966 1371 223 16804
NM_030809chr121416 12281 1107 --
NM_030816chr143258 1047 788 617 ----1726
NM_030820chr611024 --21036 914 --
NM_030895chr811131 --21186 1151 --
NM_030917chr4----161 --
NM_030935chr7------1401
NM_030965chr12648 228 ----1829
NM_031296chr442746 2452 1084 760 ----1591
NM_031445chr243248 2157 1349 92 --22191 1234 --
NM_031453chr1042598 2037 526 419 --22402 1685 --
NM_031889chr4----11960 --
NM_031911chr412562 --1354 --
NM_032047chr331693 744 667 12085 22285 857 2544 306
NM_032102chr1153066 1011 897 634 243 --1195 --
NM_032124chr18--1965 --1774
NM_032132chr1------1425
NM_032139chr192846 760 --2919 908 --
NM_032144chr241512 1399 737 142 ------
NM_032153chr312355 ----12347
NM_032168chr2----182 --
NM_032199chr1033706 2895 783 --22809 2624 13906
NM_032208chr273652 3577 3422 2936 2869 2508 2319 --12712 1672
NM_032221chr2041431 1363 743 233 --164 11374
NM_032373chr1041744 1445 1275 366 --2865 859 35927 5508 4221
NM_032424chr1121145 77 21453 396 21575 606 --
NM_032436chr13----1948 1138
NM_032437chr1----156 --
NM_032439chr10----31438 496 487 --
NM_032440chr1042153 1909 556 165 ----11847
NM_032458chrX53362 3342 2734 2264 1002 13011 23220 2816 1127
NM_032638chr321488 157 ------
NM_032777chr8----11359 --
NM_032793chr1------1365
NM_032810chr1031186 157 141 1613 --11004
NM_032830chr16179 ------
NM_032833chr12815 762 ------
NM_032842chr751648 1358 684 150 114 ------
NM_032859chr1331093 304 78 22464 2456 13831 1285
NM_032873chr1133693 1445 904 --44302 3654 2845 562 --
NM_032947chr531094 496 75 --1122 --
NM_032968chrX42946 2734 2621 1007 --32684 1376 1095 --
NM_032973chrY42941 2729 2620 1007 --32679 1376 1095 --
NM_033030chr22370 143 --2558 343 --
NM_033049chr311226 ----21239 1182
NM_033081chr20----21464 1127 --
NM_033083chr343144 3130 307 94 11219 23275 3266 --
NM_033119chr16----1121 2106 88
NM_033132chr13------12354
NM_033143chr423493 220 --13557 --
NM_033211chr52625 323 1665 2588 339 --
NM_033224chr767020 6070 1014 891 826 441 1763 12419 13153
NM_033285chr834239 3788 1544 --13447 1795
NM_033394chr221071 616 --11256 --
NM_033495chrX1994 --1147 --
NM_033512chr863104 2884 2382 765 259 196 --22941 2201 12357
NM_033656chr2165474 4078 1364 1342 648 346 --35621 1479 153 --
NM_052879chr1234001 2600 744 --33234 1404 878 --
NM_052885chr1284890 4695 3581 3286 3215 947 489 28 --23520 1055 --
NM_052904chr61158 --11411 --
NM_052905chr2----31869 1461 263 --
NM_052911chr182244 58 --1860 --
NM_052932chr1132495 2171 851 --12126 11813
NM_052937chr841683 842 485 464 ----12616
NM_052978chr1411483 11558 11879 11472
NM_053056chr1122618 2204 --22641 2458 1609
NM_058237chr1421031 247 --1762 --
NM_080743chr622161 111 145 1831 --
NM_080764chr2253271 2285 752 495 329 --23197 619 --
NM_080867chr14--1847 41530 937 899 533 --
NM_080872chr853583 2931 2764 2652 967 ----14094
NM_080874chr42624 323 --2408 225 11893
NM_080927chr331124 191 176 13039 12583 13277
NM_133259chr21166 --4759 544 316 58 --
NM_133473chr1911205 --11891 11399
NM_133646chr255465 5107 1747 1319 891 --25377 2096 13899
NM_138316chr10----1497 --
NM_138333chr921980 274 --32533 420 142 --
NM_138448chr21407 --1304 2415 399
NM_138459chr642530 2433 1109 717 --62976 2596 1233 697 626 516 --
NM_138689chr11------1190
NM_138771chr71178 --1479 --
NM_138782chr511584 --12300 --
NM_139207chr1242088 777 604 424 ----1533
NM_139244chr6------1631
NM_144563chr21606 ----3777 750 172
NM_144570chr16----12371 --
NM_144571chr476928 5441 5265 4481 2581 2452 877 --15724 137
NM_144578chr1435248 4543 1970 --55490 4936 4792 1436 1325 12118
NM_144599chr1555019 4371 1267 1067 348 --25459 941 --
NM_144633chr31537 --21005 375 --
NM_144642chr341433 477 382 237 --11286 --
NM_144643chr41145 --2406 109 --
NM_144963chr831704 379 289 12742 22178 22 --
NM_144979chr42667 201 --1566 --
NM_144982chr121115 ------
NM_145005chr92699 332 --3187 149 134 --
NM_145176chr653313 3096 2652 802 253 1838 13447 --
NM_145260chr21781 ------
NM_145274chr172299 64 ----1188
NM_145290chr4----1324 --
NM_145647chr8----1140 --
NM_145805chr152567 514 --2573 118 --
NM_147128chr721409 1213 ----11194
NM_147189chr832073 2027 1553 --31682 897 105 --
NM_147190chr12----1202 --
NM_152265chr121582 1343 --1406 195
NM_152292chr442319 2288 670 483 ----1723
NM_152412chr821431 168 --11496 --
NM_152414chr8--21158 352 21329 1259 1605
NM_152424chrX24545 3414 13359 --14389
NM_152444chr14----1123 --
NM_152519chr221519 672 --11539 11547
NM_152556chr731993 1649 489 --22156 229 --
NM_152622chr532134 1391 930 23411 3209 32540 741 592 --
NM_152624chr5127016 6005 5190 4723 2968 2553 2080 1070 917 355 312 234 12937 22072 1362 --
NM_152641chr1232734 2672 1113 --22634 61 --
NM_152707chr1021048 340 ----1750
NM_152727chr16----1283 --
NM_152737chr631531 387 307 1767 --12134
NM_152745chr73400 89 62 --2981 933 --
NM_152756chr563930 3231 666 610 369 132 --33135 2689 998 33509 678 622
NM_152772chr12------1366
NM_152787chrX53702 3495 3400 769 315 --13457 13032
NM_152835chr112749 --12573 --
NM_152990chr611116 --21204 1168 --
NM_153020chr611641 1139 ----
NM_153262chr122587 2086 --22208 642 --
NM_153332chr842570 2482 2255 609 140 --1891
NM_153367chr1023754 2900 --1177 13330
NM_153371chr1332087 942 260 ----12270
NM_153456chr1356150 5271 4257 565 415 26228 1065 32211 2204 801 13929
NM_153689chr242339 2073 1906 60 1189 21719 319 --
NM_170600chr9----1397 --
NM_172069chr232317 1643 902 --12037 12290
NM_172071chr1117211 6359 6088 5895 5644 4828 4709 4550 2230 1849 1152 35105 1390 536 57344 5035 2581 1080 576 --
NM_173074chr2----190 --
NM_173164chr16------196
NM_173468chr432274 251 68 21329 1222 15899 --
NM_173475chr1631211 197 188 --11681 --
NM_173496chr1022043 1966 1689 32203 1004 825 --
NM_173510chr221693 --22928 655 1500
NM_173511chr253900 3101 1437 1192 444 --33940 3849 2956 --
NM_173531chr1953346 3219 2808 967 641 --11104 11445
NM_173552chr352424 758 690 496 98 11678 11626 --
NM_173556chr11----1115 --
NM_173576chr1041973 1829 568 144 --1212 --
NM_173582chr11116310 5982 5597 4228 4141 3914 2503 1973 560 464 392 22403 235 24118 3813 15492
NM_173591chr123915 301 244 --2858 789 --
NM_173825chr332265 2203 723 --22787 499 12253
NM_173827chr422694 488 --43025 2975 2676 81 --
NM_173829chr575807 5623 5604 5155 5108 4188 1709 --46096 5868 1252 203 1293
NM_173851chr843193 2873 2496 785 --33964 3594 2446 --
NM_174890chr10----1237 --
NM_174909chr5----2252 150 --
NM_174921chr41423 --1182 --
NM_175736chr1245778 5290 1511 1157 --45117 4936 1170 99 --
NM_175839chr20----1258 --
NM_175856chr51103 --284 64 1232
NM_175861chr1265605 5532 5476 5275 1846 1807 --45872 5653 1215 809 11659
NM_175907chr1842754 2002 1786 1739 --1274 1565
NM_175921chr554178 3581 1198 418 245 --24296 4262 22710 1385
NM_177424chr131405 593 388 ----21326 609
NM_177938chr3----1156 --
NM_177968chr242231 1691 586 278 --31760 885 517 --
NM_178011chr103947 716 455 129 2482 445 --
NM_178033chr1----1539 --
NM_178313chr22685 339 ----1391
NM_178470chrX61531 1507 1346 1102 691 312 ------
NM_178566chr91324 ----1258
NM_178815chr1022747 2050 --31024 758 610 --
NM_180989chr133992 571 227 --31904 1767 125 --
NM_181358chr143945 3048 1390 684 1877 31322 614 402 23781 650
NM_181504chr564167 3268 3180 1425 1381 937 --3890 837 459 --
NM_181714chr641632 1584 1352 690 --11360 11995
NM_181723chr821738 201 --62113 2046 1439 1422 677 493 1191
NM_182485chr473767 3624 3134 2843 1436 616 257 ----1460
NM_182700chr711472 ------
NM_182756chr23546 243 102 1615 1121 --
NM_182765chr1052134 2093 1966 768 536 ------
NM_182920chr3----31415 1194 383 --
NM_183376chr1532338 1814 955 --12326 --
NM_194071chr775447 5319 4667 4059 3998 3962 453 11925 24575 1589 11664
NM_194247chr274079 4025 1378 1258 1073 156 72 --31638 1524 1343 11133
NM_194285chr1152426 1114 1107 714 456 --12276 --
NM_194291chr832677 2503 472 --32308 324 274 12643
NM_194314chr1114530 4158 4055 4020 4009 3933 3734 1798 1315 745 686 --25639 5152 --
NM_198273chr552858 2731 2322 1952 854 --22943 2375 --
NM_198581chr277504 5502 4875 2093 1577 737 727 12043 17093 17037
NM_198715chr135679 5580 1730 14350 15312 --
NM_198859chr344727 868 596 398 14123 ----
NM_199000chr7--2664 597 22338 1784 --
NM_203364chr1121045 1007 --11126 2181 96
NM_203394chr12----1479 --
NM_203403chr91191 --3920 378 149 21214 1043
NM_203406chr552827 882 723 566 500 --1674 --
NM_203459chr152421 736 725 574 246 11860 1360 --
NM_203463chr274830 3932 3509 3280 1717 927 596 --33394 1810 1326 11158
NM_206853chr644060 1125 1115 406 --13709 1152
NM_207303chr1054156 2845 1498 959 800 13916 ----
NM_207325chr1961914 1750 687 572 496 147 21486 1376 --22068 764
NM_207361chr1345651 5217 1382 930 16164 --2444 360
NM_207371chr10192 1267 1509 --
NM_207406chr456410 5204 5190 4019 2237 --25266 4034 16462
NM_207506chr8--11230 ----
NM_213589chr265482 5470 4710 4095 3641 234 23421 1299 1105 25291 988
NM_213726chr17------1258