TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-873-3p
miRNA Sequence: GGAGACUGAUGAGUUCCCGGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521332 909 --1942 --
NM_000052chrX82857 2526 2170 1029 880 866 799 26 12992 --1820
NM_000074chrX2332 46 --3904 669 652 --
NM_000081chr141360 602 318 68 ------
NM_000084chrX86623 6450 5694 5107 4674 4319 2681 1993 1878 14222 25199 1595
NM_000088chr1721283 1225 ------
NM_000089chr7------2692 180
NM_000092chr223026 1315 12774 11297 --
NM_000097chr33486 269 106 ------
NM_000104chr22399 68 2863 442 ----
NM_000109chrX22587 225 12241 ----
NM_000110chr11920 --1318 --
NM_000125chr62770 295 --24014 3146 --
NM_000138chr1552574 2077 1711 1011 986 11804 ----
NM_000163chr542335 1721 1530 644 12133 --12262
NM_000165chr621580 584 --21483 1352 --
NM_000168chr72680 211 12410 --12029
NM_000176chr523377 70 33129 2438 1543 --13118
NM_000202chrX53251 2610 1265 217 182 13114 ----
NM_000210chr252336 1634 896 890 321 21798 762 11803 --
NM_000214chr201154 --1253 1337
NM_000217chr1244319 4050 3458 289 1737 12119 --
NM_000220chr113985 347 34 1313 --1794
NM_000232chr423202 2307 33189 2783 2503 23100 1152 --
NM_000248chr341979 734 707 524 ----11127
NM_000259chr15105993 4631 4564 2253 2183 1437 729 689 464 439 ----25665 5081
NM_000264chr932754 2669 2355 22551 333 11172 --
NM_000284chrX51974 1885 1402 598 156 --11541 --
NM_000297chr452008 1822 768 288 108 21314 350 ----
NM_000302chr11708 ------
NM_000310chr141346 1162 368 257 --168 --
NM_000314chr1043073 2566 1222 296 13294 ----
NM_000321chr1311817 11479 ----
NM_000325chr42557 545 ------
NM_000328chrX4372 149 93 81 ------
NM_000330chrX2608 450 1507 1398 1323
NM_000332chr676404 6125 5986 5489 1573 1162 425 25219 1306 16614 --
NM_000346chr1751736 1324 1276 785 679 ------
NM_000362chr2243540 3434 2778 2266 ------
NM_000379chr221404 24 ------
NM_000390chrX33109 2701 2297 31082 964 51 ----
NM_000391chr1131649 601 192 ------
NM_000393chr21229 ----11901
NM_000408chr231264 1124 200 2727 642 22705 1096 --
NM_000430chr1722999 976 ------
NM_000441chr741962 788 773 380 ------
NM_000448chr1143062 1047 841 42 13228 --1870
NM_000450chr121377 86 11506 ----
NM_000458chr17----2742 192 1905
NM_000461chr323503 522 --1986 13497
NM_000462chr1531298 1284 537 ------
NM_000480chr1121628 607 --21491 1388 --
NM_000486chr12--12695 --11059
NM_000489chrX22237 628 13399 11125 13285
NM_000495chrX31001 366 194 ------
NM_000500chr6----137 --
NM_000503chr831555 1484 1466 --2134 69 --
NM_000509chr41146 ------
NM_000536chr111540 ------
NM_000555chrX65939 5553 5538 4932 2500 1173 22188 2176 65865 5574 5031 1395 922 338 --
NM_000574chr1155 --1423 --
NM_000599chr284409 4100 3065 2852 2833 1835 1318 1167 --11344 --
NM_000610chr1122293 795 12079 1721 --
NM_000615chr1131870 914 460 --12614 1408
NM_000618chr1276190 5783 5318 2324 1984 742 481 15509 24435 1276 --
NM_000618chr1276190 5783 5318 2324 1984 742 481 15509 24435 1276 --
NM_000663chr1612712 12812 12158 --
NM_000668chr431361 425 407 --133 --
NM_000681chr1011099 --11135 --
NM_000700chr9182 ------
NM_000719chr1236512 5703 1162 --21990 747 26486 1595
NM_000724chr1051520 629 564 76 43 1652 1490 --
NM_000726chr221374 1366 --11069 --
NM_000739chr72169 105 ------
NM_000756chr81450 ------
NM_000780chr81211 1373 1169 --
NM_000800chr53235 186 40 ------
NM_000801chr20--11087 2981 293 2829 288
NM_000806chr561769 1690 1626 1563 163 114 ------
NM_000809chr489157 8134 7408 6789 6128 3705 3399 3322 19133 18112 --
NM_000812chr42312 140 --1302 --
NM_000813chr545326 5113 4497 3631 ----15575
NM_000814chr1544115 3080 2796 533 ------
NM_000826chr43894 457 413 ------
NM_000827chr52885 470 --11918 --
NM_000831chr1116268 6071 5619 4407 4302 2472 1461 1200 1154 724 313 14713 ----
NM_000833chr1621244 266 ----1536
NM_000840chr71408 ------
NM_000844chr31386 ------
NM_000859chr51199 21730 159 ----
NM_000866chr321529 1504 ------
NM_000868chrX32312 1662 548 --11714 --
NM_000875chr1567022 4595 4324 2389 2367 400 1757 1293 12482
NM_000880chr82697 73 ------
NM_000899chr1273784 3060 2958 1495 1193 770 419 23104 271 --13322
NM_000901chr451602 561 334 196 36 --31001 694 119 --
NM_000917chr102910 314 169 ----
NM_000919chr53517 178 107 ------
NM_000927chr72510 135 ------
NM_000933chr2021700 1299 ------
NM_000944chr452150 2022 805 617 146 ----1546
NM_000945chr231398 1382 467 ------
NM_000950chrX33236 3063 2269 11306 ----
NM_000961chr2053764 3428 2810 864 320 13239 ----
NM_000965chr321285 319 --11132 --
NM_000966chr122951 144 ------
NM_001001132chr2141029 936 529 164 --1926 --
NM_001001323chr1252986 2446 2284 1256 1050 ------
NM_001001331chr332301 2287 721 21679 500 ----
NM_001001389chr1122293 795 12079 1721 --
NM_001001390chr1122293 795 12079 1721 --
NM_001001391chr1122293 795 12079 1721 --
NM_001001392chr1122339 841 12125 1767 --
NM_001001396chr144086 3536 1167 281 --31562 1521 997 23411 2859
NM_001001419chr564240 4064 1784 1682 1088 869 --1428 --
NM_001001420chr564240 4064 1784 1682 1088 869 --1428 --
NM_001001481chr812891 13358 171 --
NM_001001521chr2141 ------
NM_001001549chr742137 2111 696 61 --11812 --
NM_001001550chr742137 2111 696 61 --11812 --
NM_001001555chr742137 2111 696 61 --11812 --
NM_001001664chr223896 1106 23929 349 ----
NM_001001790chr92454 385 --152 --
NM_001001890chr2114315 11096 14266 --
NM_001001928chr22108334 7746 6293 5538 2826 2301 1468 1403 1387 124 26511 1017 ----
NM_001001937chr18136 ------
NM_001001974chr1032137 1726 308 --21537 45 11511
NM_001001994chrX------1362
NM_001001996chrX------1362
NM_001002243chr2----2365 22 --
NM_001002258chr231300 776 653 1576 12022 --
NM_001002295chr1031124 437 245 1781 ----
NM_001002838chrX61874 1604 1501 609 186 73 1482 ----
NM_001002906chrY3543 159 123 ------
NM_001002909chr1731560 1536 174 --11486 --
NM_001002919chr21163 ------
NM_001002926chr762735 2196 727 533 524 24 --12345 12848
NM_001003396chr6128 ------
NM_001003397chr6128 ------
NM_001003407chr1064417 3968 3792 3544 3279 1773 ------
NM_001003408chr1064417 3968 3792 3544 3279 1773 ------
NM_001003652chr18148689 8518 8045 6632 6286 5971 3163 2703 2191 1790 1488 1351 1244 922 23134 127 18170 --
NM_001003674chr1886839 5617 5251 4834 2450 1936 1854 131 --12173 190
NM_001003675chr1886839 5617 5251 4834 2450 1936 1854 131 --12173 190
NM_001003679chr141737 605 212 54 ------
NM_001003681chr2252030 1780 1652 1617 423 ------
NM_001003688chr431064 958 435 ------
NM_001003698chr631899 1411 677 1711 21763 1234 --
NM_001003699chr631899 1411 677 1711 21763 1234 --
NM_001003712chr1253844 3090 1287 1213 317 ------
NM_001003760chr642772 2512 1367 694 22579 2372 ----
NM_001003792chr321130 78 --1957 --
NM_001003793chr321130 78 --1957 --
NM_001003800chr921043 431 1497 11218 --
NM_001003810chr42632 278 ------
NM_001004106chr5165 ------
NM_001004317chr633533 3360 2829 13670 23286 1630 12919
NM_001004342chr165330 5091 5053 3813 1903 526 --34675 1817 880 26081 4943
NM_001004441chr541285 609 362 183 ------
NM_001004720chr221061 113 ------
NM_001004722chr221230 282 ------
NM_001005266chr151751 ------
NM_001005267chr151751 ------
NM_001005268chr151751 ------
NM_001005269chr151751 ------
NM_001005271chr1711020 --11086 --
NM_001005273chr1711020 --11086 --
NM_001005366chr121148 ------
NM_001005375chrY21200 455 2623 111 21508 1174 --
NM_001005404chr1763775 3629 3318 3299 1131 888 22922 1609 31715 1151 732 --
NM_001005417chr1--1157 ----
NM_001005463chr1022283 296 ------
NM_001005473chr5106561 5670 5063 4304 4221 4056 1664 1406 274 99 44050 4016 1395 1353 1562 --
NM_001005505chr31441 ------
NM_001005527chr331179 887 284 ------
NM_001005739chr21764 ------
NM_001005746chr221374 1366 --11069 --
NM_001005747chr221374 1366 --11069 --
NM_001005910chr31593 --2647 496 --
NM_001005911chr31593 --2647 496 --
NM_001006115chr341083 840 826 551 1910 11744 1465
NM_001006600chr531991 958 761 12460 ----
NM_001006610chr161987 ----147
NM_001006618chr91197 ------
NM_001006626chr72169 105 ------
NM_001006627chr72169 105 ------
NM_001006628chr72169 105 ------
NM_001006629chr72169 105 ------
NM_001006630chr72169 105 ------
NM_001006631chr72169 105 ------
NM_001006632chr72169 105 ------
NM_001007024chr1723339 643 --43265 474 457 175 --
NM_001007025chr1723339 643 --43265 474 457 175 --
NM_001007097chr954249 4199 3421 1284 452 14875 33511 1930 1790 13775
NM_001007099chr11702 1265 ----
NM_001007100chr11702 1265 ----
NM_001007214chr12731 277 ------
NM_001007226chr172448 262 --11289 --
NM_001007227chr172448 262 --11289 --
NM_001007228chr172448 262 --11289 --
NM_001007229chr172448 262 --11289 --
NM_001007230chr172448 262 --11289 --
NM_001007246chr2121970 1907 ------
NM_001007278chr1395054 4907 4749 3334 2075 1555 1415 389 23 --11145 --
NM_001007468chr221298 --1221 --
NM_001007471chr9166 ------
NM_001007527chr5----2675 55 --
NM_001007553chr121196 133 ------
NM_001007559chr1851833 1643 1537 702 666 1537 --1810
NM_001007794chr12694 511 ------
NM_001008225chr71729 ------
NM_001008239chr1883340 2982 2812 2660 1448 928 556 344 --12350 --
NM_001008392chr342733 2698 694 470 ------
NM_001008408chr765847 5167 2425 645 437 98 22003 1190 16437 --
NM_001008495chr82434 392 11445 ----
NM_001008529chr1711256 --1441 1870
NM_001008530chr142332 88 1481 1186 --
NM_001008540chr22443 95 --1484 --
NM_001008541chr1022045 504 --191 --
NM_001008541chr1022045 504 --191 --
NM_001008566chr22--1459 ----
NM_001008660chr112516 195 ------
NM_001008738chr512294 21829 305 ----
NM_001008744chr1451376 1353 1303 1029 194 196 ----
NM_001008895chr1331220 907 195 ------
NM_001008925chr473221 3113 2565 900 566 426 345 12434 --196
NM_001008938chr112456 376 ------
NM_001009185chr52525 507 --1696 --
NM_001009552chr82228 220 ------
NM_001009555chr421727 659 11288 ----
NM_001009880chr2274589 4018 3584 3316 1362 1140 510 13172 ----
NM_001009894chr1231339 1219 574 ----21568 139
NM_001009899chr355861 4977 4585 1164 118 ------
NM_001009955chr12606 545 1173 ----
NM_001009955chr12606 545 1173 ----
NM_001009958chr71636 ------
NM_001009959chr222235 171 --11605 --
NM_001009993chr244564 3685 3568 166 1436 22877 787 --
NM_001010000chr1843336 3262 3247 3040 --1498 --
NM_001010853chr643217 2989 2650 723 --11301 --
NM_001010854chr141212 ------
NM_001010861chr132550 2440 303 --12737 --
NM_001010867chr176280 6053 2572 2297 2007 1906 1591 25167 2196 26271 5739 --
NM_001010888chrX64499 4148 4078 3781 1676 1260 24441 628 11296 --
NM_001010891chr5115945 5923 5106 4797 4420 2603 2004 1627 1469 1410 727 12524 12562 --
NM_001010895chr9142 1667 ----
NM_001010917chr1012188 --1791 --
NM_001010942chr121157 ------
NM_001010971chr1--158 1356 --
NM_001010984chr141752 1660 185 86 21774 1685 1223 --
NM_001010986chrX22427 1585 ------
NM_001011513chr433032 1595 503 1971 11556 --
NM_001011537chr362179 1775 1670 840 724 708 1626 --11557
NM_001011538chr4--1658 ----
NM_001011553chr72261 95 --1871 --
NM_001011666chr744303 2016 604 239 45189 2045 1556 1358 ----
NM_001011708chr232824 2698 576 ----12637
NM_001011713chr142442 372 ------
NM_001011724chr132303 209 ------
NM_001011725chr132303 209 ------
NM_001012267chr911485 ----1513
NM_001012321chr3----165 --
NM_001012393chr1133580 1982 1490 1348 23524 1702 14332
NM_001012420chr1542634 2290 2076 176 --12312 11928
NM_001012423chr1542634 2290 2076 176 --12312 11928
NM_001012478chr191536 ----1597
NM_001012614chr41268 ------
NM_001012751chr103576 567 169 --11650 --
NM_001012755chrX124832 4696 4490 4344 2037 1397 1374 1207 1164 1072 770 700 --33361 1438 211 1223
NM_001012968chrX32134 1718 431 1154 1507 --
NM_001012980chrX1220 ------
NM_001013031chr1043321 975 957 857 ----11048
NM_001013406chr741363 1290 546 403 ------
NM_001013415chr431462 1288 1247 ----11209
NM_001013438chr31912 --1248 --
NM_001013439chr31758 --194 --
NM_001013620chr1297349 7058 6805 6100 5257 3040 2849 2740 813 27692 5967 26508 993 --
NM_001013642chr141157 1071 1059 904 ------
NM_001013674chr12708 313 ------
NM_001013699chr121459 ------
NM_001013843chr151627 ------
NM_001014286chr13166 ------
NM_001014342chr131724 558 65 --1124 --
NM_001014797chr1097393 5345 2917 2833 2478 2255 2010 1540 1496 57272 7181 6034 1642 1066 27152 1458 --
NM_001015508chr82559 206 ------
NM_001015877chrX53074 2932 2726 2605 899 1874 1220 --
NM_001015881chrX5998 807 332 192 62 ------
NM_001017368chr1741116 674 480 441 22845 899 12212 1328
NM_001017369chr43947 861 221 ------
NM_001017371chr251242 1047 1020 457 285 ------
NM_001017395chr362665 2291 1351 1039 994 979 ------
NM_001017523chr12----1531 --
NM_001017922chr161729 1569 1555 1366 1123 240 ------
NM_001017923chr1411408 1114 ----
NM_001017926chr831231 1172 354 ------
NM_001017962chr102910 314 169 ----
NM_001017969chr9123 ------
NM_001017995chr554043 3608 1749 369 157 13753 ----
NM_001017999chr122165 733 11869 ----
NM_001017999chr122165 733 11869 ----
NM_001018000chr122165 733 11869 ----
NM_001018000chr122165 733 11869 ----
NM_001018001chr122165 733 11869 ----
NM_001018038chr92541 451 152 ----
NM_001018054chr111064 ------
NM_001018057chr114351 235 191 117 ------
NM_001018064chr92519 401 ------
NM_001018067chr175251 4218 3991 1472 752 341 200 ------
NM_001018068chr175251 4218 3991 1472 752 341 200 ------
NM_001018069chr175251 4218 3991 1472 752 341 200 ------
NM_001018072chr12----1531 --
NM_001018074chr523377 70 33129 2438 1543 --13118
NM_001018075chr523377 70 33129 2438 1543 --13118
NM_001018076chr523377 70 33129 2438 1543 --13118
NM_001018077chr523377 70 33129 2438 1543 --13118
NM_001018090chr1531090 446 143 ------
NM_001018091chr153556 253 51 ------
NM_001018102chr1531090 446 143 ------
NM_001018108chr152884 603 ------
NM_001018111chr753872 2819 2638 1615 753 --11444 --
NM_001020658chr11607 11229 ----
NM_001020658chr11607 11229 ----
NM_001023567chr151176 ----11949
NM_001024094chr523377 70 33129 2438 1543 --13118
NM_001024226chr111138 --1204 --
NM_001024227chr111138 --1204 --
NM_001024228chr111138 --1204 --
NM_001024455chrX42593 1651 381 277 1109 ----
NM_001024460chr61259 1378 ----
NM_001024649chr542705 2509 407 144 --22456 319 --
NM_001024660chr31450 ------
NM_001024847chr322125 1555 32422 1928 1540 ----
NM_001024948chr123360 2482 21012 601 1457 --
NM_001025072chr352434 2207 1888 291 148 12397 --12596
NM_001025073chr352434 2207 1888 291 148 12397 --12596
NM_001025076chr10116182 5460 5072 4755 4655 4241 3909 1821 1720 501 472 2825 112 45234 5213 2209 1873 --
NM_001025077chr10117540 6818 6430 6113 6013 5599 5267 1859 1830 977 174 35046 2183 1470 26592 6571 --
NM_001025079chr353434 3304 998 340 237 ------
NM_001025108chr2104123 3934 3692 3167 1518 1329 1307 945 240 36 22940 2917 12602 --
NM_001025356chr1232717 1149 844 2571 109 1576 1147
NM_001025366chr621814 657 ------
NM_001025366chr621814 657 ------
NM_001025367chr621814 657 ------
NM_001025367chr621814 657 ------
NM_001025368chr621814 657 ------
NM_001025368chr621814 657 ------
NM_001025369chr621830 673 ------
NM_001025369chr621830 673 ------
NM_001025370chr621814 657 ------
NM_001025370chr621814 657 ------
NM_001025389chr1121628 607 --21491 1388 --
NM_001025390chr1121628 607 --21491 1388 --
NM_001025580chrX53902 3202 1384 427 113 --13539 --
NM_001025595chr41195 ------
NM_001025616chr42639 290 ------
NM_001025777chr231274 391 44 11517 ----
NM_001029835chr71326 ------
NM_001029858chr632776 503 100 22337 1219 22821 1062 --
NM_001029863chr643203 818 140 57 22058 682 ----
NM_001029875chr542416 2003 549 414 12270 ----
NM_001029882chr11276 ------
NM_001029882chr11276 ------
NM_001029884chr662606 2526 2037 1856 1760 518 ------
NM_001030006chr1731031 581 129 ------
NM_001030007chr1652743 2446 1304 1290 805 13922 --1976
NM_001030055chr1464721 4375 4124 3976 3606 1775 13665 13690 --
NM_001031679chr1282845 2823 2572 2492 1375 552 295 108 ------
NM_001031695chr2264870 4521 4245 1597 495 485 --35188 4501 1256 --
NM_001031711chr521432 619 --21748 307 --
NM_001031716chr23958 866 179 ------
NM_001031723chr41417 ------
NM_001031732chr443439 1379 1229 1074 12865 33637 3066 550 --
NM_001031803chr171230 ------
NM_001031804chr1674415 4121 3447 3244 1717 1354 855 13580 ----
NM_001031812chr512176 --21755 1427 --
NM_001032296chr1342823 2138 2047 185 --2836 158 12068
NM_001032393chrX1201 ------
NM_001033057chr32654 78 ------
NM_001033081chr141728 1650 1306 106 ------
NM_001033082chr141728 1650 1306 106 ------
NM_001033087chr2053099 2728 2332 671 198 1970 ----
NM_001033112chr52783 130 ------
NM_001033117chr364298 3652 3390 3320 3127 700 11843 14050 --
NM_001033506chr11------1442
NM_001033576chr1792738 2678 2560 2251 2131 2005 596 463 158 32115 731 116 ----
NM_001033602chr1352685 808 767 449 309 --148 --
NM_001033756chr621748 591 ------
NM_001033756chr621748 591 ------
NM_001034025chr12--1805 152 --
NM_001034841chr1695308 4614 4209 3778 3515 1909 1462 1343 1145 14044 --11182
NM_001034850chr53670 365 344 --11651 --
NM_001034954chr1032962 884 475 --22667 2116 --
NM_001034955chr1032962 884 475 --22667 2116 --
NM_001034956chr1032962 884 475 --22667 2116 --
NM_001034957chr1032962 884 475 --22667 2116 --
NM_001035chr121059 309 ------
NM_001035260chr1041322 1155 1111 209 11535 ----
NM_001037132chr72538 512 --12253 11455
NM_001037133chr72538 512 --12253 11455
NM_001037164chr741896 1474 521 195 1687 ----
NM_001037172chr32994 916 --1507 11165
NM_001037317chr132550 2440 303 --12737 --
NM_001037334chr1842251 1874 1515 783 ----1685
NM_001037339chr131249 537 309 ----11662
NM_001037340chr131249 537 309 ----11662
NM_001037341chr131249 537 309 ----11662
NM_001037341chr131249 537 309 ----11662
NM_001037535chrX41551 610 487 161 ------
NM_001037536chrX41551 610 487 161 ------
NM_001037540chrX41551 610 487 161 ------
NM_001037637chr51265 ------
NM_001037954chr1143469 1253 1014 96 --22416 2355 --
NM_001038493chr211564 --1560 --
NM_001039111chr3------1107
NM_001039199chr2065034 4900 1653 1577 1252 238 --190 --
NM_001039538chr243210 2348 1452 1029 22881 2687 12712 1736
NM_001039590chrX73717 3630 3572 3565 3420 2849 805 21204 472 12939 --
NM_001039591chrX73717 3630 3572 3565 3420 2849 805 21204 472 12939 --
NM_001039618chr1174916 4076 3963 2357 825 616 360 15637 24303 213 --
NM_001039690chr1651870 1667 1463 488 446 --22132 328 --
NM_001039693chr273986 3891 3715 3655 3200 1620 1469 1549 ----
NM_001039711chr11300 --11143 --
NM_001039712chr11300 --11143 --
NM_001039762chr1032087 2009 22 ------
NM_001039802chr11473 --11279 --
NM_001039840chrX55336 5256 2306 1599 80 ----1930
NM_001039937chr1333676 3120 1476 11110 ----
NM_001040059chr171594 ------
NM_001040092chr81434 ----128
NM_001040101chr411079 11219 ----
NM_001040108chr1452042 528 415 352 297 --2473 150 13045
NM_001040110chr751384 495 453 88 34 11562 ----
NM_001040142chr221897 1650 --11921 --
NM_001040143chr221897 1650 --11921 --
NM_001040144chr1651870 1667 1463 488 446 --22132 328 --
NM_001040146chr1651870 1667 1463 488 446 --22132 328 --
NM_001040152chr744308 4234 3794 802 --1333 --
NM_001040157chr452729 2395 2133 710 101 41815 1077 900 632 ----
NM_001040158chr53148 110 48 ------
NM_001040179chr631003 734 225 --1373 --
NM_001040260chr421022 280 ------
NM_001040261chr421022 280 ------
NM_001040284chr1695463 5383 5321 5149 4747 4732 4308 2330 1631 11010 35843 5390 942 --
NM_001040402chr43398 200 43 --12807 --
NM_001040429chr1321264 1246 12513 ----
NM_001040440chr51474 1147 ----
NM_001040446chr551798 916 841 400 297 ------
NM_001040450chr153745 409 370 21783 199 ----
NM_001040453chr153745 409 370 21783 199 ----
NM_001040455chr1121034 442 --11045 --
NM_001040665chr774424 3700 3604 1957 1863 1448 1423 --13563 1697
NM_001040712chr942783 780 183 57 --1750 --
NM_001040715chr16172 --2996 369 --
NM_001041chr3--155 ----
NM_001042355chr1654871 4009 3964 3643 545 25083 980 14780 --
NM_001042368chr9------1119
NM_001042370chr11226 ------
NM_001042403chr122877 400 ------
NM_001042404chr131868 1340 371 ------
NM_001042412chr1654871 4009 3964 3643 545 25083 980 14780 --
NM_001042413chr952847 2708 2569 1566 1253 1495 11592 --
NM_001042424chr41972 --21136 840 --
NM_001042453chrX41540 1341 1255 501 1219 ----
NM_001042481chr1422081 862 --11917 --
NM_001042494chr1573628 3156 2730 2531 2388 812 234 13290 11330 --
NM_001042495chr1573628 3156 2730 2531 2388 812 234 13290 11330 --
NM_001042496chr1573628 3156 2730 2531 2388 812 234 13290 11330 --
NM_001042497chr1573628 3156 2730 2531 2388 812 234 13290 11330 --
NM_001042510chr822212 1455 11529 ----
NM_001042511chr822212 1455 11529 ----
NM_001042533chr333359 1143 92 --12805 --
NM_001042537chrX32430 2125 1732 ------
NM_001042555chr1241449 1380 1019 850 --11927 1720
NM_001042576chr202180 142 ------
NM_001042599chr2106954 6266 5158 4983 4821 3094 2546 2112 1686 466 35993 5199 3029 2548 532 --
NM_001042603chr1295120 5068 3752 1862 1781 1732 1484 750 556 32060 1475 1271 24523 1805 14940
NM_001042604chr384133 3873 3738 3484 1499 987 597 204 33910 2953 1340 ----
NM_001042632chr2052500 2305 2048 1640 191 --22414 1710 1624
NM_001042633chr2052500 2305 2048 1640 191 --22414 1710 1624
NM_001042669chr42639 290 ------
NM_001042728chr122951 144 ------
NM_001042749chrX42024 1468 214 157 ----1680
NM_001042750chrX42024 1468 214 157 ----1680
NM_001042751chrX42024 1468 214 157 ----1680
NM_001042762chr71245 --141 --
NM_001043318chr1443834 3354 2917 1505 12632 21012 789 --
NM_001044305chr61278 ------
NM_001044385chr223803 2803 13215 12606 --
NM_001044722chr512176 --21755 1427 --
NM_001044723chr512176 --21755 1427 --
NM_001046chr531206 1171 425 11080 ----
NM_001048183chr153578 3289 3052 482 350 32962 2806 168 13769 --
NM_001077628chr11171 ------
NM_001079874chr131887 1618 227 21725 148 ----
NM_001083620chr43893 456 412 ------
NM_001084chr73302 293 86 ----1273
NM_001095chr1231837 517 145 ------
NM_001099678chr365697 5267 2125 2110 1846 245 31657 1274 221 45425 4674 2244 1166 --
NM_001100108chr1117921 7884 7076 6740 5291 5192 3266 2997 2907 791 712 26556 5098 --1157
NM_001106chr369051 8863 8806 2264 476 196 18979 32060 1701 851 --
NM_001113490chrX31389 939 174 1499 43228 2875 2490 578 1947
NM_001117chr1852393 2303 2050 1971 557 12153 12021 --
NM_001122679chr521332 909 --1942 --
NM_001128chr1652743 2446 1304 1290 805 13922 --1976
NM_001146chr862028 1824 1613 1572 703 185 ----11717
NM_001148chr41702 ------
NM_001149chr101290 ------
NM_001152chrX----193 --
NM_001167chrX96488 5819 5693 4628 4471 2302 1879 1435 682 11378 16049 15535
NM_001173chr1464721 4375 4124 3976 3606 1775 13665 13690 --
NM_001174chrX31832 222 50 ------
NM_001177chr1232217 1554 840 ------
NM_001186chr2142782 2555 2177 2019 13194 22750 725 11204
NM_001204chr2127182 7039 6222 6160 5297 5177 4737 3108 2449 1360 340 222 25337 287 36916 2028 351 --
NM_001206chr943030 2919 1186 521 12260 ----
NM_001207chr51265 ------
NM_001212chr17--130 ----
NM_001248chr31316 --1349 --
NM_001251chr171594 ------
NM_001254chr171839 --21009 59 11091
NM_001256chr1772944 2779 2751 2710 1995 360 78 --22187 2079 --
NM_001257chr163579 158 36 ------
NM_001259chr776181 5409 5172 4975 4623 731 574 36013 4030 2177 15912 11243
NM_001260chr132296 219 ------
NM_001275chr141269 ------
NM_001278chr101176 --1297 --
NM_001280chr191686 ------
NM_001282chr1731031 581 129 ------
NM_001293chr113462 406 91 ------
NM_001304chr1753599 2627 2476 1078 160 --23686 1140 --
NM_001310chr1221057 976 ------
NM_001316chr20--1470 ----
NM_001326chr111316 1462 ----
NM_001328chr41268 ------
NM_001329chr1011160 1648 ----
NM_001331chr114909 591 410 295 ----11139
NM_001332chr521132 633 ----11316
NM_001343chr51266 ------
NM_001351chr331482 1169 524 --11143 --
NM_001356chrX2657 579 --12492 --
NM_001357chr11219 ------
NM_001364chr1134457 3271 1821 --14225 --
NM_001389chr211236 ------
NM_001391chr18174 2953 264 --1275
NM_001396chr2162613 2462 2440 2365 1766 743 ------
NM_001400chr1--1395 ----
NM_001401chr921167 1050 ------
NM_001402chr651931 1758 1724 784 195 11403 --157
NM_001406chr1731528 587 58 --21513 1134 --
NM_001408chr121617 1313 --1410 --
NM_001417chr1241211 498 300 32 ------
NM_001418chr114589 547 277 184 ------
NM_001418chr114589 547 277 184 ------
NM_001419chr1964390 2986 1962 1531 771 207 1688 14718 --
NM_001430chr231859 1596 1447 ------
NM_001432chr463367 3268 2883 2618 1407 571 21295 586 ----
NM_001438chr172998 2868 1208 1170 850 554 181 13009 --13340
NM_001448chrX51518 1153 1115 167 113 ------
NM_001452chr61689 ------
NM_001453chr631646 1234 324 --11668 --
NM_001494chr101291 ------
NM_001498chr62879 300 11064 ----
NM_001514chr12470 464 ------
NM_001526chr61159 ------
NM_001530chr142216 60 ------
NM_001546chr61932 11146 ----
NM_001552chr171121 ------
NM_001553chr4279 22 ------
NM_001614chr17----1477 --
NM_001614chr17----1477 --
NM_001616chr222364 77 --13135 13294
NM_001620chr111584 ------
NM_001635chr72745 674 --1873 --
NM_001642chr1121328 1092 ------
NM_001650chr1841395 854 308 133 22792 583 11373 --
NM_001655chr1162014 1871 1550 1506 1355 458 1380 ----
NM_001658chr111138 --1204 --
NM_001663chr141135 --1413 11966
NM_001664chr311058 --1983 --
NM_001668chr141653 1574 1539 1518 ------
NM_001681chr121714 ------
NM_001682chr1252700 2160 1998 970 764 ------
NM_001683chr332301 2287 721 21679 500 ----
NM_001684chr133803 3253 884 --31279 1238 714 23128 2576
NM_001688chr13236 75 60 ------
NM_001689chr231300 776 653 1576 12022 --
NM_001690chr332291 2027 834 22447 2314 11650 --
NM_001695chr8103089 1703 1486 1307 1066 913 794 767 277 192 13067 ----
NM_001699chr1951549 1297 1173 359 328 1439 ----
NM_001704chr61526 ------
NM_001706chr32801 324 ------
NM_001707chr7----2781 291 --
NM_001726chr11138 ------
NM_001730chr1311091 ------
NM_001730chr1311091 ------
NM_001731chr121771 --1272 --
NM_001735chr9129 ------
NM_001742chr731523 199 185 ----11367
NM_001746chr542705 2509 407 144 --22456 319 --
NM_001753chr72195 145 --11516 --
NM_001754chr2114315 11096 14266 --
NM_001759chr12104958 4801 4006 3338 1673 1643 1074 937 840 48 --12071 --
NM_001761chr1631448 1262 141 --21759 1487 --
NM_001777chr353434 3304 998 340 237 ------
NM_001788chr72261 95 --1871 --
NM_001791chr11473 --11279 --
NM_001800chr191121 --1488 --
NM_001801chr51213 ----1488
NM_001806chr1962914 2674 2467 926 873 803 ------
NM_001854chr111541 --11065 11392
NM_001855chr9198 ------
NM_001858chr633470 3355 748 24398 393 34153 1248 802 --
NM_001859chr963298 3117 3086 2759 1074 597 --1171 --
NM_001861chr161120 ------
NM_001865chr6----1136 136
NM_001880chr2125 --174 --
NM_001881chr101401 ------
NM_001884chr52524 25 ----1478
NM_001885chr11142 ------
NM_001901chr631011 957 171 ------
NM_001904chr35995 869 692 426 37 ------
NM_001938chr141681 1503 1204 719 1144 ----
NM_001942chr1841962 1912 745 239 11460 ----
NM_001945chr521364 1180 11015 1909 --
NM_001946chr123755 749 462 --151 --
NM_001949chr643079 2674 756 564 12293 ----
NM_001964chr5--1761 ----
NM_001968chr41204 1146 ----
NM_001981chr111526 32215 842 339 1738 --
NM_001987chr1264179 3863 1221 1213 711 348 11514 13306 21269 1151
NM_002006chr463710 3616 3594 1261 403 101 22291 2072 2800 617 --
NM_002010chr13------1482
NM_002015chr1343374 2966 1319 1175 ------
NM_002017chr112935 219 --2338 233 --
NM_002024chrX52021 1499 448 410 344 12212 --11768
NM_002025chrX128866 8652 8532 7792 7608 7516 7174 6432 3314 2690 1044 809 12314 12260 22551 1922
NM_002031chr62609 95 ------
NM_002033chr1183843 3227 3171 3126 2547 1148 1128 919 23208 1106 13163 11558
NM_002040chr2152712 880 360 112 31 --11024 --
NM_002051chr1031124 437 245 1781 ----
NM_002069chr741500 1471 421 76 ------
NM_002076chr1272624 2295 2047 1132 219 107 82 11237 ----
NM_002077chr921632 72 ----11847
NM_002082chr5128 ------
NM_002092chr454629 4553 3784 193 88 43314 778 702 154 23813 877 24245 4059
NM_002107chr11174 ------
NM_002114chr62435 384 ------
NM_002126chr17103981 3800 2575 1616 1077 642 562 436 311 43 13707 ----
NM_002128chr1332029 1884 518 1971 ----
NM_002130chr531194 1087 170 11321 ----
NM_002136chr121209 ------
NM_002137chr731952 1809 1740 1346 1257 22336 828
NM_002138chr42632 278 ------
NM_002147chr171781 --1302 --
NM_002154chr51109 ------
NM_002158chr242650 1258 1240 567 ----11375
NM_002184chr5--1144 ----
NM_002193chr221905 1599 ------
NM_002203chr533899 2790 150 24088 3770 ----
NM_002210chr243363 2348 843 460 --11203 --
NM_002211chr102400 350 11001 ----
NM_002222chr331355 1190 124 1509 ----
NM_002224chr61235 ------
NM_002226chr142234 91 ------
NM_002232chr111260 --1888 --
NM_002242chr222030 385 21866 392 ----
NM_002247chr1012205 --1525 --
NM_002253chr411308 2968 275 1152 --
NM_002264chr334789 4227 1849 13664 ----
NM_002267chr1362370 2256 2058 2052 1919 296 --1290 --
NM_002268chr321655 1525 11186 ----
NM_002270chr5115272 4927 4909 4100 3894 2203 1749 993 981 861 298 --148 --
NM_002271chr1341825 625 416 171 ------
NM_002285chr2104123 3934 3692 3167 1518 1329 1307 945 240 36 22940 2917 12602 --
NM_002293chr141088 979 890 642 12347 --1385
NM_002295chr3----165 --
NM_002296chr121546 1485 11235 --1282
NM_002310chr586436 6280 5945 5425 4182 2391 1060 168 24207 2614 ----
NM_002313chr1064417 3968 3792 3544 3279 1773 ------
NM_002336chr1233349 1245 670 24267 4078 ----
NM_002351chrX21729 324 158 ----
NM_002355chr122538 125 ----177
NM_002356chr622080 568 1644 ----
NM_002360chr741926 1887 1013 759 ------
NM_002374chr243210 2348 1452 1029 22881 2687 12712 1736
NM_002375chr312300 ------
NM_002384chr181950 --1153 --
NM_002395chr621369 122 ------
NM_002398chr221461 1289 11439 ----
NM_002408chr14----128 --
NM_002419chr11--1480 199 --
NM_002442chr1221767 1124 ------
NM_002469chr121506 ------
NM_002480chr1231045 1016 526 --1438 --
NM_002486chr942347 962 703 254 ------
NM_002487chr151303 ------
NM_002499chr152506 45 ----1779
NM_002515chr14--1434 --11394
NM_002519chr1141055 970 534 385 ------
NM_002522chr1723153 1583 11560 ----
NM_002526chr611686 ------
NM_002544chr171230 ----1118
NM_002545chr1133580 1982 1490 1348 23524 1702 14332
NM_002577chr373710 3552 3157 2725 2702 658 403 32680 2513 534 ----
NM_002581chr9115504 4869 4694 4237 3990 3466 1024 925 588 180 127 --14290 --
NM_002588chr5--21218 86 1667 --
NM_002600chr131249 537 309 ----11662
NM_002612chr751790 1763 1682 741 277 ----1340
NM_002613chr1665396 5123 1906 1102 752 338 ------
NM_002628chr331172 855 382 ------
NM_002635chr12--1146 ----
NM_002641chrX21856 348 ----11506
NM_002655chr834156 3266 832 --1502 --
NM_002657chr2041393 1079 920 27 --1840 --
NM_002670chr351322 1003 478 415 52 ------
NM_002709chr233571 2949 646 ------
NM_002710chr1231037 847 276 ------
NM_002713chr13871 773 452 ------
NM_002715chr521002 523 11300 21078 242 --
NM_002719chr1442118 1746 865 577 ------
NM_002720chr161212 ------
NM_002731chr112608 12697 --12353
NM_002734chr1722225 579 ----11870
NM_002736chr71552 11465 ----
NM_002740chr342828 2355 1827 237 --12522 1857
NM_002748chr15--1964 11164 --
NM_002822chr12--11645 1539 --
NM_002828chr182952 706 --1990 --
NM_002834chr1253917 1324 1014 996 383 ----12915
NM_002835chr73782 595 477 ------
NM_002837chr1253394 3072 911 890 195 --13567 21702 1668
NM_002839chr942783 780 183 57 --1750 --
NM_002844chr611332 ------
NM_002847chr71137 ------
NM_002851chr72633 74 ------
NM_002852chr31236 ------
NM_002858chr11417 --11177 1426
NM_002868chr1262340 2070 1674 963 803 562 --2872 742 --
NM_002873chr52355 106 ------
NM_002886chr385062 4208 4173 3419 3310 3238 2076 1753 24186 330 34788 4157 1137 --
NM_002890chr5163 ------
NM_002892chr1451383 1340 1186 604 30 ------
NM_002897chr21104 ------
NM_002902chr151238 1104 ----
NM_002906chr1122083 114 --1529 --
NM_002911chr1921705 663 ------
NM_002918chr1931128 1093 898 ------
NM_002924chr1--1441 ----
NM_002938chr441980 1406 281 166 ------
NM_002941chr31503 ------
NM_002942chr331174 903 514 ------
NM_002948chr3191 ----1815
NM_002955chr631899 1411 677 1711 21763 1234 --
NM_002956chr1231148 1136 163 ------
NM_002959chr153297 1757 1717 1508 1195 14283 21430 952 --
NM_002968chr161362 ------
NM_002970chrX1316 ------
NM_002973chr12--1425 ----
NM_002979chr11702 1265 ----
NM_002996chr1622007 1874 ------
NM_002998chr822250 855 11618 ----
NM_003011chr961658 1542 1177 631 204 130 --172 --
NM_003016chr1711743 --2368 295 --
NM_003017chr611040 1553 1424 --
NM_003020chr151304 ------
NM_003022chrX3988 959 42 11140 ----
NM_003026chr931046 839 370 ------
NM_003028chr953837 2511 1532 726 243 12413 1983 13664
NM_003031chr161987 ----147
NM_003034chr1257577 7541 2141 908 699 38094 7877 1341 17329 --
NM_003042chr332238 1800 627 21595 1536 1853 --
NM_003045chr13104863 4852 4795 4564 4276 3839 1547 1526 984 941 --21965 915 --
NM_003048chr222119 1134 12689 11941 --
NM_003068chr811029 ------
NM_003071chr341685 1663 711 27 ------
NM_003072chr191306 194 ----
NM_003073chr221298 --1221 --
NM_003074chr32854 348 --21880 287 11491
NM_003081chr2021165 186 1252 ----
NM_003096chr21179 ------
NM_003099chr1585293 4235 2557 2272 1114 1092 802 206 34982 823 587 25749 1511 --
NM_003106chr341087 998 430 405 ------
NM_003107chr621838 444 12252 ----
NM_003108chr287021 6751 6601 5562 1611 1417 464 314 --22451 941 25306 5227
NM_003111chr251242 1047 1020 457 285 ------
NM_003112chr763068 2730 2604 2100 2068 2000 1907 ----
NM_003137chr62655 107 ------
NM_003140chrY--189 ----
NM_003144chr641394 409 292 27 ------
NM_003146chr11----175 --
NM_003149chr321304 349 ------
NM_003150chr1731824 1786 860 --11466 --
NM_003155chr822515 66 ------
NM_003156chr1121087 331 ------
NM_003161chr1742588 2580 1166 1108 ----195
NM_003178chr31621 ------
NM_003182chr7--1472 1351 --
NM_003182chr7--1472 1351 --
NM_003185chr201110 --1320 --
NM_003188chr61629 ------
NM_003189chr163254 2759 2519 2125 592 245 --1380 --
NM_003194chr63582 386 63 ------
NM_003199chr1823575 1998 12038 1929 --
NM_003211chr1231225 71 38 1460 ----
NM_003217chr1231915 1465 1248 12004 ----
NM_003234chr362304 2129 2047 786 346 41 --12114 1762
NM_003242chr322125 1555 32422 1928 1540 ----
NM_003246chr151173 ------
NM_003247chr621325 229 11589 --1684
NM_003257chr151106 ------
NM_003262chr374196 4095 1532 1194 1159 897 188 34434 1804 241 31967 1331 414 --
NM_003270chrX1809 1934 ----
NM_003286chr20--2889 110 ----
NM_003292chr152053 1893 1620 711 194 ------
NM_003298chr385388 5358 4565 4397 2295 1742 1400 755 --46105 5708 5339 5087 12056
NM_003315chr17147 ------
NM_003317chr141762 --1783 --
NM_003319chr21307 ------
NM_003330chr1221573 306 --21620 588 1262
NM_003337chr551234 1191 549 477 132 31498 615 503 1685 --
NM_003338chr101368 ------
NM_003339chr511402 --11311 --
NM_003340chr421123 989 ------
NM_003341chr3------1130
NM_003342chr1773166 3086 2831 2019 471 418 42 13330 ----
NM_003344chr731431 1369 234 ------
NM_003347chr2231786 541 143 ------
NM_003348chr1231594 1529 1207 ----186
NM_003369chr1132501 499 368 --12253 --
NM_003370chr192799 637 ------
NM_003372chrX1315 1157 ----
NM_003374chr52773 751 ------
NM_003376chr621814 657 ------
NM_003376chr621814 657 ------
NM_003380chr10197 ------
NM_003389chr9----1197 1462
NM_003390chr113858 196 76 ------
NM_003392chr384192 3928 3530 3308 2989 1587 1503 1415 13637 ----
NM_003405chr22------1155
NM_003409chr1841288 1226 422 295 ------
NM_003410chrX63100 3044 2177 1928 540 192 ----174
NM_003411chrY----2182 68 --
NM_003412chr342231 1083 961 870 12343 31103 607 301 11074
NM_003413chrX12007 ----1416
NM_003418chr31787 ------
NM_003423chr1952345 2156 2003 636 521 12323 ----
NM_003430chr1941611 1214 408 240 --11558 --
NM_003432chr5163 ------
NM_003458chr333173 1531 889 22885 1344 13711 --
NM_003462chr12253 108 ------
NM_003463chr632398 2049 125 22971 580 ----
NM_003467chr22443 95 --1484 --
NM_003468chr232811 2775 544 24183 384 1672 --
NM_003472chr611254 ------
NM_003478chr1183174 2975 2796 2736 2368 2325 2152 1216 11004 13273 --
NM_003480chr1231980 1551 521 1754 11898 --
NM_003482chr1232469 2462 2296 --12485 --
NM_003483chr1212125 12218 11084 --
NM_003487chr171189 ------
NM_003488chr172978 26 ----1281
NM_003489chr212857 21 ------
NM_003498chr1632192 1105 499 --1790 12232
NM_003507chr231690 642 323 --1565 --
NM_003557chr1----11375 --
NM_003559chr1763637 2785 2635 2447 2403 1236 --23852 3060 12608
NM_003563chr172448 262 --11289 --
NM_003566chr1262711 2646 2457 1221 881 575 ------
NM_003567chr1140 ------
NM_003574chr1843605 2308 813 322 21735 1003 14177 --
NM_003576chr1342823 2138 2047 185 --2836 158 12068
NM_003581chr221061 113 ------
NM_003583chr1223480 2588 12597 --12678
NM_003589chr1331220 907 195 ------
NM_003590chr273893 3672 2900 2885 2793 921 159 2668 484 --14092
NM_003595chr22--1459 ----
NM_003597chr262169 1627 1513 799 789 102 1199 1836 --
NM_003601chr4--1153 ----
NM_003603chr422113 656 ------
NM_003607chr144100 3201 3069 1584 1363 13654 --
NM_003615chr363602 3181 2887 853 731 284 --12779 --
NM_003620chr174873 268 137 114 --1244 --
NM_003629chr173487 3034 2950 2435 1371 667 49 --1431 12599
NM_003630chr63197 128 85 ------
NM_003632chr171569 ------
NM_003636chr141749 722 200 47 --131 --
NM_003659chr21454 11043 --1966
NM_003660chr19----1290 --
NM_003663chr333042 957 704 ------
NM_003670chr33902 385 361 ------
NM_003671chr933291 2244 1415 1250 ----
NM_003672chr131668 601 238 ------
NM_003685chr192712 356 ------
NM_003692chr92171 153 ------
NM_003713chr121172 432 ------
NM_003718chr72563 392 --1475 --
NM_003735chr5--21218 86 1667 --
NM_003736chr5--21218 86 1667 --
NM_003743chr221935 668 ------
NM_003749chr1332398 1592 97 ------
NM_003758chr1521287 408 --11585 --
NM_003758chr1521287 408 --11585 --
NM_003759chr454217 4056 3281 1395 238 ------
NM_003760chr1--161 ----
NM_003768chr141741 1552 1526 242 ----11316
NM_003774chr1232892 410 247 33183 3166 2923 12210 --
NM_003778chr31739 ------
NM_003780chr1--1157 ----
NM_003783chr121088 277 ----1942
NM_003787chr1811351 --2101 44 --
NM_003791chr161463 --1103 --
NM_003795chr61134 ------
NM_003799chr18104205 4029 3478 3375 3048 2785 1410 1301 1286 1026 ------
NM_003822chr122839 894 12009 1913 12176
NM_003829chr91136 ------
NM_003850chr132595 274 --1232 --
NM_003870chr151211 ----1296
NM_003873chr1032214 735 589 ------
NM_003875chr3137 ------
NM_003885chr1732630 1025 67 11799 1123 --
NM_003887chr221843 936 ----181
NM_003888chr1531522 1480 1280 --21358 179 --
NM_003899chr1342336 984 595 289 --1668 --
NM_003902chr13825 811 787 ------
NM_003909chr852809 2331 2294 626 538 ----12342
NM_003913chr673721 3354 2841 1442 1277 491 64 --12688 12964
NM_003916chrX11426 1985 1259 --
NM_003922chr151371 ------
NM_003924chr431415 1218 351 ------
NM_003932chr22----11848 --
NM_003934chr921332 347 1382 11153 --
NM_003939chr1063359 3112 2672 960 402 191 12614 33524 1005 115 --
NM_003941chr72532 438 1792 ----
NM_003948chr421972 1712 12594 ----
NM_003953chr11869 2988 414 ----
NM_003955chr1721275 216 ------
NM_003958chr632757 1312 113 11114 --1537
NM_003971chr17--199 ----
NM_003972chr1011224 11106 --1485
NM_003980chr611125 ------
NM_003983chr1623953 3480 1695 22872 1597 11263
NM_003993chr1----2315 217 --
NM_003994chr1273784 3060 2958 1495 1193 770 419 23104 271 --13322
NM_003996chr6125 --132 --
NM_004006chrX22587 225 12241 ----
NM_004007chrX22587 225 12241 ----
NM_004009chrX22587 225 12241 ----
NM_004010chrX22587 225 12241 ----
NM_004011chrX22587 225 12241 ----
NM_004012chrX22587 225 12241 ----
NM_004013chrX22587 225 12241 ----
NM_004014chrX22587 225 12241 ----
NM_004015chrX22587 225 12241 ----
NM_004016chrX22501 139 12155 ----
NM_004017chrX22587 225 12241 ----
NM_004018chrX22501 139 12155 ----
NM_004020chrX22587 225 12241 ----
NM_004021chrX22501 139 12155 ----
NM_004022chrX22501 139 12155 ----
NM_004023chrX22501 139 12155 ----
NM_004028chr1841395 854 308 133 22792 583 11373 --
NM_004040chr221345 1084 ------
NM_004046chr18136 ------
NM_004052chr102658 624 ------
NM_004056chr831089 311 103 ------
NM_004061chr51194 ------
NM_004080chr761480 1284 1107 180 126 89 --11373 --
NM_004081chrY21200 455 2623 111 21508 1174 --
NM_004085chrX--1557 --1750
NM_004087chr331602 419 77 --11507 --
NM_004089chrX5998 807 332 192 62 ------
NM_004093chr1342472 2402 1097 168 13189 ----
NM_004098chr1011134 ------
NM_004100chr642676 2257 1056 1010 1991 12369 --
NM_004107chr19----1154 --
NM_004111chr111241 ------
NM_004113chr311718 ------
NM_004114chrX21180 925 ------
NM_004117chr63742 489 105 1531 1279 11748
NM_004124chr1453435 2219 710 380 104 1649 33551 3514 1162 --
NM_004128chr131161 ------
NM_004130chr31571 ------
NM_004136chr1563188 2638 2261 2131 724 551 ------
NM_004156chr82228 220 ------
NM_004162chr33914 124 30 ------
NM_004170chr931823 1389 555 ----11888
NM_004171chr11108545 7736 7145 5996 3701 2981 2635 2156 1962 592 --47217 6189 1177 1164 26874 3427
NM_004193chr101427 ------
NM_004229chrX31673 786 72 32258 2097 1435 ----
NM_004232chr1873378 3234 1547 205 136 112 61 23339 1284 ----
NM_004242chr61318 ------
NM_004261chr11301 1745 1102 --
NM_004270chr5--186 --174
NM_004272chr531650 1321 789 --11885 --
NM_004274chr1422458 1159 ------
NM_004277chr621059 549 ------
NM_004279chr741882 889 518 266 --1171 --
NM_004293chr973424 3362 1109 1005 977 877 725 13450 ----
NM_004311chr1043019 636 506 311 12346 ----
NM_004316chr1211165 ------
NM_004331chr822654 477 ------
NM_004337chr821493 33 ----11535
NM_004338chr1886839 5617 5251 4834 2450 1936 1854 131 --12173 190
NM_004342chr732076 1446 172 11576 ----
NM_004349chr821190 872 ------
NM_004362chr42260 84 ------
NM_004368chr192891 362 1387 ----
NM_004370chr661718 1540 700 289 205 35 --1781 --
NM_004384chr512176 --21755 1427 --
NM_004392chr13----11908 --
NM_004397chr1152654 2632 1129 812 595 ------
NM_004407chr41888 143 ----
NM_004415chr6--1506 ----
NM_004418chr2--1125 ----
NM_004427chr12973 776 ------
NM_004429chrX21395 120 1916 11093 --
NM_004430chr81831 ------
NM_004437chr122585 1325 23627 444 1140 --
NM_004441chr33811 522 494 ------
NM_004442chr121657 1444 --1354 --
NM_004443chr31487 ------
NM_004447chr123756 450 250 --1374 --
NM_004449chr2121104 390 2276 176 ----
NM_004450chr142379 354 ------
NM_004456chr7194 ------
NM_004457chr231263 334 23 ------
NM_004459chr1711507 1370 11559 --
NM_004460chr2164 ------
NM_004480chr141746 ------
NM_004482chr23655 623 173 ------
NM_004487chr321239 511 --2951 90 --
NM_004491chr1944012 3964 3682 1252 --13590 --
NM_004496chr141917 ------
NM_004500chr1421940 1420 2558 216 ----
NM_004501chr153891 3457 1612 534 182 ------
NM_004504chr231050 596 114 13003 ----
NM_004505chr1721280 634 21603 179 ----
NM_004516chr191172 ------
NM_004520chr51268 ------
NM_004521chr104381 301 276 246 ------
NM_004524chr171202 ------
NM_004529chr9--11025 ----
NM_004535chr202497 283 ------
NM_004537chr1221408 247 ------
NM_004538chrX3689 185 143 ------
NM_004549chr11--21405 285 21216 192 128
NM_004571chr2173351 2925 2784 2723 1268 987 60 ------
NM_004575chr431481 1253 1203 --21196 188 --
NM_004576chr51283 ------
NM_004578chr12839 830 ----1355
NM_004586chrX75150 4052 3695 3325 1329 1264 381 15477 ----
NM_004587chr202180 142 ------
NM_004588chr1154021 3707 3463 3416 2791 ----1767
NM_004593chr33379 269 245 ------
NM_004598chr543179 2744 864 94 ------
NM_004600chr121482 226 ------
NM_004602chr20--1590 ----
NM_004612chr984643 4447 3947 1600 1581 698 440 237 11315 ----
NM_004615chrX1658 --1166 --
NM_004631chr111064 ------
NM_004654chrY4978 460 446 385 ------
NM_004660chrY32079 849 506 ------
NM_004663chr1521202 135 --11277 --
NM_004673chr1--21092 164 ----
NM_004677chrY3543 159 123 ------
NM_004687chr1732105 1380 631 --11341 --
NM_004715chr181649 --178 --
NM_004719chr1231873 720 683 12254 ----
NM_004725chr1051461 1406 1385 268 255 ------
NM_004726chrX75382 4753 3863 3585 2296 2043 1410 15575 1292 --
NM_004730chr531601 537 263 ----1626
NM_004731chr1241837 1410 298 281 ------
NM_004734chr1333021 1272 921 ----1190
NM_004736chr151853 1837 1761 772 433 1814 ----
NM_004744chr423324 2732 ------
NM_004745chr875906 4861 4456 4360 2409 1363 1061 35611 869 757 --11407
NM_004748chr1523404 42 ------
NM_004760chr772503 2280 1996 1753 1734 974 460 11743 11639 --
NM_004768chr121129 233 11086 11152 --
NM_004772chr531385 1230 171 ------
NM_004774chr1732474 308 212 ------
NM_004775chr1832240 1945 396 ----12141
NM_004788chr1112350 --21848 649 --
NM_004795chr1351806 1719 1256 1231 476 11204 ----
NM_004796chr1422263 2174 ------
NM_004798chr2013162 --22562 561 --
NM_004805chr22547 409 ------
NM_004815chr174352 4012 3783 3514 3495 1090 624 1331 ----
NM_004824chr611260 ------
NM_004834chr262804 1344 1146 907 173 39 ------
NM_004836chr22820 229 ------
NM_004839chr152594 110 ------
NM_004840chrX3282 112 75 11732 ----
NM_004842chr621701 99 1237 ----
NM_004850chr221444 1316 --21455 701 --
NM_004857chr1444544 4038 886 614 54688 3733 2985 1506 608 13303 --
NM_004859chr1762683 2241 1936 1107 859 68 22957 221 --12311
NM_004866chr574927 4832 4012 3538 1743 1343 179 11766 ----
NM_004867chrX--1224 ----
NM_004871chr1723339 643 --43265 474 457 175 --
NM_004874chr82505 188 ------
NM_004893chr53148 110 48 ------
NM_004896chr1041237 1070 1026 124 11450 ----
NM_004898chr422683 778 ----1100
NM_004902chr203860 666 561 ------
NM_004904chr744303 2016 604 239 45189 2045 1556 1358 ----
NM_004905chr13790 676 157 ------
NM_004906chr62605 532 1516 ----
NM_004912chr741363 1290 546 403 ------
NM_004921chr152114 1936 929 269 136 11576 ----
NM_004926chr1441840 1488 1331 354 --1529 --
NM_004929chr82330 179 11065 --21173 528
NM_004956chr764314 4298 4214 2887 503 459 24166 1486 ----
NM_004964chr12520 514 ------
NM_004966chr10--1956 ----
NM_004967chr41404 ------
NM_004969chr10289 48 ------
NM_004973chr611639 --11221 --
NM_004976chr11103409 1551 1309 1238 1095 1024 733 313 209 92 24580 3206 24237 2005 --
NM_004979chrX21169 744 1138 ----
NM_004985chr1274152 3642 2959 2749 1119 908 848 11040 11735 --
NM_004992chrX78278 3270 3014 1966 992 879 144 12419 23416 2301 12134
NM_004992chrX78278 3270 3014 1966 992 879 144 12419 23416 2301 12134
NM_004993chr1421269 975 11337 ----
NM_005006chr22174 23 1907 ----
NM_005010chr72538 512 --12253 11455
NM_005011chr751384 495 453 88 34 11562 ----
NM_005012chr1--1134 ----
NM_005016chr122304 69 --1119 --
NM_005028chr1062360 2104 1934 1751 1503 465 ----11598
NM_005032chrX11027 ------
NM_005036chr22108334 7746 6293 5538 2826 2301 1468 1403 1387 124 26511 1017 ----
NM_005056chr1295364 5312 3996 2106 2025 1976 1728 994 800 21719 1515 24767 2049 15184
NM_005063chr1063619 3480 3428 1472 869 794 11339 21387 301 --
NM_005065chr1421792 1556 11277 12112 --
NM_005066chr12113 29 ------
NM_005068chr611297 ------
NM_005080chr221772 138 ----
NM_005087chr31758 --194 --
NM_005088chrX1883 ----1215
NM_005105chr141640 707 488 293 42172 1515 514 507 ----
NM_005113chr142390 188 ------
NM_005116chr2084065 3385 3161 3059 2862 1319 1287 1275 13580 12870 --
NM_005119chr11339 ------
NM_005121chr1721044 665 ------
NM_005124chr63881 761 268 ------
NM_005135chr1573628 3156 2730 2531 2388 812 234 13290 11330 --
NM_005151chr1842251 1874 1515 783 ----1685
NM_005153chr163780 719 606 ----1305
NM_005155chr61644 ------
NM_005156chr975310 5153 4967 4317 3484 3317 2150 34823 4227 4086 23953 3640 21370 889
NM_005171chr1251344 1259 1191 522 254 ------
NM_005180chr1031462 1330 586 ------
NM_005188chr11158353 7875 5879 2649 2407 2190 2078 1759 1747 1491 1135 999 943 582 108 17276 35470 2299 2137 12823
NM_005197chr1436177 5142 1442 24869 3951 --15616
NM_005203chr10165 ------
NM_005206chr172228 147 1293 --11462
NM_005207chr2273563 3506 2657 2264 1418 1219 50 21412 788 1653 --
NM_005219chr511788 --2622 380 --
NM_005227chr11499 ------
NM_005233chr322527 2430 ------
NM_005235chr2106954 6266 5158 4983 4821 3094 2546 2112 1686 466 35993 5199 3029 2548 532 --
NM_005238chr1122345 932 23122 637 ----
NM_005241chr31301 ------
NM_005249chr141653 --1128 --
NM_005252chr141615 ------
NM_005256chr11167 ------
NM_005257chr1831376 505 482 ------
NM_005264chr103371 253 90 ------
NM_005273chr71338 ------
NM_005277chr411736 ------
NM_005278chrX------1362
NM_005295chr71196 ------
NM_005308chr101360 ------
NM_005311chr742137 2111 696 61 --11812 --
NM_005313chr151195 ------
NM_005324chr1721904 590 31607 857 436 21453 459 11430
NM_005327chr43727 210 111 ------
NM_005329chr1631789 850 106 ------
NM_005339chr463787 3779 3712 3438 2993 961 ------
NM_005342chrX42837 2539 2387 135 ------
NM_005359chr1886296 5334 4531 4300 2105 1932 1108 615 14571 ----
NM_005370chr1931241 1025 531 ------
NM_005375chr61161 11022 --1211
NM_005378chr21300 ------
NM_005382chr81417 --1168 --
NM_005385chr372758 1873 1081 595 443 358 73 ------
NM_005392chr911667 11625 ----
NM_005397chr753872 2819 2638 1615 753 --11444 --
NM_005399chr153334 1565 1090 701 468 14100 --171
NM_005400chr253108 2636 2437 1209 754 ----1967
NM_005402chr7----1276 11691
NM_005410chr52326 35 ------
NM_005415chr23792 605 104 ------
NM_005418chr112464 286 ------
NM_005433chr1831735 457 446 ------
NM_005436chr1054101 3780 3737 3701 1561 ------
NM_005437chr1011372 --11039 --
NM_005442chr3--1528 ----
NM_005443chr42140 63 ------
NM_005450chr171226 ------
NM_005461chr2041934 1769 769 589 ------
NM_005475chr122708 134 --12962 --
NM_005477chr1542211 909 645 290 1812 12339 11012
NM_005477chr1542211 909 645 290 1812 12339 11012
NM_005487chr2252030 1780 1652 1617 423 ------
NM_005497chr17116169 6006 4536 3969 1834 1637 1258 804 565 558 291 34911 3780 1812 45436 4158 2113 1272 --
NM_005499chr191532 ----1588
NM_005501chr1711213 ------
NM_005502chr911238 23155 2520 ----
NM_005517chr12922 48 ------
NM_005520chr51195 1567 1204 --
NM_005522chr71942 11133 1100 --
NM_005530chr151310 ------
NM_005537chr131840 21132 254 ----
NM_005539chr1031415 319 312 ------
NM_005542chr781705 1226 732 691 650 361 192 151 ------
NM_005544chr22912 154 ------
NM_005562chr111092 --11517 --
NM_005570chr1861159 1125 985 425 316 87 ------
NM_005578chr345028 1551 1069 94 ----11128
NM_005587chr152757 307 ------
NM_005595chr11631 ------
NM_005596chr965516 2498 1240 1002 759 695 14416 35703 5426 4144 --
NM_005600chr1------1200
NM_005604chr611839 11788 12462 --
NM_005606chr142332 88 1481 1186 --
NM_005611chr1631126 998 834 ------
NM_005626chr12418 38 1412 ----
NM_005637chr1851833 1643 1537 702 666 1537 --1810
NM_005639chr1211492 11437 11905 --
NM_005642chr51363 --127 --
NM_005647chrX63264 3063 2526 2504 2299 486 22860 894 11198 --
NM_005650chr2221322 364 ------
NM_005665chr153249 1712 1483 711 526 ----1157
NM_005668chr554323 1843 1685 427 236 1874 ----
NM_005669chr542002 1776 952 146 ------
NM_005688chr33829 423 23 --11046 --
NM_005711chr531090 848 776 1337 ----
NM_005715chr632519 2471 1770 ------
NM_005717chr111195 --1388 --
NM_005725chr141916 1558 666 573 --1387 --
NM_005730chr1212818 1704 13059 12471
NM_005734chr112640 251 ------
NM_005737chr222159 747 12544 ----
NM_005738chr741896 1474 521 195 1687 ----
NM_005746chr722326 1865 1407 1423 --
NM_005754chr52191 96 1965 1826 --
NM_005759chr274679 4516 3724 3488 1719 998 658 ------
NM_005768chr122715 150 ------
NM_005779chr563108 2776 2403 953 868 182 22577 2541 2767 316 161
NM_005786chr181788 --187 --
NM_005789chr1722163 1870 --22084 1537 --
NM_005798chr1395054 4907 4749 3334 2075 1555 1415 389 23 --11145 --
NM_005801chr172762 186 ------
NM_005807chr11104 ------
NM_005808chr342733 2698 694 470 ------
NM_005813chr232368 1618 1058 ----12026
NM_005819chr153105 2663 2529 1345 536 ------
NM_005822chr611621 42068 1493 795 440 ----
NM_005828chr1764362 1676 1469 1326 1098 629 ------
NM_005840chrX37031 5872 5841 25707 2555 21827 210 --
NM_005843chr251680 1622 1231 510 189 ------
NM_005852chr1711020 --11086 --
NM_005859chr511472 --1180 --
NM_005862chr31877 ------
NM_005863chr10159 ------
NM_005871chr1011066 ------
NM_005875chr31265 ------
NM_005876chr21741 ------
NM_005880chr1621060 303 1270 ----
NM_005888chr12--1146 ----
NM_005898chr1122634 2277 32469 2363 1096 1784 12099
NM_005899chr171225 ------
NM_005900chr431064 958 435 ------
NM_005901chr18148689 8518 8045 6632 6286 5971 3163 2703 2191 1790 1488 1351 1244 922 23134 127 18170 --
NM_005903chr564240 4064 1784 1682 1088 869 --1428 --
NM_005905chr132443 86 ------
NM_005906chr611646 --11675 --
NM_005909chr594202 4120 3453 1461 1102 697 579 547 166 1600 23290 2678 --
NM_005911chr211471 ------
NM_005917chr21160 ------
NM_005920chr142832 2743 841 530 12545 ----
NM_005923chr61567 ------
NM_005930chr142676 52 ------
NM_005935chr423494 1031 13231 11763 1356
NM_005941chr853752 1310 1059 573 337 23352 1046 ----
NM_005955chr155022 4685 3970 2057 1376 --24854 2095 --
NM_005962chr1022045 504 --191 --
NM_005962chr1022045 504 --191 --
NM_005964chr1721201 448 ------
NM_005966chr292325 2122 2067 2042 1814 949 538 381 145 21858 1548 ----
NM_005977chr13--1359 ----
NM_005985chr201791 ------
NM_005990chr572716 2148 1810 1067 945 549 356 ----12372
NM_006007chr964246 3862 3293 1670 1348 423 13692 14133 --
NM_006016chr641689 1468 1444 347 ------
NM_006024chr71368 --1171 --
NM_006030chr31441 ------
NM_006035chr1431325 492 158 11248 21253 385 --
NM_006036chr232411 317 150 153 ----
NM_006037chr254425 3653 3389 642 173 --2777 447 --
NM_006040chr1631253 1171 528 1545 ----
NM_006047chr2033535 1145 801 12461 --13087
NM_006048chr13873 299 282 ------
NM_006060chr763673 3541 2720 1506 1084 316 11694 14050 --
NM_006080chr722404 2251 ----12534
NM_006089chrX51897 661 302 214 82 21447 1283 ----
NM_006090chr12694 511 ------
NM_006094chr831790 735 566 ------
NM_006095chr474237 3510 1373 337 226 86 68 1837 ----
NM_006106chr1142667 1266 1099 85 22887 2458 ----
NM_006108chr1172055 2038 916 843 490 478 132 ------
NM_006113chr131887 1618 227 21725 148 ----
NM_006135chr131455 1226 324 --1461 --
NM_006136chr72992 205 ------
NM_006139chr211809 32794 2737 215 ----
NM_006141chr162362 97 ----1373
NM_006145chr192429 235 --1381 --
NM_006152chr12--143 ----
NM_006153chr31266 ------
NM_006157chr111129 ------
NM_006160chr1711638 --1533 --
NM_006164chr2--1187 ----
NM_006166chr1242542 1658 915 867 --1315 --
NM_006180chr92519 401 ------
NM_006186chr22304 292 ----198
NM_006190chr21944 ------
NM_006195chr911395 11421 ----
NM_006196chr21299 --1110 --
NM_006203chr584990 4056 1958 1862 1482 874 502 171 --11093 --
NM_006206chr432447 1793 772 --12337 --
NM_006209chr81434 ----128
NM_006210chr1921140 424 ----1181
NM_006224chr1742553 1908 1629 742 --2617 341 --
NM_006237chr1332247 1930 925 11792 11507 --
NM_006242chr2041534 1424 874 855 ------
NM_006243chr11344 1233 ----
NM_006252chr1117604 7378 6462 5656 5507 5341 4947 2222 2052 1537 1222 45224 4649 4628 700 16540 16775
NM_006253chr121184 11274 11071 --
NM_006256chr131913 512 286 ----1220
NM_006258chr1011117 1544 ----
NM_006265chr851470 1448 409 384 115 --21309 1034 --
NM_006266chr9------1119
NM_006275chr2032431 664 620 ------
NM_006282chr2054619 4496 3663 1719 438 23997 3061 11288 11400
NM_006292chr11191 ------
NM_006300chr1932356 1932 807 ------
NM_006306chrX45872 4802 4452 2296 31497 1132 499 1906 --
NM_006313chr12--1107 1213 --
NM_006317chr5----1779 --
NM_006323chr4--1508 ----
NM_006325chr121170 1240 ----
NM_006328chr111670 ------
NM_006330chr82402 181 --177 --
NM_006350chr5150 ------
NM_006352chr151815 1793 773 394 75 21937 813 187 --
NM_006357chr21450 ------
NM_006359chrX32430 2125 1732 ------
NM_006364chr1431153 882 245 ------
NM_006375chrX31417 768 741 11282 11689 --
NM_006378chr9189 --1223 11333
NM_006380chr1733464 1479 217 22736 1112 12764 --
NM_006386chr2262331 1942 1812 889 796 211 ------
NM_006393chr1084464 4385 4183 3949 3065 3006 2783 506 --23218 3108 --
NM_006411chr63997 891 330 --2651 217 --
NM_006420chr2033066 2859 2531 181 1159 --
NM_006425chr54561 471 283 245 ------
NM_006431chr12----136 --
NM_006434chr1032962 884 475 --22667 2116 --
NM_006451chr541058 341 37 24 ------
NM_006457chr433032 1595 503 1971 11556 --
NM_006459chr1031473 1317 658 11852 --21464 201
NM_006460chr171486 1391 ----
NM_006469chr121483 622 --1616 --
NM_006472chr11308 --189 --
NM_006482chr1223480 2588 12597 --12678
NM_006489chr14--1434 --11394
NM_006504chr1031884 1047 548 --22777 503 12806
NM_006526chr2022089 1536 11496 1493 --
NM_006529chr421652 1320 ------
NM_006534chr2023227 2249 --12528 13301
NM_006537chr15153 ------
NM_006540chr85630 417 229 199 63 ------
NM_006544chr14105908 5860 5188 4573 4550 2439 1268 964 852 438 15051 ----
NM_006546chr1796613 6395 6215 5883 4770 2524 2139 1784 971 15810 25370 4638 --
NM_006547chr731695 1464 474 1290 ----
NM_006549chr1232774 869 397 32734 1900 499 11098 --
NM_006559chr121222 395 1344 ----
NM_006561chr10116182 5460 5072 4755 4655 4241 3909 1821 1720 501 472 2825 112 45234 5213 2209 1873 --
NM_006565chr16------11080
NM_006572chr1743409 2991 2181 80 12371 12491 --
NM_006584chr171111 ------
NM_006591chr1131742 510 281 --1232 --
NM_006595chr1131404 412 385 ------
NM_006599chr16128145 6791 6703 6542 2657 1900 1356 1204 1068 515 307 247 27905 5097 12375 1829
NM_006603chrX42024 1468 214 157 ----1680
NM_006609chr252183 2119 1840 888 574 --22505 1926 --
NM_006614chr322567 509 43205 2610 545 479 1386 21117 630
NM_006618chr111560 --11150 --
NM_006622chr51214 ------
NM_006626chr941725 659 321 54 1225 ----
NM_006628chr1563935 3649 3284 3189 2840 1106 24343 3463 14217 --
NM_006629chr182267 186 2941 674 ----
NM_006644chr131160 ----1247
NM_006646chr134913 366 292 57 11959 2786 536 12417
NM_006654chr1241449 1380 1019 850 --11927 1720
NM_006660chr152246 72 ------
NM_006662chr163386 243 86 ------
NM_006670chr62611 157 ------
NM_006698chr2031299 1035 385 181 --1350
NM_006699chr14821 778 689 617 ------
NM_006706chr52828 579 --1139 --
NM_006708chr631170 989 916 ------
NM_006711chr16153 ------
NM_006713chr52742 309 1329 ----
NM_006716chr721371 994 ------
NM_006717chr942163 1197 996 82 --32743 2171 495 --
NM_006720chr1064417 3968 3792 3544 3279 1773 ------
NM_006722chr341979 734 707 524 ----11127
NM_006726chr421169 149 ------
NM_006729chrX54569 2235 1905 1847 624 13972 14829 13515
NM_006731chr9125821 5722 5044 4578 4475 3798 3763 3720 1268 1194 1186 851 33776 2053 1507 11645 14150
NM_006734chr6182 ------
NM_006738chr1574638 4524 4316 1675 1563 477 81 ------
NM_006744chr101182 122 152 --
NM_006745chr43947 861 221 ------
NM_006746chrX41551 610 487 161 ------
NM_006749chr811164 --1966 --
NM_006750chr1697863 6581 6076 5410 3228 3150 2648 1986 174 37882 7510 7434 ----
NM_006751chr22777 122 ------
NM_006756chr8--21004 168 ----
NM_006759chr2141 ------
NM_006766chr8--1789 22036 1841 --
NM_006775chr622195 2104 12693 --12324
NM_006777chrX82279 2266 1015 690 640 576 293 270 11896 ----
NM_006803chr851844 1671 1327 751 27 12116 ----
NM_006807chr1721348 127 21098 1053 ----
NM_006808chr91155 ------
NM_006815chr1241257 396 325 77 ------
NM_006822chr172604 505 --1694 --
NM_006826chr22878 127 ----11234
NM_006827chr1463258 2699 2510 1153 1107 962 12677 ----
NM_006832chr143940 848 756 ------
NM_006851chr1242550 2504 2311 2052 1966 1909 --
NM_006861chr1222096 1695 1622 21448 88 183
NM_006874chr421138 1012 --1784 --
NM_006885chr1644046 3473 565 423 ------
NM_006887chr21714 1233 ----
NM_006888chr1472493 2409 2267 854 824 309 218 12202 11352 12170
NM_006889chr341579 1554 969 449 --21382 1001 --
NM_006892chr2011378 ------
NM_006892chr2011378 ------
NM_006912chr112551 --1404 --
NM_006914chr91147 ------
NM_006920chr21465 ----1284
NM_006922chr242065 888 658 613 21739 731 --1565
NM_006924chr1753836 3684 1236 1218 45 33663 2701 982 14404 --
NM_006930chr521324 70 2611 524 ----
NM_006938chr182135 74 1832 --1192
NM_006939chr141755 ----11204
NM_006948chr2142492 2198 2120 86 --11900 --
NM_006951chr102789 762 ------
NM_006965chr183753 312 255 ------
NM_006981chr922910 639 ------
NM_006993chr10--162 ----
NM_006996chr121829 1206 ------
NM_007005chr91961 --11451 --
NM_007007chr1284762 4478 3913 3418 1620 1147 485 75 24520 3601 142 --
NM_007008chr22374 306 ----1107
NM_007010chr1711792 21478 85 --1169
NM_007011chr15116225 5878 5857 5171 2628 1965 1365 1117 1061 301 74 11833 1837 1264
NM_007014chr161197 --21774 1415 --
NM_007033chr141760 1442 879 41 --1506 --
NM_007034chr1----1837 --
NM_007050chr20167810 7756 6843 6720 6562 6160 5747 5619 2490 2149 2005 1312 933 677 513 173 --26069 5902 11698
NM_007054chr5103873 3800 3627 3587 3024 2539 893 660 286 161 22861 2667 1587 13888
NM_007064chr31450 ------
NM_007067chr1731291 602 245 ----11446
NM_007078chr102792 715 --12053 --
NM_007084chr131363 21399 377 ----
NM_007106chr1342723 1851 98 33 1779 ----
NM_007114chr322383 1296 --12514 --
NM_007125chrY11220 ------
NM_007126chr92138 118 --1500 --
NM_007146chr1722558 1024 ------
NM_007150chrX31969 550 66 11894 11645 --
NM_007158chr121196 133 ------
NM_007159chr31447 ------
NM_007166chr112516 195 ------
NM_007173chr1151757 701 663 561 219 ------
NM_007175chr843549 2737 2434 207 --23530 1106 --
NM_007195chr1843550 2986 2436 1380 31395 1192 1046 ----
NM_007200chr1574638 4524 4316 1675 1563 477 81 ------
NM_007202chr17--2593 217 1539 --
NM_007204chr12201 127 1262 ----
NM_007212chr162155 1415 748 427 313 237 ------
NM_007222chr831231 1172 354 ------
NM_007236chr1551826 765 583 290 27 11667 1474 --
NM_007238chr2043076 1315 1293 312 --34285 1354 642 --
NM_007246chr421002 258 1112 ----
NM_007249chr13139196 8980 8951 8796 8467 7296 6330 3030 2132 1731 1351 733 722 27186 2057 ----
NM_007271chr661803 1701 1213 734 534 124 --21639 1455 1473
NM_007279chr191536 ----1597
NM_007286chr531599 1464 661 ------
NM_007315chr231460 474 36 11489 ----
NM_007317chr16_random164 ------
NM_007350chr1254103 3550 3303 1505 668 --21261 99 --
NM_007358chr121981 323 ------
NM_007363chrX2234 21 1372 ----
NM_007373chr102718 248 11398 ----
NM_007375chr1----12359 --
NM_012062chr122304 207 1351 --1251
NM_012073chr5--1149 --21423 1204
NM_012081chr533408 3076 280 22589 110 ----
NM_012082chr82808 786 ------
NM_012095chr1063551 3348 3268 2634 2258 30 1341 1992 --
NM_012096chr332943 2643 1470 --145 --
NM_012104chr1143357 3094 2987 468 1351 ----
NM_012104chr1143357 3094 2987 468 1351 ----
NM_012118chr42364 73 1294 ----
NM_012124chr111153 ------
NM_012129chr732247 2043 1858 --12025 1408
NM_012134chr111539 ----11457
NM_012137chr162903 2674 1989 1067 861 584 --22715 986 --
NM_012141chr1333676 3120 1476 11110 ----
NM_012158chr1331140 278 271 ----11435
NM_012161chr411148 ----1239
NM_012164chr9127244 7092 6476 6080 5997 5687 4634 2938 2686 2231 1048 505 --12760 --
NM_012180chr42658 27 ------
NM_012189chr18------1182
NM_012193chr1184244 4140 2016 1959 1211 981 957 97 ----13778
NM_012199chr184433 3873 3783 2890 1761 1169 1021 565 ------
NM_012207chr102824 27 1373 ----
NM_012214chr274923 4626 4563 2561 2310 1581 786 --24298 526 11207
NM_012215chr1041670 287 237 34 ----1407
NM_012218chr192410 311 --22353 1937 --
NM_012219chr313227 33143 2161 500 ----
NM_012234chr383512 3481 3258 3124 2885 2456 1017 462 12356 --23034 634
NM_012238chr1021649 1259 1337 ----
NM_012242chr101830 ------
NM_012250chr112297 66 ------
NM_012252chr744278 4210 3616 937 --3695 418 373 --
NM_012255chr20144 ------
NM_012259chr641431 1390 498 260 ----1912
NM_012262chr144825 4118 3457 75 34898 1436 186 ----
NM_012266chr9----1258 --
NM_012281chr741957 1779 1509 187 --1513 --
NM_012282chrX2670 565 --1192 --
NM_012286chrX2124 61 ------
NM_012294chr773620 3484 3022 1413 1194 662 292 ------
NM_012296chr1111092 23475 443 13716 1117
NM_012297chr452591 1966 1917 1874 23 --32253 1606 923 --
NM_012300chr532287 792 38 11859 ----
NM_012301chr771765 1734 1582 1476 779 754 646 ------
NM_012302chr12481 325 ------
NM_012304chr5--22439 2126 32340 2322 232 --
NM_012308chr1151842 1807 1694 673 301 ------
NM_012309chr1144191 4066 1339 847 --44585 3814 1980 208 --
NM_012316chr133502 1853 1503 11208 14167 --
NM_012319chr182341 229 146 ----
NM_012322chr71106 ------
NM_012325chr20----11650 --
NM_012327chr1831499 1246 995 ------
NM_012333chr13547 317 273 ------
NM_012334chr554161 1691 958 687 204 44071 3001 1503 719 1214 13767
NM_012338chr72993 837 1164 ----
NM_012339chr102650 589 ------
NM_012345chr1341436 1285 1190 149 --21789 1527 --
NM_012399chr2231358 702 514 --11964 --
NM_012402chr1131110 531 141 ------
NM_012408chr201653 1774 ----
NM_012412chr71811 ------
NM_012416chr91111 --11078 --
NM_012419chr6194 ------
NM_012421chr1--1452 ----
NM_012426chr161359 ------
NM_012432chr13352 331 87 ------
NM_012464chr472758 2268 1791 1012 494 309 158 1710 ----
NM_012479chr752326 1733 588 552 541 1510 32703 717 48 --
NM_013230chrY31590 1526 373 1230 ----
NM_013231chr1443677 3335 765 208 24413 455 11240 --
NM_013236chr222833 432 --1290 1814
NM_013244chr12----126 --
NM_013252chr762119 1846 833 483 271 188 ------
NM_013253chr114351 235 191 117 ------
NM_013255chr7158183 7395 7109 6802 6440 6402 6297 5988 5798 2773 2571 2083 1718 962 311 1614 --26136 1741
NM_013261chr443462 861 843 276 --12599 --
NM_013262chr64472 379 354 286 ------
NM_013279chr112266 148 ------
NM_013281chr20--1169 11309 --
NM_013313chr2242538 2261 855 831 32841 2372 873 ----
NM_013316chr71941 ----1282
NM_013322chr721613 1292 11114 ----
NM_013323chr173421 325 274 ------
NM_013336chr312010 ------
NM_013341chr232824 2698 576 ----12637
NM_013354chr82961 424 ------
NM_013357chr8--1755 ----
NM_013361chr191148 ------
NM_013372chr1542870 1153 765 522 23330 3304 22238 209 --
NM_013374chr332712 2646 2361 1548 12595 --
NM_013377chr12----151 --
NM_013390chr92508 108 ------
NM_013411chr122817 2476 --22222 175 --
NM_013438chr921709 296 ------
NM_013448chr142728 183 ------
NM_013449chr1262507 2428 2386 2180 762 576 --11099 --
NM_013995chrX22362 2255 ------
NM_013996chr7--1472 1351 --
NM_013996chr7--1472 1351 --
NM_013997chr7--1472 1351 --
NM_013997chr7--1472 1351 --
NM_013998chr7--1472 1351 --
NM_013998chr7--1472 1351 --
NM_014010chr92433 406 ------
NM_014011chr272600 2427 1852 1705 773 738 247 ------
NM_014016chr371240 643 588 535 502 179 60 ----1390
NM_014021chr143157 2741 2480 278 33244 542 46 22977 1118 --
NM_014023chr1032730 2450 603 42849 946 664 24 22595 653 --
NM_014030chr172781 432 ------
NM_014038chr71404 ------
NM_014043chr331088 297 198 --11485 --
NM_014055chr122452 441 ------
NM_014110chr13871 773 452 ------
NM_014117chr1642484 1071 905 728 --22446 948 --
NM_014141chr754977 4047 3844 1487 554 24996 756 11686 --
NM_014154chr341534 1522 1196 526 ------
NM_014155chr1185849 5092 1931 1069 1029 294 153 112 11443 ----
NM_014157chr1653022 2449 861 428 416 11012 ----
NM_014178chr14159 1470 --1557
NM_014181chr2--1122 ----
NM_014203chr19163 ------
NM_014240chr312726 23454 858 11155 --
NM_014243chr411916 --12022 --
NM_014245chr33730 416 170 1920 --1346
NM_014248chr221118 ------
NM_014250chr2252030 1780 1652 1617 423 ------
NM_014253chrX1259 1847 11717 1356
NM_014263chr102155 65 --1453 --
NM_014267chr111603 --1783 --
NM_014279chr91669 ------
NM_014280chr11798 ------
NM_014283chr13521 183 59 ------
NM_014285chr9--1238 ----
NM_014289chrX21401 928 ------
NM_014294chr821304 96 21401 967 ----
NM_014305chr131281 1170 ----
NM_014309chr2264860 4511 4235 1587 485 475 --35178 4491 1246 --
NM_014319chr1231578 610 205 1137 21639 1374 --
NM_014323chr221917 --1280 --
NM_014325chr122856 706 --11500 --
NM_014331chr477242 6989 2071 1030 746 609 239 36181 5018 2388 ----
NM_014332chrX1313 ------
NM_014333chr11--1273 --1510
NM_014344chr111767 ------
NM_014352chr1121421 311 --11081 --
NM_014363chr133429 421 291 ------
NM_014369chr21116 ------
NM_014372chr151976 1956 1501 592 112 11435 ----
NM_014381chr1452042 528 415 352 297 --2473 150 13045
NM_014382chr331512 1208 43 ------
NM_014383chr191270 ------
NM_014392chr411079 11219 ----
NM_014393chr831966 664 396 ------
NM_014394chr1041197 1100 966 294 --1450 --
NM_014397chr921235 426 --11404 --
NM_014409chr111014 11177 ----
NM_014415chr311390 ----1328
NM_014418chr1421806 1347 --11371 --
NM_014423chr554612 4272 2233 2014 1612 24441 1767 ----
NM_014431chr101566 --11594 --
NM_014432chr62182 103 ----11402
NM_014445chr331858 401 322 --11568 --
NM_014447chr41195 ------
NM_014454chr62133 50 --1864 --
NM_014456chr1031741 1208 687 ----123
NM_014482chr21129 ------
NM_014491chr7--1399 ----
NM_014494chr1651589 962 634 595 149 11711 ----
NM_014515chr121323 --1657 --
NM_014517chr33753 385 79 11744 ----
NM_014521chr211761 ------
NM_014554chr1212161 ----11812
NM_014572chr1321756 255 ------
NM_014574chr1441382 1357 1054 597 ------
NM_014575chr31455 ------
NM_014583chr3--1205 ----
NM_014584chr1431593 589 299 ----21322 89
NM_014585chr231085 368 224 ------
NM_014588chr20197 ------
NM_014606chr4----11471 --
NM_014607chr221872 811 ------
NM_014612chr91491 --1342 --
NM_014614chr22330 147 2309 258 11318 --
NM_014615chr1663514 3071 2931 1218 409 233 12524 --1439
NM_014616chr343089 2299 924 289 12500 12573 --
NM_014620chr122675 625 ------
NM_014630chr1533222 3099 494 --13333 --
NM_014635chr231625 1341 1257 1155 ----
NM_014636chr921501 1412 --34280 4082 1106 11558
NM_014637chr82388 260 ------
NM_014653chr1231594 538 144 ------
NM_014655chr132330 2031 1461 --11667 1806
NM_014660chr711003 ------
NM_014667chr332121 1564 763 1661 ----
NM_014670chr24624 342 237 176 1423 ----
NM_014671chr731372 1088 271 ------
NM_014674chr373228 1395 780 692 326 96 72 --22505 1234 --
NM_014676chr11607 11229 ----
NM_014677chr831340 1296 856 ----1293
NM_014679chr1121252 287 2399 80 ----
NM_014683chr172431 254 12071 ----
NM_014702chr653332 2945 1186 1106 746 --1128 --
NM_014705chr71779 ------
NM_014707chr7112284 2088 1887 1639 1511 832 465 443 351 343 51 12045 ----
NM_014709chr2193 ------
NM_014711chr1641772 816 793 127 ------
NM_014721chr687144 6591 6076 2989 2569 2398 2143 1298 --27161 6823 --
NM_014729chr842013 1787 1722 498 ------
NM_014730chr1275048 4313 3303 1214 1059 764 421 11835 14555 --
NM_014730chr1275048 4313 3303 1214 1059 764 421 11835 14555 --
NM_014735chrX62087 1444 859 538 430 144 ------
NM_014743chr422407 509 --12278 --
NM_014747chr185829 4952 4938 4830 1095 440 338 77 11823 ----
NM_014751chr842102 427 294 241 --1858 --
NM_014752chr1161752 1368 1218 257 205 137 ------
NM_014755chr232842 1678 575 ----14264
NM_014756chr112456 376 ------
NM_014762chr132321 806 284 --22368 2164 --
NM_014764chr123503 409 98 --1525 --
NM_014765chr132669 2069 327 11693 1561 --
NM_014787chr142844 2758 2535 1943 22638 774 ----
NM_014810chr132944 1115 431 --13025 12371
NM_014812chr131868 1340 371 ------
NM_014822chr41637 --1226 --
NM_014824chr11----21731 62 --
NM_014826chr144100 3201 3069 1584 1363 13654 --
NM_014827chr161727 1219 1134 476 334 98 157 11365 --
NM_014828chr1442469 2264 2230 938 ------
NM_014829chr542200 1796 1513 67 1489 ----
NM_014830chr1243713 1570 1298 925 13592 ----
NM_014832chr1321894 1795 --11631 --
NM_014839chr112091 188 ----
NM_014841chr611349 182 ----
NM_014848chr1542461 1779 901 241 12665 ----
NM_014850chr364298 3652 3390 3320 3127 700 11843 14050 --
NM_014860chr242656 1686 431 181 ----22630 1635
NM_014872chr972271 2209 2085 1496 907 664 116 --12094 --
NM_014873chr184353 3818 1531 1098 998 525 502 383 --11281 --
NM_014877chr17137365 6119 5929 5694 5543 5409 5340 4960 4928 2665 2236 1760 1624 37351 5419 4770 ----
NM_014893chrY1687 --12294 --
NM_014903chr1252315 2070 1904 849 127 ------
NM_014904chr1033783 446 387 12842 ----
NM_014905chr231549 754 364 --11695 --
NM_014906chr1723499 2641 22897 702 --21257 194
NM_014917chr11910 ------
NM_014918chr1521243 73 1606 ----
NM_014920chr633595 1197 1108 11441 --21229 1178
NM_014923chr1332268 1550 648 --11467 --
NM_014924chr1423168 642 12358 ----
NM_014925chr121284 ------
NM_014932chr321276 403 21972 784 ----
NM_014939chr1861264 1213 497 475 388 40 ----11090
NM_014946chr253043 2804 1121 655 572 22030 116 1749 --
NM_014947chr183001 2752 1150 938 436 394 337 275 ----12334
NM_014951chr1022387 1695 --1282 --
NM_014962chr2042117 853 784 300 --12565 --
NM_014964chr1752147 1987 1802 658 313 ----1627
NM_014969chr12345 225 --1184 --
NM_014974chr101236 --11519 --
NM_014989chr631543 1274 605 1698 21634 1331 --
NM_014997chr762974 2172 1964 1894 810 160 --12265 --
NM_015001chr11978 ------
NM_015002chr1232133 656 270 1297 ----
NM_015008chr362665 2291 1351 1039 994 979 ------
NM_015017chr131126 248 217 1437 ----
NM_015020chr1663441 2942 2865 2586 170 132 23804 519 ----
NM_015023chr111334 ------
NM_015025chr232269 1961 907 ------
NM_015026chr1273959 3683 1544 377 303 64 36 11422 ----
NM_015032chr1352365 868 812 512 204 ------
NM_015035chr20106239 5775 5762 4705 4688 4517 4361 4064 2508 35 11888 ----
NM_015039chr174125 4044 3997 3461 1543 561 202 33557 1575 887 21642 1335 --
NM_015040chr243181 3161 2733 2217 12100 ----
NM_015042chr1532976 1626 1152 11289 23429 1358 --
NM_015044chr1652780 1972 897 762 473 ----12827
NM_015045chr1021870 732 ----12223
NM_015046chr952489 628 584 394 255 ------
NM_015051chr963368 2847 2273 1367 1187 874 --12182 --
NM_015054chr121156 ------
NM_015057chr131181 ------
NM_015068chr733160 3086 2646 ------
NM_015070chr132566 141 ------
NM_015076chr643905 1795 1786 198 2566 506 1820 13301
NM_015080chr112960 924 ------
NM_015082chr542026 696 144 132 12190 --11761
NM_015091chr141747 ------
NM_015092chr1633526 1293 1013 14314 1878 14704
NM_015093chr621765 56 176 ----
NM_015094chr2234030 871 289 ----14660
NM_015097chr391728 1710 1689 1656 1507 381 172 115 28 ------
NM_015099chr17------149
NM_015100chr132049 1847 1316 ------
NM_015115chr43398 200 43 --12807 --
NM_015132chr71575 --1101 --
NM_015138chr154847 663 539 533 --1386 --
NM_015149chr121463 421 --1767 --
NM_015153chr61501 ------
NM_015155chr1023304 2640 --12521 1680
NM_015162chr153217 81 73 --123 --
NM_015173chr431513 1429 1179 ------
NM_015176chr1--11157 1337 --
NM_015191chr1132661 2565 1963 --31095 871 836 1970
NM_015192chr2022462 532 ------
NM_015197chr1453288 2366 1362 1206 76 ----22782 119
NM_015200chr422022 358 ------
NM_015208chr1853372 839 476 453 413 12784 21360 195 --
NM_015209chr122165 733 11869 ----
NM_015213chr11------1618
NM_015215chr123018 147 --11010 --
NM_015225chr953132 2818 1035 953 436 2735 416 ----
NM_015233chr1352685 808 767 449 309 --148 --
NM_015239chr91130 ------
NM_015247chr1654871 4009 3964 3643 545 25083 980 14780 --
NM_015252chr22694 42 1789 --1709
NM_015256chr52525 507 --1696 --
NM_015264chr2274589 4018 3584 3316 1362 1140 510 13172 ----
NM_015271chr464238 4080 3093 3066 1278 232 ------
NM_015272chr16----1586 --
NM_015282chr292202 2004 1949 1224 1025 821 543 529 303 1974 52677 2169 2162 650 204 --
NM_015285chr1841819 1721 1692 710 ------
NM_015288chr543428 2634 1062 938 11195 2874 81 --
NM_015294chr172283 162 ------
NM_015308chr112751 69 161 2852 275 --
NM_015310chr887913 7012 5457 2142 1530 809 300 150 26975 5782 27567 1193 15076
NM_015317chr252735 2574 2367 795 384 --11770 --
NM_015326chr151153 1135 921 605 521 32677 954 325 42582 1890 559 438 --
NM_015328chr782634 2406 1963 1173 1041 800 679 595 22522 2176 11254 --
NM_015331chr1--1658 ----
NM_015336chr123668 402 353 --1137 --
NM_015338chr2011890 11663 1388 --
NM_015344chr81812 ------
NM_015347chr1211976 32361 1190 189 22366 2086 --
NM_015349chr642976 1077 236 101 ------
NM_015354chr91367 ------
NM_015355chr1711955 ------
NM_015358chr21----1838 --
NM_015361chr21821 ------
NM_015365chrX53902 3202 1384 427 113 --13539 --
NM_015375chr143365 1759 1544 1131 --14838 --
NM_015379chr7----1228 --
NM_015385chr1032962 884 475 --22667 2116 --
NM_015387chr231988 1981 260 11592 11517 --
NM_015393chr443118 1324 1151 1062 23348 1187 23153 3092 --
NM_015394chr1231656 743 678 1253 21571 105 11901
NM_015396chr32512 132 ------
NM_015397chr931480 1300 582 --150 --
NM_015412chr352434 2207 1888 291 148 12397 --12596
NM_015419chrX31047 959 418 ------
NM_015435chr821004 590 181 11324 --
NM_015436chr483040 2932 2384 1353 719 385 245 164 12253 ----
NM_015439chr61403 --149 --
NM_015443chr172367 105 ------
NM_015446chr1--3644 543 336 --1370
NM_015455chr533454 3199 1250 23166 2853 ----
NM_015457chr111704 ------
NM_015458chr875214 4278 3337 3262 1600 1183 970 --11560 15054
NM_015461chr182779 729 ------
NM_015472chr31142 ----1441
NM_015472chr31142 ----1441
NM_015475chr21351 153 ----
NM_015477chr153711 321 285 ------
NM_015483chr72419 322 1173 ----
NM_015485chr11100 ------
NM_015488chr21253 --11344 11456
NM_015525chr611031 177 ----
NM_015530chr21697 ------
NM_015532chr1531090 446 143 ------
NM_015534chr16960 898 763 386 371 75 ------
NM_015542chr102991 106 1408 11149 --
NM_015550chr753390 3333 921 904 885 --22605 1189 --
NM_015553chr654420 4060 3958 1835 1486 13374 13603 --
NM_015554chr1542807 2500 2175 284 --2774 273 --
NM_015567chr1321323 1194 ----11286
NM_015569chr174484 4089 3902 1256 1230 887 122 1719 ----
NM_015575chr262633 2577 2490 1439 528 53 13357 ----
NM_015576chr342331 1949 941 28 ----12518
NM_015601chr102867 25 ------
NM_015602chr12368 100 11110 1194 --
NM_015609chr12586 352 ----12888
NM_015634chr101111 ------
NM_015635chr91696 11531 ----
NM_015640chr175251 4218 3991 1472 752 341 200 ------
NM_015646chr121157 ------
NM_015652chr101252 ------
NM_015660chr71246 ------
NM_015676chr14----176 --
NM_015680chr22490 41 --1545 1683
NM_015695chr641884 1848 1658 156 11898 1523 --
NM_015713chr832826 2607 52 22249 1443 ----
NM_015723chr71572 ------
NM_015844chr181950 --1153 --
NM_015846chr181950 --1153 --
NM_015847chr181950 --1153 --
NM_015859chr14162 ------
NM_015872chr1--11284 ----
NM_015878chr83368 339 224 ------
NM_015879chr1887850 6469 6383 5647 5383 2203 1476 329 17309 12306 --
NM_015881chr114351 235 191 117 ------
NM_015885chr111349 1186 ----
NM_015886chr875366 5341 4947 4867 3951 3490 1259 1683 25359 1717 --
NM_015891chr622043 252 ------
NM_015892chr103860 697 455 --3639 577 232 --
NM_015902chr8------1721
NM_015906chr164504 3935 3768 3606 3307 895 1220 24652 880 --
NM_015975chrX11484 31408 304 222 ----
NM_015982chr17153 ------
NM_016009chr174415 3853 1703 1619 1556 1284 426 13278 23808 1933 --
NM_016018chr862877 2520 2480 2466 2230 876 22496 779 ----
NM_016019chr72227 191 ------
NM_016023chr82805 114 --11413 --
NM_016025chr1621809 21 ------
NM_016037chr141121 1000 798 124 1203 ----
NM_016057chr122828 812 ------
NM_016061chr231060 1019 35 --1564 --
NM_016072chr1232140 2034 2027 21556 696 ----
NM_016073chr152955 125 ------
NM_016076chr132414 1225 124 11074 ----
NM_016083chr633487 864 146 1247 21200 1013 --
NM_016087chr721152 137 11293 11640 --
NM_016096chr822212 1455 11529 ----
NM_016097chr1811007 1183 ----
NM_016120chrX2385 156 ------
NM_016129chr4------159
NM_016131chr242268 2093 1671 692 ------
NM_016132chr155798 677 311 303 215 33201 1064 1016 11341 --
NM_016133chr22539 105 --11039 --
NM_016152chr321285 319 --11132 --
NM_016156chr1162141 2045 1788 377 277 73 11673 ----
NM_016166chr151180 ------
NM_016201chr341447 928 639 560 --1735 --
NM_016206chr398150 8013 7601 7413 7206 7115 6835 6650 1207 26294 1186 ----
NM_016224chr61361 1344 11899 --
NM_016227chr13521 183 59 ------
NM_016234chr103997 745 268 --1393 --
NM_016248chr133749 622 424 ----22655 507
NM_016252chr21137 ------
NM_016255chr622283 658 ------
NM_016258chr11130 --1739 --
NM_016260chr277606 6423 6125 5579 2879 2804 1141 26266 6055 27235 6972 --
NM_016261chr171769 ------
NM_016269chr421146 851 ------
NM_016271chr1872306 2021 1782 1759 1539 941 862 12327 1690 --
NM_016275chr331090 518 509 1765 ----
NM_016282chr941671 1102 595 332 ------
NM_016287chr141560 1337 745 148 ------
NM_016297chr233478 2415 921 21286 722 13532 --
NM_016300chr31532 ------
NM_016302chr32584 206 --1144 --
NM_016306chr3--1257 ----
NM_016315chr221524 1463 ------
NM_016322chr942658 2176 757 140 ------
NM_016338chr52967 278 ------
NM_016357chr1231235 506 441 21227 1053 ----
NM_016358chr5172 ------
NM_016376chr1763979 3562 1730 1192 514 367 14091 11302 14383
NM_016377chr621701 99 1237 ----
NM_016395chr153279 57 32 --11521 --
NM_016396chr1551179 661 301 269 216 1673 11070 --
NM_016410chr91229 ------
NM_016422chr1123237 469 1787 ----
NM_016424chr171548 ------
NM_016441chr232350 2102 567 ------
NM_016448chr131329 339 269 --1585 --
NM_016472chr1431340 478 172 ------
NM_016480chr52783 130 ------
NM_016485chr63702 176 86 ------
NM_016507chr1723178 2429 --22808 749 1344
NM_016513chr633595 1197 1108 11441 --21229 1178
NM_016516chr21764 ------
NM_016525chr92690 293 --3919 855 144 --
NM_016529chr132139 43 ------
NM_016530chr1533154 1211 1172 --12854 --
NM_016531chr433993 2784 1485 12964 1826 --
NM_016542chrX41540 1341 1255 501 1219 ----
NM_016559chr321441 575 11099 1160 --
NM_016578chr113654 504 145 ------
NM_016584chr121236 1294 ----
NM_016604chr51205 1852 ----
NM_016607chrX31477 400 97 ------
NM_016612chr8--1661 ----
NM_016620chr13942 169 29 ------
NM_016621chr1111170 --44495 4150 1498 712 --
NM_016626chr183563 445 184 ------
NM_016631chr212785 74 1646 ----
NM_016821chr31417 ------
NM_016823chr17198 1163 --11332
NM_016827chr33721 315 248 ------
NM_016829chr32776 303 ------
NM_016836chr21104 ------
NM_016839chr21104 ------
NM_016936chr1652085 1645 857 669 59 11663 1570 --
NM_016946chr133553 3133 2760 32308 1058 82 12210 --
NM_016952chr1163984 3104 3090 1177 887 465 ------
NM_017415chr561727 1572 1539 992 511 378 21559 925 1734 --
NM_017420chr1443665 2984 1518 523 21118 531 ----
NM_017423chr43829 347 132 ------
NM_017426chr41449 ------
NM_017440chr121135 ------
NM_017447chr2183800 3739 3568 3150 2721 1482 172 43 1976 ----
NM_017449chr121657 1444 --1354 --
NM_017452chr20--1590 ----
NM_017453chr20--1590 ----
NM_017454chr20--1590 ----
NM_017510chr51675 1628 ----
NM_017519chr621016 861 ------
NM_017520chr133218 142 66 ------
NM_017522chr111064 ------
NM_017544chrX1618 1662 --1368
NM_017548chr311636 1222 11444 --
NM_017553chr1531079 494 372 1266 1474 --
NM_017563chr365265 1542 1161 1085 596 453 35506 2172 101 --14478
NM_017569chr132103 42 ------
NM_017580chr1021879 208 1468 ----
NM_017582chr11444 11405 ----
NM_017596chr153815 3452 1780 1444 1279 --13387 --
NM_017599chr1241867 1755 1674 1642 22014 537 11748 1461
NM_017602chrX1370 --1963 --
NM_017610chr1531567 758 157 ------
NM_017626chr1021470 537 --11344 --
NM_017628chr485240 4902 4186 1261 1079 442 297 113 43637 1909 1667 349 1390 --
NM_017632chr41112 ------
NM_017633chr652820 2565 2385 444 373 1423 ----
NM_017635chr1131638 1440 325 ----1498
NM_017637chr985837 3014 2830 1970 1778 1360 1009 345 12457 39098 6226 3468 --
NM_017643chr1722288 744 --11972 --
NM_017644chr365046 1888 1378 1270 1148 460 14670 ----
NM_017650chr734606 4335 519 55918 4322 3824 2104 1423 ----
NM_017657chr2----2365 22 --
NM_017658chr1474152 3877 3756 1581 1011 772 70 22905 1464 ----
NM_017666chrX22192 1524 2454 358 11419 --
NM_017668chr16126 ------
NM_017703chr19134 ------
NM_017704chr113909 822 26 1409 ----
NM_017714chr202660 646 ------
NM_017719chr312062 --12288 --
NM_017736chr1642742 2042 161 91 --1635 13016
NM_017737chr132069 763 635 ------
NM_017741chr442101 1801 1089 1014 ----1449
NM_017744chr11783 ----1945
NM_017745chrX1190 ------
NM_017747chr5----1433 --
NM_017749chr112980 869 1818 2701 354 --
NM_017753chr93803 753 323 ----1871
NM_017758chr1731450 1153 461 --1414 --
NM_017762chr1521979 783 11611 ----
NM_017769chr1423107 2636 12999 ----
NM_017778chr831136 445 44 11369 185 --
NM_017786chr81464 1546 188 --
NM_017787chr1012577 11039 --12844
NM_017789chr2--1280 ----
NM_017799chr142369 246 21473 503 1261 --
NM_017811chr963034 2552 2375 1251 358 155 12521 12703 --
NM_017813chr875435 5325 4173 2340 2157 1179 785 11966 15550 --
NM_017824chr1052456 2207 1776 1005 818 11012 12056 --
NM_017830chr41247 132 193 --
NM_017845chr42585 229 ------
NM_017848chrX43824 3617 3214 3141 24578 242 11810 --
NM_017849chr263195 2678 2299 1075 908 282 ------
NM_017857chr112651 615 ------
NM_017864chr81193 ------
NM_017902chr10104885 4499 4066 3948 1603 756 534 519 502 310 22088 1116 25640 4471 14273
NM_017925chr9--11406 11698 --
NM_017933chr231502 1435 303 11657 ----
NM_017938chrX21786 1523 ------
NM_017944chr1143073 2966 2344 1027 ------
NM_017964chr24995 836 373 117 ------
NM_017987chr1031894 553 119 ------
NM_017988chr12------139
NM_017994chr732770 2495 417 1715 11913 --
NM_018000chr231744 413 145 ----12090
NM_018008chr31275 ------
NM_018015chrX41150 1066 423 131 --11088 --
NM_018025chr191226 ------
NM_018036chr1434342 1442 815 23876 3544 ----
NM_018046chr561947 1493 1406 1229 561 107 11749 ----
NM_018047chr5196 ------
NM_018050chr122154 61 180 ----
NM_018061chr12609 257 ------
NM_018070chr12606 545 1173 ----
NM_018084chr232883 1151 610 --158 --
NM_018086chr231569 1530 1413 ------
NM_018092chr161164 11596 ----
NM_018120chr831445 936 48 ------
NM_018121chr1033219 2059 858 1235 ----
NM_018124chr1632304 886 97 21925 1706 12323 --
NM_018126chr421258 251 11532 11296 11095
NM_018128chr171450 1513 1983 --
NM_018133chr342140 1813 1565 49 ------
NM_018144chr10----1103 --
NM_018155chr333250 2251 1125 --1307 --
NM_018157chr121976 --12995 --
NM_018171chr121227 --1326 --
NM_018177chr42348 260 ------
NM_018182chr1751973 1487 664 256 58 288 80 1514 --
NM_018184chr332097 1472 437 --1871 --
NM_018200chr1531977 536 401 --1559 --
NM_018202chr13302 221 179 --2680 89 --
NM_018211chr12374 113 ------
NM_018221chr22407 171 ------
NM_018223chr1231095 300 120 1364 ----
NM_018227chr453206 902 575 541 400 ----12148
NM_018229chr142149 41 1132 ----
NM_018237chr101284 ------
NM_018244chr2021155 149 ------
NM_018247chr652415 2310 2143 2075 540 --1134 --
NM_018254chr12687 407 ------
NM_018257chr2052330 2132 2058 979 863 12263 11632 --
NM_018263chr252573 2212 1656 996 474 ------
NM_018270chr201766 ------
NM_018286chr17--1927 --1379
NM_018287chr10--1842 --1497
NM_018290chr4------11116
NM_018293chr341880 241 216 76 12397 1274 --
NM_018299chr812891 13358 171 --
NM_018302chr422102 569 3849 713 187 ----
NM_018315chr431462 1288 1247 ----11209
NM_018319chr1451376 1353 1303 1029 194 196 ----
NM_018323chr431608 155 114 11169 ----
NM_018327chr203664 655 205 --11636 --
NM_018351chr1274676 4135 3359 3101 3027 1020 373 13948 24062 3920 --
NM_018362chr1143546 3189 1481 446 11464 --22883 473
NM_018364chr142816 978 863 527 23982 1069 --13186
NM_018367chr112305 228 ------
NM_018369chr5------1670
NM_018374chr764493 3517 3425 1617 1461 807 14487 ----
NM_018375chr1411583 --186 --
NM_018388chrX21421 419 --11271 --
NM_018403chr323572 3513 ------
NM_018416chr1242665 605 380 275 22599 2135 22288 2242 1454
NM_018429chr542834 2011 1067 725 ------
NM_018439chr1842260 733 677 468 --1629 --
NM_018440chr8118726 7703 6543 5991 5547 2870 2137 2024 971 726 654 33204 2848 290 28218 160 --
NM_018452chr6_random33673 3525 1464 43128 2722 443 401 1918 --
NM_018464chr10--1370 ----
NM_018471chr21570 ------
NM_018482chr832545 491 328 ------
NM_018486chrX2371 77 ------
NM_018490chr1141896 1547 1359 137 11248 ----
NM_018534chr2190 ------
NM_018566chr174802 4639 3135 1492 924 545 517 21221 685 ----
NM_018584chr13967 888 844 1291 ----
NM_018593chr6155 ------
NM_018602chr1521083 221 11311 11187 --
NM_018638chr12104887 4353 4230 4195 4085 3461 1382 782 663 250 25246 1016 --25092 989
NM_018644chr1122245 2077 ------
NM_018650chr142198 1421 728 55 ------
NM_018657chr31751 ----1735
NM_018682chr72750 613 ------
NM_018695chr531991 958 761 12460 ----
NM_018696chr183393 86 65 ------
NM_018698chrX1155 ------
NM_018710chr821131 136 1372 11171 --
NM_018718chr73345 261 229 --22267 451 --
NM_018719chr751169 907 500 417 271 --11118 --
NM_018834chr51837 1334 ----
NM_018840chr202455 389 ------
NM_018841chr133364 2470 143 13889 1535 11181
NM_018898chr52253 35 ------
NM_018899chr52253 35 ------
NM_018900chr52253 35 ------
NM_018901chr52253 35 ------
NM_018902chr52253 35 ------
NM_018903chr52253 35 ------
NM_018904chr52253 35 ------
NM_018905chr52253 35 ------
NM_018906chr52253 35 ------
NM_018907chr52253 35 ------
NM_018908chr52253 35 ------
NM_018909chr52253 35 ------
NM_018910chr52253 35 ------
NM_018911chr52253 35 ------
NM_018912chr5--21218 86 1667 --
NM_018913chr5--21218 86 1667 --
NM_018914chr5--21218 86 1667 --
NM_018915chr5--21218 86 1667 --
NM_018916chr5--21218 86 1667 --
NM_018917chr5--21218 86 1667 --
NM_018918chr5--21218 86 1667 --
NM_018919chr5--21218 86 1667 --
NM_018920chr5--21218 86 1667 --
NM_018921chr5--21218 86 1667 --
NM_018922chr5--21218 86 1667 --
NM_018923chr5--21218 86 1667 --
NM_018924chr5--21218 86 1667 --
NM_018925chr5--21218 86 1667 --
NM_018926chr5--21218 86 1667 --
NM_018927chr5--21218 86 1667 --
NM_018928chr5--21218 86 1667 --
NM_018929chr5--21218 86 1667 --
NM_018945chr632302 1095 669 11324 ----
NM_018947chr784598 4425 3814 3722 1474 1189 1069 181 54947 3918 1971 1417 1351 ----
NM_018948chr121284 62 1203 ----
NM_018955chr17--193 ----
NM_018958chr1542969 2628 1600 562 2878 89 ----
NM_018959chr191731 ------
NM_018968chr21135 ------
NM_018970chr772928 2413 2089 1957 1206 241 108 11272 21154 137 --
NM_018976chr1222468 226 --12232 192
NM_018977chrX----1929 --
NM_018979chr1242600 666 296 172 ------
NM_018992chr1651667 1653 1365 448 352 ------
NM_018999chr1094924 4859 4788 4332 3377 3102 1929 1179 229 33862 3652 3275 31869 390 305 --
NM_019000chr53670 365 344 --11651 --
NM_019001chr384133 3873 3738 3484 1499 987 597 204 33910 2953 1340 ----
NM_019004chr742314 1993 825 517 ------
NM_019005chr71141 ------
NM_019006chr151500 --1727 --
NM_019018chr52636 63 ------
NM_019022chr1861205 959 752 644 438 189 12319 ----
NM_019027chr4--12091 ----
NM_019045chrX4959 734 270 39 ------
NM_019063chr22607 525 32080 1411 142 1153 --
NM_019080chr1331564 426 127 --1341 --
NM_019084chr1032375 1780 1728 --1406 --
NM_019087chr531207 641 55 --21143 676 --
NM_019091chr21372 ------
NM_019094chr1263288 2414 2359 901 316 294 33709 2826 1450 --23275 39
NM_019114chr932462 477 118 1796 ----
NM_019116chr1643695 2466 2424 1303 --22445 704 1380
NM_019117chrX43058 726 381 251 --22960 1253 --
NM_019556chrX31269 1119 1047 1554 11241 --
NM_019590chr1031429 211 56 ------
NM_019592chr94919 649 556 102 --1816 --
NM_019597chrX1201 ------
NM_019600chr152724 125 ------
NM_019605chr11615 --1517 1587
NM_019610chr111422 ------
NM_019617chr2--1132 ----
NM_019842chr61123 ------
NM_019845chr22632 587 ------
NM_019857chrX21654 609 --21673 474 --
NM_020039chr1231837 517 145 ------
NM_020120chr231274 391 44 11517 ----
NM_020122chr285784 4067 2320 2094 1765 1408 1287 1220 11754 ----
NM_020130chr821134 901 1987 ----
NM_020141chr132010 1611 843 ------
NM_020143chr21278 --1862 1873
NM_020144chr731894 1558 1445 --1379 --
NM_020148chr1853083 2357 2243 359 230 42399 2186 976 773 ----
NM_020151chr251314 1219 715 424 323 1587 ----
NM_020159chr431498 1178 250 --21441 1208 --
NM_020177chr563259 2951 2780 446 397 363 11224 12329 --
NM_020178chr171934 2307 292 ----
NM_020193chr1131284 1045 292 --11327 --
NM_020198chr17--11504 1105 --
NM_020205chr13743 696 358 ------
NM_020225chr42364 105 ------
NM_020226chr42570 511 ------
NM_020228chr1142532 1731 1681 124 ------
NM_020235chr3--1361 ----
NM_020309chr19--1439 129 1201
NM_020311chr22647 198 --1554 --
NM_020336chr2053624 3511 2991 62 35 --1658 --
NM_020337chr432046 712 594 ------
NM_020341chr2021628 1400 ------
NM_020342chr252240 1987 958 672 294 32176 2169 120 ----
NM_020353chr321547 457 ------
NM_020357chr32660 230 1217 155 --
NM_020369chr71125 ------
NM_020373chr121217 ----1456
NM_020381chr641639 744 594 198 ------
NM_020390chr334820 4627 3151 1945 --13512
NM_020403chr131697 1324 ----
NM_020418chr31564 --1182 --
NM_020420chrY21200 455 2623 111 21508 1174 --
NM_020432chr742046 1691 513 189 198 ----
NM_020443chr186215 5760 5601 5325 4727 2758 2314 1274 --26430 399 --
NM_020449chrX1208 1702 ----
NM_020452chr131881 1850 498 ------
NM_020456chr1352029 1579 905 489 210 21846 1657 ----
NM_020463chr2----11315 --
NM_020466chr684811 4562 4148 3274 3227 1629 655 34 --1573 188
NM_020473chrX21856 348 ----11506
NM_020474chr1861633 1459 1326 750 358 251 ------
NM_020532chr22374 306 ----1107
NM_020546chr51584 12729 12768 22155 1076
NM_020630chr101126 ------
NM_020640chr341679 689 202 33 1289 ----
NM_020645chr113529 457 169 ----1258
NM_020647chr822305 2227 ----1566
NM_020651chr241234 363 256 84 --1206 --
NM_020655chr161158 ------
NM_020666chr54888 733 597 580 1759 ----
NM_020673chr20167363 7177 6181 5989 5767 5417 5372 5251 2893 2417 1251 1009 891 179 106 83 25065 957 36341 990 99 17513
NM_020679chr17173 ----1441
NM_020686chr1612712 12812 12158 --
NM_020697chr81154 ------
NM_020698chr1273081 3006 2760 2499 1100 342 329 --12686 --
NM_020699chr155197 4956 4384 1666 241 14149 ----
NM_020702chr921155 427 11321 21698 39 --
NM_020708chr2022021 214 ------
NM_020711chr222235 171 --11605 --
NM_020718chr1656228 5315 2167 1341 590 14302 21134 535 --
NM_020724chr451976 952 497 198 159 1317 3853 806 179 --
NM_020726chr51609 1255 ----
NM_020727chr2164005 3310 3234 799 726 260 --13656 11067
NM_020732chr621016 861 ------
NM_020734chr1243151 2380 819 758 ------
NM_020737chr6182 --1113 --
NM_020739chr1523404 42 ------
NM_020742chrX32667 928 99 ----11836
NM_020747chr51829 --1796 --
NM_020750chr631268 1195 426 --11525 --
NM_020752chr1012374 12387 ----
NM_020754chr31486 ------
NM_020760chr211433 21474 83 ----
NM_020766chrX13272 --14339 --
NM_020768chr52979 504 ------
NM_020772chr17118700 7423 7055 6669 3060 2208 1990 1957 1705 1583 1501 48382 6777 2604 1872 --18239
NM_020773chr432550 2424 2215 --22224 2095 22085 353
NM_020774chr18105845 5806 5389 5371 5064 4558 1967 1521 1483 109 35224 3972 1619 11104 1671
NM_020783chr183944 532 465 ------
NM_020791chr171405 11411 ----
NM_020794chr12276 236 ----11172
NM_020796chr552767 2217 2131 979 832 ------
NM_020800chr321138 267 ------
NM_020801chr5----1247 --
NM_020809chr112648 317 ------
NM_020810chr1453653 2910 1232 753 569 1603 ----
NM_020830chr273038 2830 2732 2407 2224 1063 851 ------
NM_020841chr1253844 3090 1287 1213 317 ------
NM_020854chr1831479 513 95 11104 ----
NM_020856chr192300 31 ------
NM_020858chr1522195 480 --1863 --
NM_020860chr41242 ------
NM_020865chr3133 ------
NM_020866chr131375 1343 ----
NM_020870chr452035 1651 1559 195 61 ------
NM_020871chrX22164 1836 3615 303 34 1764 12106
NM_020888chr131981 538 514 1346 1239 --
NM_020899chr1732344 2319 548 12290 1213 --
NM_020917chr1941290 702 461 256 1499 23550 596 --
NM_020918chr1062600 2465 2360 1327 906 478 1781 ----
NM_020921chr142287 118 23688 707 ----
NM_020922chrX61874 1604 1501 609 186 73 1482 ----
NM_020926chrX129 ------
NM_020927chr1622245 1547 ------
NM_020929chr11149 ------
NM_020935chr254082 1830 1624 574 391 2492 191 --13985
NM_020940chr1042382 2184 2073 706 --1987 --
NM_020948chr183557 3326 2883 2482 1004 484 441 101 1122 ----
NM_020951chr1931534 308 239 21822 1541 21844 921 1435
NM_020952chr9166 ------
NM_020974chr11----1530 --
NM_020975chr10--41672 1410 1297 230 11271 --
NM_020977chr41702 ------
NM_020983chr12----11718 --
NM_020987chr101290 ------
NM_021005chr1551128 1037 450 367 275 ------
NM_021007chr221897 1650 --11921 --
NM_021012chr1722738 2459 ------
NM_021032chr311718 ------
NM_021045chr10------146
NM_021069chr422113 656 ------
NM_021079chr1753100 2636 2048 884 210 --11258 --
NM_021097chr262983 2195 2165 975 659 231 --1690 --
NM_021106chr92652 492 ------
NM_021109chrX1324 ------
NM_021109chrX1324 ------
NM_021111chr911134 ------
NM_021116chr746660 3288 1906 980 28136 1035 28932 6756 --
NM_021120chrX1190 22660 1971 ----
NM_021136chr141526 ------
NM_021140chrX2892 424 11020 ----
NM_021141chr251046 844 810 400 295 1671 ----
NM_021145chr721157 399 --1339 --
NM_021148chr732479 2375 2019 1859 ----
NM_021149chr1621215 423 ------
NM_021156chr205927 909 275 173 67 1138 ----
NM_021183chrX1609 --1334 --
NM_021190chr131089 1011 248 21252 1061 ----
NM_021194chr12231 118 ------
NM_021202chr2042674 2640 2274 574 --22264 1120 --
NM_021203chr3268 45 ------
NM_021204chr41762 1177 ----
NM_021215chr2032317 1964 1552 ------
NM_021222chr141337 1200 486 387 1933 --11277
NM_021238chr122596 498 12115 31954 1791 1542 --
NM_021240chr92539 256 ------
NM_021252chr1061433 1281 202 195 188 95 ----12001
NM_021622chr1032137 1726 308 --21537 45 11511
NM_021627chr321169 800 ------
NM_021633chr131093 438 411 11193 --11411
NM_021639chr12765 708 ------
NM_021643chr22552 119 ------
NM_021644chr102824 27 1373 ----
NM_021648chr632539 923 34 --182 --
NM_021722chr7--1107 ----
NM_021728chr14162 ------
NM_021794chr12312 280 ------
NM_021800chr10----165 --
NM_021813chr655440 5309 4864 4184 126 34575 4197 1855 25046 266 --
NM_021814chr651482 1423 645 592 96 ------
NM_021830chr102870 111 ------
NM_021911chr545326 5113 4497 3631 ----15575
NM_021912chr1544115 3080 2796 533 ------
NM_021913chr1951549 1297 1173 359 328 1439 ----
NM_021931chr201794 ------
NM_021940chr61278 ------
NM_021942chr41186 ----1766
NM_021943chr612144 ------
NM_021949chrX31768 670 74 --22670 1882 --
NM_021956chr621509 1122 --1440 --
NM_021960chr132045 1893 60 --12026 1223
NM_021961chr1196864 5173 2907 2861 2369 1276 1083 887 308 26564 6223 36525 5388 2705 --
NM_021964chr386562 6535 6418 5973 2515 2378 1460 611 35784 4713 4390 21659 735 --
NM_021970chr43559 264 239 ------
NM_022037chr221032 233 ------
NM_022041chr1662211 1069 1053 988 775 534 ------
NM_022048chr15136152 6131 5789 5278 4735 4609 4523 2438 1918 1892 1710 1062 640 15081 --14755
NM_022049chr13730 613 332 ----11854
NM_022058chr231470 794 357 1478 ----
NM_022060chr141118 --21033 1024 --
NM_022062chr1121566 460 1446 --11416
NM_022063chr10--11689 1152 --
NM_022073chr1411357 --21659 1073 --
NM_022079chr102867 25 ------
NM_022085chr631548 1514 191 ------
NM_022116chr71245 --141 --
NM_022121chr621083 386 1173 ----
NM_022130chr52974 342 ------
NM_022133chr821489 706 ------
NM_022173chr221032 233 ------
NM_022340chr363571 3253 1217 1113 677 387 22422 1404 ----
NM_022351chr843567 3159 2766 1170 --13244 12848
NM_022366chr11378 ------
NM_022459chr13106029 5867 5759 5723 5688 4610 2480 1062 511 74 25712 4063 11972 25147 5135
NM_022462chr1953544 1338 1098 1092 909 1199 --13183
NM_022474chr1481907 1882 1874 1788 928 870 633 171 ------
NM_022484chr721401 413 ------
NM_022485chr32408 377 ------
NM_022496chr121333 ------
NM_022552chr221178 790 --11191 --
NM_022553chr62534 95 ------
NM_022572chr21253 --11344 11456
NM_022650chr5163 ------
NM_022652chr123755 749 462 --151 --
NM_022728chr71114 ------
NM_022730chr21308 ----11010
NM_022735chr13512 288 98 ------
NM_022739chr1731000 951 369 172 ----
NM_022753chr132698 2107 930 1981 --12735
NM_022763chr342307 1261 886 348 --1934 --
NM_022780chr251858 1836 1684 1190 662 ------
NM_022781chr931011 964 169 11075 ----
NM_022782chr121378 ------
NM_022784chr1521168 177 1431 ----
NM_022802chr1011160 1648 ----
NM_022824chr51668 21504 1488 ----
NM_022826chr211167 ----1463
NM_022828chr52645 253 21097 231 ----
NM_022831chr131433 1338 264 ------
NM_022841chr1532580 954 434 2869 308 ----
NM_022843chr1311117 ------
NM_022893chr222750 516 --1548 --
NM_022894chr241652 1327 1174 122 21708 1156 ----
NM_022897chr51974 164 2228 194 --
NM_022898chr1454394 3062 1630 1570 566 --33942 3929 3469 --
NM_022909chr51526 ------
NM_022912chr222143 302 13088 ----
NM_022913chr5154 ------
NM_023000chr1451383 1340 1186 604 30 ------
NM_023001chr1451383 1340 1186 604 30 ------
NM_023012chr121526 ------
NM_023015chr1--1681 ----
NM_023016chr242769 1080 635 360 --12551 --
NM_023071chr121336 --11130 1972
NM_023074chr1921272 219 ------
NM_023076chr1642263 877 508 328 ------
NM_023923chr153578 3289 3052 482 350 32962 2806 168 13769 --
NM_023929chr841763 1727 996 564 22725 575 ----
NM_024046chr31448 --31124 270 159 --
NM_024052chr1742892 1038 953 225 --2561 198 --
NM_024061chr71636 ------
NM_024077chr9----1632 --
NM_024312chr1221145 97 --1375 --
NM_024321chr19------1110
NM_024345chr975841 5807 5499 4211 1483 610 585 --35140 2051 1223 --
NM_024408chr132594 906 573 21128 612 11262 1171
NM_024423chr1842720 1616 1079 448 --13717 --
NM_024430chr1861324 1220 1192 547 401 191 11515 ----
NM_024511chr453527 2341 2304 998 865 32640 532 343 ----
NM_024523chr731089 423 128 --11119 --
NM_024524chr372946 2777 2688 2215 740 100 65 ----12739
NM_024525chr11651 ------
NM_024529chr12411 199 --1883 --
NM_024539chrX4847 816 215 65 ------
NM_024548chr321601 642 --1479 --
NM_024551chr1241962 1679 1002 340 1982 12580 --
NM_024551chr1241962 1679 1002 340 1982 12580 --
NM_024556chr111380 ------
NM_024557chr1131678 1490 1333 ------
NM_024561chr132374 207 ----1927
NM_024567chr8----1103 --
NM_024569chr11946 21065 491 ----
NM_024582chr41880 ------
NM_024594chr521756 1306 ------
NM_024595chr12305 264 ------
NM_024598chr161979 ----11332
NM_024613chr811413 --11389 --
NM_024617chr91584 1182 --1299
NM_024624chr22644 596 11184 ----
NM_024639chr611958 ------
NM_024645chr8----21415 633 --
NM_024646chr13282 203 119 22718 2559 1159 13753
NM_024665chr374499 4203 3933 1826 826 414 323 --23711 529 --
NM_024700chr13789 129 50 ----1246
NM_024705chr132997 256 --1843 --
NM_024713chr1531582 1513 77 ------
NM_024721chr851820 1742 973 662 604 22537 2504 ----
NM_024740chr1184200 4024 3736 3370 2952 1429 1079 718 ----12778
NM_024755chr151627 ------
NM_024757chr941097 906 320 292 --11110 --
NM_024761chr934310 3492 495 24131 3910 ----
NM_024762chr192377 166 ------
NM_024769chr1121013 942 ------
NM_024798chr1512360 1486 ----
NM_024811chr1131749 322 281 ------
NM_024830chr52829 321 ------
NM_024834chr10------1366
NM_024837chr153690 611 516 11882 11215 --
NM_024920chr441288 643 417 292 ------
NM_024927chr171200 ------
NM_024947chr3109207 8215 7514 6235 5924 1948 682 638 583 33 58079 3646 3510 2681 1637 16666 --
NM_024949chr454757 4358 3328 1219 825 13651 23682 3634 11937
NM_024963chr775751 4896 4581 4082 2128 1872 531 24543 2189 11815 128
NM_024969chr21701 --1184 --
NM_024971chr9166 ------
NM_024989chr2137450 7347 6658 6389 6326 6247 3072 2842 2721 1589 1430 442 283 22393 2205 28131 5935 1350
NM_024991chr1032962 884 475 --22667 2116 --
NM_024993chr211323 ------
NM_025054chr823274 2992 1293 11059 --
NM_025126chr122688 502 ------
NM_025133chr23909 852 803 ----1986
NM_025134chr1662473 2130 1734 1036 554 184 22417 1869 ----
NM_025135chr182370 107 ------
NM_025138chr1311188 ------
NM_025146chr352644 2561 2116 859 606 ------
NM_025160chr193944 3200 2976 1550 1441 1286 1233 423 392 12635 23434 755 --
NM_025179chr144216 3574 3055 166 24280 62 14202 --
NM_025181chr23780 113 98 1226 ----
NM_025203chr221403 1270 --1188 --
NM_025208chr1132041 1927 1599 1138 11946 --
NM_025211chr9198 ------
NM_025214chr1812569 275 45 ----
NM_025222chr341166 956 605 463 --12566 13049
NM_025268chr141395 ------
NM_030621chr1474183 3559 1323 1103 870 690 640 --11504 --
NM_030625chr1032361 939 283 1969 ----
NM_030627chr541444 432 420 108 --11305 --
NM_030629chr162602 126 ----11613
NM_030637chr142191 104 ------
NM_030647chr796116 5404 4419 3994 1405 514 251 93 43 1549 34267 4233 1298 25587 5036
NM_030648chr455345 5196 4618 1462 644 ------
NM_030652chr61281 ------
NM_030660chr1421269 975 11337 ----
NM_030670chr122573 498 2467 207 --22130 54
NM_030671chr122573 498 2467 207 --22130 54
NM_030674chr12105031 4494 4484 3978 3865 1689 1566 1203 1165 1056 11273 1307 --
NM_030751chr1051701 1639 680 576 242 ------
NM_030751chr1051701 1639 680 576 242 ------
NM_030755chr1431082 563 111 12465 22769 2693 --
NM_030759chr101639 ------
NM_030761chr112709 11728 168 --
NM_030762chr1221358 1317 --1626 --
NM_030763chrX1159 1346 1836 --
NM_030780chr831201 519 148 1262 ----
NM_030791chr141708 ------
NM_030806chr1109183 6729 5876 5802 5710 3155 2164 1914 1858 455 --26529 3247 --
NM_030810chr631548 1514 191 ------
NM_030813chr112926 917 ----1112
NM_030816chr132677 951 902 ------
NM_030820chr61299 1695 1947 --
NM_030881chr2262331 1942 1812 889 796 211 ------
NM_030884chr312300 ------
NM_030885chr312306 ------
NM_030918chr165234 4260 4209 1516 550 170 34568 2044 2021 1263 --
NM_030920chr13398 372 168 ------
NM_030923chr23702 257 43 ------
NM_030925chr132328 48 --21310 555 --
NM_030933chr1--184 ----
NM_030938chr1721061 134 --1439 --
NM_030939chr6148 --11168 --
NM_030953chr5--11399 --11384
NM_030954chr81357 ------
NM_030963chr61230 1588 ----
NM_031157chr121209 ------
NM_031216chr1831388 626 192 12121 ----
NM_031243chr731952 1809 1740 1346 1257 22336 828
NM_031244chr611125 ------
NM_031267chr72563 392 --1475 --
NM_031268chr1665396 5123 1906 1102 752 338 ------
NM_031271chr831373 1357 455 ------
NM_031283chr21146 ------
NM_031292chr1231432 1193 1075 11295 --11503
NM_031305chr42639 290 ------
NM_031314chr1421940 1420 2558 216 ----
NM_031369chr42632 278 ------
NM_031370chr42632 278 ------
NM_031411chr52253 35 ------
NM_031418chr1142588 986 697 502 --1391 1256
NM_031427chr1465949 5224 4404 578 340 105 25127 3745 --1250
NM_031431chr1361768 1513 1338 1181 67 60 ------
NM_031435chr1233276 2336 997 ------
NM_031442chrX43008 2312 1975 110 12231 --13153
NM_031443chr71326 ------
NM_031453chr1032300 754 353 12386 12239 --
NM_031476chr1662658 2266 1100 1065 923 240 32078 911 446 ----
NM_031483chr2032609 1206 496 1308 ----
NM_031844chr153891 3457 1612 534 182 ------
NM_031845chr243210 2348 1452 1029 22881 2687 12712 1736
NM_031847chr243210 2348 1452 1029 22881 2687 12712 1736
NM_031849chr52253 35 ------
NM_031857chr52253 35 ------
NM_031858chr171225 ------
NM_031860chr52253 35 ------
NM_031862chr171225 ------
NM_031892chrX2290 140 ------
NM_031922chr62422 358 ------
NM_031942chr271008 1002 977 860 300 276 57 1499 2878 204 --
NM_031989chr122304 69 --1119 --
NM_032012chr963713 3372 1590 1233 1092 586 1259 13574 --
NM_032042chr522788 729 ------
NM_032047chr322429 1730 --1500 --
NM_032050chr221917 --1280 --
NM_032088chr5--21218 86 1667 --
NM_032092chr5--21218 86 1667 --
NM_032102chr1163131 1207 1195 724 142 65 ------
NM_032147chr122877 400 ------
NM_032153chr342403 1108 939 462 ------
NM_032160chr1854325 4231 4173 673 243 23826 3637 11285 --
NM_032182chr102337 290 21291 192 ----
NM_032186chr13942 169 29 ------
NM_032195chr211524 ------
NM_032199chr1063834 3689 3036 2434 1279 207 ------
NM_032208chr243109 2238 878 60 --33019 743 623 --
NM_032211chr1021031 824 1878 1324 --
NM_032221chr2061808 1637 1436 305 205 41 21268 171 --11386
NM_032228chr1122368 767 ------
NM_032229chr1321102 199 ------
NM_032239chr42283 170 ----11143
NM_032272chr81493 ------
NM_032283chr131868 1555 110 ------
NM_032288chr362179 1775 1670 840 724 708 1626 --11557
NM_032291chr131745 1731 1371 21329 794 ----
NM_032312chr21732 ------
NM_032354chr171224 --31049 889 859 --
NM_032373chr10135662 5448 4877 4609 4370 4161 1325 1270 1251 1229 1218 627 371 11002 ----
NM_032403chr5--21218 86 1667 --
NM_032408chr721132 795 --1489 --
NM_032410chr81171 1898 ----
NM_032433chr1931553 1357 1273 ------
NM_032435chr131922 492 440 11685 ----
NM_032439chr10--11559 11676 --
NM_032440chr1062822 2545 2390 1988 1923 1065 1772 ----
NM_032445chr1532000 696 573 ----1505
NM_032446chr51403 ------
NM_032449chr162286 2188 1837 261 146 94 ------
NM_032457chr443887 3669 1179 317 23265 1092 1734 12842
NM_032458chrX53404 3262 3056 2935 1229 11204 1550 --
NM_032494chr2----2571 543 --
NM_032499chr1521094 164 ------
NM_032503chr631003 734 225 --1373 --
NM_032505chr372663 1857 1774 936 727 638 580 21126 563 ----
NM_032509chr842045 1744 452 88 21687 546 --11823
NM_032539chrX1682 ------
NM_032558chr91551 11094 ----
NM_032560chr142994 92 --1416 --
NM_032562chr102103 67 ------
NM_032590chr123769 320 128 ------
NM_032598chr17140 ------
NM_032622chr42994 80 ------
NM_032632chr1451807 1768 1538 465 435 ------
NM_032682chr352803 2455 2295 1462 104 ------
NM_032689chr1921077 116 --1178 --
NM_032704chr12198 ------
NM_032727chr101550 --11396 1123
NM_032741chr63997 891 330 --2651 217 --
NM_032765chr52188 92 ----1863
NM_032778chr333359 1143 92 --12805 --
NM_032802chr152228 95 ------
NM_032826chr754448 1750 1527 1448 301 24050 1186 13387 --
NM_032833chr122406 776 11951 ----
NM_032838chr193842 253 228 ------
NM_032859chr1393561 3137 2695 1127 905 839 712 276 240 11139 ----
NM_032867chr111458 --1429 --
NM_032870chr61100 1127 ----
NM_032875chr174791 742 726 67 ------
NM_032876chr1451993 1967 1602 351 233 1517 ----
NM_032924chr71460 141 ----
NM_032932chr1776471 1766 1705 1681 1669 1143 729 11585 21336 888 --
NM_032968chrX31710 522 499 ------
NM_032969chrX31710 522 499 ------
NM_032973chrY31704 522 499 ------
NM_032978chr18174 2953 264 --1275
NM_032979chr18174 2953 264 --1275
NM_032981chr18174 2953 264 --1275
NM_032983chr762914 2857 2822 2716 2458 2356 --144 --
NM_032998chr11300 --11143 --
NM_033008chr31564 --1182 --
NM_033009chr31564 --1182 --
NM_033010chr31564 --1182 --
NM_033020chr164504 3935 3768 3606 3307 895 1220 24652 880 --
NM_033025chr192869 746 --1169 --
NM_033030chr211458 ------
NM_033055chr11172 ------
NM_033081chr2041495 1206 474 309 1453 1970 --
NM_033082chr121157 ------
NM_033121chr12--1689 ----
NM_033129chr201597 --1465 --
NM_033133chr1742926 2632 1082 750 13512 21294 1265 --
NM_033135chr1132041 1927 1599 1138 11946 --
NM_033136chr541200 416 367 221 --1171 --
NM_033137chr541200 416 367 221 --1171 --
NM_033138chr732076 1446 172 11576 ----
NM_033139chr732076 1446 172 11576 ----
NM_033140chr732076 1446 172 11576 ----
NM_033143chr464627 4592 3358 3243 379 320 24117 2872 ----
NM_033157chr732076 1446 172 11576 ----
NM_033181chr633487 864 146 1247 21200 1013 --
NM_033196chr1921459 137 11560 ----
NM_033208chr161125 ------
NM_033211chr521340 750 ------
NM_033222chr921375 531 ------
NM_033224chr788058 6809 6614 5994 5573 5541 1164 810 76506 5912 5476 2882 2290 1149 774 --26319 5562
NM_033225chr832499 2433 1987 ------
NM_033226chr162603 61 ------
NM_033285chr874471 4344 4289 3884 3365 3082 2740 ----13667
NM_033300chr111064 ------
NM_033326chr11--3628 606 295 --1921
NM_033331chr933291 2244 1415 1250 ----
NM_033360chr1274273 3763 3080 2870 1240 1029 969 11161 11856 --
NM_033380chrX31001 366 194 ------
NM_033381chrX31001 366 194 ------
NM_033421chr2031844 1649 1392 2748 726 21758 425 --
NM_033425chr1143469 1253 1014 96 --22416 2355 --
NM_033430chr483910 3822 2920 2768 2720 1625 1444 64 ------
NM_033437chr483910 3822 2920 2768 2720 1625 1444 64 ------
NM_033512chr822576 2308 32902 2707 2287 ----
NM_033515chr61253 ------
NM_033516chr92290 44 ----1603
NM_033535chr411148 ----1239
NM_033540chr311025 --11122 --
NM_033624chr1232133 656 270 1297 ----
NM_033631chr143711 3284 2885 1353 --31438 622 408 --
NM_033632chr431462 1288 1247 ----11209
NM_033637chr1063359 3112 2672 960 402 191 12614 33524 1005 115 --
NM_033642chrX21180 925 ------
NM_033644chr532287 792 38 11859 ----
NM_033645chr532287 792 38 11859 ----
NM_033656chr2185970 5946 5695 5561 4397 3846 2066 376 ------
NM_044472chr12650 549 ------
NM_048368chr181768 --1197 --
NM_052811chr1395054 4907 4749 3334 2075 1555 1415 389 23 --11145 --
NM_052818chr1331942 122 54 12178 2225 43 --
NM_052820chr9----1197 1462
NM_052834chr1841819 1721 1692 710 ------
NM_052840chr15--1458 11620 --
NM_052851chr1311633 12028 ----
NM_052865chr202677 45 1909 1342 --
NM_052879chr1283838 3592 3370 3308 1260 964 720 639 ------
NM_052885chr1274636 4242 3958 1553 872 451 265 13455 11648 --
NM_052886chr81264 136 1498 --
NM_052900chr831585 651 232 11195 11412 --
NM_052904chr621372 906 ------
NM_052905chr221510 1355 ----1567
NM_052918chr1053520 2273 1174 1156 1056 ----11247
NM_052923chr61193 ------
NM_052927chr532255 340 132 --21749 1514 --
NM_052951chr201211 ------
NM_052953chr3----1114 --
NM_052965chr11229 ------
NM_052966chr131139 322 24 11435 ----
NM_052998chr1------1167
NM_053002chr321205 833 --11043 --
NM_053016chr9117421 7023 6700 6538 5491 1746 1614 1574 1326 958 512 --17064 12142
NM_053023chr1133015 2485 890 --1733 --
NM_053024chr321494 1177 171 ----
NM_053025chr321544 559 21468 1422 125 --
NM_053026chr321544 559 21468 1422 125 --
NM_053027chr321544 559 21468 1422 125 --
NM_053028chr321544 559 21468 1422 125 --
NM_053031chr321544 559 21468 1422 125 --
NM_053032chr321544 559 21468 1422 125 --
NM_053043chr765847 5167 2425 645 437 98 22003 1190 16437 --
NM_053056chr1122055 1079 ------
NM_053064chr1442638 2504 2377 2041 ------
NM_053067chr91296 ------
NM_053281chrX286 49 ------
NM_054016chr131335 1238 185 ------
NM_054016chr131335 1238 185 ------
NM_054016chr131335 1238 185 ------
NM_054025chr1122245 2077 ------
NM_057159chr921167 1050 ------
NM_057168chr721152 137 11293 11640 --
NM_057175chr462504 1771 1763 980 663 642 --1200 1694
NM_057178chr1741116 674 480 441 22845 899 12212 1328
NM_058170chr1--11489 ----
NM_058172chr41567 ------
NM_079421chr191121 --1488 --
NM_080491chr1111092 23475 443 13716 1117
NM_080546chr92830 512 ------
NM_080552chr201131 ------
NM_080594chr16153 ------
NM_080599chr102991 106 1408 11149 --
NM_080629chr111541 --11065 11392
NM_080630chr111541 --11065 11392
NM_080645chr661718 1540 700 289 205 35 --1781 --
NM_080654chr113473 74 22 ------
NM_080664chr1471895 1753 1635 1519 785 512 322 ------
NM_080671chr222144 64 11735 21424 844 --
NM_080676chr2053099 2728 2332 671 198 1970 ----
NM_080759chr13----11908 --
NM_080760chr13----11908 --
NM_080764chr2242379 1267 955 513 1322 --12536
NM_080798chr10165 ------
NM_080799chr10165 ------
NM_080800chr10165 ------
NM_080801chr10165 ------
NM_080802chr10165 ------
NM_080803chr10165 ------
NM_080804chr10165 ------
NM_080805chr10165 ------
NM_080806chr10165 ------
NM_080807chr10165 ------
NM_080808chr10165 ------
NM_080809chr10165 ------
NM_080810chr10165 ------
NM_080811chr10165 ------
NM_080812chr10165 ------
NM_080813chr10165 ------
NM_080814chr10165 ------
NM_080815chr10165 ------
NM_080821chr2021532 434 --22014 357 --
NM_080867chr1454938 4128 3776 3586 1139 21840 1706 14694 --
NM_080872chr854011 3717 3352 3094 1104 13207 ----
NM_080927chr342693 2607 1109 415 31061 746 646 ----
NM_080928chr72280 116 ------
NM_130391chr942783 780 183 57 --1750 --
NM_130392chr942783 780 183 57 --1750 --
NM_130393chr942783 780 183 57 --1750 --
NM_130434chr15----1872 --
NM_130435chr1031884 1047 548 --22777 503 12806
NM_130436chr2162613 2462 2440 2365 1766 743 ------
NM_130438chr2163190 3039 3017 2942 2343 1320 ------
NM_130439chr1022045 504 --191 --
NM_130439chr1022045 504 --191 --
NM_130787chr19163 ------
NM_130795chr92652 492 ------
NM_130809chr543121 1188 1037 88 12234 22288 427 12276
NM_130811chr2021165 186 1252 ----
NM_130838chr1531298 1284 537 ------
NM_130839chr1531298 1284 537 ------
NM_133170chr20167810 7756 6843 6720 6562 6160 5747 5619 2490 2149 2005 1312 933 677 513 173 --26069 5902 11698
NM_133171chr202843 164 ------
NM_133264chr1732785 1377 271 12926 23712 949 --
NM_133265chrX31389 939 174 1499 43228 2875 2490 578 1947
NM_133326chr12239 32 ------
NM_133329chr21154 ------
NM_133330chr41972 --21136 840 --
NM_133331chr41972 --21136 840 --
NM_133334chr455365 5231 5092 4695 544 13894 ----
NM_133335chr41972 --21136 840 --
NM_133338chr52355 106 ------
NM_133339chr52355 106 ------
NM_133340chr52355 106 ------
NM_133341chr52355 106 ------
NM_133342chr52355 106 ------
NM_133343chr52355 106 ------
NM_133344chr52355 106 ------
NM_133367chr633153 2596 601 13293 ----
NM_133370chr443439 1379 1229 1074 12865 33637 3066 550 --
NM_133372chr512294 21829 305 ----
NM_133378chr21307 ------
NM_133432chr21307 ------
NM_133433chr53747 306 91 --1683 --
NM_133437chr21307 ------
NM_133443chr1642034 1892 1833 762 ------
NM_133445chr91189 --23786 2673 --
NM_133507chr122328 85 ------
NM_133625chr31918 ----1176
NM_133631chr31503 ------
NM_133634chr2111660 ----1224
NM_133646chr274772 4249 4152 3769 2216 1680 69 14858 --11989
NM_133647chr1573628 3156 2730 2531 2388 812 234 13290 11330 --
NM_134427chr92652 492 ------
NM_138270chrX22237 628 13399 11125 13285
NM_138285chr21524 ------
NM_138288chr1431581 548 211 31888 1591 1442 --12227
NM_138316chr1011353 --11110 --
NM_138335chr42574 129 ------
NM_138348chr5146308 5946 5436 5415 5355 4618 4348 1957 925 507 435 300 182 83 11555 24794 2372 --
NM_138350chr121376 1049 ------
NM_138357chr1021373 736 --2487 237 --
NM_138423chr1542197 2083 730 439 ------
NM_138426chr721880 173 ------
NM_138444chr1394797 4351 4169 3892 1945 1461 1190 860 320 21346 695 1511 --
NM_138459chr653636 3334 2705 1399 315 ------
NM_138468chr275156 4956 4778 2022 1937 546 441 ------
NM_138473chr1275162 5041 4216 4191 3691 1025 973 15153 34569 4323 262 --
NM_138554chr952597 2212 644 330 203 ------
NM_138558chr13871 773 452 ------
NM_138576chr1454394 3062 1630 1570 566 --33942 3929 3469 --
NM_138609chr53148 110 48 ------
NM_138610chr53148 110 48 ------
NM_138633chr621701 99 1237 ----
NM_138694chr643564 3187 415 261 --12311 13357
NM_138713chr16128145 6791 6703 6542 2657 1900 1356 1204 1068 515 307 247 27905 5097 12375 1829
NM_138714chr16128145 6791 6703 6542 2657 1900 1356 1204 1068 515 307 247 27905 5097 12375 1829
NM_138717chr61644 ------
NM_138727chr11783 ----1945
NM_138728chr11783 ----1945
NM_138730chr61343 ------
NM_138732chr112960 924 ------
NM_138734chr112960 924 ------
NM_138766chr53517 178 107 ------
NM_138775chr111526 1137 ----
NM_138782chr51840 1338 12065 --
NM_138821chr53517 178 107 ------
NM_138822chr53517 178 107 ------
NM_138931chr32801 324 ------
NM_138959chr176473 5407 5354 4983 4202 2715 897 14395 12182 --
NM_138962chr17170 ------
NM_138967chr152700 286 --22119 468 --
NM_138970chr1422263 2174 ------
NM_138971chr1143357 3094 2987 468 1351 ----
NM_138971chr1143357 3094 2987 468 1351 ----
NM_138972chr1143357 3094 2987 468 1351 ----
NM_138972chr1143357 3094 2987 468 1351 ----
NM_138973chr1143357 3094 2987 468 1351 ----
NM_138973chr1143357 3094 2987 468 1351 ----
NM_139015chr1241369 1236 400 347 --1435 1455
NM_139053chr11101 ------
NM_139068chr5----295 27 --
NM_139069chr5----295 27 --
NM_139072chr21328 ------
NM_139136chr121690 1374 1320 --
NM_139157chr112464 286 ------
NM_139164chr51553 21415 1332 11337 1577
NM_139168chr51428 ------
NM_139169chr1011513 21896 368 1302 1142
NM_139201chr121633 ------
NM_139215chr171189 ------
NM_139244chr61744 ------
NM_139276chr1731824 1786 860 --11466 --
NM_139283chr1262160 1859 693 573 472 122 12334 11952 --
NM_139312chr102155 65 --1453 --
NM_139316chr72745 674 --1873 --
NM_139321chr2023003 2898 1682 12872 --
NM_144488chr92652 492 ------
NM_144489chr92652 492 ------
NM_144563chr22231 36 ----1156
NM_144563chr22231 36 ----1156
NM_144567chr121062 961 1772 --12598
NM_144571chr426470 6353 31645 1456 963 15390 --
NM_144578chr1454736 4255 1855 1601 1150 ------
NM_144586chr2179 ------
NM_144590chr1042481 2360 507 232 --22911 421 --
NM_144604chr161126 1494 ----
NM_144632chr22349 247 22364 1900 ----
NM_144633chr331431 1314 55 11404 ----
NM_144642chr33468 309 129 --11376 --
NM_144643chr4----1373 --
NM_144645chr41196 ------
NM_144657chrX1260 1253 132 --
NM_144664chr1142115 2090 1756 395 ------
NM_144668chr121140 ------
NM_144710chr221448 323 ------
NM_144720chr4149 ------
NM_144721chr422679 2131 21089 612 ----
NM_144767chr1574638 4524 4316 1675 1563 477 81 ------
NM_144778chr135881 863 741 362 301 21842 1069 ----
NM_144949chr272600 2427 1852 1705 773 738 247 ------
NM_144963chr822531 731 ------
NM_144982chr121730 ------
NM_144992chr22529 483 ------
NM_144997chr172422 84 21073 882 ----
NM_145005chr92735 216 --1821 --
NM_145012chr1021024 40 ------
NM_145025chr61109 --1880 --
NM_145049chr52730 131 ------
NM_145055chr1883340 2982 2812 2660 1448 928 556 344 --12350 --
NM_145117chr1153003 2514 2291 1021 898 32784 2040 475 --13301
NM_145159chr142234 91 ------
NM_145206chr1012618 --12552 --
NM_145259chr256805 6032 5563 2179 571 12580 14863 --
NM_145280chr23328 202 143 --1292 --
NM_145284chrX11799 1435 ----
NM_145307chr1074588 4231 3987 3248 2918 1666 1137 13498 21174 227 --
NM_145320chr753390 3333 921 904 885 --22605 1189 --
NM_145321chr753390 3333 921 904 885 --22605 1189 --
NM_145322chr753390 3333 921 904 885 --22605 1189 --
NM_145331chr61629 ------
NM_145332chr61777 ------
NM_145333chr61777 ------
NM_145341chr1031741 1208 687 ----123
NM_145686chr262804 1344 1146 907 173 39 ------
NM_145687chr262804 1344 1146 907 173 39 ------
NM_145716chr12606 545 1173 ----
NM_145756chr1831305 464 439 ------
NM_145793chr103371 253 90 ------
NM_145808chr722557 2113 --12266 --
NM_145810chr271008 1002 977 860 300 276 57 1499 2878 204 --
NM_145891chr1621386 1333 11742 ----
NM_145892chr1621386 1333 11742 ----
NM_145893chr1631508 1455 59 11864 ----
NM_145913chr121664 --1726 --
NM_147175chrX11461 --11748 --
NM_147223chr222118 851 ------
NM_147233chr221935 668 ------
NM_148174chr83368 339 224 ------
NM_148571chr171317 --1583 1474
NM_148894chr411033 ----1919
NM_148898chr7--1399 ----
NM_148899chr7--1399 ----
NM_148921chr1752147 1987 1802 658 313 ----1627
NM_148955chr1585293 4235 2557 2272 1114 1092 802 206 34982 823 587 25749 1511 --
NM_148977chr1011353 --11110 --
NM_148978chr1011353 --11110 --
NM_152244chr173421 325 274 ------
NM_152261chr1242320 2290 287 280 2894 425 ----
NM_152265chr121292 225 ------
NM_152275chr221513 504 ------
NM_152280chr183000 2706 2462 2236 1355 1003 440 250 ------
NM_152282chr32994 916 --1507 11165
NM_152283chr5122 1714 ----
NM_152284chr82652 619 2635 609 ----
NM_152289chr1941405 1150 1142 412 --21274 608 11608
NM_152300chr1711792 21478 85 --1169
NM_152309chr102634 362 --21996 50 --
NM_152330chr1422081 862 --11917 --
NM_152332chr1441807 1032 947 372 --22094 1124 12654
NM_152344chr1721251 1188 --11317 --
NM_152375chr132429 1969 338 2743 177 ----
NM_152380chr121488 51 --1555 --
NM_152384chr231930 594 167 12013 ----
NM_152387chr21225 ------
NM_152388chr223803 2803 13215 12606 --
NM_152391chr221042 104 ------
NM_152399chr4----155 --
NM_152400chr4--3739 694 413 ----
NM_152409chr533536 2812 2418 12867 22309 1374 --
NM_152414chr831522 1409 191 ------
NM_152424chrX63936 3559 3098 1446 1012 236 --33210 3080 1174 --
NM_152437chr1222304 1651 ------
NM_152441chr121256 --1534 --
NM_152450chr155778 207 197 160 33 ------
NM_152455chr1572742 2647 2304 1811 964 177 57 2743 640 ----
NM_152470chr1863542 2664 2599 1335 525 396 --11400 --
NM_152478chr192438 107 ----1461
NM_152520chr2180 ------
NM_152549chr51474 1147 ----
NM_152556chr712098 2941 190 ----
NM_152574chr92296 113 ------
NM_152594chr1542363 1881 944 484 21890 1500 ----
NM_152605chr19----11312 --
NM_152608chr172378 2145 1936 1580 874 695 458 ----1506
NM_152622chr583328 3077 2513 1180 911 783 612 73 23383 3153 ----
NM_152624chr565932 2907 2314 1719 1016 795 46577 6055 5463 4697 35553 5098 1917 --
NM_152629chr952847 2708 2569 1566 1253 1495 11592 --
NM_152630chrX31307 1296 61 ------
NM_152641chr1242703 1940 832 601 2459 81 11881 12418
NM_152647chr15159 ------
NM_152665chr111022 11148 ----
NM_152678chr332260 588 506 11707 22026 694 --
NM_152694chrX1317 ------
NM_152699chr343401 2897 2708 192 21447 532 ----
NM_152709chr101300 ------
NM_152713chr11193 ------
NM_152716chr1131619 1032 116 ------
NM_152737chr651589 1447 793 590 243 1575 11994 1721
NM_152745chr731117 884 426 11191 ----
NM_152756chr564053 3885 3474 2855 1403 233 23333 244 ----
NM_152758chr822725 786 ------
NM_152780chrX2512 223 11205 ----
NM_152787chrX73220 3078 2534 2446 1394 1258 376 23100 2419 13783 --
NM_152793chr784670 4320 4284 3369 1536 1424 953 414 14727 14211 14861
NM_152826chr1585293 4235 2557 2272 1114 1092 802 206 34982 823 587 25749 1511 --
NM_152835chr132444 2130 287 12954 12002 --
NM_152836chr821489 706 ------
NM_152837chr821489 706 ------
NM_152838chr2033535 1145 801 12461 --13087
NM_152857chr61372 1340 ----
NM_152858chr61372 1340 ----
NM_152860chr1211534 --2402 44 --
NM_152890chr121127 409 --11097 --
NM_152924chr15116225 5878 5857 5171 2628 1965 1365 1117 1061 301 74 11833 1837 1264
NM_152991chr111457 ------
NM_152998chr7194 ------
NM_152999chr774424 3700 3604 1957 1863 1448 1423 --13563 1697
NM_153000chr183647 549 181 ------
NM_153020chr6--11365 ----
NM_153035chr162968 2203 2143 1139 669 578 ----12312
NM_153038chr22747 195 ------
NM_153182chr333359 1143 92 --12805 --
NM_153183chrX2843 297 ------
NM_153184chr321429 382 11517 ----
NM_153188chr5115272 4927 4909 4100 3894 2203 1749 993 981 861 298 --148 --
NM_153207chr1242902 2854 1530 1345 12924 --151
NM_153256chr101564 41519 1293 654 364 ----
NM_153260chr152518 211 1372 ----
NM_153261chr161308 11534 ----
NM_153262chr142328 1127 1077 726 ----12115
NM_153273chr341083 840 826 551 1910 11744 1465
NM_153362chr61905 1237 ----
NM_153367chr1032615 1483 884 21063 249 21249 948 --
NM_153371chr1332342 1920 682 --1202 1495
NM_153426chr42557 545 ------
NM_153427chr42557 545 ------
NM_153490chr171256 ------
NM_153499chr1232872 967 495 32832 1998 597 11196 --
NM_153500chr1232872 967 495 32832 1998 597 11196 --
NM_153607chr532337 2288 949 12535 ----
NM_153616chr1522195 480 --1863 --
NM_153617chr1522195 480 --1863 --
NM_153618chr1522195 480 --1863 --
NM_153619chr1543433 2399 440 176 ------
NM_153620chr731333 1135 259 11524 1491 --
NM_153633chr122675 625 ------
NM_153634chr1231153 1135 106 --1367 --
NM_153685chr12--11216 ----
NM_153686chr432472 1849 678 12381 --1804
NM_153689chr22820 104 --11727 --
NM_153702chr41243 ------
NM_153704chr81406 ------
NM_153712chr232596 1067 806 --12993 --
NM_153748chr121690 1374 1320 --
NM_153759chr221178 790 --11191 --
NM_153764chr113985 347 34 1313 --1794
NM_153765chr113985 347 34 1313 --1794
NM_153766chr113985 347 34 1313 --1794
NM_153767chr113985 347 34 1313 --1794
NM_153810chr1054900 1704 1426 1189 525 --14212 --
NM_153812chr131685 1673 446 --1707 --
NM_153828chr22374 306 ----1107
NM_170601chr1111071 168 ----
NM_170606chr71616 1338 ----
NM_170665chr1274549 4291 3373 1060 640 488 444 11246 ----
NM_170672chr21337 1682 11342 --
NM_170696chr1531522 1480 1280 --21358 179 --
NM_170697chr1531522 1480 1280 --21358 179 --
NM_170706chr174125 4044 3997 3461 1543 561 202 33557 1575 887 21642 1335 --
NM_170711chr191907 ------
NM_170719chr1311188 ------
NM_170721chr1721086 1041 ------
NM_170751chr611260 ------
NM_170752chr611260 ------
NM_171998chrX1802 1406 ----
NM_172037chr831107 581 453 ------
NM_172058chr831555 1484 1466 --2134 69 --
NM_172059chr831555 1484 1466 --2134 69 --
NM_172060chr831555 1484 1466 --2134 69 --
NM_172069chr231974 1929 136 ------
NM_172070chr211776 ------
NM_172071chr166318 5760 4939 1917 1486 43 36998 6211 1049 36417 2574 1335 14587
NM_172103chr642676 2257 1056 1010 1991 12369 --
NM_172105chr642676 2257 1056 1010 1991 12369 --
NM_172127chr432052 1387 337 --1499 --
NM_172128chr432008 1343 293 --1455 --
NM_172130chr141749 722 200 47 --131 --
NM_172216chr1232774 869 397 32734 1900 499 11098 --
NM_172226chr1232872 967 495 32832 1998 597 11196 --
NM_172337chr14162 ------
NM_172344chr21154 ------
NM_172373chr132405 285 ------
NM_173075chr421413 1281 1362 ----
NM_173082chr63527 134 89 ------
NM_173167chr1792738 2678 2560 2251 2131 2005 596 463 158 32115 731 116 ----
NM_173171chr22304 292 ----198
NM_173172chr231080 612 600 ----1406
NM_173173chr22304 292 ----198
NM_173198chr922910 639 ------
NM_173200chr922910 639 ------
NM_173214chr16128145 6791 6703 6542 2657 1900 1356 1204 1068 515 307 247 27905 5097 12375 1829
NM_173355chr21223 1270 ----
NM_173468chr455124 3923 1469 1434 1234 34300 3683 1033 25791 1958 --
NM_173469chr1511196 ------
NM_173470chrX82425 2217 1991 1022 840 524 474 198 --11039 --
NM_173475chr161626 --1434 --
NM_173478chr172855 98 ------
NM_173495chrX22493 285 --32058 653 184 --
NM_173508chr121157 94 --11222 --
NM_173511chr243605 2875 1299 801 42569 2518 1427 239 33756 3367 2789 12587
NM_173517chr7150 --1182 130
NM_173519chr82370 158 1440 ----
NM_173542chr121579 ------
NM_173560chr6--1229 ----
NM_173582chr1186328 5895 5693 5484 5009 2446 1132 993 --36185 5768 1552 --
NM_173595chr1264472 4293 4269 1601 1539 1331 --14306 11662
NM_173602chr1283369 3296 3123 2913 2360 1036 862 359 --13093 --
NM_173609chr151751 ------
NM_173642chr156449 5808 3179 2172 777 17996 22675 1611 --
NM_173644chr2031661 1490 1273 158 ----
NM_173647chr221082 856 ------
NM_173683chr811447 1489 1705 --
NM_173794chrX192 1427 167 --
NM_173797chr531225 1169 533 153 ----
NM_173808chr143700 2793 1173 73 ----13873
NM_173814chr151423 ------
NM_173822chr2--11469 --12161
NM_173825chr372983 2727 1236 1182 737 429 43 ------
NM_173826chr31108 1543 --1385
NM_173834chrX1368 ------
NM_173848chr82668 150 ----1260
NM_173854chr112052 12243 --1251
NM_174887chr171321 ------
NM_174890chr101279 ------
NM_174916chr1521569 427 --1919 --
NM_174934chr1153574 2377 1183 298 121 --2552 308 --
NM_175056chr342133 1556 699 296 ------
NM_175061chr721456 702 11487 ----
NM_175607chr33460 249 191 ------
NM_175610chr151106 ------
NM_175612chr33460 249 191 ------
NM_175629chr221178 790 --11191 --
NM_175634chr821190 872 ------
NM_175635chr821190 872 ------
NM_175636chr821190 872 ------
NM_175733chr1112218 ------
NM_175767chr531774 1542 1257 21828 1441 ----
NM_175768chr621713 1326 --1644 --
NM_175848chr2011378 ------
NM_175848chr2011378 ------
NM_175849chr2011378 ------
NM_175849chr2011378 ------
NM_175850chr2011378 ------
NM_175850chr2011378 ------
NM_175852chr142452 2268 284 156 ------
NM_175854chr1332442 1807 860 --12770 --
NM_175859chrX21654 609 --21673 474 --
NM_175862chr341579 1554 969 449 --21382 1001 --
NM_175863chr621016 861 ------
NM_175876chr162727 2572 999 619 529 379 2342 95 11999 --
NM_175907chr1841980 358 259 139 12534 12604 12472
NM_176787chr1831499 1246 995 ------
NM_176812chr201673 ------
NM_176814chr7--1596 1287 --
NM_176863chr1722163 1870 --22084 1537 --
NM_177414chr121172 432 ------
NM_177424chr161917 1392 572 444 143 59 --1324 --
NM_177438chr1474183 3559 1323 1103 870 690 640 --11504 --
NM_177553chr11167 ------
NM_177947chrX31477 400 97 ------
NM_177948chrX31477 400 97 ------
NM_177966chr311903 1352 ----
NM_177974chr1542197 2083 730 439 ------
NM_177990chr2021628 1400 ------
NM_178006chr1311633 12028 ----
NM_178007chr1311633 12028 ----
NM_178011chr1043088 2704 737 461 32867 2365 329 1406 --
NM_178120chr211386 --1382 --
NM_178123chr231019 1007 274 1110 ----
NM_178151chrX65939 5553 5538 4932 2500 1173 22188 2176 65865 5574 5031 1395 922 338 --
NM_178152chrX65939 5553 5538 4932 2500 1173 22188 2176 65865 5574 5031 1395 922 338 --
NM_178153chrX65939 5553 5538 4932 2500 1173 22188 2176 65865 5574 5031 1395 922 338 --
NM_178154chr141746 ------
NM_178155chr141746 ------
NM_178156chr141746 ------
NM_178157chr141746 ------
NM_178423chr711283 ----1446
NM_178425chr711283 ----1446
NM_178426chr141753 1674 1639 1618 ------
NM_178427chr141653 1574 1539 1518 ------
NM_178454chr12675 311 1662 ----
NM_178498chr1133802 1573 299 13894 --13754
NM_178509chr1763766 1223 1216 1161 685 79 1329 ----
NM_178517chr171168 1115 ----
NM_178554chr333483 945 841 ----11181
NM_178565chr821676 1319 ----1524
NM_178584chr221448 323 ------
NM_178586chr1442118 1746 865 577 ------
NM_178812chr81226 1648 ----
NM_178815chr1052635 1922 1869 860 400 ------
NM_178835chr4--127 ----
NM_178864chr112706 248 --1215 --
NM_180989chr1321847 646 1347 ----
NM_181054chr142362 206 ------
NM_181077chr151176 ----11947
NM_181332chrX32667 928 99 ----11836
NM_181351chr1131870 914 460 --12614 1408
NM_181358chr174031 2860 2779 2747 2602 820 193 1570 --13104
NM_181443chr2042117 853 784 300 --12565 --
NM_181453chr231625 1341 1257 1155 ----
NM_181481chr1886839 5617 5251 4834 2450 1936 1854 131 --12173 190
NM_181482chr1886839 5617 5251 4834 2450 1936 1854 131 --12173 190
NM_181483chr1886839 5617 5251 4834 2450 1936 1854 131 --12173 190
NM_181492chr2221260 302 ------
NM_181504chr563557 2842 1020 882 844 78 --11398 --
NM_181521chr1697161 6915 6898 6185 6105 5146 5068 4667 2577 12557 1713 --
NM_181523chr563557 2842 1020 882 844 78 --11398 --
NM_181524chr563557 2842 1020 882 844 78 --11398 --
NM_181537chr17159 ------
NM_181645chr112295 264 ------
NM_181659chr2023227 2249 --12528 13301
NM_181659chr2023227 2249 --12528 13301
NM_181670chr121416 ------
NM_181671chr171811 --1683 --
NM_181672chrX2527 486 11587 1347 --
NM_181673chrX2527 486 11587 1347 --
NM_181674chr51283 ------
NM_181675chr51283 ------
NM_181676chr51283 ------
NM_181677chr51283 ------
NM_181678chr51283 ------
NM_181780chr321378 485 --1454 --
NM_181782chr61538 1422 --22020 914
NM_181784chr241971 1808 1633 956 --21607 630 --
NM_181836chr552530 2194 2011 1020 466 2915 643 ----
NM_181838chr511402 --11311 --
NM_181886chr421123 989 ------
NM_181887chr421123 989 ------
NM_181888chr421123 989 ------
NM_181889chr421123 989 ------
NM_181890chr421123 989 ------
NM_181891chr421123 989 ------
NM_181892chr421170 1036 ------
NM_181893chr421123 989 ------
NM_182314chrX31417 768 741 11282 11689 --
NM_182398chr143165 71 30 ------
NM_182481chr2111303 ------
NM_182482chr2111303 ------
NM_182485chr443650 3380 2491 315 --13394 --
NM_182488chr131769 ------
NM_182522chr331179 887 284 ------
NM_182569chr171110 ------
NM_182641chr1711507 1370 11559 --
NM_182643chr831790 735 566 ------
NM_182646chr443650 3380 2491 315 --13394 --
NM_182648chr142728 183 ------
NM_182666chr3------1130
NM_182678chr21450 ------
NM_182691chr731153 552 187 ------
NM_182692chr731153 552 187 ------
NM_182697chr731431 1369 234 ------
NM_182700chr71674 1719 1734 --
NM_182717chr1021031 113 --11177 --
NM_182720chr1021031 113 --11177 --
NM_182721chr1021031 113 --11177 --
NM_182722chr1021031 113 --11177 --
NM_182723chr1021031 113 --11177 --
NM_182729chr1221573 306 --21620 588 1262
NM_182742chr1221573 306 --21620 588 1262
NM_182743chr1221573 306 --21620 588 1262
NM_182763chr132034 1882 49 --12015 1212
NM_182764chr202843 164 ------
NM_182765chr1031800 739 480 ------
NM_182767chr1211553 --21741 313 --
NM_182789chr541058 341 37 24 ------
NM_182797chr2021720 1319 ------
NM_182830chr1432109 1480 59 22230 2182 ----
NM_182848chr1331522 333 214 11541 ----
NM_182853chr1021031 113 --11177 --
NM_182898chr744303 2016 604 239 45189 2045 1556 1358 ----
NM_182899chr744303 2016 604 239 45189 2045 1556 1358 ----
NM_182918chr2121104 390 2276 176 ----
NM_182920chr311161 ----1549
NM_182931chr72750 613 ------
NM_182948chr112608 12697 --12353
NM_182964chr1153003 2514 2291 1021 898 32784 2040 475 --13301
NM_182976chr12808 548 ------
NM_183011chr1021031 113 --11177 --
NM_183012chr1021031 113 --11177 --
NM_183013chr1021031 113 --11177 --
NM_183043chr13--1359 ----
NM_183044chr13--1359 ----
NM_183047chr201653 1774 ----
NM_183048chr201653 1774 ----
NM_183049chr41320 ------
NM_183065chr171224 --31049 889 859 --
NM_183075chr443009 2234 1842 1068 ------
NM_183079chr2021054 328 ------
NM_183237chr32792 232 1982 --1408
NM_183238chr1243739 3301 3069 294 1430 ----
NM_183323chr541058 341 37 24 ------
NM_183353chrX2385 156 ------
NM_183416chr111578 1158 1198 --
NM_183419chr821004 590 181 11324 --
NM_184234chr203860 666 561 ------
NM_194247chr283754 3720 1719 1557 1309 555 405 207 13771 1446 11492
NM_194250chr21177 ------
NM_194271chr122688 502 ------
NM_194278chr1443834 3354 2917 1505 12632 21012 789 --
NM_194286chr1276157 5243 5222 4678 4585 957 835 34408 4211 1438 25256 1929 14217
NM_194292chr12620 153 196 ----
NM_194314chr184361 4320 3509 1857 1849 1412 1390 104 1339 13888 25416 126
NM_194317chr212744 ------
NM_194318chr1351969 1889 1622 432 280 2834 358 ----
NM_194328chr931011 964 169 11075 ----
NM_194329chr931011 964 169 11075 ----
NM_194330chr931011 964 169 11075 ----
NM_194332chr931011 964 169 11075 ----
NM_194434chr1843605 2308 813 322 21735 1003 14177 --
NM_194442chr121546 1485 11235 --1282
NM_194454chr741363 1290 546 403 ------
NM_194455chr741363 1290 546 403 ------
NM_194456chr741363 1290 546 403 ------
NM_194463chrX4847 816 215 65 ------
NM_197941chr511047 --12122 12440
NM_197970chr211458 ------
NM_198040chr12973 776 ------
NM_198057chrX5998 807 332 192 62 ------
NM_198086chr1451993 1967 1602 351 233 1517 ----
NM_198123chr831585 651 232 11195 11412 --
NM_198124chr831585 651 232 11195 11412 --
NM_198128chr1872306 2021 1782 1759 1539 941 862 12327 1690 --
NM_198158chr341979 734 707 524 ----11127
NM_198159chr341979 734 707 524 ----11127
NM_198177chr341979 734 707 524 ----11127
NM_198178chr341979 734 707 524 ----11127
NM_198186chr92433 406 ------
NM_198187chr92433 406 ------
NM_198217chr131840 21132 254 ----
NM_198218chr131840 21132 254 ----
NM_198219chr131840 21132 254 ----
NM_198240chr1231148 1136 163 ------
NM_198261chr121526 ------
NM_198262chr121526 ------
NM_198268chr174031 2860 2779 2747 2602 820 193 1570 --13104
NM_198269chr174031 2860 2779 2747 2602 820 193 1570 --13104
NM_198270chrX43404 2675 1057 188 189 1212 13438
NM_198279chrX31248 1068 496 1234 1217 --
NM_198336chr781617 1138 644 603 562 273 104 63 ------
NM_198390chr162602 126 ----11613
NM_198391chr20--1169 11309 --
NM_198395chr52191 96 1965 1826 --
NM_198401chr811486 --167 --
NM_198465chrX72879 2307 1864 604 280 90 51 --12763 --
NM_198468chr684481 3514 3389 3030 1361 1082 1076 876 11024 ----
NM_198472chr10----1263 1332
NM_198503chr122226 458 ------
NM_198504chr3149 ------
NM_198513chr821402 372 ------
NM_198549chr132122 1331 655 --12031 --
NM_198552chr11178 --1198 1136
NM_198581chr277511 7330 7064 7041 6451 5492 4863 45682 2465 2145 357 35767 5440 5385 25659 5165
NM_198715chr165287 5121 4498 1035 381 207 --21247 849 13984
NM_198793chr353430 3300 994 336 233 ------
NM_198859chr313717 --13906 14234
NM_198892chr4156 ------
NM_198904chr511804 21935 45 ----
NM_198956chr71674 1719 1734 --
NM_198990chr742777 2523 2420 990 22842 2140 13090 22453 1256
NM_198991chr181652 ------
NM_199003chr821139 36 1356 ----
NM_199040chr1263288 2414 2359 901 316 294 33709 2826 1450 --23275 39
NM_199051chr12219 65 ------
NM_199053chr41208 ----1788
NM_199072chr743006 2946 2026 373 23225 2634 2765 415 --
NM_199136chr7172 ------
NM_199188chr1283838 3592 3370 3308 1260 964 720 639 ------
NM_199189chr51837 1334 ----
NM_199190chr1283838 3592 3370 3308 1260 964 720 639 ------
NM_199244chr92948 78 --1788 --
NM_199320chr4--12376 ----
NM_199320chr4--12376 ----
NM_199324chr41198 --11166 --
NM_199330chr152594 110 ------
NM_199331chr152594 110 ------
NM_199332chr152594 110 ------
NM_199342chr1157 ------
NM_199421chr1454938 4128 3776 3586 1139 21840 1706 14694 --
NM_199424chr161197 --21774 1415 --
NM_199436chr253043 2804 1121 655 572 22030 116 1749 --
NM_199437chr1142532 1731 1681 124 ------
NM_199438chr1142532 1731 1681 124 ------
NM_199439chr1142532 1731 1681 124 ------
NM_199462chr143365 1759 1544 1131 --14838 --
NM_199482chr231988 1981 260 11592 11517 --
NM_199483chr202283 217 ------
NM_199487chr2021155 149 ------
NM_201267chr2190 ------
NM_201269chr13942 169 29 ------
NM_201278chr1162141 2045 1788 377 277 73 11673 ----
NM_201281chr1162141 2045 1788 377 277 73 11673 ----
NM_201436chr71811 ------
NM_201437chr8--21004 168 ----
NM_201439chr121157 --139 --
NM_201440chr121157 --139 --
NM_201515chr121157 --139 --
NM_201516chr71867 ------
NM_201517chr71811 ------
NM_201548chr2------1104
NM_201570chr1051520 629 564 76 43 1652 1490 --
NM_201571chr1051520 629 564 76 43 1652 1490 --
NM_201572chr1051520 629 564 76 43 1652 1490 --
NM_201590chr1051520 629 564 76 43 1652 1490 --
NM_201591chr411736 ------
NM_201592chr411736 ------
NM_201593chr1051520 629 564 76 43 1652 1490 --
NM_201595chr14162 ------
NM_201596chr1051520 629 564 76 43 1652 1490 --
NM_201597chr1051520 629 564 76 43 1652 1490 --
NM_201624chr131126 248 217 1437 ----
NM_201999chr421138 1012 --1784 --
NM_203327chr2084065 3385 3161 3059 2862 1319 1287 1275 13580 12870 --
NM_203341chr11374 1818 1175 --
NM_203342chr122585 1325 23627 444 1140 --
NM_203343chr122585 1325 23627 444 1140 --
NM_203349chr1561894 1812 1623 1435 1360 175 11933 ----
NM_203350chr111427 1673 ----
NM_203354chr142676 52 ------
NM_203355chr142676 52 ------
NM_203356chr142676 52 ------
NM_203364chr1141066 1053 1035 55 ------
NM_203372chr231263 334 23 ------
NM_203379chr103997 745 268 --1393 --
NM_203380chr103997 745 268 --1393 --
NM_203437chr2----2365 22 --
NM_203446chr212501 482 --11111 12117
NM_203458chr133440 3124 980 ----11277
NM_203459chr132426 929 880 ------
NM_203487chr131697 1324 ----
NM_203504chr452591 1966 1917 1874 23 --32253 1606 923 --
NM_203505chr452591 1966 1917 1874 23 --32253 1606 923 --
NM_205768chr151815 1793 773 394 75 21937 813 187 --
NM_205833chrX1608 --137 --
NM_205836chr51604 ------
NM_205860chr122839 894 12009 1913 12176
NM_206594chr172998 2868 1208 1170 850 554 181 13009 --13340
NM_206595chr172998 2868 1208 1170 850 554 181 13009 --13340
NM_206852chr141526 ------
NM_206853chr674082 3087 2954 1591 1279 932 166 23544 63 ----
NM_206854chr675343 4348 4215 1427 1278 1194 761 24805 1324 ----
NM_206855chr6126308 5313 5180 4003 2392 2243 2159 1726 506 398 198 59 35770 4050 2289 --1532
NM_206857chr141526 ------
NM_206866chr2142782 2555 2177 2019 13194 22750 725 11204
NM_206876chr233571 2949 646 ------
NM_206909chr887913 7012 5457 2142 1530 809 300 150 26975 5782 27567 1193 15076
NM_206944chr9166 ------
NM_206945chr9166 ------
NM_206946chr9166 ------
NM_206947chr9166 ------
NM_207012chr1063551 3348 3268 2634 2258 30 1341 1992 --
NM_207015chr362223 2001 939 528 389 354 11509 ----
NM_207032chr2031339 277 120 ------
NM_207033chr2031247 185 28 ------
NM_207034chr2031247 185 28 ------
NM_207043chr121945 572 22184 848 12255 --
NM_207044chr121945 572 22184 848 12255 --
NM_207047chr121945 572 22184 848 12255 --
NM_207171chr132049 1847 1316 ------
NM_207189chr11138 ------
NM_207299chr93803 753 323 ----1871
NM_207303chr1052589 1075 555 382 210 23661 3060 21306 123 --
NM_207304chr135768 750 628 249 188 21729 956 ----
NM_207336chr7--1332 139 --
NM_207337chr121153 --1886 --
NM_207371chr1031410 1292 489 ------
NM_207396chr131808 1332 116 31762 1217 307 ----
NM_207406chr496574 6219 5715 4377 4181 2465 2301 726 107 --35365 1783 751 --
NM_207442chr1411046 ------
NM_207481chr21973 ------
NM_207491chr431395 1255 122 ------
NM_207520chr22374 306 ----1107
NM_207521chr22374 306 ----1107
NM_207577chr1132909 2169 347 --11893 12421
NM_207645chr112464 198 ------
NM_212460chr741896 1474 521 195 1687 ----
NM_212464chr15------21617 1445
NM_212467chr151962 1159 --22194 2022
NM_212471chr1722225 579 ----11870
NM_212472chr1722225 579 ----11870
NM_212543chr31739 ------
NM_212551chr12862 167 --11024 --
NM_212554chr1011276 ------
NM_213590chr1395054 4907 4749 3334 2075 1555 1415 389 23 --11145 --
NM_213606chr103997 601 500 ----1358
NM_213608chr22131 103 ------
NM_213611chr12--1146 ----
NM_213618chr112464 286 ------
NM_213654chr341534 1522 1196 526 ------
NM_213662chr1741918 1880 954 37 --11560 --