TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-873-5p
miRNA Sequence: GCAGGAACUUGUGAGUCUCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521325 117 11587 ----
NM_000051chr1162824 2510 2259 1371 1146 729 22946 874 1974 --
NM_000052chrX63408 3371 3206 2680 2229 908 13288 ----
NM_000081chr121828 700 ------
NM_000084chrX186547 6178 6157 5875 5819 5165 4853 4808 2709 2682 2341 2256 2186 2171 2047 1994 1750 1426 24973 600 35229 1893 538 12359
NM_000089chr72732 681 ------
NM_000090chr22628 54 1366 ----
NM_000091chr252861 2563 1884 1100 363 1420 ----
NM_000092chr2114243 3787 2933 1737 1409 1385 1015 593 342 156 116 11780 ----
NM_000097chr32932 841 ------
NM_000108chr7138 266 29 ----
NM_000109chrX52511 2416 1067 912 226 ----11964
NM_000110chr11467 1217 ----
NM_000115chr1332710 1808 1684 ------
NM_000125chr643013 2649 1287 159 --14016 1794
NM_000127chr81336 ------
NM_000134chr431413 675 423 ------
NM_000138chr151856 22232 244 1938 12270
NM_000139chr1142690 2213 364 213 --1149 --
NM_000141chr1031471 1313 532 --1205 --
NM_000158chr33453 445 51 1633 ----
NM_000163chr532398 2085 418 11816 ----
NM_000165chr651698 1553 1484 1290 574 21150 418 ----
NM_000167chrX41865 1699 1578 647 1578 ----
NM_000168chr763348 3218 2857 2321 2241 2221 12789 1483 --
NM_000176chr541396 1374 749 392 23490 1199 ----
NM_000189chr231970 756 594 ----1817
NM_000192chr1221178 203 ----1613
NM_000208chr19124129 3515 3451 1746 1178 829 803 725 560 395 136 125 11842 11297 --
NM_000210chr252304 1804 1766 713 424 ------
NM_000214chr20152 --21472 156 --
NM_000217chr1264686 4205 3640 1521 1266 348 15157 ----
NM_000222chr452097 1904 1765 1449 1371 21862 133 1737 --
NM_000232chr452674 2644 2100 1275 533 ------
NM_000237chr811582 1120 --11418
NM_000240chrX31620 373 305 1260 ----
NM_000245chr7--22055 341 ----
NM_000248chr342986 2751 2412 951 42896 270 85 46 --13056
NM_000258chr31233 ------
NM_000259chr15106079 5802 5190 4969 4006 3882 2259 1869 690 38 14086 ----
NM_000264chr932124 1160 680 12079 1435 --
NM_000267chr1753442 3318 2924 2524 106 1320 ----
NM_000276chrX41713 1453 798 437 22263 1509 ----
NM_000280chr112817 788 ------
NM_000310chr141347 1148 1041 475 1876 --1924
NM_000314chr1023300 2154 1133 12568 --
NM_000318chr832814 2171 2160 32679 2584 454 12719 --
NM_000319chr123961 270 168 2952 334 ----
NM_000321chr1321605 1216 --11552 --
NM_000325chr42558 503 ----1583
NM_000328chrX------184
NM_000330chrX2625 281 21420 163 ----
NM_000332chr6156408 6378 6217 5816 5555 5027 4691 2789 2732 2360 2295 2245 1687 1567 733 24788 4549 44914 2404 866 116 --
NM_000334chr1752190 2127 1944 1809 1592 ------
NM_000337chr5126624 6509 6111 5968 5088 4818 4262 2631 1090 1017 776 502 ------
NM_000340chr351551 1115 1085 290 275 31015 965 496 ----
NM_000345chr41791 21052 27 ----
NM_000346chr1761794 1482 1419 1325 1261 576 ------
NM_000353chr16--1278 1137 --
NM_000362chr2231293 237 104 12579 12750 23047 681
NM_000368chr961815 1648 1407 369 266 81 --34092 3316 1011 --
NM_000386chr172565 509 1763 ----
NM_000393chr242128 1322 597 365 ------
NM_000399chr103964 167 91 ------
NM_000406chr452683 2077 1971 1054 271 22917 243 ----
NM_000408chr222669 2628 --32707 503 435 --
NM_000412chr32272 89 ------
NM_000414chr51225 ------
NM_000415chr12149 2749 348 ----
NM_000421chr173310 285 58 --1250 --
NM_000428chr1442507 2470 2257 259 ------
NM_000430chr1753757 3077 2472 354 342 22511 422 13083 --
NM_000439chr572434 2075 733 538 437 250 223 12386 1404 --
NM_000450chr141590 1166 637 98 ------
NM_000452chr133816 379 42 ------
NM_000461chr3104073 3713 3675 3581 1760 1712 1297 895 855 84 --13298 --
NM_000462chr1521718 588 1306 ----
NM_000474chr72677 135 ------
NM_000480chr1151629 1324 614 344 250 2496 187 11390 --
NM_000484chr2131112 785 340 ------
NM_000486chr1252644 1984 1213 828 124 11040 33196 2914 2447 --
NM_000489chrX52911 2737 1112 495 412 2464 175 12413 --
NM_000493chr62819 403 1114 ----
NM_000495chrX31034 875 834 1860 ----
NM_000503chr841467 1382 1329 419 21635 396 ----
NM_000522chr71215 ------
NM_000523chr22828 265 1751 1224 11041
NM_000533chrX41606 1580 1503 1298 11912 1221 --
NM_000536chr112541 489 1251 ----
NM_000538chr1331378 300 118 ------
NM_000539chr32302 295 ------
NM_000555chrX157850 7831 7686 6793 6685 5930 5446 5349 2757 2644 2440 1617 1433 699 165 --11909 --
NM_000573chr172305 1870 1761 822 476 344 320 ------
NM_000574chr131146 56 49 ------
NM_000575chr241038 1019 923 732 --1454 --
NM_000598chr73239 172 105 1509 11115 --
NM_000600chr71302 ------
NM_000601chr72348 159 1337 ----
NM_000610chr1152888 2520 1941 722 158 2320 199 ----
NM_000611chr1196888 6763 6740 6122 4782 4728 2751 1921 1643 32678 1287 1216 140 --
NM_000615chr1142192 996 703 522 21019 904 ----
NM_000617chr1242307 929 725 51 2766 180 12142 --
NM_000618chr12115784 4946 4854 4471 4396 4062 2644 2285 1179 762 743 --11494 --
NM_000618chr12115784 4946 4854 4471 4396 4062 2644 2285 1179 762 743 --11494 --
NM_000627chr21639 ------
NM_000636chr6--1104 1509 --
NM_000651chr172305 1870 1761 822 476 344 320 ------
NM_000663chr1623102 2474 11176 22509 356 12536
NM_000680chr8178 1383 ----
NM_000682chr271678 1637 1450 614 403 96 60 1355 21832 371 --
NM_000693chr1531566 536 244 185 ----
NM_000706chr124645 306 136 28 ------
NM_000719chr12156655 5935 4920 4767 4621 2256 1687 1382 1281 1105 887 847 748 123 47 1730 24658 1557 --
NM_000724chr103580 445 374 --21522 1417 --
NM_000767chr1931516 1200 90 --1227 --
NM_000786chr721424 234 ------
NM_000795chr111850 ------
NM_000810chr152217 157 ------
NM_000811chr52217 44 --137 --
NM_000813chr565327 4902 4640 2112 1725 516 45618 5549 1950 1841 ----
NM_000814chr1593988 3665 3192 1361 1202 1118 1054 598 552 13873 1764 --
NM_000816chr52116 30 1667 ----
NM_000817chr22456 182 ------
NM_000818chr101473 ----1382
NM_000826chr452632 2444 1643 1634 210 --1438 --
NM_000827chr552522 1793 772 209 196 1148 12556 --
NM_000828chrX51975 1406 879 556 368 1465 --1694
NM_000829chr111735 --1349 --
NM_000831chr186313 5912 4616 4023 994 910 706 215 --1315 --
NM_000833chr162545 403 11356 ----
NM_000838chr642720 1910 1819 1789 1219 ----
NM_000840chr71409 --124 --
NM_000842chr111518 1760 ----
NM_000845chr73401 335 325 --1359 --
NM_000859chr531535 1113 166 21593 333 11227 --
NM_000861chr361994 1906 1730 244 148 102 11826 ----
NM_000865chr6--182 ----
NM_000866chr32466 249 21514 1349 ----
NM_000868chrX52584 2513 2229 462 72 22106 512 ----
NM_000872chr1051002 573 535 155 74 21469 1419 1253 --
NM_000875chr15157023 6935 6834 6759 5538 4923 4895 4880 4726 4429 2119 1778 1344 1136 179 26750 2830 15480 35302 2586 1291
NM_000891chr1773520 3421 3058 2656 2407 1060 995 22574 2380 ----
NM_000899chr1221704 1389 1611 23275 132 --
NM_000901chr42494 120 --2336 244 --
NM_000902chr373101 2344 1301 1290 687 665 268 11179 ----
NM_000908chr52140 28 ----193
NM_000909chr42872 128 --1527 --
NM_000912chr8103463 3177 2750 2632 2480 2394 1361 1161 250 31 32743 2474 840 ----
NM_000917chr102793 170 ------
NM_000926chr11209455 8630 8416 8142 7949 7785 7426 7272 6096 5802 3753 2721 2615 2236 1355 1345 1115 867 567 92 59079 9045 6000 2701 219 ----
NM_000927chr73600 578 522 ------
NM_000933chr2031694 1383 545 --1686 --
NM_000944chr422200 651 --196 --
NM_000945chr241495 1399 1324 531 --1735 --
NM_000950chrX93338 3273 3064 2706 2301 1442 1219 235 154 1548 13631 --
NM_000956chr144779 286 62 22 ------
NM_000959chr1103941 3913 3701 3484 2890 2587 1313 1300 971 598 --13400 --
NM_000961chr2033765 366 75 13939 ----
NM_000962chr9123016 2003 1252 874 829 725 598 498 359 287 258 95 1389 32786 2242 416 --
NM_000965chr321133 357 2998 957 --1322
NM_000983chr131332 652 176 --1449 137
NM_000990chr1163914 2812 1044 833 209 66 22687 551 ----
NM_001001132chr21--11005 ----
NM_001001323chr1273038 2279 1051 864 680 458 381 --23219 767 --
NM_001001342chr1041016 956 466 398 1171 1970 --
NM_001001344chrX52596 2115 832 279 140 ------
NM_001001389chr1152888 2520 1941 722 158 2320 199 ----
NM_001001390chr1152888 2520 1941 722 158 2320 199 ----
NM_001001391chr1152888 2520 1941 722 158 2320 199 ----
NM_001001392chr1152934 2566 1987 768 204 2366 245 ----
NM_001001395chr122939 425 22642 2246 1618 --
NM_001001396chr1144332 4087 4051 3674 3537 3521 3256 2717 1459 1110 998 845 815 613 23158 3113 --11524
NM_001001419chr5124748 4566 4402 4217 3496 2093 2040 1977 1894 1004 622 429 --14547 13267
NM_001001420chr5124748 4566 4402 4217 3496 2093 2040 1977 1894 1004 622 429 --14547 13267
NM_001001433chr2043083 2550 2474 2447 ------
NM_001001436chr163838 559 116 1689 ----
NM_001001481chr873198 1370 1239 1054 989 896 722 --13344 --
NM_001001484chr1041954 418 379 341 1363 ----
NM_001001549chr772882 2848 2618 2576 2514 1968 626 ------
NM_001001550chr772882 2848 2618 2576 2514 1968 626 ------
NM_001001555chr772882 2848 2618 2576 2514 1968 626 ------
NM_001001556chr154558 407 401 61 21167 385 ----
NM_001001664chr233019 1388 1325 12675 33976 2641 95 12502
NM_001001665chr232090 443 361 ------
NM_001001701chr452270 1985 1506 866 204 171 11683 139
NM_001001890chr21144267 4098 3593 3222 3203 3103 3064 2996 2940 2869 2754 1193 1075 596 --13119 1870
NM_001001933chr11626 1488 ----
NM_001001974chr1032211 1913 1649 ------
NM_001001995chrX31806 1560 1335 3743 579 475 ----
NM_001002026chr33686 430 86 1661 ----
NM_001002233chr81463 --31804 795 32 --
NM_001002814chr863847 3159 2902 2797 2663 463 --2795 32 --
NM_001002843chr1521087 971 ------
NM_001002860chr1484352 3794 3759 3353 3226 3037 1878 1174 13304 --14280
NM_001002906chrY2544 160 ------
NM_001002909chr1761958 1644 1584 1577 236 198 --11834 --
NM_001003407chr10184856 4800 4713 4672 4545 4295 3654 3575 3415 3378 3284 3239 1698 1227 1134 1027 947 732 44579 4486 3893 496 34759 3995 757 11776
NM_001003408chr10184856 4800 4713 4672 4545 4295 3654 3575 3415 3378 3284 3239 1698 1227 1134 1027 947 732 44579 4486 3893 496 34759 3995 757 11776
NM_001003652chr18228579 8410 8365 8171 7993 7877 7296 7191 6419 6195 5972 5310 3118 2809 2711 2635 2029 1594 1503 1362 549 529 37699 7451 401 58297 7624 6436 1825 1164 --
NM_001003665chr15962 802 679 102 87 22235 822 ----
NM_001003674chr1887044 7035 6950 5733 4311 2382 1261 498 21582 872 --1141
NM_001003675chr1887044 7035 6950 5733 4311 2382 1261 498 21582 872 --1141
NM_001003681chr2222024 1783 ------
NM_001003696chr211102 ----1152
NM_001003697chr211102 ----1152
NM_001003698chr651683 1412 1405 1365 1238 11808 1378 11766
NM_001003699chr651683 1412 1405 1365 1238 11808 1378 11766
NM_001003701chr211102 ----1152
NM_001003703chr211102 ----1152
NM_001003712chr1242879 1596 1206 1140 13101 21569 1045 --
NM_001003760chr622513 159 12322 12821 --
NM_001003792chr331232 1124 453 1334 ----
NM_001003793chr331232 1124 453 1334 ----
NM_001003794chr372771 2475 2261 1199 1029 381 333 12301 ----
NM_001003800chr973499 3349 2525 1325 677 396 268 23620 686 ----
NM_001003937chr271497 1436 1399 688 664 617 112 1504 21633 1627 --
NM_001003940chr1563818 2851 2457 647 600 558 ------
NM_001003942chr1563818 2851 2457 647 600 558 ------
NM_001003943chr1563822 2855 2461 651 604 562 ------
NM_001004065chr983895 3609 3307 3171 2955 786 633 514 23747 3136 22849 2806 --
NM_001004304chr1273224 2430 2169 2136 2113 225 213 11139 1380 --
NM_001004317chr664431 3355 1631 1052 852 22 31476 597 439 --12781
NM_001004329chr1241142 994 936 345 1502 ----
NM_001004342chr1136042 6015 5791 4568 4386 3746 2103 1615 911 904 513 316 153 31640 1520 983 11897 --
NM_001004346chr441051 1030 991 167 ------
NM_001004360chr241294 520 235 202 ------
NM_001004419chr1254101 4053 3424 1481 845 --13882 --
NM_001005158chr32452 404 ------
NM_001005159chr32452 404 ------
NM_001005366chr12288 49 2388 27 2960 150 --
NM_001005375chrY51827 1655 1372 254 200 ------
NM_001005386chr231764 958 249 ------
NM_001005404chr1764434 3758 3505 3429 1118 149 23252 3014 24481 3679 23686 565
NM_001005463chr1062634 1860 1848 821 732 409 22191 1688 ----
NM_001005473chr5106601 6412 6170 5037 4889 2328 2047 1107 365 149 12584 11408 --
NM_001005474chr341245 1238 366 107 ------
NM_001005502chr1254795 4423 4352 3944 1161 25232 121 ----
NM_001005609chrX23140 558 --33860 3326 1488 --
NM_001005732chr211124 ------
NM_001005733chr211124 1230 ----
NM_001005753chr262253 2150 2061 1955 1844 164 --12008 --
NM_001005781chr22564 385 ------
NM_001005782chr231013 834 60 ------
NM_001005845chr85474 342 227 200 188 31888 462 451 ----
NM_001005849chr172599 38 ------
NM_001006115chr362757 2639 2577 1975 448 311 1672 21726 807 --
NM_001006600chr532331 1690 823 --1719 --
NM_001006610chr162762 22 --1904 --
NM_001006623chr262475 952 700 370 315 168 42592 2410 1643 544 12360 --
NM_001006624chr141976 1610 661 361 11849 --155
NM_001006684chrX2417 46 160 ----
NM_001006946chr271823 1510 1337 1301 534 277 217 ------
NM_001007024chr1784321 4218 3596 3458 367 293 206 176 14381 ----
NM_001007025chr1784321 4218 3596 3458 367 293 206 176 14381 ----
NM_001007067chr82997 254 21005 985 ----
NM_001007068chr82997 254 21005 985 ----
NM_001007069chr82997 254 21005 985 ----
NM_001007070chr82997 254 21005 985 ----
NM_001007097chr975000 1908 1791 1355 1203 689 125 23537 1893 11932 --
NM_001007098chr15939 821 712 320 119 ------
NM_001007102chr631268 1182 375 11334 ----
NM_001007156chr1551954 1517 1495 750 736 --11590 --
NM_001007237chr132734 2381 235 11912 32816 2697 241 --
NM_001007246chr2171930 1394 1228 626 528 458 266 ------
NM_001007466chr695125 4914 4571 4559 4411 3975 1913 361 300 55168 4760 4267 4219 1876 24402 553 --
NM_001007538chr1351643 1325 1298 162 23 ----11553
NM_001007553chr141200 1001 826 446 11014 ----
NM_001007559chr1811617 ------
NM_001007793chr103279 109 22 ------
NM_001007794chr12760 36 ------
NM_001008220chr562691 2665 1087 942 705 53 ------
NM_001008222chrX21056 154 1178 1452 --
NM_001008226chr1541779 1622 1166 196 ------
NM_001008239chr1883798 3687 3473 2989 2716 2661 805 368 1572 ----
NM_001008392chr363577 3459 3333 2712 1161 1047 21369 764 13366 12220
NM_001008405chr7--1516 1670 --
NM_001008408chr7166175 5660 5518 5505 5434 5258 4738 4042 3977 2233 1522 1333 1173 639 606 299 1930 11089 22568 2284
NM_001008495chr8112150 2077 2012 1852 1843 1819 1653 420 310 270 165 ------
NM_001008528chr1741803 1620 614 70 11535 2224 149 11569
NM_001008529chr173935 881 35 --1288 --
NM_001008539chr855300 5063 1105 1097 610 15383 24465 1883 --
NM_001008541chr1021965 637 2391 278 ----
NM_001008541chr1021965 637 2391 278 ----
NM_001008564chr1352119 1963 400 350 176 ------
NM_001008660chr1111266 ------
NM_001008661chr1----127 1343
NM_001008662chr1----127 1343
NM_001008701chr19103127 2918 2895 2878 2817 2157 1199 1183 503 367 ------
NM_001008707chr142773 78 ------
NM_001008708chr21240 ------
NM_001008738chr592878 2664 2628 2344 2295 2254 2180 805 697 22366 2327 ----
NM_001008801chr1942192 1982 1768 1463 ------
NM_001008895chr1341168 291 209 77 --2310 231 --
NM_001008925chr432455 1201 996 1219 13115 1535
NM_001009552chr82547 462 --1100 --
NM_001009554chr484181 4025 3870 2944 955 492 429 296 12989 ----
NM_001009554chr484181 4025 3870 2944 955 492 429 296 12989 ----
NM_001009555chr441519 1136 1091 23 1137 ----
NM_001009567chr101580 ------
NM_001009569chr1051360 1348 1325 216 193 ----11120
NM_001009571chr761449 1129 572 539 352 326 ------
NM_001009814chr131246 ----146
NM_001009880chr2254930 4885 3997 3203 1622 ----23630 429
NM_001009881chr11420 ------
NM_001009882chr11420 ------
NM_001009899chr3125548 5371 5099 4978 4727 2473 2415 2390 1974 1169 1124 627 34641 2082 994 25225 1769 --
NM_001009909chr1173466 3371 3302 2940 2817 482 86 2732 646 ----
NM_001009959chr241872 761 397 208 ------
NM_001009960chr762699 2436 1143 1122 1040 769 --22107 1131 --
NM_001009993chr294275 3222 3055 2878 1141 985 884 788 567 33779 3676 3106 ----
NM_001009996chr31136 ------
NM_001010000chr18123375 3248 3194 3041 2819 2737 2345 1146 499 344 118 97 1844 ----
NM_001010853chr6----22652 1252 12822
NM_001010854chr142499 180 ----1215
NM_001010861chr142595 2115 304 200 12471 ----
NM_001010862chrX41263 685 541 197 ------
NM_001010867chr1116106 6098 6040 5770 5374 4520 2456 2089 1962 640 213 12641 26231 5718 --
NM_001010888chrX64204 3581 3145 1582 1246 398 33481 3429 3194 ----
NM_001010891chr5116560 6263 5785 5722 5487 5080 4486 2128 2005 769 698 55095 4676 4657 1437 993 --24881 4261
NM_001010895chr961997 1944 1557 543 489 416 --1778 --
NM_001010898chr193752 3338 3071 2646 2540 1180 908 854 373 32428 603 75 ----
NM_001010908chr102652 573 ------
NM_001010917chr1052324 2175 602 470 155 2795 214 ----
NM_001010932chr72348 159 1337 ----
NM_001010971chr12704 677 --1884 2765 713
NM_001010984chr152021 908 511 278 224 --173 --
NM_001011513chr442802 1630 1005 211 32961 1334 256 13533 11559
NM_001011537chr352172 1888 1607 265 208 11507 11455 --
NM_001011553chr72960 855 ----1152
NM_001011663chr10--3999 957 695 ----
NM_001011666chr796297 5404 4648 4411 4323 1788 279 243 108 ------
NM_001011713chr1431142 341 211 2481 416 11061 --
NM_001011720chr811236 1586 11307 1312
NM_001011885chr1531142 525 328 11695 ----
NM_001012267chr9184 --3610 535 383 --
NM_001012337chr3191 ------
NM_001012393chr11105074 5013 4571 3661 3613 3372 1497 1259 536 105 ------
NM_001012398chr162713 35 1270 ----
NM_001012420chr1572851 2635 2463 731 582 328 127 22043 828 ----
NM_001012423chr1572851 2635 2463 731 582 328 127 22043 828 ----
NM_001012507chr6--122 ----
NM_001012614chr41208 --1254 --
NM_001012751chr1011298 31935 1739 1467 11360 --
NM_001012755chrX34371 3249 1093 23897 730 23100 1563 11135
NM_001012756chr1932996 2662 766 32932 2884 2560 22368 276 --
NM_001012761chr561027 925 478 402 388 192 ----12409
NM_001012968chrX72506 2300 2145 2023 964 512 344 --2934 433 12178
NM_001012977chrX31163 897 567 11272 ----
NM_001012989chrX1455 ------
NM_001013031chr1062477 1257 654 537 451 336 1262 --1960
NM_001013398chr73239 172 105 1509 11115 --
NM_001013415chr42479 373 ------
NM_001013438chr33269 183 169 ------
NM_001013439chr32115 29 ------
NM_001013615chr141215 974 934 818 ------
NM_001013620chr12118485 7443 7059 5258 5156 2297 1660 936 928 858 503 27022 490 18020 --
NM_001013622chr481175 1162 379 317 255 193 132 70 ------
NM_001013635chr1241095 866 859 190 ------
NM_001013693chr132794 2280 1010 2876 261 --1852
NM_001013693chr132794 2280 1010 2876 261 --1852
NM_001013843chr152718 219 ------
NM_001014283chr1341688 1344 252 186 21964 105 170 --
NM_001014380chr13115518 5223 4677 4172 2133 2075 1952 1547 227 59 25 44904 1997 1615 1004 ----
NM_001014797chr10127949 7230 7208 7156 6866 5608 5475 5056 2958 2842 2781 2036 27322 2103 ----
NM_001014809chr44700 339 142 62 1933 ----
NM_001015045chr432376 644 354 1787 22336 2081 --
NM_001015048chr1442476 2266 1193 541 23239 1278 23139 2454 --
NM_001015049chr1442476 2266 1193 541 23239 1278 23139 2454 --
NM_001015877chrX83092 2606 2578 1981 1966 1027 812 301 --43028 2635 556 222 --
NM_001015880chr1051710 1458 1131 625 21 41283 1189 498 27 ----
NM_001015881chrX3409 361 54 ------
NM_001015887chr351720 1470 732 670 317 21555 624 ----
NM_001017365chr1155 ------
NM_001017366chr1155 ------
NM_001017367chr1155 ------
NM_001017368chr1742091 510 453 436 --31027 737 235 --
NM_001017371chr2272 64 1415 ----
NM_001017395chr383219 2834 2692 2666 2548 2408 2387 821 --12685 13207
NM_001017415chr11240 ------
NM_001017416chr11240 ------
NM_001017420chr841365 1116 438 158 1465 ----
NM_001017424chr13523 469 352 1183 1321 --
NM_001017425chr13523 469 352 1183 1321 --
NM_001017440chr7218014 7377 7080 6997 6876 6568 6372 6215 6053 5756 3108 2513 2470 2341 2332 2148 1867 1615 1549 681 609 32628 1764 1342 --11595
NM_001017523chr1231476 1330 1178 --1141 --
NM_001017923chr1431452 1344 1037 1202 ----
NM_001017926chr81673 21204 307 ----
NM_001017930chrX2385 317 ----1970
NM_001017962chr102793 170 ------
NM_001017967chr163925 807 38 ------
NM_001017969chr91186 --1422 --
NM_001017979chr42510 272 1686 ----
NM_001017995chr574553 4237 2949 1420 447 238 131 --24175 3476 --
NM_001017999chr172290 2151 2074 2055 1952 1770 754 ------
NM_001017999chr172290 2151 2074 2055 1952 1770 754 ------
NM_001018000chr172290 2151 2074 2055 1952 1770 754 ------
NM_001018000chr172290 2151 2074 2055 1952 1770 754 ------
NM_001018001chr172290 2151 2074 2055 1952 1770 754 ------
NM_001018004chr15--2673 551 ----
NM_001018006chr15--2673 551 ----
NM_001018007chr15--2673 551 ----
NM_001018009chr33906 281 156 --1200 --
NM_001018020chr15--2673 551 ----
NM_001018037chr961373 1083 969 505 486 379 ------
NM_001018038chr93432 262 166 --1660 --
NM_001018053chr141858 1632 1341 607 ------
NM_001018056chr91180 ------
NM_001018064chr951776 560 520 437 239 1796 --11906
NM_001018067chr154828 3979 1178 963 29 14892 --15308
NM_001018068chr154828 3979 1178 963 29 14892 --15308
NM_001018069chr154828 3979 1178 963 29 14892 --15308
NM_001018072chr1231476 1330 1178 --1141 --
NM_001018074chr541396 1374 749 392 23490 1199 ----
NM_001018075chr541396 1374 749 392 23490 1199 ----
NM_001018076chr541396 1374 749 392 23490 1199 ----
NM_001018077chr541396 1374 749 392 23490 1199 ----
NM_001018089chr1563983 3837 3384 2634 587 105 12901 13603 1438
NM_001018108chr1551900 1861 1734 495 233 ------
NM_001018111chr743644 1398 974 601 12886 11446 --
NM_001020818chr19121904 1838 1735 1722 1549 1520 485 449 261 215 110 46 --31849 1704 171 --
NM_001020819chr19121904 1838 1735 1722 1549 1520 485 449 261 215 110 46 --31849 1704 171 --
NM_001020820chr19121904 1838 1735 1722 1549 1520 485 449 261 215 110 46 --31849 1704 171 --
NM_001020821chr19121904 1838 1735 1722 1549 1520 485 449 261 215 110 46 --31849 1704 171 --
NM_001023560chr61103 ------
NM_001023567chr1531548 585 127 --12243 --
NM_001023587chr32338 201 --1301 --
NM_001024024chr141803 --11061 11016
NM_001024070chr141799 --11057 11012
NM_001024094chr541396 1374 749 392 23490 1199 ----
NM_001024218chr143813 561 234 ------
NM_001024593chr102828 166 1798 2147 71 --
NM_001024649chr592920 2482 2461 2195 2030 2024 1833 1016 541 --22511 206 --
NM_001024660chr321262 451 ------
NM_001024668chr122703 676 1657 ----
NM_001024688chr822124 1991 --12115 --
NM_001024808chr1231902 811 466 --11794 --
NM_001024847chr352292 2126 1556 894 95 --1672 --
NM_001024948chr193292 3233 3215 2755 2575 1260 1157 426 271 ----21304 1291
NM_001025076chr10166173 6154 5982 5521 4798 4656 4305 3956 2473 2238 2066 1574 1130 833 447 329 23823 144 22106 1892 25793 133
NM_001025077chr10157531 7512 7340 6879 6156 6014 5663 5314 2932 2488 2191 1805 1687 709 206 35181 1502 764 --27151 1491
NM_001025079chr3103460 3439 3141 2827 2714 2554 1513 1391 937 607 24042 952 ----
NM_001025081chr183469 243 225 ----11561
NM_001025090chr183469 243 225 ----11561
NM_001025092chr183469 243 225 ----11561
NM_001025101chr183469 243 225 ----11561
NM_001025105chr52512 56 ------
NM_001025108chr2113596 3464 3042 2682 2545 1308 1223 1190 981 883 837 23666 3365 12604 1279
NM_001025201chr27676 632 524 514 508 192 137 191 ----
NM_001025203chr21------1122
NM_001025204chr21------1122
NM_001025248chr1561286 1258 1115 948 833 500 ------
NM_001025249chr1561286 1258 1115 948 833 500 ------
NM_001025252chr852615 2269 307 211 179 --12263 --
NM_001025253chr852615 2269 307 211 179 --12263 --
NM_001025356chr1282979 2937 2805 1963 1118 845 341 321 1239 ----
NM_001025366chr641308 330 321 277 ------
NM_001025366chr641308 330 321 277 ------
NM_001025367chr641308 330 321 277 ------
NM_001025367chr641308 330 321 277 ------
NM_001025368chr641308 330 321 277 ------
NM_001025368chr641308 330 321 277 ------
NM_001025369chr641324 346 337 293 ------
NM_001025369chr641324 346 337 293 ------
NM_001025370chr641308 330 321 277 ------
NM_001025370chr641308 330 321 277 ------
NM_001025389chr1151629 1324 614 344 250 2496 187 11390 --
NM_001025390chr1151629 1324 614 344 250 2496 187 11390 --
NM_001025580chrX103903 3540 3094 3080 1260 957 939 346 313 69 --23972 305 13685
NM_001025595chr461561 1038 635 266 196 115 --1493 --
NM_001025596chr115469 456 432 200 46 ------
NM_001025777chr221094 377 170 ----
NM_001025780chr93551 223 38 ------
NM_001029858chr653154 2822 2699 834 700 ----12779
NM_001029863chr642633 1194 1010 505 --1535 --
NM_001029875chr582955 2868 2659 2133 2077 1167 1091 728 11927 ----
NM_001029884chr692609 2597 2426 879 700 687 650 622 337 22494 1845 ----
NM_001030006chr1742631 1998 1985 179 1699 ----
NM_001030007chr1653741 2732 2447 587 409 11074 12745 --
NM_001030055chr14144738 4722 4614 3757 3691 3361 3074 1833 1117 985 559 387 292 280 ----14683
NM_001030287chr121142 90 --11090 --
NM_001031623chr651824 1265 1157 553 341 21247 61 ----
NM_001031677chr53482 343 68 ------
NM_001031679chr1232979 2757 2336 ------
NM_001031680chr152005 1879 1701 713 642 12115 ----
NM_001031690chr7102890 2780 2634 2244 2102 2060 1117 1013 660 355 ------
NM_001031695chr22124983 4745 4634 4624 4558 4210 1510 1054 627 463 200 171 --2796 497 34524 4177 1747
NM_001031710chr72146 129 1263 ----
NM_001031711chr561820 1534 637 590 410 181 ------
NM_001031716chr22372 122 ----1961
NM_001031717chr3137 ------
NM_001031723chr4147 ----1125
NM_001031732chr483638 3616 3503 2988 2591 2501 381 285 23233 1259 ----
NM_001031746chr102371 280 21325 1106 ----
NM_001031804chr1683464 3355 3347 2787 1466 646 477 384 ----13623
NM_001031812chr532263 1756 308 ------
NM_001031855chrX2189 61 1207 ----
NM_001032221chr93274 164 79 --2452 416 --
NM_001032280chr621203 95 --11427 --
NM_001032282chr8--21222 885 ----
NM_001032296chr13102922 2873 2705 2686 2297 2223 2197 2014 928 837 12000 ----
NM_001032363chr162001 1874 1771 892 252 162 11695 21422 799 --
NM_001032363chr162001 1874 1771 892 252 162 11695 21422 799 --
NM_001032999chr2055239 4441 3410 256 246 35101 3769 3326 14714 --
NM_001033045chr263987 3852 1739 1138 1016 969 13976 ----
NM_001033047chr462273 2057 1740 1622 591 149 ------
NM_001033049chr2121977 928 1367 ----
NM_001033057chr392045 2039 1885 1855 1838 1590 1389 276 79 11653 ----
NM_001033059chr652045 1588 1549 1522 1496 ------
NM_001033081chr141817 1545 1527 167 11533 ----
NM_001033082chr141817 1545 1527 167 11533 ----
NM_001033087chr2053223 2965 1019 345 260 13060 ----
NM_001033117chr3134802 4522 4486 4242 4038 3716 3540 3393 3380 1916 1270 1087 581 --24589 1511 --
NM_001033507chr141700 1429 720 202 --11899 --
NM_001033551chr1722837 2815 2586 302 24085 3979 11411
NM_001033557chr221156 32 ------
NM_001033576chr1762774 2553 1745 329 290 209 ------
NM_001033578chr852386 2312 2282 1937 205 ------
NM_001033723chr842610 2575 2539 496 1366 ----
NM_001033756chr641242 264 255 211 ------
NM_001033756chr641242 264 255 211 ------
NM_001034841chr1695523 4821 4478 4354 3873 3795 1163 999 348 24713 1084 --1451
NM_001034845chr451438 1198 1138 1103 162 --11335 11186
NM_001034850chr51609 21393 190 11653 --
NM_001034852chr143753 567 371 ------
NM_001034954chr1073177 2206 1988 1156 875 860 281 32271 2008 719 ----
NM_001034955chr1073177 2206 1988 1156 875 860 281 32271 2008 719 ----
NM_001034956chr1073177 2206 1988 1156 875 860 281 32271 2008 719 ----
NM_001034957chr1073177 2206 1988 1156 875 860 281 32271 2008 719 ----
NM_001034996chr3131 ------
NM_001035chr121079 121 ------
NM_001035005chr183655 232 205 ------
NM_001035254chr952506 2333 1728 930 591 12259 ----
NM_001035511chr162106 2070 2047 1993 560 89 31925 624 222 1464 --
NM_001035512chr172213 2177 2154 2100 667 196 58 32032 731 329 1571 --
NM_001035513chr172213 2177 2154 2100 667 196 58 32032 731 329 1571 --
NM_001037132chr732137 1476 107 1223 ----
NM_001037133chr732137 1476 107 1223 ----
NM_001037163chr71938 --1103 --
NM_001037164chr741910 1551 1492 547 1660 1523 --
NM_001037165chr7148943 8924 8880 8169 7397 6689 6595 6557 6229 2456 2428 1866 801 774 --38338 1503 1271 --
NM_001037172chr331406 1013 448 21289 409 --1535
NM_001037174chr251586 1407 845 777 358 ------
NM_001037317chr142595 2115 304 200 12471 ----
NM_001037331chr181207 ----2755 186
NM_001037332chr51193 11840 --11826
NM_001037333chr51193 11840 --11826
NM_001037334chr182316 250 42260 1951 841 564 1388 --
NM_001037339chr131803 550 515 ------
NM_001037340chr131803 550 515 ------
NM_001037341chr131803 550 515 ------
NM_001037341chr131803 550 515 ------
NM_001037533chr12829 318 ------
NM_001037535chrX41095 525 445 77 ------
NM_001037536chrX41095 525 445 77 ------
NM_001037540chrX41095 525 445 77 ------
NM_001037582chr411704 1430 ----
NM_001037631chr21875 --1241 11086
NM_001037637chr51248 ------
NM_001037872chr22597 479 ------
NM_001037954chr1162994 459 363 224 159 97 11115 --11321
NM_001038493chr251592 1565 1426 547 202 ------
NM_001038640chr153653 266 203 2898 873 ----
NM_001038702chr551759 1697 964 837 158 22690 912 ----
NM_001038707chr182194 1971 1925 1710 1563 1440 822 460 --31462 621 315 --
NM_001038707chr182194 1971 1925 1710 1563 1440 822 460 --31462 621 315 --
NM_001039029chr1231987 468 331 1438 ----
NM_001039395chr922339 209 ------
NM_001039465chr141102 --1333 --
NM_001039538chr243567 2713 2561 982 --12463 1377
NM_001039547chr3137833 6836 6383 6088 5210 2917 2010 1837 1754 1464 1133 826 758 38010 6158 1517 37222 3067 969 --
NM_001039570chr22104675 4066 3828 3528 3472 3460 3371 430 395 76 ------
NM_001039571chr22104675 4066 3828 3528 3472 3460 3371 430 395 76 ------
NM_001039577chr184427 3986 2872 1713 1703 1499 946 165 11577 --14047
NM_001039585chr1104198 4170 3958 3741 3147 2844 1570 1557 1228 855 1223 13657 --
NM_001039590chrX104013 3116 2560 2466 1117 990 829 578 338 66 22817 294 ----
NM_001039591chrX104013 3116 2560 2466 1117 990 829 578 338 66 22817 294 ----
NM_001039618chr11125840 5390 4304 3964 3942 3677 2245 1408 934 390 236 214 54697 3926 3893 3877 2295 11592 --
NM_001039690chr1662393 2368 1860 1848 1605 329 21874 1728 32134 1884 1622 --
NM_001039709chr2055239 4441 3410 256 246 35101 3769 3326 14714 --
NM_001039802chr141333 1147 953 23 ------
NM_001039840chrX115812 5543 5344 5013 4263 3927 3725 2307 2062 1060 344 15476 ----
NM_001039916chr123949 470 447 1162 ----
NM_001039917chr123949 470 447 1162 ----
NM_001039918chr123949 470 447 1162 ----
NM_001039919chr123949 470 447 1162 ----
NM_001039920chr123949 470 447 1162 ----
NM_001039937chr1353979 2928 2652 1567 746 189 ----
NM_001039960chr1241748 1122 247 155 ------
NM_001040020chr731360 985 400 ------
NM_001040057chr731502 121 103 ------
NM_001040059chr171595 1115 ----
NM_001040100chr33308 176 142 ------
NM_001040102chr1042642 2614 984 249 ----2464 305
NM_001040103chr1042642 2614 984 249 ----2464 305
NM_001040108chr1482962 2456 2417 2410 2108 1253 872 529 42402 2046 1159 156 1444 12902
NM_001040110chr771751 1618 1607 1570 1269 259 187 --21340 1224 --
NM_001040134chr191129 ----11476
NM_001040142chr232246 622 213 --21723 1652 --
NM_001040143chr232246 622 213 --21723 1652 --
NM_001040144chr1662393 2368 1860 1848 1605 329 21874 1728 32134 1884 1622 --
NM_001040146chr1662393 2368 1860 1848 1605 329 21874 1728 32134 1884 1622 --
NM_001040151chr1173679 3628 3269 3146 968 835 819 1813 1729 34523 1310 742
NM_001040152chr744524 1607 1195 803 11350 ----
NM_001040157chr452518 2492 877 791 282 ------
NM_001040158chr52416 399 ------
NM_001040167chr731090 902 384 --1845 --
NM_001040202chr441979 1949 793 552 --11029 --
NM_001040272chr931868 548 396 --11882 --
NM_001040273chr1042003 1677 1313 229 21750 410 ----
NM_001040280chr671457 1305 1113 507 413 160 21 129 --11174
NM_001040284chr16105844 5174 5119 3687 2331 2315 1632 1290 1092 1016 35762 1574 1497 15465 13952
NM_001040402chr422034 1047 21269 320 ----
NM_001040409chr231053 915 793 1993 1152 --
NM_001040429chr1363445 2281 1196 553 156 35 1356 ----
NM_001040441chr144240 4137 1088 53 35375 4020 144 ----
NM_001040446chr582693 2032 1799 944 920 796 662 330 2816 260 1402 --
NM_001040450chr1532631 2508 1865 2970 383 --1412
NM_001040453chr1532631 2508 1865 2970 383 --1412
NM_001040619chr141592 1042 540 68 1229 11540 --
NM_001040633chr71841 ------
NM_001040653chr352624 1988 830 202 145 2602 232 31966 474 93 --
NM_001040709chr1102534 2441 2347 981 835 646 368 352 229 193 ------
NM_001040712chr973569 3384 3254 3180 2712 2660 986 ------
NM_001040876chr421443 191 --1365 1198
NM_001042353chr201582 --1194 --
NM_001042355chr16145399 5239 4818 4596 4550 3921 3705 2148 2142 1859 1763 879 676 550 11195 23591 558 --
NM_001042357chr1041298 462 387 114 ------
NM_001042358chr1041298 462 387 114 ------
NM_001042360chr1041298 462 387 114 ------
NM_001042363chr1041298 462 387 114 ------
NM_001042389chr1041298 462 387 114 ------
NM_001042390chr1041298 462 387 114 ------
NM_001042392chr1041298 462 387 114 ------
NM_001042395chr1041298 462 387 114 ------
NM_001042412chr16145399 5239 4818 4596 4550 3921 3705 2148 2142 1859 1763 879 676 550 11195 23591 558 --
NM_001042413chr973327 3101 1320 565 286 211 133 52575 1467 1243 1139 852 ----
NM_001042424chr452412 2287 780 557 411 22508 2254 1222 1843
NM_001042425chr621203 95 --11427 --
NM_001042473chr1042171 1622 1407 555 --22102 2060 --
NM_001042476chr1631999 1386 511 12159 ----
NM_001042481chr1442569 2245 2082 68 --1864 --
NM_001042492chr1753442 3318 2924 2524 106 1320 ----
NM_001042494chr1583629 3465 3415 2698 2396 897 751 658 ----13787
NM_001042495chr1583629 3465 3415 2698 2396 897 751 658 ----13787
NM_001042496chr1583629 3465 3415 2698 2396 897 751 658 ----13787
NM_001042497chr1583629 3465 3415 2698 2396 897 751 658 ----13787
NM_001042506chrX31173 897 567 31435 1304 1283 ----
NM_001042510chr851595 1456 842 590 450 1835 11763 --
NM_001042511chr851595 1456 842 590 450 1835 11763 --
NM_001042517chr131250 1725 ----
NM_001042537chrX72359 2243 2173 1733 1661 433 193 ------
NM_001042555chr1264756 4450 3576 3518 1278 810 33343 3275 119 ----
NM_001042599chr2167630 7357 6604 6476 6466 5937 5560 5268 2926 2694 1908 1110 533 409 342 214 56820 5019 2671 1747 1117 1550 --
NM_001042601chr373151 3062 3032 819 625 319 86 13204 ----
NM_001042603chr1285137 5069 5041 4524 4286 1935 1568 527 34897 4640 4262 --14713
NM_001042604chr384266 3535 3192 3130 3036 1562 1516 915 --14223 --
NM_001042646chr331384 595 350 1518 ----
NM_001042681chr192520 2231 2044 1885 1847 1786 999 917 799 1186 143 --
NM_001042682chr192520 2231 2044 1885 1847 1786 999 917 799 1186 143 --
NM_001042682chr192520 2231 2044 1885 1847 1786 999 917 799 1186 143 --
NM_001042683chr641844 1139 579 108 11734 ----
NM_001042749chrX21755 399 11848 --11380
NM_001042750chrX21755 399 11848 --11380
NM_001042751chrX21755 399 11848 --11380
NM_001043318chr1474136 3625 1478 1266 766 705 129 13348 21167 110 --
NM_001043351chr142094 1427 861 778 ------
NM_001044305chr621567 1530 ------
NM_001044385chr243064 2682 2607 2487 32701 795 453 23334 861 --
NM_001044722chr532263 1756 308 ------
NM_001044723chr532263 1756 308 ------
NM_001046chr521026 892 ------
NM_001048183chr132783 616 434 23476 690 ----
NM_001049chr1452021 746 413 261 245 12229 ----
NM_001066chr172175 1334 442 427 372 128 116 --11970 --
NM_001079874chr141892 1715 267 107 ------
NM_001083620chr452630 2442 1642 1633 209 --1437 --
NM_001083621chr174248 2953 1736 1643 1067 747 29 1503 21138 681 --
NM_001099678chr386277 5839 5576 5426 2461 2043 1788 1497 46108 4646 1491 565 12246 --
NM_001100108chr1178190 7626 6987 6718 5984 5282 3267 3110 2493 2222 2213 2075 1084 844 804 750 67 57538 6688 6358 1024 38 21501 75 15085
NM_001106chr3269585 9043 8749 8446 7993 7599 7569 7562 7318 6878 6735 6285 6222 6126 3792 3673 3239 3116 2939 2699 2661 1730 1276 1080 896 852 16744 13909 --
NM_001109977chr42304 142 2667 109 131 --
NM_001113490chrX43360 2692 2476 1012 --22423 72 --
NM_001116chr1652866 2459 1998 1225 463 --1444 --
NM_001117chr1852189 2166 1618 822 635 1832 ----
NM_001121chr1011446 11276 ----
NM_001123chr102684 335 157 ----
NM_001126chr11350 1942 ----
NM_001128chr1653741 2732 2447 587 409 11074 12745 --
NM_001148chr471980 1943 1798 1697 441 226 138 ------
NM_001149chr103462 425 334 ------
NM_001152chrX194 171 ----
NM_001157chr102635 78 1256 ----
NM_001167chrX136750 6706 6678 6464 4724 2627 2460 2234 1460 1050 768 368 34 65704 4855 1974 1134 1075 170 12208 --
NM_001173chr14144738 4722 4614 3757 3691 3361 3074 1833 1117 985 559 387 292 280 ----14683
NM_001177chr1262261 2224 2218 1521 231 223 ------
NM_001186chr2173228 2377 2193 763 558 364 282 ------
NM_001198chr672250 2219 2169 1893 620 490 29 11643 ----
NM_001200chr2021043 794 ------
NM_001204chr2137736 7399 7079 6609 5495 2259 2200 1806 1532 597 543 426 352 27294 1714 16698 1461
NM_001206chr952970 2056 2023 1200 1193 ------
NM_001207chr51248 ------
NM_001219chr742286 1882 896 819 ------
NM_001241chr212037 1882 ----
NM_001241chr212037 1882 ----
NM_001251chr171595 1115 ----
NM_001256chr17122949 2603 2518 2188 2173 1999 727 625 441 361 256 55 ----1406
NM_001257chr1621186 290 ------
NM_001259chr7105247 5121 5014 4965 4710 1935 1082 1000 901 620 11739 ----
NM_001261chr941069 464 437 214 ------
NM_001270chr52413 25 ------
NM_001271chr1583258 2007 1235 1197 1094 912 763 350 23185 906 1564 --
NM_001273chr121183 1560 ----
NM_001277chr1121084 934 1911 ----
NM_001278chr10--1484 ----
NM_001280chr191676 ----2590 471
NM_001282chr1742631 1998 1985 179 1699 ----
NM_001283chr71708 --185 --
NM_001284chr52505 209 --1177 --
NM_001286chr162753 2289 1921 1147 778 229 2826 199 1343 --
NM_001290chr45998 904 871 429 207 ------
NM_001292chr1521140 266 --198 1186
NM_001293chr111126 1132 1464 --
NM_001304chr1773814 3536 3076 3035 2348 1113 54 ----13211
NM_001305chr7240 25 --1778 --
NM_001310chr1251229 1058 907 846 81 32959 2453 1079 1978 1938
NM_001313chr44700 339 142 62 1933 ----
NM_001326chr11--1370 2385 95 1142
NM_001328chr41208 --1254 --
NM_001331chr1182830 2305 2077 1884 1768 938 284 173 22770 448 ----
NM_001332chr551138 983 470 450 65 --11586 --
NM_001343chr551700 1102 652 176 95 1604 11358 --
NM_001346chr362635 2205 897 621 540 396 2933 311 1629 12268
NM_001351chr321346 159 ------
NM_001364chr11184693 4484 4403 4226 4208 3874 3366 3279 3169 2952 2910 1679 1444 1365 1286 1140 894 268 ------
NM_001380chr103852 776 678 1684 ----
NM_001383chr171183 1657 1289 --
NM_001385chr82339 325 ------
NM_001386chr852096 2024 2015 1591 756 11713 ----
NM_001387chr572783 2702 745 633 601 189 139 ------
NM_001390chr1872780 2774 2666 2377 2367 1452 998 32537 1137 489 13202 33011 2299 604
NM_001396chr2132319 1104 26 12004 ----
NM_001399chrX23140 558 --33860 3326 1488 --
NM_001400chr11492 11014 1183 11317
NM_001402chr641965 1725 1492 308 31868 392 377 ----
NM_001406chr1771478 1238 434 367 187 66 41 21651 1352 ----
NM_001407chr351681 1482 484 385 271 ------
NM_001408chr151511 1471 1441 1093 1054 ------
NM_001412chrX53219 2448 536 206 129 135 --11025
NM_001419chr19114817 4448 4315 3910 3904 3521 3167 2990 1025 484 64 11338 23701 773 --
NM_001423chr1241922 1406 765 274 ------
NM_001427chr722034 1469 12103 11935 --
NM_001429chr221885 1774 1766 --
NM_001430chr271816 1597 1572 492 359 295 228 1163 ----
NM_001431chr631219 290 246 ------
NM_001432chr493886 3533 3485 1444 1197 758 710 403 350 21234 239 ----
NM_001438chr153111 2465 1032 682 182 ----1173
NM_001440chr862664 1988 961 738 653 62 ----1947
NM_001448chrX41547 1295 385 359 1410 1204 --
NM_001449chrX61223 519 274 218 65 48 --1876 --
NM_001453chr641671 1475 1455 325 ------
NM_001460chr1103544 3502 3361 3033 2877 2339 2224 151 129 123 12792 --1598
NM_001463chr23335 259 148 --1161 --
NM_001483chr72409 36 ------
NM_001491chr682735 2565 2541 1807 1740 1660 461 385 1236 --22661 524
NM_001493chrX3580 207 175 ------
NM_001497chr982685 2471 2428 2172 2064 1887 831 641 2680 236 12477 --
NM_001498chr64540 517 371 113 ------
NM_001518chr73843 414 398 ------
NM_001527chr6104792 4425 3735 1661 829 770 632 475 407 151 1290 ----
NM_001530chr142742 180 ------
NM_001542chr132734 2381 235 11912 32816 2697 241 --
NM_001543chr5124655 4235 4040 1627 1503 962 734 606 600 559 297 267 13025 24378 1864 --
NM_001553chr4180 --166 --
NM_001554chr1--2439 135 ----
NM_001560chrX32102 1868 335 22019 309 12624 --
NM_001565chr42261 109 ------
NM_001570chr351417 1355 1247 1217 218 ------
NM_001584chr1141177 1097 446 104 ------
NM_001587chrX41713 1453 798 437 22263 1509 ----
NM_001604chr112817 788 ------
NM_001609chr1074158 4109 3669 3437 3320 1108 1085 12884 ----
NM_001616chr273419 3364 3136 2783 763 451 85 12583 ----
NM_001617chr211230 ------
NM_001620chr114666 553 540 67 ----1710
NM_001621chr742833 778 632 348 ------
NM_001621chr742833 778 632 348 ------
NM_001634chr652045 1588 1549 1522 1496 ------
NM_001650chr1862961 2915 1324 1242 476 227 14104 11375 --
NM_001655chr1121872 1579 42085 1948 866 113 ----
NM_001659chr1282625 2555 2490 1729 1063 911 692 167 12563 ----
NM_001663chr1422731 2605 --1321 --
NM_001664chr321015 276 1746 ----
NM_001668chr172285 1934 1836 1823 646 91 71 --12209 --
NM_001670chr22137 ------
NM_001674chr121142 90 --11090 --
NM_001677chr13937 836 136 --1296 --
NM_001681chr122720 254 1540 ----
NM_001682chr1272752 1993 765 578 394 172 95 --22933 481 --
NM_001684chr1144049 3804 3768 3391 3254 3238 2973 1552 1176 827 715 562 532 330 22875 2830 --11241
NM_001685chr211102 ----1152
NM_001690chr321887 391 21667 66 ----
NM_001693chr841179 1111 1036 839 31047 1029 445 ----
NM_001695chr864083 3918 2964 1574 1013 193 1465 ----
NM_001699chr1941550 1440 1174 520 ------
NM_001701chr931475 1357 564 ------
NM_001709chr11----32566 1959 431 --
NM_001714chr122578 198 ------
NM_001717chr1541415 1326 608 442 --177 --
NM_001718chr621246 388 ------
NM_001722chr81188 1507 1470 169
NM_001742chr751631 1171 411 160 46 ------
NM_001743chr2287 31 ------
NM_001745chr55929 825 465 365 234 ------
NM_001746chr592920 2482 2461 2195 2030 2024 1833 1016 541 --22511 206 --
NM_001753chr73665 618 54 21521 594 ----
NM_001754chr21144267 4098 3593 3222 3203 3103 3064 2996 2940 2869 2754 1193 1075 596 --13119 1870
NM_001755chr1612038 11435 12005 --
NM_001759chr12164959 4830 4802 4409 3758 3486 3413 3276 1851 1159 1131 1108 1064 845 75 60 15263 12073 --
NM_001773chr131290 1000 105 11516 1506 --
NM_001777chr3103460 3439 3141 2827 2714 2554 1513 1391 937 607 24042 952 ----
NM_001788chr72960 855 ----1152
NM_001789chr321484 1218 ------
NM_001791chr141333 1147 953 23 ------
NM_001792chr182948 279 1308 ----
NM_001797chr162675 548 ------
NM_001800chr192172 80 ------
NM_001806chr1962890 2530 1159 927 280 129 12789 32900 805 365 --
NM_001812chr42274 126 ------
NM_001822chr27676 632 524 514 508 192 137 191 ----
NM_001826chr12350 90 2161 66 ----
NM_001830chrX73493 3355 3283 3196 3009 1270 575 ----31618 621 440
NM_001833chr92273 92 ------
NM_001839chr15663 599 488 282 158 ------
NM_001845chr1351107 548 540 359 257 ------
NM_001854chr1--2532 233 --11032
NM_001858chr664086 4012 3349 1785 1252 286 1379 127 --
NM_001859chr983465 3382 2931 1581 948 457 90 71 --21282 300 --
NM_001874chr1254795 4423 4352 3944 1161 25232 121 ----
NM_001875chr221068 772 1341 ----
NM_001892chr52512 56 ------
NM_001894chr2241207 837 201 145 1957 1309 --
NM_001902chr14380 284 172 33 153 ----
NM_001923chr11184 ----1652
NM_001931chr11185 ------
NM_001938chr141900 1769 1481 1205 11816 1634 --
NM_001945chr521356 1050 11379 21366 1245 --
NM_001946chr123994 331 52 ------
NM_001948chr1561286 1258 1115 948 833 500 ------
NM_001949chr672796 2478 2302 2058 842 790 706 ------
NM_001951chr81126 ------
NM_001957chr442103 1795 1750 832 12154 ----
NM_001964chr54434 245 175 94 ------
NM_001969chr1493316 3310 3239 3224 1040 523 395 306 227 --12903 --
NM_001981chr161684 1595 891 739 391 118 21474 46 ----
NM_001987chr1264180 2965 1216 627 510 500 24096 1712 1534 --
NM_001995chr461518 1152 1072 577 328 138 --1599 --
NM_001999chr561524 1333 1271 551 327 112 ------
NM_002006chr4135833 5583 5445 5018 4587 4571 1584 1183 1114 665 523 475 413 35101 4286 1194 ----
NM_002009chr1562812 2782 2566 2232 1753 867 11071 ----
NM_002010chr13169 1393 ----
NM_002015chr13102973 2967 2935 2501 2482 2103 1081 484 182 107 --13181 1983
NM_002017chr1151408 1262 339 132 100 ------
NM_002023chr12286 136 --11512 --
NM_002024chrX41403 882 807 309 ------
NM_002025chrX149254 8989 8941 8885 8048 6985 6974 6890 6879 6676 6588 6235 1114 629 58755 8357 2215 1980 647 17346 --
NM_002026chr23902 744 91 1182 ----
NM_002028chr142856 136 ------
NM_002033chr1153154 811 416 263 102 2693 331 ----
NM_002039chr4--2133 23 2885 351 --
NM_002040chr2131196 774 667 ----1915
NM_002044chr154558 407 401 61 21167 385 ----
NM_002045chr32290 95 ------
NM_002048chr92839 214 ------
NM_002056chr24872 578 325 288 ------
NM_002062chr62583 296 --21448 626 --
NM_002063chrX5976 333 256 137 30 ------
NM_002069chr741651 614 583 253 21245 759 ----
NM_002072chr94951 903 307 74 ------
NM_002074chr131530 1098 599 ------
NM_002076chr1283287 3182 3162 2985 2520 2238 1181 1016 21119 48 1109 33119 2062 296
NM_002077chr962008 1871 861 814 761 46 22094 612 ----
NM_002080chr1661011 796 700 346 149 36 ------
NM_002081chr231751 1098 178 ------
NM_002092chr4145061 4967 4918 4780 3960 3814 3785 3412 1822 1798 1207 1026 351 63 --23242 1162 11233
NM_002095chr82295 97 --2289 54 --
NM_002114chr62497 51 188 1386 --
NM_002126chr17103816 3391 3135 3084 2623 1659 1446 1242 211 51 185 1461 --
NM_002128chr1331885 1572 30 22048 504 1267 --
NM_002137chr741849 846 280 258 12047 11993 12076
NM_002139chrX--1570 1153 --
NM_002143chr11748 ------
NM_002146chr1751452 1387 1200 576 117 11440 ----
NM_002147chr172923 156 --1639 1276
NM_002158chr263213 2874 2520 1189 568 495 53623 3578 2968 2729 1362 11504 --
NM_002166chr23537 511 242 ------
NM_002196chr202336 260 ------
NM_002196chr202336 260 ------
NM_002198chr51194 1622 ----
NM_002199chr45993 890 361 206 37 ------
NM_002210chr263132 2907 2487 1405 895 566 33114 2189 1277 12853 1327
NM_002211chr1041088 841 714 260 --1352 --
NM_002214chr795466 4943 4881 4837 4092 3639 3485 1095 1069 15277 ----
NM_002221chr1102871 2751 2629 2505 2143 1088 492 419 150 69 32963 1163 864 22469 465 --
NM_002222chr321066 879 11087 ----
NM_002223chr1253433 3217 2956 2938 1478 12800 22712 993 13741
NM_002228chr131258 775 493 ------
NM_002229chr192494 455 ------
NM_002230chr176993 445 402 322 204 171 ------
NM_002234chr125695 675 604 579 528 ----1650
NM_002240chr21295 76 ------
NM_002241chr172936 2321 947 856 618 557 504 12170 ----
NM_002242chr221294 495 11300 22032 1323 --
NM_002247chr102909 675 ------
NM_002253chr42993 73 ------
NM_002254chr252276 2177 1513 663 443 1542 1792 --
NM_002264chr374240 3772 3404 3118 806 483 318 14467 24871 937 --
NM_002266chr172184 62 1253 ----
NM_002267chr1332417 2390 2059 12025 1760 --
NM_002269chr61350 ------
NM_002270chr585405 5349 2165 1627 1598 1472 1229 1027 15488 1593 --
NM_002271chr1382264 2229 2155 1572 883 531 420 67 --1206 --
NM_002285chr2113596 3464 3042 2682 2545 1308 1223 1190 981 883 837 23666 3365 12604 1279
NM_002293chr162469 2229 2080 1939 1048 399 ----12065
NM_002296chr131696 1593 1168 ----1328
NM_002298chr1341446 1060 468 214 1222 1430 --
NM_002310chr5126350 5613 4191 2222 1283 1159 1044 970 691 592 337 81 36132 4162 1666 36438 5947 1316 --
NM_002312chr131684 ------
NM_002313chr10184856 4800 4713 4672 4545 4295 3654 3575 3415 3378 3284 3239 1698 1227 1134 1027 947 732 44579 4486 3893 496 34759 3995 757 11776
NM_002334chr1172042 1320 713 683 618 131 34 31847 1591 1366 ----
NM_002336chr1264866 3594 1664 1391 1339 1264 11159 ----
NM_002345chr124648 637 555 42 ------
NM_002351chrX2556 294 21493 1412 ----
NM_002355chr1261111 1070 1058 478 184 175 ------
NM_002356chr622515 268 12291 ----
NM_002359chr1763515 1634 1240 1131 936 739 22967 2845 23764 2781 --
NM_002360chr722660 2352 --12106 --
NM_002372chr5151 1557 ----
NM_002374chr243567 2713 2561 982 --12463 1377
NM_002375chr352234 1454 764 683 498 11712 ----
NM_002381chr22367 284 --192 --
NM_002382chr142840 281 1881 11188 --
NM_002385chr183469 243 225 ----11561
NM_002387chr594292 4043 3847 3758 3307 1963 1316 841 413 --51688 1660 1404 349 273 --
NM_002395chr631426 1417 517 --1215 --
NM_002397chr522095 36 ------
NM_002398chr261087 579 403 378 267 181 11149 --11449
NM_002408chr142719 536 --193 --
NM_002430chr2232570 833 677 32602 2468 1002 21893 1014 --
NM_002438chr101580 ------
NM_002449chr531168 925 196 1976 --1857
NM_002451chr963264 2906 1054 857 406 62 23323 1094 23035 958 1944
NM_002460chr693605 2655 2348 2334 1441 946 826 767 407 23181 858 41513 1246 952 671 12674
NM_002473chr2221002 92 ------
NM_002481chr1117495 6766 6547 5421 5035 3128 2994 2840 584 305 184 27156 6074 --11783
NM_002482chr11670 --1461 1225
NM_002485chr822124 1991 --12115 --
NM_002486chr93926 486 88 ------
NM_002487chr152562 251 ----131
NM_002498chr13------1147
NM_002499chr1552416 2245 1543 917 769 --31536 854 527 --
NM_002501chr1994000 3801 2600 1532 1197 1147 902 79 31 11578 21566 987 --
NM_002505chr641581 1145 597 40 1528 ----
NM_002515chr1451766 1544 441 247 92 21731 196 ----
NM_002518chr251206 1196 1163 1028 201 --1220 --
NM_002519chr1151056 971 600 386 322 ----1150
NM_002526chr621438 639 ------
NM_002537chr154870 796 438 395 --1757 --
NM_002538chr51579 --2428 228 --
NM_002540chr92624 522 3664 451 197 ----
NM_002545chr11105074 5013 4571 3661 3613 3372 1497 1259 536 105 ------
NM_002547chrX123985 3576 3376 1564 1519 1354 1043 963 762 658 351 238 23067 1381 14056 --
NM_002553chr72495 92 ------
NM_002556chr1162013 1660 1341 856 626 287 --1636 --
NM_002568chr81419 ------
NM_002572chr113351 342 294 --1110 --
NM_002576chr1141232 870 417 283 2344 114 ----
NM_002577chr3114053 3941 3895 3813 3506 2575 1431 964 930 465 432 11297 ----
NM_002578chrX2307 106 ------
NM_002579chr191129 ----11476
NM_002581chr9105362 5320 4863 4291 3729 3488 2148 1826 1027 849 11659 14110 --
NM_002586chr621019 372 --21041 632 --
NM_002594chr2031613 798 249 ----1332
NM_002595chr12101960 1845 1814 1770 1715 1580 1318 718 470 409 11280 ----
NM_002599chr115939 338 322 142 113 21126 216 1852 --
NM_002600chr131803 550 515 ------
NM_002605chr153976 319 37 158 1267 --
NM_002607chr741286 887 393 47 181 1874 --
NM_002609chr54400 367 131 85 ------
NM_002610chr252788 2719 816 393 295 ------
NM_002612chr741552 1393 695 410 21747 61 1160 --
NM_002613chr1695254 4896 4250 3416 2114 1930 1103 616 539 --11704 23507 3285
NM_002628chr331029 861 123 ------
NM_002633chr14504 468 412 379 ------
NM_002641chrX51830 525 329 192 143 1176 1765 --
NM_002642chr13251 203 176 ------
NM_002645chr1133155 2633 364 3968 667 278 --1655
NM_002655chr845252 3339 1127 101 21701 1211 ----
NM_002657chr2041527 1439 1418 1369 --1870 --
NM_002658chr104777 646 262 39 1929 ----
NM_002660chr20169 ------
NM_002670chr341613 1208 479 470 1556 11507 --
NM_002687chr141157 21115 51 ----
NM_002693chr152323 313 ------
NM_002698chr1952533 2365 2315 1129 884 22834 80 ----
NM_002701chr6196 ------
NM_002702chr123796 663 657 ----1290
NM_002703chr421669 217 21784 149 11279 --
NM_002709chr273572 3352 2390 2340 2289 1251 879 12543 ----
NM_002710chr122739 224 --1404 --
NM_002715chr541243 1185 912 468 --21080 244 --
NM_002716chr11133679 3486 3470 3147 2913 2832 2774 2551 2516 849 221 65 38 33115 507 237 ----
NM_002717chr83244 69 34 ------
NM_002718chr332385 53 47 ------
NM_002719chr1462011 1598 926 107 72 40 11684 11906 --
NM_002721chr9258 33 ------
NM_002725chr154174 3637 3548 1779 1113 13401 ----
NM_002726chr65510 484 447 195 109 ------
NM_002727chr101631 ----1202
NM_002731chr192974 2901 2890 2749 1950 841 794 560 102 12297 ----
NM_002734chr1762136 1783 853 651 438 115 22215 1923 --11720
NM_002736chr741961 1722 1612 94 11975 ----
NM_002737chr1786210 6179 5047 4453 4428 4146 1651 1625 26233 6125 55787 5100 4285 4122 1372 --
NM_002738chr162321 32 21054 110 1808 --
NM_002740chr362795 2545 2356 1930 1828 465 1888 ----
NM_002742chr142753 95 ------
NM_002745chr22124278 4264 4120 4071 3602 3524 3420 1554 1396 318 295 54 11165 31258 890 144 169
NM_002748chr15----1128 --
NM_002753chr41163 ------
NM_002756chr171695 ------
NM_002760chrY95528 5193 4925 4897 4741 1590 1441 772 626 24405 185 22262 943 --
NM_002763chr13425 202 153 ------
NM_002775chr10--1153 ----
NM_002787chr72637 209 1233 1588 --
NM_002797chr142203 30 ------
NM_002811chr16177 --1357 --
NM_002822chr1221556 339 21127 636 ----
NM_002825chr71466 1611 ----
NM_002827chr2011373 31246 1196 452 ----
NM_002828chr182991 182 --1837 --
NM_002833chr1551204 1160 502 212 113 1341 1640 --
NM_002834chr1273933 3716 3478 3301 3059 1489 902 11479 --12667
NM_002835chr72690 306 --1619 1480
NM_002837chr12124497 4478 4369 4212 3993 3837 3568 1564 1387 1293 196 96 13958 1892 --
NM_002838chr111095 1463 ----
NM_002839chr973569 3384 3254 3180 2712 2660 986 ------
NM_002840chr1--21628 459 ----
NM_002843chr1153326 894 839 655 22 2529 218 ----
NM_002844chr631232 1161 550 ------
NM_002850chr1921142 780 --1128 --
NM_002857chr152561 2502 1027 862 202 11088 1228 --
NM_002858chr141359 1178 434 243 ------
NM_002868chr1272087 1906 1819 1749 616 563 328 --21589 874 1400
NM_002869chr1122166 855 2725 570 ----
NM_002871chr13660 328 96 ------
NM_002874chr932482 2058 699 32342 1961 630 --11006
NM_002880chr33759 726 65 1809 ----
NM_002886chr3125194 5175 4789 4158 3568 3437 1347 654 586 580 241 78 33943 3551 1156 23778 1506 --
NM_002891chr153163 140 131 ------
NM_002892chr1441656 1559 1437 166 ------
NM_002893chrX--1352 125 --
NM_002897chr22552 27 172 --1119
NM_002906chr114926 829 271 27 ------
NM_002911chr1931678 397 330 ------
NM_002926chr411171 --1359 --
NM_002940chr421443 191 --1365 1198
NM_002941chr341175 1165 315 275 ------
NM_002942chr33347 210 175 1921 1516 --
NM_002946chr11469 1235 1513 --
NM_002948chr331019 903 179 1106 --11242
NM_002955chr651683 1412 1405 1365 1238 11808 1378 11766
NM_002957chr963797 2671 863 408 173 64 1212 13570 --
NM_002959chr184415 3726 3605 3526 2824 2753 1431 1227 24132 1130 1117 --
NM_002968chr1631010 905 35 1930 ----
NM_002971chr331065 382 315 ------
NM_002973chr121123 ------
NM_002977chr242849 2281 1170 925 23277 990 ----
NM_002994chr461755 1479 1338 493 144 58 ------
NM_002996chr1631875 553 528 ----11314
NM_002997chr271823 1510 1337 1301 534 277 217 ------
NM_002998chr862148 1952 1702 863 813 423 11454 ----
NM_003001chr172213 2177 2154 2100 667 196 58 32032 731 329 1571 --
NM_003010chr1752364 2333 1943 697 592 ------
NM_003011chr941648 1369 243 216 ----21091 124
NM_003012chr842978 1219 687 467 11146 1138 11963
NM_003013chr42831 57 1165 ----
NM_003014chr731510 1409 1303 ------
NM_003016chr1732027 1679 247 --22003 370 --
NM_003017chr631175 967 892 ------
NM_003020chr152298 98 ------
NM_003022chrX----1465 --
NM_003026chr92976 286 ------
NM_003028chr942682 2656 2469 1533 12505 22912 245 --
NM_003029chr12521 255 11047 2543 481 11311
NM_003030chr341599 1358 1351 712 11375 ----
NM_003031chr162762 22 --1904 --
NM_003042chr342239 1775 854 410 11573 11419 1354
NM_003043chr352977 910 476 384 35 44107 2872 2778 2670 ----
NM_003045chr1364796 4668 4567 4214 889 277 14491 31629 1017 783 --
NM_003046chr855300 5063 1105 1097 610 15383 24465 1883 --
NM_003051chr13729 666 552 11566 1565 --
NM_003069chrX3641 270 190 ------
NM_003074chr3102198 2133 1872 802 530 409 288 89 82 71 1539 ----
NM_003079chr1741037 775 215 100 1393 ----
NM_003081chr201436 --1349 --
NM_003082chr141128 140 ----
NM_003095chr122379 283 ------
NM_003099chr1572522 2266 1721 769 547 334 209 15006 ----
NM_003107chr632197 490 454 11799 ----
NM_003108chr2126233 5581 5053 4668 4477 2584 2125 1800 1418 1000 253 51 47203 5428 5121 373 ----
NM_003110chr1711098 ------
NM_003111chr2272 64 1415 ----
NM_003112chr742636 2069 1037 113 ------
NM_003113chr2127 1809 1259 --
NM_003115chr12466 381 ------
NM_003128chr282708 2443 1743 1130 587 355 272 99 --12777 --
NM_003133chr13839 768 277 ------
NM_003137chr64737 525 486 108 1703 21697 497 --
NM_003150chr1762184 1467 1456 571 508 356 --21788 402 --
NM_003151chr2160 ------
NM_003155chr83860 619 108 1500 ----
NM_003156chr1131355 527 346 --1354 --
NM_003161chr17103460 3351 3128 2874 2601 2589 2309 1406 916 632 12364 11129 --
NM_003165chr93373 263 178 --2551 515 --
NM_003174chr102556 288 ------
NM_003178chr341590 854 501 109 12159 2872 179 --
NM_003185chr2041032 825 243 120 --2322 162 --
NM_003188chr62846 834 ------
NM_003189chr163266 646 180 173 123 39 --13194 --
NM_003199chr1895663 5655 4467 3825 2231 1738 1714 921 799 34427 2085 1329 --24593 1209
NM_003204chr1741374 1177 600 245 ------
NM_003205chr1542294 2008 1721 1565 11948 ----
NM_003216chr22102716 2461 2365 2109 1101 1031 921 635 262 255 11012 12315 --
NM_003217chr1271659 1549 1531 1302 704 586 201 11919 1418 --
NM_003220chr621203 95 --11427 --
NM_003221chr694125 3620 3210 2774 1651 1436 1353 799 260 ------
NM_003222chr2021257 177 --21121 1057 --
NM_003224chr203855 272 113 ------
NM_003234chr392204 2058 1684 855 731 715 532 278 48 22384 490 ----
NM_003239chr1451060 835 795 251 168 --1879 --
NM_003242chr352292 2126 1556 894 95 --1672 --
NM_003246chr1522052 116 11698 ----
NM_003247chr651766 1534 1436 291 132 1453 11772 --
NM_003253chr2151847 1642 1514 564 43 11621 ----
NM_003255chr1772063 1922 1828 1056 866 464 82 12645 21985 1866 1592
NM_003257chr1561330 1232 1115 1038 898 347 --1978 --
NM_003262chr3104931 3836 3708 2083 2063 1968 1533 1408 1348 415 14217 --14098
NM_003269chr621260 1022 ----1966
NM_003274chr2152714 1887 802 408 196 1433 1693 --
NM_003275chr91120 ------
NM_003285chr13551 513 35 --1169 --
NM_003292chr131708 712 655 1729 11767 --
NM_003297chr123334 241 37 ------
NM_003298chr3126065 5897 4026 2115 1937 1904 1525 1210 868 520 125 115 1182 35909 2276 1093 --
NM_003299chr12--1219 ----
NM_003317chr142828 789 1875 ----
NM_003319chr22930 308 174 ----
NM_003326chr182691 2633 2503 2352 2333 2114 751 314 --12444 --
NM_003337chr521235 686 ------
NM_003338chr102753 485 11881 --1140
NM_003339chr511567 ------
NM_003340chr43432 176 62 ------
NM_003342chr1772994 2868 1098 801 409 342 72 ------
NM_003344chr751505 1432 1099 511 170 1705 11217 --
NM_003347chr2261903 1875 1432 384 272 265 12252 31840 1678 611 --
NM_003348chr1261595 1449 1414 1306 1120 1114 11443 ----
NM_003350chr831011 866 322 ------
NM_003352chr231013 834 60 ------
NM_003358chr91122 ------
NM_003368chr11240 ------
NM_003369chr113862 531 369 12478 12255 --
NM_003370chr19--1766 ----
NM_003371chr962161 1865 764 739 460 36 ------
NM_003373chr1061942 1758 1354 603 362 266 --1196 --
NM_003374chr52584 250 ------
NM_003375chr103319 170 155 ------
NM_003376chr641308 330 321 277 ------
NM_003376chr641308 330 321 277 ------
NM_003383chr91180 ------
NM_003385chr22320 146 --1724 --
NM_003392chr383338 3260 2708 2660 1745 1713 542 135 ----11650
NM_003394chr121510 --2725 718 --
NM_003400chr23614 342 154 ------
NM_003404chr2021855 830 ------
NM_003406chr861911 1561 1484 1238 1228 539 11411 11333 --
NM_003409chr1831307 325 175 ------
NM_003410chrX53026 2621 2287 2277 1147 22374 1198 ----
NM_003411chrY31646 1501 183 11123 ----
NM_003412chr331121 359 302 ------
NM_003413chrX21988 1712 1320 ----
NM_003423chr1931907 1899 1015 12649 ----
NM_003432chr52230 118 --1516 --
NM_003439chr733151 1245 41 42856 2770 1311 730 12998 --
NM_003442chr11--2152 104 ----
NM_003453chr132696 307 ------
NM_003458chr353053 2924 2630 1159 930 --23713 3697 --
NM_003462chr141537 426 351 57 1112 ----
NM_003463chr643229 3126 906 210 1898 11018 --
NM_003468chr283507 2996 1538 868 679 673 366 212 --34139 4128 1249 --
NM_003472chr631505 1128 229 21407 290 ----
NM_003473chr102888 179 ------
NM_003474chr1032034 1789 460 22209 358 1842 --
NM_003478chr1163354 3175 3123 3038 1208 465 --23275 325 --
NM_003483chr1272949 2816 2784 2715 2658 2495 2126 ------
NM_003487chr17190 ------
NM_003489chr2143445 3075 1084 895 22132 795 12849 --
NM_003496chr75794 773 672 135 86 1291 ----
NM_003498chr163968 791 644 12533 ----
NM_003507chr281803 1679 1563 1507 1330 757 324 142 --193 --
NM_003557chr141426 1285 1100 436 2541 156 11377 --
NM_003559chr1773437 3194 2905 2710 1597 1473 1356 --12856 1356
NM_003566chr1263118 2541 864 851 748 645 12650 ----
NM_003574chr18125605 4178 4160 3995 3940 1703 1591 1215 692 608 279 26 15390 --11865
NM_003576chr13102922 2873 2705 2686 2297 2223 2197 2014 928 837 12000 ----
NM_003580chr81516 ------
NM_003583chr1283764 3552 3442 2693 1471 805 773 670 ------
NM_003589chr1341168 291 209 77 --2310 231 --
NM_003590chr2102849 1321 1203 1129 1075 1004 631 227 62 29 --11428 --
NM_003601chr4145 ------
NM_003603chr441971 1811 662 226 22123 2071 ----
NM_003613chr153572 212 124 --1668 --
NM_003615chr353462 3021 494 246 204 53102 2656 1292 773 376 --1873
NM_003618chr231205 400 246 ----11302
NM_003621chr111512 ------
NM_003626chr112297 204 11305 11236 --
NM_003631chr105894 812 774 331 218 1723 ----
NM_003633chr572301 2158 2049 1889 1651 1015 606 ----22080 565
NM_003637chr131138 492 419 --11098 11454
NM_003659chr241161 828 157 110 --1384 1815
NM_003663chr322174 481 23513 2624 ----
NM_003664chr52484 130 1496 ----
NM_003670chr351478 1322 1175 985 543 11394 ----
NM_003671chr9113077 2980 2806 2584 2519 2269 1202 740 733 460 393 13470 ----
NM_003672chr13423 87 30 ------
NM_003677chr1231902 1885 735 ------
NM_003679chr173158 3125 3087 2947 2424 2156 1321 12122 ----
NM_003685chr191837 1382 ----
NM_003692chr91244 ------
NM_003701chr132709 32 ------
NM_003713chr12607 436 11465 21122 56 --
NM_003714chr533039 2570 553 1627 ----
NM_003743chr242142 904 789 193 41939 751 260 73 ----
NM_003749chr1332267 1596 936 11692 12239 --
NM_003759chr493800 3386 2790 1086 977 918 355 319 111 13563 ----
NM_003760chr12542 251 ------
NM_003762chr13951 460 189 ------
NM_003763chr2043083 2550 2474 2447 ------
NM_003766chr171508 ------
NM_003768chr151742 1719 747 595 194 1529 ----
NM_003772chr111384 1338 ----
NM_003774chr1223236 2441 1773 23093 2212 13330
NM_003783chr111060 21004 141 ----
NM_003787chr1871731 1512 1497 1456 1268 682 430 11312 ----
NM_003795chr61221 1630 ----
NM_003800chr63916 634 457 22237 490 ----
NM_003808chr173219 135 116 1727 ----
NM_003816chr82397 88 31502 76 65 ----
NM_003822chr142840 1082 882 828 --23132 329 --
NM_003825chr152286 163 ------
NM_003829chr92198 137 ------
NM_003831chr1831806 1548 1461 11760 --1648
NM_003842chr841718 1594 623 50 12285 ----
NM_003846chr13662 620 221 ------
NM_003850chr13179 ------
NM_003861chr1432654 2024 573 22144 715 1319 --
NM_003864chr4173 ------
NM_003872chr242789 1876 888 692 ------
NM_003873chr1062295 1013 949 805 594 211 1972 ----
NM_003885chr1752316 1026 1010 768 395 --1377 --
NM_003887chr242305 1606 748 339 3804 795 705 138 --
NM_003899chr1342374 2086 340 22 ----1637
NM_003901chr1042077 1780 1046 150 --22580 51 11977
NM_003902chr12725 189 ------
NM_003908chr2011105 2979 908 ----
NM_003909chr842777 2439 2087 492 12998 1467 --
NM_003913chr6114322 3976 2689 2667 1519 1240 830 762 692 463 324 54247 3430 1694 1382 469 11560 --
NM_003916chrX3260 231 27 ------
NM_003924chr431548 1409 1140 ------
NM_003930chr762425 2136 2109 1996 1703 367 ------
NM_003932chr2241849 1778 1470 1402 11613 --1450
NM_003934chr941259 1097 478 353 --11155 --
NM_003941chr761675 1628 533 439 366 58 ------
NM_003947chr3--21359 1055 ----
NM_003948chr482423 2238 1973 1884 585 460 425 57 22329 134 2967 289 --
NM_003949chr1721931 1691 --11656 --
NM_003953chr182900 2636 2378 2344 2267 870 827 662 --12211 --
NM_003957chr112764 734 ------
NM_003958chr683028 2707 2634 2504 1490 1075 521 453 23652 1123 13601 --
NM_003966chr5217269 7218 5852 5762 5652 5041 3069 3042 2805 2756 2697 2689 2153 1994 1946 1654 1555 1106 525 41 25 77367 7302 4793 2965 2858 2625 260 47609 6413 1147 642 176
NM_003972chr102286 48 ------
NM_003973chr3131 ------
NM_003980chr64580 525 273 69 ----1112
NM_003981chr153724 702 35 1897 1837 --
NM_003983chr1674271 3657 3454 3346 2873 1781 1040 31606 1119 823 1923 --
NM_003994chr1221704 1389 1611 23275 132 --
NM_003996chr6--136 ----
NM_003998chr42589 162 ------
NM_004004chr1341302 446 405 329 --11030 --
NM_004006chrX52511 2416 1067 912 226 ----11964
NM_004007chrX52511 2416 1067 912 226 ----11964
NM_004009chrX52511 2416 1067 912 226 ----11964
NM_004010chrX52511 2416 1067 912 226 ----11964
NM_004011chrX52511 2416 1067 912 226 ----11964
NM_004012chrX52511 2416 1067 912 226 ----11964
NM_004013chrX52511 2416 1067 912 226 ----11964
NM_004014chrX52511 2416 1067 912 226 ----11964
NM_004015chrX52511 2416 1067 912 226 ----11964
NM_004016chrX52425 2330 981 826 140 ----11878
NM_004017chrX52511 2416 1067 912 226 ----11964
NM_004018chrX52425 2330 981 826 140 ----11878
NM_004020chrX52511 2416 1067 912 226 ----11964
NM_004021chrX52425 2330 981 826 140 ----11878
NM_004022chrX52425 2330 981 826 140 ----11878
NM_004023chrX52425 2330 981 826 140 ----11878
NM_004024chr141501 951 449 68 --11449 --
NM_004028chr1862961 2915 1324 1242 476 227 14104 11375 --
NM_004035chr1785182 4847 4222 4205 4197 3818 3180 415 --1523 --
NM_004036chr23498 176 78 1582 --1480
NM_004050chr1442676 2461 2331 744 12172 ----
NM_004056chr82400 391 1446 ----
NM_004067chr731066 1006 115 11475 1624 --
NM_004075chr123584 137 124 1407 ----
NM_004080chr721481 1021 ------
NM_004081chrY51827 1655 1372 254 200 ------
NM_004087chr352061 1603 1508 610 22 21759 83 11302 11263
NM_004089chrX3409 361 54 ------
NM_004090chr1733360 2594 2303 12537 22661 225 --
NM_004093chr1353262 2403 2382 2311 1309 22185 2078 ----
NM_004094chr1483068 2386 1871 960 889 441 410 50 1287 ----
NM_004096chr1041978 1799 1643 249 ------
NM_004098chr1021135 922 ------
NM_004099chr942069 1973 1929 847 21900 453 ----
NM_004100chr632370 2210 878 12391 ----
NM_004109chr1152231 1925 1793 806 346 1160 ----
NM_004114chrX51184 929 840 457 367 --11089 --
NM_004117chr632221 2061 280 --1744 --
NM_004119chr132617 301 ------
NM_004124chr1483153 3129 2300 2240 2177 1382 530 112 13214 11406 --
NM_004128chr133439 162 152 ------
NM_004130chr32575 541 ----151
NM_004136chr1553051 2883 2639 1002 334 1169 ----
NM_004156chr82547 462 --1100 --
NM_004161chr22507 457 21250 263 ----
NM_004171chr11169450 9294 8393 7563 7146 6788 6423 6316 6190 5950 3655 3187 2605 2439 2346 922 59251 7834 7178 2708 26 49018 7738 2285 281 --
NM_004180chr24533 396 181 136 ------
NM_004181chr42345 110 --1281 --
NM_004187chrX41302 1285 1202 84 165 ----
NM_004200chr1142889 2097 226 160 1247 --13064
NM_004228chr191130 ------
NM_004229chrX31651 1544 875 ------
NM_004231chr71259 ------
NM_004232chr18113840 3724 3473 2904 1511 1476 933 850 760 654 188 23384 3116 --13569
NM_004233chr671457 1305 1113 507 413 160 21 129 --11174
NM_004238chr22216 105 --1230 --
NM_004252chr174692 579 528 151 1121 ----
NM_004261chr11784 ------
NM_004263chr261624 1486 1405 692 343 222 1193 ----
NM_004272chr571651 1456 1396 1362 790 585 521 1300 --21888 1640
NM_004273chr10104685 3809 3225 1857 1701 1561 1357 736 411 54 --21606 1388 --
NM_004274chr1452902 1173 1038 848 271 1706 ----
NM_004277chr681226 1172 1149 1073 646 581 476 152 ------
NM_004279chr781979 1736 1520 1458 797 519 374 307 ----1337
NM_004280chr61163 ------
NM_004282chr63537 219 79 ------
NM_004283chr191174 1319 1926 --
NM_004293chr951113 544 347 286 121 12336 2979 102 --
NM_004302chr1252938 2757 2121 1987 665 --192 --
NM_004311chr1043038 2968 1978 641 176 ----
NM_004313chr171415 ----1425
NM_004319chr162548 2494 2456 2309 1083 380 13037 ----
NM_004326chr151250 1139 1029 407 371 --11115 --
NM_004329chr1031443 908 345 ------
NM_004331chr81957 1753 11752 --
NM_004337chr872261 1948 1864 897 483 263 86 11858 ----
NM_004338chr1887044 7035 6950 5733 4311 2382 1261 498 21582 872 --1141
NM_004339chr2141578 359 212 33 21882 1763 ----
NM_004342chr722291 220 --1410 --
NM_004349chr831129 913 420 ------
NM_004350chr152005 1879 1701 713 642 12115 ----
NM_004354chr43614 576 73 ------
NM_004370chr651456 832 782 676 651 32180 1490 1447 11511 160
NM_004379chr21624 11325 ----
NM_004380chr1652519 2192 645 235 75 2918 432 138 --
NM_004384chr532263 1756 308 ------
NM_004386chr1932292 1615 842 ------
NM_004392chr1361830 1738 929 516 240 128 2488 107 ----
NM_004393chr322364 1459 22024 1581 ----
NM_004397chr1153598 1559 1545 1012 263 13759 13514 --
NM_004411chr74791 706 667 218 ------
NM_004414chr2131506 362 299 11190 ----
NM_004426chr1251966 1772 1634 1580 648 --11232 --
NM_004427chr12298 180 21141 72 2975 477 --
NM_004428chr14802 758 610 264 ------
NM_004429chrX61451 1167 1034 566 252 121 --11370 --
NM_004430chr832781 2519 719 1801 11740 1925
NM_004431chr14845 746 534 109 ------
NM_004432chr9--21714 414 ----
NM_004434chr142773 78 ------
NM_004437chr173193 2953 2921 2474 1279 572 141 23390 3057 12439 --
NM_004438chr283148 2768 1166 923 858 673 240 224 ------
NM_004439chr41174 ------
NM_004441chr351193 1127 1078 863 495 11030 11066 --
NM_004442chr161117 1065 633 588 557 355 --1290 --
NM_004444chr72827 568 ------
NM_004447chr121872 198 11168 --
NM_004450chr141250 ------
NM_004454chr332148 1546 94 --1248 --
NM_004457chr211595 1257 ----
NM_004458chrX62573 2459 2392 1787 1755 774 32621 2438 1024 22643 2275 --
NM_004459chr1771899 1560 1508 1348 1257 511 154 ------
NM_004464chr464078 3245 3221 3091 3085 49 2921 312 23470 2746 --
NM_004480chr141747 --1691 --
NM_004481chr142014 734 530 79 12100 1649 --
NM_004482chr21597 --1175 --
NM_004485chr1124378 4345 3815 3742 3472 3228 3009 2935 2806 1054 480 447 24299 33 ----
NM_004491chr1953899 3005 2853 1282 429 --13592 13967
NM_004496chr143918 858 241 ----11337
NM_004500chr1431587 778 334 ------
NM_004504chr242673 2642 2197 2044 21907 489 22926 649 --
NM_004505chr1721281 558 1429 ----
NM_004514chr1762625 2456 2433 1135 834 811 --22953 2164 13073
NM_004516chr1941027 979 845 104 ------
NM_004523chr1061592 1356 1290 572 544 452 ------
NM_004529chr921258 1164 --21303 84 --
NM_004537chr1241036 579 437 170 21299 1093 ----
NM_004540chr212777 93 ------
NM_004549chr1121555 68 21570 569 11534 148
NM_004571chr2183402 3297 3007 2933 2311 2092 1373 764 ------
NM_004575chr441506 565 522 189 ------
NM_004586chrX75419 5151 3663 1851 709 488 195 22114 1204 24841 133 --
NM_004588chr1174022 3906 3450 3091 2784 2596 406 --13857 1512
NM_004592chr12--1155 1200 --
NM_004593chr33771 686 270 ------
NM_004598chr5123325 3025 2919 2854 2732 2567 1125 1046 1001 789 271 59 --13128 --
NM_004612chr974050 4043 3518 3354 764 592 193 13387 ----
NM_004614chr1611813 --11514 --
NM_004615chrX2802 724 ------
NM_004622chr252472 1596 1566 290 271 1707 ----
NM_004637chr311327 ------
NM_004641chr1051360 1348 1325 216 193 ----11120
NM_004643chr142553 546 --1582 --
NM_004654chrY3979 480 461 ------
NM_004660chrY22164 2080 11955 ----
NM_004663chr1551280 1203 1053 605 78 ------
NM_004666chr631366 218 113 ------
NM_004670chr1051710 1458 1131 625 21 41283 1189 498 27 ----
NM_004671chr18277 51 1249 ----
NM_004677chrY2544 160 ------
NM_004685chr1321111 366 1781 22221 982 --
NM_004687chr1751735 1586 540 436 76 11706 --11744
NM_004690chr62655 504 --1251 --
NM_004696chr12856 813 ------
NM_004703chr172725 362 11763 22122 1976 --
NM_004705chr111187 ------
NM_004713chr141149 2554 263 ----
NM_004719chr1262129 1896 1762 1095 503 468 12460 ----
NM_004721chr31354 ------
NM_004723chr121033 682 --1404 --
NM_004725chr1061500 1330 1243 522 394 350 21078 499 ----
NM_004726chrX74489 3890 3869 3632 3586 1935 1102 33544 2054 444 ----
NM_004730chr531467 410 223 --11603 --
NM_004732chr171241 ------
NM_004733chr33606 238 155 ------
NM_004734chr1372767 2727 2425 2307 649 600 465 1512 ----
NM_004736chr141854 1838 1427 171 11932 ----
NM_004739chr113631 459 452 ------
NM_004742chr351650 1374 1250 654 262 31545 329 187 ----
NM_004744chr473747 3681 3592 2974 2930 2733 625 22764 181 13610 1851
NM_004745chr876666 6513 5857 5198 1554 1291 589 14515 44892 4268 2664 81 --
NM_004748chr15114178 3798 3720 3465 3392 2745 2574 1272 250 61 43 2853 634 ----
NM_004755chr1411088 2489 246 1263 --
NM_004758chr173954 315 159 ------
NM_004760chr752209 1642 975 771 266 --2965 567 --
NM_004764chr122206 94 ------
NM_004768chr11198 1739 --11155
NM_004772chr541386 1363 358 79 ------
NM_004774chr1743049 2154 1116 546 1987 32520 1998 223 --
NM_004783chr161150 ------
NM_004787chr41150 148 ----
NM_004788chr1182708 2060 1895 736 498 85 74 65 11931 ----
NM_004791chr132233 38 1128 ----
NM_004795chr1341807 539 371 249 11511 ----
NM_004796chr1482448 2323 2264 2198 2005 1668 1658 440 --22167 935 --
NM_004798chr2073412 3110 1261 635 379 359 168 13430 1500 13165
NM_004799chr1125 --1420 --
NM_004805chr221006 294 2916 230 --11192
NM_004815chr194153 4035 3759 3690 3508 1664 1120 1110 674 23798 1471 13370 1417
NM_004821chr53636 559 509 1829 ----
NM_004822chr1783766 3699 3600 3407 2466 2446 1498 1465 --23475 1224 --
NM_004824chr6----11061 --
NM_004826chr2----1292 --
NM_004834chr2103072 3046 2805 2703 2219 1328 976 702 655 153 ------
NM_004836chr22220 98 ------
NM_004839chr154623 616 539 74 2637 502 ----
NM_004844chr33906 281 156 --1200 --
NM_004845chrX74147 3832 3320 3068 2947 1639 1158 23188 885 11360 --
NM_004850chr231332 1081 624 1107 ----
NM_004857chr1474642 4135 4083 3304 3110 1058 1028 --12909 --
NM_004859chr1752684 1076 853 698 135 --22621 99 --
NM_004863chr1475318 5093 3768 3762 3348 1056 713 33681 1219 1147 --13365
NM_004866chr584586 4521 3176 1895 1256 344 180 115 13367 13313 --
NM_004867chrX1455 2485 259 ----
NM_004869chr1831597 1168 564 ------
NM_004871chr1784321 4218 3596 3458 367 293 206 176 14381 ----
NM_004873chr1442476 2266 1193 541 23239 1278 23139 2454 --
NM_004874chr81474 ------
NM_004884chr1531284 1271 222 --21248 207 --
NM_004888chr93940 682 432 1390 --1807
NM_004890chr17----1249 --
NM_004891chr22214 169 ------
NM_004893chr52416 399 ------
NM_004897chr103902 142 114 ------
NM_004898chr472841 2676 2627 2608 2271 1997 1939 22297 652 1131 --
NM_004899chr23457 303 152 ------
NM_004902chr203562 290 123 2627 45 ----
NM_004904chr796297 5404 4648 4411 4323 1788 279 243 108 ------
NM_004905chr13877 677 61 1161 ----
NM_004923chr113679 668 530 1180 ----
NM_004924chr1911037 --11044 --
NM_004929chr82260 156 11370 ----
NM_004946chr52488 452 --149 --
NM_004952chr1--1694 ----
NM_004956chr773149 3014 2790 1124 138 87 48 ------
NM_004965chr21145 ------
NM_004967chr44405 181 166 135 ------
NM_004969chr10--143 --192
NM_004973chr651577 1393 1259 1222 549 ------
NM_004976chr1184446 4186 3591 3536 3174 1518 1509 531 13694 13411 14240
NM_004985chr1253157 1192 711 255 106 33794 3082 466 --13963
NM_004992chrX158374 7661 7449 7019 7008 6310 6253 5773 5721 5428 5316 2052 1234 1214 932 46639 5588 1832 1205 16729 --
NM_004992chrX158374 7661 7449 7019 7008 6310 6253 5773 5721 5428 5316 2052 1234 1214 932 46639 5588 1832 1205 16729 --
NM_004993chr1461270 569 540 369 299 243 1462 ----
NM_005006chr21693 ------
NM_005010chr732137 1476 107 1223 ----
NM_005011chr771751 1618 1607 1570 1269 259 187 --21340 1224 --
NM_005016chr123259 120 32 ----172
NM_005020chr72585 527 1534 ----
NM_005026chr111895 12022 21777 1704 --
NM_005028chr1032361 2118 833 1205 ----
NM_005032chrX2417 305 ------
NM_005045chr72865 365 ------
NM_005054chr231410 1213 1129 11316 11733 --
NM_005056chr1285381 5313 5285 4768 4530 2179 1812 771 35141 4884 4506 --14957
NM_005063chr1083740 1553 1388 989 961 950 341 22 11547 ----
NM_005065chr1475113 4986 4810 600 351 313 258 21134 973 ----
NM_005066chr12773 70 ------
NM_005068chr641410 1300 136 25 ------
NM_005076chr184230 4213 4172 4157 3801 2640 1377 68 23255 1192 11051 --
NM_005078chr1521318 325 ------
NM_005079chr852615 2269 307 211 179 --12263 --
NM_005080chr224915 725 322 232 ------
NM_005086chr1261514 1189 340 299 192 168 ------
NM_005087chr32115 29 ------
NM_005088chrX3696 576 345 ------
NM_005093chr2055239 4441 3410 256 246 35101 3769 3326 14714 --
NM_005095chr142181 650 218 199 11683 ----
NM_005097chr101221 ------
NM_005105chr152063 682 632 489 179 1696 1795 --
NM_005109chr342035 580 310 139 --1561 --
NM_005112chr43412 171 82 --1395 --
NM_005116chr2084355 4287 4101 3162 1679 1338 144 53 24279 1473 11649 --
NM_005119chr12988 24 1507 ----
NM_005121chr1742793 1530 1366 532 11168 1393 --
NM_005126chr342210 1536 691 640 --1736 --
NM_005135chr1583629 3465 3415 2698 2396 897 751 658 ----13787
NM_005151chr182316 250 42260 1951 841 564 1388 --
NM_005153chr161520 2274 256 ----
NM_005155chr61645 ----1535
NM_005156chr964472 3641 3577 1593 215 192 14745 --13287
NM_005157chr911605 11567 21911 247 --
NM_005160chr22196794 5983 5939 5878 5686 5635 5507 4375 4239 2572 2028 1728 1273 1112 879 533 474 447 207 46487 5042 4365 506 12306 12234
NM_005180chr1041645 526 502 215 --2376 270 --
NM_005188chr11258354 7085 7028 6910 6810 6456 6301 5977 5745 5447 3230 2943 2921 2588 1554 1425 1327 1321 1047 835 713 642 612 346 84 11686 15538 --
NM_005197chr1495921 5912 5278 5079 4405 3856 1443 988 106 55746 5564 5244 5014 1240 56179 4861 4855 4456 1334 --
NM_005201chr3--138 ----
NM_005202chr151990 1784 1583 1573 195 --21712 173 --
NM_005207chr2273665 3382 1223 646 220 118 21 13346 ----
NM_005214chr21838 --1204 11049
NM_005224chr193698 636 552 ------
NM_005229chrX41013 931 497 209 --11285 --
NM_005231chr1131349 1054 91 11139 170 --
NM_005233chr382414 2163 1779 1656 972 830 771 431 ------
NM_005235chr2167630 7357 6604 6476 6466 5937 5560 5268 2926 2694 1908 1110 533 409 342 214 56820 5019 2671 1747 1117 1550 --
NM_005238chr1132505 2452 1037 21255 218 ----
NM_005240chr15562 339 317 198 109 ------
NM_005245chr42322 70 ------
NM_005249chr141111 1829 ----
NM_005254chr1511229 --1151 1955
NM_005261chr82415 267 ------
NM_005266chr141513 751 581 379 ----11836
NM_005271chr102456 365 ------
NM_005277chr421803 649 11645 11510 --
NM_005279chr22281 254 --1120 --
NM_005311chr772882 2848 2618 2576 2514 1968 626 ------
NM_005312chr972660 2476 2404 1814 278 260 172 --12102 --
NM_005316chr112941 423 --11051 21083 1058
NM_005324chr1722040 233 --1255 --
NM_005328chr86734 697 614 588 569 47 ------
NM_005329chr1632276 2194 777 --11791 --
NM_005339chr454143 1592 1019 753 105 143 --11135
NM_005342chrX62838 2825 2617 2597 2540 2043 22705 885 32784 572 318 --
NM_005347chr9--21703 685 --11048
NM_005358chr1371842 1597 1494 1355 695 495 368 ------
NM_005359chr18116472 6459 5901 5434 4994 4561 4484 4437 4166 2491 1775 56526 4555 4390 4376 2611 15127 --
NM_005370chr1931208 858 224 ------
NM_005373chr141498 1180 619 417 ------
NM_005375chr631007 333 165 ------
NM_005385chr342142 2050 692 526 1243 ----
NM_005388chr941435 690 98 71 ------
NM_005397chr743644 1398 974 601 12886 11446 --
NM_005398chr1031032 498 483 ------
NM_005399chr174344 4004 3624 3436 1208 474 55 --23470 267 --
NM_005400chr282975 2830 2750 2244 2009 1003 979 325 12643 21217 203 --
NM_005402chr731157 648 265 2730 282 11163 --
NM_005407chr1461354 1124 480 424 137 108 ------
NM_005409chr42415 320 1200 ----
NM_005415chr24681 559 254 55 ------
NM_005433chr1832373 2118 458 1694 ----
NM_005436chr1094034 3536 3414 3228 3119 2668 1638 818 538 --12546 13693
NM_005437chr1041233 467 114 31 11376 189 --
NM_005455chr161671 1662 1533 1317 1221 1198 1747 ----
NM_005458chr952285 1789 805 705 534 32317 1947 1533 --1967
NM_005460chr53512 135 76 --1494 --
NM_005461chr2051595 1472 1450 745 697 1357 21962 1506 --
NM_005465chr141561 1475 634 59 ------
NM_005471chr531181 407 52 --1134 --
NM_005475chr1222963 2891 13255 1230 --
NM_005476chr951185 1114 941 260 79 1200 159 11143
NM_005487chr2222024 1783 ------
NM_005497chr1785821 5437 4125 2433 1571 770 280 202 ------
NM_005499chr191667 ------
NM_005502chr982983 2804 2553 2485 2424 2248 1239 973 --1328 --
NM_005504chr12105978 5867 5224 4867 2403 1949 1687 786 419 149 36269 5639 551 16620 --
NM_005509chr51105 11220 11194 --
NM_005522chr741372 1034 283 228 11259 ----
NM_005530chr1531179 485 311 1103 ----
NM_005536chr82294 135 ------
NM_005537chr134846 784 427 267 ------
NM_005542chr711925 11574 11488 --
NM_005546chr552223 2050 1750 551 308 11791 ----
NM_005562chr12519 504 31469 193 144 134 11520
NM_005563chr14839 751 589 236 ------
NM_005575chr51605 2561 169 ----
NM_005578chr3115079 5032 4110 3434 3399 3376 3369 2056 364 276 102 ------
NM_005593chr121510 ------
NM_005594chr12298 72 ------
NM_005596chr9136261 5949 5810 5746 4932 4799 4777 4578 4203 2514 1361 500 472 12336 14736 --
NM_005599chr151520 1097 1053 1002 532 ----11088
NM_005602chr32307 258 21303 962 ----
NM_005604chr662402 2279 905 773 491 101 1412 2946 692 12031
NM_005610chr11619 1593 ----
NM_005625chr82997 254 21005 985 ----
NM_005637chr1811617 ------
NM_005638chrX51719 1481 1403 1197 185 11602 ----
NM_005647chrX33222 3200 3143 --13132 --
NM_005659chr221362 ------
NM_005660chrX145 ------
NM_005665chr194715 4451 4294 4205 3862 3337 1782 603 276 24426 3467 ----
NM_005668chr5144388 4353 4160 3440 3302 1828 1772 1715 1689 1608 1573 1380 1148 633 2582 39 ----
NM_005669chr562217 1781 913 390 147 24 --11693 --
NM_005671chr82465 411 ------
NM_005682chr1631320 1272 1247 ------
NM_005686chr141464 1172 1080 366 21580 177 1622 --
NM_005688chr33861 516 220 ------
NM_005715chr652015 1971 1786 670 50 12736 ----
NM_005717chr13942 119 101 ------
NM_005721chr22879 252 155 ----
NM_005722chr231764 958 249 ------
NM_005725chr182350 1870 1590 882 771 525 388 280 2815 274 1228 --
NM_005730chr1292708 1308 1238 1182 1136 1072 1054 768 541 1496 22422 1207 23109 828
NM_005731chr2197 ------
NM_005736chr10--31223 1038 62 ----
NM_005738chr741910 1551 1492 547 1660 1523 --
NM_005742chr23606 311 38 --1299 --
NM_005746chr752456 2226 1817 825 653 ------
NM_005748chr1263337 3117 2588 2222 889 755 1310 1599 1587
NM_005751chr7165 ------
NM_005752chr1621126 184 ------
NM_005754chr531250 1008 464 1181 ----
NM_005756chrX41493 1439 1076 208 21476 198 ----
NM_005759chr284697 3856 3592 3358 3080 1901 388 188 --24320 621 --
NM_005761chr12136 ------
NM_005765chrX1127 ------
NM_005777chr3----177 --
NM_005778chr31396 ------
NM_005779chr543040 1427 440 317 --43602 2925 425 362 --
NM_005780chr133845 713 259 ------
NM_005786chr1821028 417 --21074 231 11299
NM_005789chr1751943 1530 1325 460 241 22088 2067 --11312
NM_005797chr11--157 --1479
NM_005808chr363577 3459 3333 2712 1161 1047 21369 764 13366 12220
NM_005813chr231691 919 70 ------
NM_005814chr131358 1206 58 1457 31151 1141 1075 --
NM_005826chr13625 598 451 ------
NM_005828chr17165060 4982 4730 4693 4658 4238 3915 3805 3775 3670 3530 2023 1645 1396 259 46 1639 34552 1912 150 --
NM_005832chr32497 232 ------
NM_005839chr12801 296 ------
NM_005840chrX106838 6520 6186 5193 4889 3058 2698 2264 374 176 57568 7486 6579 4701 2100 22516 125 --
NM_005843chr231586 702 511 21237 23 ----
NM_005857chr14601 578 370 43 21157 34 --11059
NM_005859chr521529 181 1189 ----
NM_005868chr742113 611 561 183 ------
NM_005871chr103857 848 672 ------
NM_005875chr3--131 ----
NM_005880chr1611226 --11062 1614
NM_005885chr52459 225 ------
NM_005897chr11868 ------
NM_005898chr1152753 2227 2199 2072 785 ------
NM_005899chr173549 446 304 --11604 --
NM_005901chr18228579 8410 8365 8171 7993 7877 7296 7191 6419 6195 5972 5310 3118 2809 2711 2635 2029 1594 1503 1362 549 529 37699 7451 401 58297 7624 6436 1825 1164 --
NM_005903chr5124748 4566 4402 4217 3496 2093 2040 1977 1894 1004 622 429 --14547 13267
NM_005906chr641385 472 384 55 --11151 --
NM_005907chr631662 116 65 ------
NM_005909chr533586 2927 220 --13620 --
NM_005910chr1754063 3983 3525 2999 1532 13007 23015 1479 --
NM_005917chr21136 ------
NM_005920chr163708 2970 2947 632 231 108 --22359 1457 13916
NM_005922chr61482 ------
NM_005923chr6161 ----1570
NM_005924chr72929 746 1984 ----
NM_005927chr55898 397 311 293 63 ------
NM_005934chr1962579 2573 2449 2348 2079 1722 21024 368 1601 --
NM_005935chr4114199 4191 4137 3999 3676 3268 1780 1764 1755 1084 563 24710 1885 --13938
NM_005937chr1754160 3670 1672 1503 460 11646 11515 --
NM_005941chr863762 1342 1232 375 338 212 23968 3878 --13316
NM_005943chr631154 1066 106 --1257 --
NM_005955chr1125155 5093 4979 4855 4491 4265 4034 3965 3932 2035 766 760 24535 3492 ----
NM_005962chr1021965 637 2391 278 ----
NM_005962chr1021965 637 2391 278 ----
NM_005966chr252424 2405 2062 1872 237 ------
NM_005968chr19155 ----1257
NM_005969chr11130 ----1760
NM_005977chr1321028 866 ------
NM_005986chr1332298 642 115 22083 245 22359 2097 --
NM_005996chr1261526 1516 1108 626 592 176 --11041 --
NM_005997chr13137 64 33 ------
NM_006007chr934481 4147 931 --24458 1064 13001
NM_006011chr1564222 3969 3172 2874 1200 39 12842 ----
NM_006016chr652182 1690 1586 1445 706 1294 12171 --
NM_006022chr13----21017 979 --
NM_006024chr71866 2787 124 2370 230 --
NM_006036chr262417 2159 2108 1938 1831 1644 ------
NM_006037chr2134777 4727 4695 4354 3808 3761 3078 1830 1732 1659 780 643 152 31652 1618 719 ----
NM_006038chr2071822 1611 1534 854 713 335 273 ------
NM_006047chr2043335 2982 2518 493 32851 2480 1194 ----
NM_006054chr1131463 1112 488 1585 11639 --
NM_006067chr163740 286 267 ------
NM_006080chr71972 ------
NM_006089chrX51424 1169 653 271 167 ------
NM_006090chr12760 36 ------
NM_006094chr841557 1488 166 46 ------
NM_006095chr454286 3777 3669 2802 1787 2827 476 24049 3313 --
NM_006099chr12716 226 --1215 --
NM_006100chr32590 149 1247 ----
NM_006106chr1153252 2715 2688 874 410 12762 ----
NM_006108chr1162398 2076 1844 1564 571 219 2170 159 21629 511 1622
NM_006113chr141892 1715 267 107 ------
NM_006134chr2131490 1222 114 2640 245 ----
NM_006136chr72376 223 ------
NM_006139chr272619 2438 2422 2150 1864 540 198 22572 2158 ----
NM_006141chr1662664 2171 2048 1882 1089 267 176 1397 --
NM_006147chr1----1460 --
NM_006148chr1782904 2642 2365 2268 1957 622 436 213 --3710 586 443 --
NM_006153chr34450 430 198 104 ------
NM_006154chr1522645 984 12150 ----
NM_006159chr12243 27 --1621 --
NM_006180chr951776 560 520 437 239 1796 --11906
NM_006183chr122432 138 ------
NM_006186chr22479 121 11247 ----
NM_006190chr22819 250 21097 846 ----
NM_006191chr12181 1855 ----
NM_006194chr141168 11327 ----
NM_006195chr941359 1144 578 404 ------
NM_006196chr24252 111 66 33 ------
NM_006203chr545526 4493 3656 337 23921 507 14098 --
NM_006206chr432197 801 22 ------
NM_006212chr173442 1902 1842 990 966 601 188 34822 4499 1472 1750 --
NM_006216chr22125 65 --1153 --
NM_006224chr1762429 2384 1799 705 432 298 ------
NM_006226chr2259 51 11382 ----
NM_006228chr81397 ------
NM_006237chr1341970 1894 1435 165 ----1371
NM_006238chr682033 1685 279 270 261 248 229 199 ------
NM_006241chr382253 1998 1854 1841 564 554 191 69 1532 --21848 1731
NM_006246chr143391 320 77 1521 ----
NM_006251chr52964 419 22968 615 --12266
NM_006252chr1137347 7041 6541 5342 4663 2962 2692 2230 2152 1538 915 617 21 47463 6815 5924 4752 ----
NM_006258chr1021166 194 2601 48 ----
NM_006264chr41482 1144 ----
NM_006265chr851449 1310 1037 469 334 ----11507
NM_006267chr241192 686 602 350 ------
NM_006268chr1151038 865 391 242 43 --11182 --
NM_006279chr11572 ------
NM_006282chr2044686 1520 460 338 --34405 4308 589 --
NM_006283chr854467 4154 3096 1095 821 23671 3658 13372 --
NM_006306chrX1739 21990 185 35908 5874 3872 --
NM_006310chr172435 367 2886 273 1146 --
NM_006313chr1221372 37 ------
NM_006315chr431618 1376 1308 31481 724 484 14025 --
NM_006319chr162752 506 1699 ----
NM_006321chr382117 2001 1861 1649 876 663 182 154 2722 273 --12262
NM_006330chr831659 1364 182 ------
NM_006333chr23551 453 102 ------
NM_006345chr431277 1030 946 ------
NM_006352chr151794 1498 533 437 95 32008 554 484 ----
NM_006359chrX72359 2243 2173 1733 1661 433 193 ------
NM_006361chr1751686 1626 779 643 149 11548 ----
NM_006363chr203175 157 76 1439 ----
NM_006364chr145939 483 450 372 348 ------
NM_006366chr611080 --1148 --
NM_006367chr13439 68 21 21045 771 ----
NM_006371chr375203 4766 4645 4404 4246 3711 3690 14118 14378 --
NM_006373chr1751382 1242 1046 570 255 1167 ----
NM_006375chrX61762 1477 380 229 122 99 ------
NM_006378chr941035 292 180 68 --11175 1282
NM_006379chr72348 162 ------
NM_006380chr1764256 4136 3963 3059 2693 1229 --14421 --
NM_006386chr2242345 524 297 186 1383 12323 11546
NM_006387chr1941221 1154 98 57 ------
NM_006389chr113395 172 110 1283 --1479
NM_006393chr1064138 3680 2972 2913 925 821 33671 3178 1485 ----
NM_006409chr7--1217 ----
NM_006420chr2052829 2583 2263 449 410 52981 2659 2188 254 58 ----
NM_006434chr1073177 2206 1988 1156 875 860 281 32271 2008 719 ----
NM_006439chr41193 ------
NM_006449chr261994 1759 1459 533 525 485 1378 11619 --
NM_006451chr511042 1327 ----
NM_006457chr442802 1630 1005 211 32961 1334 256 13533 11559
NM_006459chr1061941 1638 1327 659 578 570 ------
NM_006460chr1741491 1405 214 180 1647 --11231
NM_006464chr2174475 3860 3775 3611 3238 3038 2966 2864 1697 1637 1480 1431 770 447 292 250 116 54632 4192 3874 691 683 --11272
NM_006467chr542221 2076 1613 326 22392 79 1102 --
NM_006472chr161119 810 794 487 57 40 11243 ----
NM_006474chr141976 1610 661 361 11849 --155
NM_006475chr131565 1158 ----
NM_006482chr1283764 3552 3442 2693 1471 805 773 670 ------
NM_006489chr1451766 1544 441 247 92 21731 196 ----
NM_006496chr121224 779 11311 ----
NM_006510chr64846 396 332 251 1650 ----
NM_006516chr131534 1431 1362 --11577 --
NM_006517chrX31811 1565 931 --11526 --
NM_006520chrX41732 1702 1561 1408 1560 ----
NM_006526chr2021597 1401 11906 2883 495 --
NM_006527chr44750 731 704 100 ------
NM_006529chr411496 11119 11285 --
NM_006534chr2073447 3123 3006 2802 785 408 323 22334 754 1951 --
NM_006538chr273494 3064 2876 2813 1001 588 167 12900 ----
NM_006540chr81390 11519 1367 --
NM_006544chr1475341 1569 1467 913 670 540 35 45247 1074 567 239 1343 --
NM_006546chr1796587 6106 5940 5923 5331 5113 4639 4309 1055 44842 4459 2565 395 12628 --
NM_006547chr741808 1696 1309 604 11629 --1128
NM_006549chr1222597 720 12565 22776 1100 1750
NM_006557chr931531 1446 438 --1623 --
NM_006559chr13396 73 55 ------
NM_006560chr115469 456 432 200 46 ------
NM_006561chr10166173 6154 5982 5521 4798 4656 4305 3956 2473 2238 2066 1574 1130 833 447 329 23823 144 22106 1892 25793 133
NM_006565chr1611027 ------
NM_006570chr92388 309 123 ----
NM_006572chr17113468 3427 2599 2520 1101 1091 1054 603 581 145 52 22750 125 --1590
NM_006574chr3187 1119 --1340
NM_006575chr1421454 156 11067 ----
NM_006577chr211261 11230 1285 --
NM_006585chr211113 ------
NM_006587chr441443 1167 1054 408 21236 57 ----
NM_006593chr22686 321 ------
NM_006595chr111179 11419 ----
NM_006599chr16188263 7440 7069 6432 5746 5493 5198 3152 3104 2964 2436 2241 1836 1710 1585 679 394 377 66551 3269 2774 1139 1023 640 11368 --
NM_006601chr121885 177 ----
NM_006603chrX21755 399 11848 --11380
NM_006609chr282958 2630 1988 1930 1065 696 509 140 ----12037
NM_006614chr383427 2923 2803 2679 2636 1347 707 651 --11093 --
NM_006620chr633582 669 584 --127 11888
NM_006621chr161354 688 506 278 209 123 ------
NM_006622chr5------1178
NM_006626chr9102685 2402 1009 910 840 790 422 253 105 58 41893 663 270 142 1484 12563
NM_006628chr1554093 3764 3139 1185 817 32861 1862 1413 ----
NM_006629chr1832391 1824 1767 22298 2252 11126 --
NM_006633chr52547 21 ------
NM_006636chr231053 915 793 1993 1152 --
NM_006640chr1731829 1377 1370 11908 ----
NM_006646chr1352186 1972 950 747 537 22800 917 1525 1470
NM_006650chr562691 2665 1087 942 705 53 ------
NM_006654chr1264756 4450 3576 3518 1278 810 33343 3275 119 ----
NM_006658chr741114 864 351 197 1186 2295 81 --
NM_006663chr192373 46 ----122
NM_006667chrX21128 435 1289 ----
NM_006670chr62225 158 ------
NM_006675chr1283366 3339 3252 2541 2469 2266 1086 223 1577 12272 --
NM_006682chr722045 125 12500 ----
NM_006704chr13--173 ----
NM_006706chr53753 744 294 ----1142
NM_006716chr711269 2239 49 11125 --
NM_006717chr973126 2746 2440 2420 2172 2124 1143 1530 31228 998 860 --
NM_006720chr10184856 4800 4713 4672 4545 4295 3654 3575 3415 3378 3284 3239 1698 1227 1134 1027 947 732 44579 4486 3893 496 34759 3995 757 11776
NM_006721chr102684 335 157 ----
NM_006722chr342986 2751 2412 951 42896 270 85 46 --13056
NM_006724chr61482 ------
NM_006729chrX85422 5159 4830 4267 3690 3538 1441 108 23669 1857 --13576
NM_006731chr9104820 4806 4515 4292 4229 3783 2146 1460 1073 647 22039 897 11711 --
NM_006732chr1921546 713 21841 1742 1203 1762
NM_006734chr621605 1232 --11119 --
NM_006735chr71138 2244 100 ----
NM_006746chrX41095 525 445 77 ------
NM_006749chr831263 1038 967 ------
NM_006750chr16157942 7303 7222 6153 5730 5448 5411 4899 3066 2770 2631 2441 2304 1801 1470 36051 3240 464 26224 1506 --
NM_006751chr23979 929 411 ------
NM_006754chr741160 999 984 82 ------
NM_006756chr851133 1021 607 228 87 ------
NM_006758chr21------1122
NM_006761chr176843 695 612 231 199 178 --1130 --
NM_006763chr141811 1695 1628 611 2678 594 11859 --
NM_006766chr882507 2155 2073 1933 1842 1054 955 669 --12038 1707
NM_006772chr661780 1728 1547 1120 1103 36 ------
NM_006775chr663041 3031 2180 2057 1064 205 22840 2591 ----
NM_006777chrX72936 2925 2802 2443 2340 1811 303 2274 165 ----
NM_006783chr132249 79 2609 286 ----
NM_006784chr13604 228 192 1587 ----
NM_006788chr1841702 1517 1459 711 --1702 --
NM_006791chr153602 121 53 ------
NM_006805chr531517 1449 159 21725 623 ----
NM_006806chr21180 ------
NM_006807chr1721303 236 --1129 11239
NM_006808chr9156 ------
NM_006810chr3------162
NM_006811chr203875 295 275 ------
NM_006812chr122626 45 ----1612
NM_006814chr20102668 2499 2250 2092 1736 879 827 696 506 489 22382 1957 3991 464 83 --
NM_006815chr125956 545 205 121 78 195 1471 --
NM_006818chr12867 383 ------
NM_006819chr111335 ------
NM_006827chr1463312 1223 1062 963 384 116 12855 22912 2208 --
NM_006828chr61515 1226 ----
NM_006838chr123556 399 225 138 ----
NM_006842chr111105 ------
NM_006851chr1262799 2667 2444 2242 910 462 ----12044
NM_006852chr1772727 2467 1919 1067 1024 420 128 ------
NM_006854chr721531 1422 11281 21632 170 --
NM_006856chr1251137 1022 421 401 353 ----1240
NM_006861chr1262097 2083 2039 1498 683 68 1348 11851 --
NM_006873chr282873 1326 1080 665 638 452 375 218 ------
NM_006875chrX2788 255 ------
NM_006876chr112525 496 ------
NM_006884chr341599 1358 1351 712 11375 ----
NM_006885chr16104242 3407 3346 2843 1073 822 690 665 434 191 --24024 1601 11623
NM_006888chr1463534 3353 3293 2562 2337 113 23034 2805 13415 --
NM_006895chr221940 448 11512 12001 --
NM_006908chr721306 294 11022 122 --
NM_006913chr61103 1296 ----
NM_006915chrX42328 2111 321 248 22378 724 ----
NM_006920chr271931 1781 1728 1602 1528 796 642 11790 1467 --
NM_006922chr241796 1754 840 628 ------
NM_006924chr17114452 4198 4139 3936 2886 1550 1237 1128 361 330 127 13263 --13944
NM_006925chr141102 --1333 --
NM_006931chr1262151 1646 1586 1541 795 194 ------
NM_006937chr172599 38 ------
NM_006939chr1411175 ------
NM_006947chr441315 568 502 125 --1380 --
NM_006948chr2162429 885 698 582 362 278 ------
NM_006951chr103517 269 163 ------
NM_006959chr192332 93 ------
NM_006963chr1031105 1063 398 --11229 --
NM_006981chr972911 2631 2395 458 351 148 90 1792 ----
NM_006990chr141796 1560 984 636 --1312 1961
NM_006996chr12652 479 2238 109 1623 --
NM_006997chr102180 66 ------
NM_007005chr921385 1070 ------
NM_007006chr1643535 3442 3019 398 11223 ----
NM_007007chr12144566 4106 3885 3769 3674 3658 3353 3076 3021 1802 1780 1773 1544 83 23148 1372 1346 11273
NM_007010chr1741920 1461 371 196 ------
NM_007011chr1596477 4354 4242 2549 2046 1932 1856 1825 165 66597 6562 5789 4657 2697 1763 1247 --
NM_007013chr83983 409 134 ------
NM_007017chr52891 832 ------
NM_007023chr231024 842 780 ------
NM_007027chr31187 1141 ----
NM_007033chr152073 1985 572 436 219 ------
NM_007035chr124740 687 611 555 ----146
NM_007038chr2125646 2386 21098 587 ----
NM_007039chr1422098 187 12339 12195 --
NM_007040chr194907 264 226 191 --1836 --
NM_007050chr20158036 6823 6695 6486 5903 5468 2951 2046 2024 1736 1630 1013 828 694 286 11619 11102 --
NM_007052chrX2211 194 ------
NM_007064chr321262 451 ------
NM_007078chr1062487 1146 1071 586 387 81 ------
NM_007084chr1321335 400 --1531 --
NM_007096chr92273 92 ------
NM_007099chr22900 129 ------
NM_007107chr352212 2192 2081 2010 557 31574 850 814 ----
NM_007114chr342788 2606 2384 840 32670 2518 1015 ----
NM_007124chr641944 1807 1774 752 131 ----
NM_007125chrY51221 297 288 53 35 ------
NM_007126chr91501 --1160 --
NM_007129chr1351029 947 729 661 314 --1788 --
NM_007146chr1752819 2085 1933 1776 1107 ------
NM_007150chrX52145 1681 1551 1379 213 21583 833 --11648
NM_007157chrX112686 2520 2337 2305 2276 2233 2193 1866 904 381 271 12442 ----
NM_007158chr141200 1001 826 446 11014 ----
NM_007159chr341708 1533 1085 292 2706 371 ----
NM_007166chr1111266 ------
NM_007170chr14790 605 371 337 ------
NM_007173chr1151870 1559 795 664 44 11573 ----
NM_007174chr1272118 2031 1744 1716 1513 483 414 11985 1600 --
NM_007175chr8103411 3313 3248 3226 3016 2781 2435 516 507 71 1557 --1646
NM_007187chr133895 693 172 ------
NM_007190chr103422 353 29 ------
NM_007191chr122722 205 ------
NM_007192chr1421042 282 --1955 2395 226
NM_007195chr18103435 3419 3327 2885 2840 2796 2785 2771 2381 368 --22922 2846 --
NM_007197chr1221039 58 --1970 --
NM_007202chr17--2544 105 ----
NM_007203chr983895 3609 3307 3171 2955 786 633 514 23747 3136 22849 2806 --
NM_007204chr12431 202 1103 ----
NM_007207chr12670 273 1828 1945 --
NM_007212chr161624 808 645 571 351 238 1119 1315 --
NM_007217chr3------1313
NM_007220chrX84879 4629 4141 3722 3097 1701 558 185 14915 --11876
NM_007222chr81673 21204 307 ----
NM_007229chr22185 --1129 1283
NM_007236chr1572375 2001 1900 478 421 232 208 32359 2106 551 ----
NM_007238chr2084107 3846 3145 1344 643 503 415 347 ----24853 1564
NM_007246chr44969 925 293 194 21058 1008 1353 --
NM_007249chr13199276 8911 8890 8514 8015 7886 7627 7280 6958 6307 5936 3391 3115 2419 1651 1395 1207 1148 851 36680 2506 304 39056 8481 7371 17378
NM_007259chr14479 432 399 377 1415 ----
NM_007271chr641447 1157 535 38 1675 1375 --
NM_007278chr17--2303 66 1291 --
NM_007282chr3186 ----1646
NM_007283chr372771 2475 2261 1199 1029 381 333 12301 ----
NM_007287chr373101 2344 1301 1290 687 665 268 11179 ----
NM_007288chr373101 2344 1301 1290 687 665 268 11179 ----
NM_007289chr373101 2344 1301 1290 687 665 268 11179 ----
NM_007292chr1785182 4847 4222 4205 4197 3818 3180 415 --1523 --
NM_007313chr911605 11567 21911 247 --
NM_007315chr251552 1238 425 92 75 11353 ----
NM_007324chr1125 --1420 --
NM_007325chrX51975 1406 879 556 368 1465 --1694
NM_007347chr1552421 943 875 371 145 21996 1131 ----
NM_007350chr1264071 3736 3304 3232 669 170 2999 359 11475 --
NM_007358chr161685 1518 1240 578 246 42 --11571 --
NM_007361chr141265 1561 --1113
NM_007363chrX2821 22 31037 884 228 ----
NM_007372chr173887 865 175 ------
NM_007373chr1041595 1225 224 55 --1128 --
NM_007375chr142401 1029 464 288 ------
NM_012064chr1231078 1046 938 1429 1384 --
NM_012069chrX32548 1002 930 --2257 37 --
NM_012081chr533635 439 184 33347 3128 432 ----
NM_012082chr81647 ------
NM_012083chr1071018 977 941 844 832 433 61 ------
NM_012084chrX1445 --1510 --
NM_012089chr141408 1349 597 254 11529 ----
NM_012090chr111065 11208 1308 --
NM_012092chr251880 1451 1215 601 434 1503 11747 --
NM_012093chr111220 11259 ----
NM_012095chr1063406 2875 2442 1418 1403 1018 12325 12483 --
NM_012096chr351274 847 586 310 46 --12305 --
NM_012097chr251586 1407 845 777 358 ------
NM_012102chr192520 2231 2044 1885 1847 1786 999 917 799 1186 143 --
NM_012104chr1173695 3401 2690 1440 1000 858 742 12325 11486 13287
NM_012104chr1173695 3401 2690 1440 1000 858 742 12325 11486 13287
NM_012105chr21--1165 ----
NM_012108chr42345 61 ------
NM_012120chr662134 2050 1916 947 938 889 12341 ----
NM_012124chr111135 1719 ----
NM_012129chr72874 35 ----12191
NM_012134chr131414 1265 189 11335 1239 --
NM_012137chr132153 950 556 22798 349 1408 --
NM_012141chr1353979 2928 2652 1567 746 189 ----
NM_012153chr11122602 2484 2452 2373 2174 2054 927 908 870 772 326 227 12025 ----
NM_012156chr20113328 2905 2517 2489 2449 1052 887 708 622 459 28 12499 13414 --
NM_012161chr431031 174 80 ------
NM_012164chr9147208 7067 6281 5980 5842 5772 5741 5201 4732 4721 2857 1796 924 855 25556 286 36801 6208 5515 26274 4557
NM_012177chr61561 1521 ----
NM_012193chr1195287 5195 4539 4343 3834 3336 1487 982 711 33566 3477 824 14671 35020 4678 1901
NM_012197chr951600 1476 1465 1287 469 --1644 1615
NM_012199chr1144608 4434 4342 4039 3825 3689 3457 3295 3267 1822 1640 1505 1464 653 13326 13228 --
NM_012207chr103828 432 166 ------
NM_012210chr941531 1147 1043 23 --160 11390
NM_012214chr2106365 5066 4924 4541 2358 2296 2166 1782 545 30 31979 1877 736 16121 --
NM_012215chr1031884 337 315 --11947 --
NM_012218chr194828 604 462 383 --1710 11972
NM_012223chr241133 245 115 36 11209 ----
NM_012234chr393711 3659 2728 2718 1387 1063 899 432 134 --33483 3284 1096 --
NM_012238chr1051789 1404 1181 698 173 ------
NM_012243chr12771 384 ------
NM_012249chr262832 2525 2495 1242 346 161 12211 1407 --
NM_012250chr111147 1533 --11287
NM_012252chr764987 4677 4157 3959 3451 811 23563 254 14883 --
NM_012257chr711054 --1969 --
NM_012259chr631003 975 263 ------
NM_012262chr154624 3929 773 659 205 84865 4423 3922 3300 3237 2038 1772 28 31703 1066 527 --
NM_012279chr5--31940 1803 520 2557 354 1640
NM_012281chr772319 2094 1780 1756 936 572 381 --1961 --
NM_012286chrX6649 595 471 85 69 56 ------
NM_012287chr364345 4302 4019 3114 745 234 33970 3574 2993 ----
NM_012288chr6135440 5084 4981 4519 4463 3965 1230 1130 384 307 274 165 88 35764 3861 1747 35685 5104 1698 --
NM_012290chr231279 1246 153 11498 ----
NM_012294chr793907 3326 1559 1435 903 762 262 190 78 1242 2664 499 --
NM_012296chr11103513 3424 3305 3210 1309 1093 511 502 294 81 --13725 --
NM_012297chr452108 2100 1953 419 59 11978 1354 11609
NM_012300chr542179 2082 923 594 ------
NM_012301chr77894 875 697 678 647 523 47 ----11364
NM_012302chr1--2980 441 ----
NM_012304chr572479 2323 1936 988 504 276 233 ------
NM_012308chr1132165 1991 1762 --1432 --
NM_012309chr1194488 4236 4192 4067 4058 1981 1827 707 209 34862 1618 1379 34559 4358 648 --
NM_012316chr154051 3586 1941 1716 586 12088 2623 513 --
NM_012325chr2041651 1292 1009 102 11621 11376 --
NM_012328chr741443 1320 216 72 --11308 --
NM_012329chr1761357 1037 675 468 381 167 ------
NM_012330chr102731 221 11382 ----
NM_012333chr121171 653 179 ----
NM_012339chr101631 ----1592
NM_012347chr663035 2280 533 349 235 180 12041 ----
NM_012388chr1582932 2894 2808 780 759 606 384 358 22181 973 21981 953 11935
NM_012395chr743416 2757 1065 503 ------
NM_012408chr203871 826 654 ------
NM_012412chr73824 220 153 ------
NM_012416chr931171 132 120 ------
NM_012421chr11369 ------
NM_012426chr161347 ------
NM_012428chr152758 64 ----130
NM_012430chr32663 519 1300 ----
NM_012431chr772752 2411 1033 464 282 223 105 22523 392 ----
NM_012432chr11297 3345 62 29 1276 --
NM_012434chr611663 ----11457
NM_012448chr173996 730 238 --32176 564 144 --
NM_012463chr1221479 1300 11563 ----
NM_012464chr451866 1031 744 701 340 ----11081
NM_012482chr12684 79 ------
NM_013230chrY21329 1153 ------
NM_013231chr1451445 1425 1137 1028 369 1667 34273 3786 3774 --
NM_013235chr53904 744 80 ------
NM_013236chr222433 187 1405 ----
NM_013244chr12------129
NM_013245chr16--1730 ----
NM_013246chr114939 300 226 122 1778 ----
NM_013255chr7108357 8313 7334 7150 6854 5936 5818 3443 3032 2002 23372 2159 --23258 2034
NM_013257chr852386 2312 2282 1937 205 ------
NM_013261chr463729 2816 2535 1458 1137 269 33429 2608 979 1863 --
NM_013262chr651310 1164 1087 988 505 11255 ----
NM_013269chr1254028 3980 3351 1408 772 --13809 --
NM_013279chr1192321 2301 2215 1843 1688 606 545 230 220 --32075 1717 859 --
NM_013280chr112847 832 1859 ----
NM_013281chr2041245 1006 582 344 ------
NM_013283chr52856 803 ------
NM_013286chr353016 2630 1214 625 163 ------
NM_013300chr121241 ------
NM_013302chr1684742 4612 4582 2853 1328 1304 1262 979 ----13736
NM_013305chr181618 ------
NM_013320chr121132 ------
NM_013322chr731599 1143 365 11095 ----
NM_013348chr1921154 1012 ----2376 98
NM_013354chr81157 1486 --1447
NM_013364chrX51991 1943 1785 1419 1309 --21400 1237 --
NM_013372chr1532962 2361 546 12922 ----
NM_013374chr373053 2987 2475 2063 837 536 132 11252 ----
NM_013381chr122212 197 21503 883 ----
NM_013390chr941749 1700 1560 689 --1467 --
NM_013396chr2161489 1407 1277 272 63 47 ----1626
NM_013423chrX21276 95 --1499 --
NM_013427chrX21276 95 --1499 --
NM_013433chr1952057 1772 1649 1634 823 --127 --
NM_013436chr21147 2313 135 ----
NM_013437chr811090 ----1248
NM_013438chr951693 1195 512 182 167 ------
NM_013443chr92897 222 1272 ----
NM_013444chrX185 --1722 --
NM_013448chr143729 698 603 1690 ----
NM_013449chr1272437 2249 2111 812 711 625 272 1775 32953 2430 2099 --
NM_013937chr63921 827 415 1289 1421 --
NM_013943chr173017 2899 2727 2017 1219 1019 75 23214 2795 ----
NM_013958chr8129 ------
NM_013959chr8129 ------
NM_013961chr8129 ------
NM_013962chr8129 ------
NM_013995chrX62407 2256 1946 1610 892 565 11989 11700 --
NM_014000chr1061942 1758 1354 603 362 266 --1196 --
NM_014007chr911182 1131 ----
NM_014011chr241999 1991 806 505 22557 2128 ----
NM_014015chr161647 1719 1192 --
NM_014023chr1061951 625 604 523 128 66 --22597 1174 --
NM_014028chr662993 2781 2752 1232 1052 622 12910 12718 --
NM_014033chr1232243 2161 1870 22286 661 21956 778 11734
NM_014041chr32362 235 --134 --
NM_014043chr321671 1486 11556 11595 --
NM_014044chr2161 ------
NM_014048chr1684921 4887 4239 4202 4080 3416 1540 904 31675 1577 991 21985 1957 --
NM_014057chr931098 648 367 11000 ----
NM_014089chr1352119 1963 400 350 176 ------
NM_014112chr865360 5100 4814 2098 2071 816 22174 44 25439 1743 14427
NM_014117chr163483 416 375 12450 11961 --
NM_014141chr785181 5052 3474 2148 1687 1353 978 822 34324 388 154 --22075 603
NM_014153chr164617 528 119 95 ------
NM_014154chr321570 352 --11596 1548
NM_014155chr11146776 6523 6327 5727 5719 5631 5371 4688 2363 1998 1803 1779 821 544 44558 2978 619 417 47130 6094 5239 1933 --
NM_014157chr1663769 2536 1384 1240 1220 973 11295 11315 --
NM_014171chr22574 45 --1554 --
NM_014176chr1137 ------
NM_014181chr262826 2801 2194 668 524 366 12424 ----
NM_014191chr121823 170 ----
NM_014211chr551555 1451 1420 373 133 11219 1469 --
NM_014217chr13523 469 352 1183 1321 --
NM_014223chr1--1299 ----
NM_014231chr1252041 1876 1829 478 251 --11837 --
NM_014233chr1751895 1469 1437 679 72 --1766 --
NM_014250chr2222024 1783 ------
NM_014252chr132103 64 ------
NM_014253chrX32130 2112 1718 21996 544 1206 --
NM_014263chr1011153 21485 95 ----
NM_014268chr1831363 1338 48 11476 ----
NM_014278chr4196 ------
NM_014279chr94820 733 629 160 ------
NM_014283chr191371 1271 1162 416 346 338 288 128 46 ------
NM_014288chr11216 ------
NM_014292chr2251469 444 414 316 273 11863 1248 1696
NM_014294chr841363 1206 332 78 ----185
NM_014299chr1981933 1804 1649 1630 1453 720 407 266 --21534 1432 --
NM_014305chr131125 1208 ----
NM_014309chr22124973 4735 4624 4614 4548 4200 1500 1044 617 453 190 161 --2786 487 34514 4167 1737
NM_014316chr1631999 1386 511 12159 ----
NM_014319chr1271775 1643 1439 412 365 347 51 --1464 --
NM_014323chr223657 307 281 ------
NM_014325chr1252146 1901 1739 1610 1501 --1850 --
NM_014331chr4137465 7455 7362 7243 6195 6092 5143 2624 2348 2286 1175 610 354 56613 5830 2275 234 73 12338 --
NM_014332chrX1367 ------
NM_014333chr1192634 2262 2164 1879 894 493 448 325 168 --1977 12296
NM_014335chr1521188 1056 ------
NM_014342chr113427 152 30 2952 273 ----
NM_014350chr531097 1084 387 ------
NM_014351chr2211383 1591 21364 1239 --
NM_014352chr1121522 331 1528 ----
NM_014360chr142709 587 ------
NM_014363chr1311256 --1122 --
NM_014365chr121887 ------
NM_014372chr151831 1735 1457 500 125 21810 404 ----
NM_014376chr51193 11840 --11826
NM_014381chr1482962 2456 2417 2410 2108 1253 872 529 42402 2046 1159 156 1444 12902
NM_014382chr331288 581 494 11342 ----
NM_014393chr862225 2218 2099 2013 397 79 12190 ----
NM_014394chr1031167 989 170 11150 ----
NM_014397chr941323 1086 1077 433 11282 ----
NM_014409chr121121 295 21129 930 1747 --
NM_014415chr3--21182 535 ----
NM_014419chr19176 ------
NM_014421chr451794 1522 1443 787 736 --11946 --
NM_014423chr565657 4686 3643 1953 1576 361 22118 1823 12222 11203
NM_014447chr461560 1037 635 266 196 115 --1493 --
NM_014452chr61173 ----175
NM_014454chr62415 146 --1135 --
NM_014458chr121120 1047 1915 ----
NM_014469chr112208 126 1311 ----
NM_014491chr71272 2946 250 ----
NM_014494chr164915 898 747 475 ------
NM_014498chr32350 327 ------
NM_014515chr122324 39 11029 ----
NM_014517chr341659 531 376 294 21983 1621 1755 --
NM_014521chr221858 1390 21455 579 1738 1433
NM_014522chrX1229 ------
NM_014554chr1242346 1932 900 364 22253 2149 11845 --
NM_014570chr225261 207 195 186 27 ----1134
NM_014572chr1361739 1599 1511 1184 1113 670 ------
NM_014586chr2164488 3906 3749 3272 1680 1141 54451 4063 4001 3816 3330 14009 --
NM_014591chr1041093 411 236 29 1922 ----
NM_014606chr431146 982 36 --1146 --
NM_014607chr22126 37 1696 1786 --
NM_014612chr921089 528 1312 --11211
NM_014613chr55693 529 492 361 255 21187 995 ----
NM_014614chr211037 --1128 --
NM_014615chr1683247 2879 2811 2321 1296 901 528 371 13629 ----
NM_014620chr122529 114 ------
NM_014630chr1583965 3672 3334 2459 1320 423 401 241 1754 ----
NM_014633chr112582 162 1442 ----
NM_014635chr231378 1176 1092 11284 11711 --
NM_014636chr9104244 4187 4103 4083 3755 3192 3112 1434 1416 718 11057 23699 1503 --
NM_014637chr841174 573 528 227 11083 --11223
NM_014647chr1642082 1808 656 86 --1560 --
NM_014665chr853515 2779 568 162 113 --22705 2428 --
NM_014666chr531123 418 382 1365 ----
NM_014667chr352401 2311 1750 846 252 2584 385 ----
NM_014670chr251219 1163 177 146 75 ------
NM_014671chr71498 --11039 --
NM_014674chr3123954 3676 3465 3302 3295 3003 2506 1012 616 553 173 124 11606 11005 --
NM_014682chr862269 1762 1514 898 443 184 ------
NM_014683chr1742015 1838 1606 1475 11509 12021 --
NM_014690chr7102890 2780 2634 2244 2102 2060 1117 1013 660 355 ------
NM_014702chr653241 3116 2523 647 163 --12947 --
NM_014703chr33852 186 30 --11159 --
NM_014705chr731919 1838 222 22059 772 --1552
NM_014707chr712266 ------
NM_014709chr22405 145 ------
NM_014711chr1661511 808 748 668 574 138 1710 ----
NM_014720chr1021484 265 ------
NM_014721chr6147162 6838 6824 6612 6592 6077 5376 5031 4858 2270 2144 2021 1848 1427 36729 2795 62 11543 --
NM_014729chr851970 1760 1567 1521 879 ------
NM_014730chr12115021 4282 3787 3469 3329 2028 1491 973 569 341 277 14755 31353 1192 71 --
NM_014730chr12115021 4282 3787 3469 3329 2028 1491 973 569 341 277 14755 31353 1192 71 --
NM_014733chr552095 2040 1871 416 204 22272 1480 12255 22220 1793
NM_014735chrX51489 784 604 539 431 11515 21687 1468 --
NM_014737chr2053283 2847 1039 810 202 11642 33992 1597 1099 14016
NM_014739chr633748 3241 2571 13969 ----
NM_014742chr2041270 1182 398 299 11719 21111 128 --
NM_014743chr4123112 3057 2953 2369 2286 1112 953 838 783 651 210 146 1471 ----
NM_014746chr253614 3041 1753 332 95 33806 638 557 --13486
NM_014747chr1115747 5293 5155 4872 1236 945 789 591 454 414 90 1506 54999 4593 3917 2078 761 --
NM_014751chr842037 1475 859 221 21415 258 1735 --
NM_014752chr1151349 1247 538 429 245 1162 ----
NM_014755chr273900 3830 3808 3074 1669 432 210 23775 1454 1656 13925
NM_014757chr531946 1800 933 --2568 401 --
NM_014758chr1152394 1535 576 456 210 1727 --11628
NM_014762chr132369 2322 848 --2984 736 --
NM_014765chr142498 664 549 54 2902 260 ----
NM_014776chr12103092 2988 2766 2591 2099 1221 1110 1056 650 449 1374 11251 1220
NM_014779chr32785 67 1393 ----
NM_014781chr811013 142 ----
NM_014782chrX1281 ------
NM_014786chr1141228 502 399 348 1154 ----
NM_014787chr162653 2397 706 419 407 173 1633 ----
NM_014795chr241044 873 563 252 11348 ----
NM_014797chr673016 2425 2341 2157 1121 961 301 23167 699 13206 --
NM_014803chr10122708 2651 2607 2378 2301 1920 1825 1027 861 438 310 137 22447 923 12890 --
NM_014810chr173414 3130 3098 3026 2603 731 54 21386 611 ----
NM_014813chr11555 ------
NM_014819chr542473 2320 1952 773 ------
NM_014820chr341470 1448 653 109 ------
NM_014822chr45638 617 227 98 54 ----1214
NM_014824chr1121490 790 --11719 --
NM_014827chr111226 21064 1044 ----
NM_014830chr1253654 2888 2778 1571 725 13311 1219 --
NM_014832chr1332092 1632 840 11752 ----
NM_014839chr12729 652 1318 ----
NM_014841chr62965 938 ------
NM_014848chr1561850 1129 863 650 376 69 ----12614
NM_014850chr3134802 4522 4486 4242 4038 3716 3540 3393 3380 1916 1270 1087 581 --24589 1511 --
NM_014858chr131122 1070 781 11189 ----
NM_014862chr1531504 1158 835 24130 402 --1959
NM_014868chr122232 188 1620 ----
NM_014870chr174248 2953 1736 1643 1067 747 29 1503 21138 681 --
NM_014872chr952297 2210 2194 2095 670 1170 ----
NM_014873chr184302 3900 3823 3715 3430 3302 1532 613 14631 ----
NM_014876chr2262191 2049 1915 1801 1644 762 --1185 --
NM_014877chr17137726 7695 7290 7097 6992 6836 6289 4941 2983 2707 2201 1708 41 47370 5298 1442 1331 1410 --
NM_014878chr92122 39 ------
NM_014883chr432376 644 354 1787 22336 2081 --
NM_014888chr731360 985 400 ------
NM_014892chr63551 523 176 1219 ----
NM_014893chrY22121 748 2808 197 22324 228 --
NM_014897chr1742161 2069 1092 611 1243 ----
NM_014899chr532766 2359 817 32807 2319 1047 22694 1016 --
NM_014901chr552076 1997 1815 1521 293 1472 11628 --
NM_014904chr1053147 2745 374 326 244 43643 1402 1292 593 ----
NM_014906chr1732537 1249 631 ------
NM_014909chr1473929 3469 3453 3142 2901 2750 462 12677 12832 --
NM_014912chr1012670 22171 859 13276 --
NM_014917chr11966 2723 197 ----
NM_014918chr1561610 1349 1065 587 320 190 21194 148 ----
NM_014920chr663817 2657 1109 861 806 513 1685 12627 --
NM_014921chr19103127 2918 2895 2878 2817 2157 1199 1183 503 367 ------
NM_014923chr132592 63 ------
NM_014924chr14102172 1216 909 809 765 720 603 473 75 45 1427 --1380
NM_014925chr121177 ------
NM_014934chr1393841 3376 2777 2638 2453 1376 1301 982 696 13938 ----
NM_014939chr183463 443 188 41569 1357 1195 568 ----
NM_014945chr551720 1335 1242 666 124 11892 ----
NM_014946chr252472 1081 838 614 573 42830 2571 2392 822 ----
NM_014947chr152994 2548 2045 461 43 11225 12784 --
NM_014949chr13856 179 152 1711 ----
NM_014950chr1431684 1080 104 1113 ----
NM_014951chr1042514 2477 551 78 12657 22389 1967 11672
NM_014953chr1373542 2780 2767 2647 1265 522 35 13314 ----
NM_014961chr441862 1405 766 219 1257 ----
NM_014962chr2021126 214 ------
NM_014964chr1722371 691 1128 11678 21904 1861
NM_014969chr12940 410 ------
NM_014974chr101378 --11521 --
NM_014978chr10--134 21775 1336 --
NM_014982chr1485369 3979 3915 1170 1149 1012 711 448 65201 4850 4593 3503 2147 2057 ----
NM_014988chr432255 172 144 1113 --12474
NM_014989chr631275 419 368 1468 ----
NM_014990chr144945 937 272 149 1995 ----
NM_014991chr473130 2516 2420 2195 799 312 224 12595 ----
NM_014996chr321045 74 1755 ----
NM_014997chr762860 1810 1047 796 207 141 12538 ----
NM_014999chr12----21692 1483 11376
NM_015000chr1272876 2826 2167 1144 783 569 528 22590 2007 11215 --
NM_015002chr1242134 1904 1702 879 ------
NM_015008chr383219 2834 2692 2666 2548 2408 2387 821 --12685 13207
NM_015020chr1643675 2369 1383 661 12910 ----
NM_015024chr831492 1406 1082 --1202 --
NM_015027chr1621766 744 --12020 11404
NM_015032chr1362941 2653 2256 1964 1127 696 2480 293 1653 21049 286
NM_015033chr993064 2889 2789 2641 2328 2249 813 310 36 ------
NM_015035chr20126137 5378 5226 5200 4706 4689 4614 2280 1749 1067 551 222 24857 4623 35769 5744 4448 --
NM_015039chr1103512 3416 3235 3135 1336 1063 951 547 78 59 23270 1342 21533 1368 --
NM_015040chr222085 434 1470 ----
NM_015042chr15104379 3917 3795 3778 3682 3654 3471 2844 1243 1188 23434 2971 11045 --
NM_015044chr1632918 2113 550 13148 33081 696 300 --
NM_015045chr1042085 1820 458 299 22130 628 ----
NM_015051chr942960 2604 2350 346 ------
NM_015052chr751296 1124 968 52 30 ------
NM_015057chr131167 ------
NM_015059chr15103386 3079 3035 2862 2853 2590 1094 990 658 577 13646 1901 167
NM_015064chr1252282 1049 545 517 450 32840 2336 578 12849 --
NM_015068chr763376 1587 1532 1011 459 47 1202 ----
NM_015070chr132142 59 --21412 1279 --
NM_015071chr586448 5724 4505 2235 2101 1584 989 652 25882 907 21590 140 --
NM_015073chr1962085 1926 1906 1572 631 308 --22096 395 --
NM_015074chr194599 4523 3706 3541 1556 1023 876 485 192 178 14874 --
NM_015075chrX32053 1658 100 11903 ----
NM_015076chr6134531 4451 4306 3609 3315 3276 1458 1357 1008 976 872 305 189 34480 1570 1504 14283 11789
NM_015079chr1553032 2675 2432 335 32 1887 22139 1285 --
NM_015086chr12----1427 --
NM_015087chr1342407 2274 2230 182 ------
NM_015090chr1106031 5888 5621 5110 4845 4081 3998 2225 658 336 25673 4744 24279 1656 15249
NM_015092chr1694505 4347 4007 3612 3073 1459 1014 856 267 14586 ----
NM_015093chr6--1682 ----
NM_015097chr351661 1508 1485 913 149 1738 ----
NM_015100chr12650 103 31912 473 302 11885 --
NM_015107chrX71966 1909 1538 580 401 304 124 22323 1830 11671 --
NM_015110chr942380 1627 872 410 --1224 --
NM_015115chr422034 1047 21269 320 ----
NM_015122chr191211 ------
NM_015129chrX51122 504 396 227 55 11611 ----
NM_015130chr431135 443 59 11089 ----
NM_015132chr741294 273 193 150 11239 ----
NM_015138chr1562670 2567 2547 2148 1012 963 11071 ----
NM_015144chr1673257 3245 2668 1558 1329 703 455 22930 2567 ----
NM_015149chr152156 2108 1861 839 658 --2769 129 --
NM_015156chr14103489 3378 3136 1471 891 719 464 455 393 174 2775 470 1376 --
NM_015161chr1641159 510 268 200 --159 --
NM_015163chr1471883 1874 1778 1344 492 412 34 21996 335 ----
NM_015170chr821663 617 21887 1611 1217 --
NM_015172chr131262 600 434 ------
NM_015176chr151399 1118 427 259 158 --1295 --
NM_015185chrX52931 826 589 358 209 22302 443 12286 --
NM_015191chr11112624 1871 1078 1015 837 829 527 290 197 92 51 ------
NM_015192chr2042985 2910 2490 441 ------
NM_015197chr1463329 2281 2207 2141 330 61 --23290 308 1700
NM_015198chr72259 107 --1150 --
NM_015199chr332759 1115 535 --12494 --
NM_015200chr462478 2394 2091 1609 562 546 1640 1306 --
NM_015206chr1582888 2838 2579 2441 1248 543 450 317 13697 23281 808 --
NM_015208chr1853511 1542 1361 414 196 11519 ----
NM_015209chr172290 2151 2074 2055 1952 1770 754 ------
NM_015215chr173182 2779 2727 2169 1944 731 60 23163 2714 21012 445 --
NM_015216chr531479 59 51 ------
NM_015225chr942705 2611 2072 33 1663 22820 537 --
NM_015226chr1673275 3201 2884 1239 785 696 613 1593 ----
NM_015227chr213726 511 135 --2353 166 --
NM_015230chr411273 21766 1215 ----
NM_015231chr111198 1920 ----
NM_015238chr5--1541 ----
NM_015239chr91458 ------
NM_015245chr672711 2246 1881 1117 721 668 581 11992 --12175
NM_015247chr16145399 5239 4818 4596 4550 3921 3705 2148 2142 1859 1763 879 676 550 11195 23591 558 --
NM_015250chr941801 1651 827 322 11922 ----
NM_015252chr21376 ------
NM_015254chr882934 2867 2241 1060 660 649 174 27 --22663 2601 12025
NM_015260chr1961532 1393 1236 1224 1053 341 183 --11522
NM_015263chr152855 362 ------
NM_015264chr2254930 4885 3997 3203 1622 ----23630 429
NM_015265chr272591 2073 1964 1765 887 503 48 12121 ----
NM_015267chr1232143 1367 207 ------
NM_015268chr32256 232 ------
NM_015269chr11420 ------
NM_015270chr1252158 1719 1645 1571 406 --21913 686 --
NM_015271chr474125 3921 2762 2628 651 619 174 2874 135 23539 2722 --
NM_015272chr1641680 1306 587 58 --12126 --
NM_015275chr125814 307 245 129 94 11943 ----
NM_015278chr663265 3216 2606 2408 2211 535 1360 23312 2136 13026
NM_015282chr252005 1107 427 406 151 ------
NM_015288chr553908 3597 3366 2686 1451 ----21085 590
NM_015291chr183432 3114 3054 3022 2750 2141 817 283 22172 2159 12459 --
NM_015296chr131958 ------
NM_015299chr1493811 3494 3084 1481 1419 987 901 369 64 --23280 247 --
NM_015305chr1441902 1794 1676 1549 1361 11908 1326
NM_015308chr113769 173 120 ----1855
NM_015310chr8177958 7445 6720 6564 6537 5466 5161 2639 2415 2023 1531 1270 1183 1088 1023 226 63 36940 3072 2222 28269 152 15825
NM_015313chr11134545 4449 4411 4077 4052 3900 3893 3447 3088 1908 1730 877 167 23386 857 23861 1736 --
NM_015314chr752577 1861 920 298 185 2220 112 --11896
NM_015315chr552947 2784 2767 2156 1386 12522 ----
NM_015317chr232466 2341 2124 --32726 2557 161 11773
NM_015321chr1974290 3989 3581 3057 1691 1519 929 23573 588 24728 1700 14239
NM_015326chr162557 935 908 863 738 243 21912 838 21922 117 --
NM_015328chr752008 1255 877 638 377 33052 2563 868 13062 --
NM_015330chr2232535 1815 679 22604 410 ----
NM_015336chr1242377 590 234 194 ------
NM_015339chr201715 1780 1177 --
NM_015344chr841935 827 281 37 ------
NM_015346chr142237 189 21724 322 1291 1407
NM_015349chr682687 2644 2009 1962 1115 747 543 163 22707 675 177 --
NM_015353chr1762257 2247 1931 1014 958 908 --32765 2608 2304 --
NM_015355chr1741843 1447 587 378 ------
NM_015358chr2141272 529 513 349 ------
NM_015359chr852832 1906 1895 646 131 ------
NM_015361chr23901 628 295 ------
NM_015365chrX103903 3540 3094 3080 1260 957 939 346 313 69 --23972 305 13685
NM_015375chr1114857 4552 4150 4123 3829 3786 3401 1588 1424 1116 575 --2625 497 --
NM_015378chr132991 2530 1173 ----1344
NM_015381chr2242017 1941 1356 785 11571 ----
NM_015385chr1073177 2206 1988 1156 875 860 281 32271 2008 719 ----
NM_015393chr463154 2943 2643 1225 173 38 --13094 1514
NM_015396chr331380 1280 1172 21082 228 ----
NM_015397chr991902 1469 1425 1401 1277 688 393 233 59 ------
NM_015416chr122703 676 1657 ----
NM_015423chr1121103 361 --11544 --
NM_015436chr432274 1020 815 138 12934 1354
NM_015443chr1751385 1224 1193 193 154 1383 ----
NM_015453chr321457 733 11371 ----
NM_015455chr553664 3349 2750 923 681 ------
NM_015458chr875264 5235 3584 1235 898 567 35 14293 ----
NM_015461chr18--1677 ----
NM_015464chr74975 924 266 114 ------
NM_015465chr52742 731 ------
NM_015475chr221016 116 ------
NM_015477chr1521039 865 ------
NM_015485chr13330 317 101 ------
NM_015493chr1961708 1686 1479 245 197 76 12181 ----
NM_015496chr81274 ------
NM_015497chr1551084 989 467 299 118 ----1291
NM_015508chr321547 1453 ------
NM_015509chr1251554 1433 1356 1234 536 31597 1565 1380 ----
NM_015520chr392743 2737 2583 2553 2536 2288 2087 974 777 12351 ----
NM_015525chr62923 250 1788 11033 1951
NM_015526chr1921492 574 1342 ----
NM_015528chr172195 176 ------
NM_015530chr23798 394 326 --1274 --
NM_015534chr131042 764 198 1129 --11071
NM_015535chr253972 3964 3409 2587 515 1441 1623 11499
NM_015541chr311158 --122 11259
NM_015542chr10----11151 1999
NM_015548chr63364 239 82 ------
NM_015550chr7103344 2848 2836 2726 2472 2372 1150 814 641 162 23461 616 22545 1088 --
NM_015553chr654737 4682 3693 2006 244 ------
NM_015554chr1552882 2691 2017 775 519 21032 591 22502 698 --
NM_015555chr651824 1265 1157 553 341 21247 61 ----
NM_015564chr553447 3216 3040 2585 489 33454 3072 1054 1562 --
NM_015567chr131225 ----11326
NM_015569chr144717 3076 1903 1493 24847 3747 23143 2930 24803 1064
NM_015570chr731832 1534 237 11150 ----
NM_015571chr652230 949 909 662 252 ------
NM_015575chr223333 1265 32392 1066 640 12277 --
NM_015578chr1921917 575 ------
NM_015584chr1761310 1209 946 344 283 129 21411 907 ----
NM_015601chr103941 648 60 ------
NM_015602chr161825 1589 713 454 247 101 2372 338 ----
NM_015609chr122802 1175 --22007 603 --
NM_015626chr17--2294 186 21097 124 --
NM_015630chr23969 442 218 --11067 11148
NM_015635chr93874 328 219 22069 198 11893 --
NM_015640chr154828 3979 1178 963 29 14892 --15308
NM_015678chr1341356 1208 538 503 ------
NM_015680chr21588 ----144
NM_015686chrX32473 2333 2322 ------
NM_015687chr62231 80 ------
NM_015691chrX62746 1851 687 662 418 58 ------
NM_015711chr193693 277 114 --1260 --
NM_015713chr8103586 2765 2366 2359 1313 1261 1218 1062 631 164 ------
NM_015726chr171785 1538 1395 529 343 319 66 ------
NM_015833chr2121977 928 1367 ----
NM_015850chr882290 2129 2036 1795 1733 1701 136 100 22070 342 ----
NM_015872chr151394 1185 472 452 340 --1459 --
NM_015879chr1878465 7058 6750 5613 2467 1477 1423 47275 7181 3397 1547 1331 12024
NM_015885chr11--1651 1351 --
NM_015886chr8104401 3952 3597 2220 1718 1433 1402 1008 305 36 34597 4101 204 11410 --
NM_015888chr112160 42931 2354 2299 748 11029 --
NM_015891chr642019 1799 1441 620 21829 639 ----
NM_015902chr8--1803 1356 --
NM_015906chr1144750 4653 4479 4031 3983 3545 3418 1860 1804 1062 955 835 258 183 23035 900 24669 4595 --
NM_015912chr831946 1805 1672 21886 391 ----
NM_015975chrX6650 593 569 514 271 211 1353 ----
NM_015976chr12257 65 ------
NM_015980chr531052 645 195 21642 1632 ----
NM_015981chr5103180 3128 3060 3024 2495 2220 1077 937 813 631 ------
NM_015995chr15115381 5320 5128 4505 3972 3842 1713 910 497 336 294 14286 12003 --
NM_015999chr12595 97 ------
NM_016009chr184737 4395 2996 1707 1591 814 613 138 1478 11161 1641
NM_016018chr842231 2188 2134 531 32580 1106 1031 12223 12469
NM_016021chr632739 396 211 ------
NM_016025chr1631917 1810 451 --11578 --
NM_016032chrX21056 154 1178 1452 --
NM_016038chr71566 ----1486
NM_016040chr122518 157 1978 ----
NM_016041chr17--1319 ----
NM_016045chr2021590 240 ----11481
NM_016057chr122829 190 11153 ----
NM_016061chr241448 1406 1235 517 1634 ----
NM_016070chr17--196 ----
NM_016072chr1282290 2174 1910 1690 705 557 332 107 22346 777 12267 --
NM_016073chr152327 71 ------
NM_016075chr1372670 2589 2515 2329 2206 783 563 22534 1105 ----
NM_016076chr193098 2865 2317 2257 1287 983 753 688 584 --12496 --
NM_016078chr173854 410 370 2838 55 ----
NM_016079chr262253 2150 2061 1955 1844 164 --12008 --
NM_016083chr683585 3488 3427 3196 1215 1201 962 666 --11104 11420
NM_016087chr731410 1137 198 --11458 --
NM_016090chr1121078 337 ------
NM_016096chr851595 1456 842 590 450 1835 11763 --
NM_016107chr53990 873 259 1859 ----
NM_016118chr751165 981 423 75 30 --1467 --
NM_016131chr282260 1675 727 387 282 144 106 51 ------
NM_016132chr1593376 2957 2624 2476 1044 668 537 304 260 ------
NM_016133chr22646 540 --1350 --
NM_016144chr54773 576 294 108 185 ----
NM_016152chr321133 357 2998 957 --1322
NM_016169chr1063251 3019 2793 2361 1288 1181 12030 13182 --
NM_016173chr363781 2827 1622 878 589 84 11773 1627 --
NM_016201chr372261 1679 1439 659 513 500 270 22307 2025 1783 1738
NM_016203chr71841 ------
NM_016206chr388586 7929 7689 7148 6836 6234 1945 1845 56438 5445 2607 1046 154 12421 --
NM_016217chr673537 3520 3309 2511 1472 836 550 33091 2887 2731 23652 3383 --
NM_016224chr642139 1469 380 286 21369 706 ----
NM_016227chr191371 1271 1162 416 346 338 288 128 46 ------
NM_016230chr65544 354 162 142 121 ------
NM_016231chr1731681 1060 1052 ------
NM_016234chr103977 897 694 --1942 --
NM_016248chr13104015 3961 3721 3612 3494 2745 1402 1153 598 488 21485 136 ----
NM_016255chr663213 3085 2771 2334 659 430 ------
NM_016258chr12740 731 --1609 --
NM_016260chr2196973 6874 6236 5564 5471 5102 4861 2326 2093 1424 1373 1157 1145 1039 922 834 476 386 218 46297 5332 2469 434 ----
NM_016262chr62136 57 149 ----
NM_016271chr1821783 569 1771 ----
NM_016281chr1231004 892 857 ------
NM_016284chr164962 939 397 283 192 ----
NM_016287chr152049 1893 1784 1481 214 11428 ----
NM_016289chr221908 766 1646 ----
NM_016302chr33515 328 145 ------
NM_016308chr171788 1562 1538 1271 719 377 157 --1452 --
NM_016315chr231464 1454 219 11894 ----
NM_016316chr22597 479 ------
NM_016322chr952275 1299 1123 1048 501 12126 1978 --
NM_016329chr32452 404 ------
NM_016333chr163519 468 192 --2382 166 --
NM_016339chr1741253 1230 409 109 --21470 222 --
NM_016374chr111305 1124 ----
NM_016374chr111305 1124 ----
NM_016376chr17124136 3836 3782 3547 3129 3003 1528 1512 1303 1066 467 106 23983 2930 13052 --
NM_016395chr1581812 1630 1607 1450 365 346 218 25 41804 194 148 68 ----
NM_016396chr1563043 2304 606 554 462 403 22143 1980 2706 288 --
NM_016404chr11125 ------
NM_016410chr9197 1602 ----
NM_016418chr2283744 3593 3524 3021 2448 1317 1143 877 1336 12804 --
NM_016422chr112708 474 1901 --12347
NM_016424chr1741976 799 510 50 ------
NM_016436chr2072555 2056 1995 1965 1714 1002 415 21776 935 12737 --
NM_016441chr252404 2088 1507 716 568 22300 757 12265 --
NM_016467chr211094 1204 182 --
NM_016470chr204487 184 137 106 ------
NM_016475chr1441237 1124 866 273 --1294 --
NM_016486chr12352 177 ------
NM_016507chr1753220 855 721 548 414 11256 --13082
NM_016513chr663817 2657 1109 861 806 513 1685 12627 --
NM_016519chr42169 27 ------
NM_016522chr1111200 ------
NM_016529chr134868 489 408 119 ------
NM_016530chr15103855 3729 3383 3370 3230 3155 2823 1506 804 47 23697 821 ----
NM_016531chr4104072 3635 3401 3362 3235 2785 1119 1010 577 237 34061 3972 3106 ----
NM_016546chr1211802 1425 ----
NM_016559chr341503 617 309 142 ----1415
NM_016569chr1261526 1516 1108 626 592 176 --11041 --
NM_016570chr121311 ------
NM_016574chr111850 ------
NM_016577chr384300 4029 3988 3809 3328 1118 1082 402 11300 ----
NM_016578chr112655 149 ------
NM_016588chr62172 81 ------
NM_016603chr531566 544 360 1749 ----
NM_016604chr531306 1262 288 ------
NM_016621chr11113393 1564 1048 1001 969 652 458 348 241 113 87 12881 1340 --
NM_016622chr231964 612 22 --1572 --
NM_016623chr84166 151 125 101 ------
NM_016626chr1821530 676 11758 ----
NM_016628chr102686 201 ------
NM_016630chr151443 --144 --
NM_016631chr21299 75 1944 ----
NM_016647chr821445 974 --11409 --
NM_016654chr1511229 --1151 1955
NM_016824chr1011446 11276 ----
NM_016831chr121456 690 31611 1528 123 21838 1517 1191
NM_016834chr1754063 3983 3525 2999 1532 13007 23015 1479 --
NM_016835chr1754063 3983 3525 2999 1532 13007 23015 1479 --
NM_016836chr22552 27 172 --1119
NM_016839chr22552 27 172 --1119
NM_016841chr1754063 3983 3525 2999 1532 13007 23015 1479 --
NM_016936chr1662113 1907 713 571 104 89 ------
NM_016940chr21--2448 68 ----
NM_016946chr183582 3559 3490 2701 2515 1319 1313 1223 12754 13002 --
NM_016952chr1143187 3167 2995 1061 31373 1363 742 ----
NM_017410chr1221140 384 ------
NM_017412chr811074 ------
NM_017415chr5124264 3978 3353 3144 3088 2826 1519 1487 1218 346 336 271 43680 3264 2942 1816 1910 --
NM_017420chr1493715 3303 3115 3014 2626 2457 1053 932 704 13810 11403 --
NM_017423chr411576 --12132 --
NM_017426chr41111 ------
NM_017437chr1462341 2183 971 539 382 358 --11941 --
NM_017447chr2134035 3840 724 23350 1757 ----
NM_017449chr161117 1065 633 588 557 355 --1290 --
NM_017450chr1721434 983 1438 2973 97 --
NM_017455chr152758 64 ----130
NM_017457chr191130 ------
NM_017483chr211230 ------
NM_017491chr43412 171 82 --1395 --
NM_017512chr182246 56 132 ----
NM_017519chr64862 307 285 66 --21018 72 --
NM_017533chr17155 ------
NM_017544chrX1939 1988 1711 --
NM_017545chr202401 124 ------
NM_017548chr351828 1518 850 592 233 ------
NM_017551chr1052573 2253 1784 317 132 1328 ----
NM_017563chr3106386 6002 5411 4953 4850 4639 1799 1634 1543 1086 35126 4346 1454 --12068
NM_017575chr1741594 1130 646 631 ----21240 42
NM_017578chr3193 ------
NM_017580chr1082355 2310 1492 787 744 544 403 135 1680 ----
NM_017588chr98782 743 553 525 505 235 203 179 ------
NM_017594chr9113331 2912 2427 2328 2264 2194 2084 2044 1258 701 544 --21090 756 12646
NM_017596chr174646 4289 4204 3207 1280 834 133 ------
NM_017599chr1281930 1855 756 710 571 391 305 38 ------
NM_017602chrX2600 103 ------
NM_017610chr154629 251 220 48 ------
NM_017613chr21--170 1365 --
NM_017626chr1051514 1471 1377 1345 1094 11765 ----
NM_017629chr141383 1208 376 302 2491 221 ----
NM_017633chr673316 3006 2680 1566 956 534 374 12456 ----
NM_017634chr831873 1843 630 11228 ----
NM_017635chr1151489 1450 1353 578 415 11475 11175 --
NM_017637chr9159451 9334 8760 8512 8464 8120 7717 7400 7072 6533 3469 2433 2120 1147 362 27671 1512 12105 13292
NM_017640chr64777 202 92 26 1600 ----
NM_017643chr1773023 2930 2875 2749 2483 2234 1924 ------
NM_017644chr365139 5082 4913 1616 1566 525 11141 ----
NM_017645chr923043 446 22192 267 ----
NM_017650chr7116045 5404 5370 4923 3995 3868 1840 1453 856 156 57 15989 15168 --
NM_017655chr161300 1267 597 533 162 40 ------
NM_017658chr1483772 3692 2953 1751 1744 1172 566 447 21715 75 --11127
NM_017660chr1962381 2340 2150 1225 907 158 --12607 --
NM_017661chr1521087 971 ------
NM_017664chr134816 416 201 41 2248 124 ----
NM_017666chrX82147 2106 1784 1666 878 518 320 54 --1884 --
NM_017668chr161534 1540 ----
NM_017686chr12151 24 1292 ----
NM_017691chr151422 ------
NM_017693chr1351328 1024 559 548 508 21547 1469 ----
NM_017694chr252042 1867 454 405 251 ------
NM_017705chr1533155 2558 713 23775 3536 ----
NM_017709chr163942 3531 3405 2645 1057 1022 22789 705 --23116 3032
NM_017714chr20192 ------
NM_017719chr352299 1872 822 366 34 11716 ----
NM_017730chr32689 646 ------
NM_017736chr1652808 2322 2060 473 30 22140 606 --13177
NM_017737chr152001 1942 1924 1464 204 --1510 --
NM_017744chr11246 148 --11853
NM_017745chrX4663 275 214 76 1739 ----
NM_017747chr51352 ------
NM_017752chrX31361 66 45 11984 ----
NM_017753chr92668 238 1997 ----
NM_017754chr6124857 4559 3615 3456 3226 3065 1647 1550 1459 1340 647 165 1767 14537 13754
NM_017757chr1831102 893 818 11089 21169 1068 --
NM_017758chr1721229 203 ------
NM_017769chr1452722 2290 2249 1156 753 2225 109 12638 --
NM_017772chr671579 1562 1313 1120 670 443 144 ------
NM_017778chr861001 535 383 144 134 86 --11048 --
NM_017779chr152577 2434 2003 410 329 ------
NM_017780chr8----1629 --
NM_017786chr82564 267 ------
NM_017787chr1062859 2834 2754 2450 363 113 ------
NM_017790chr9148 ------
NM_017798chr203902 303 124 11107 ----
NM_017810chr163760 272 31 2741 689 --1646
NM_017811chr933107 560 217 1343 ----
NM_017813chr885060 3976 2135 1383 1271 711 640 28 --25163 4329 15489
NM_017837chr1------1470
NM_017847chr111439 124 1799 1140
NM_017848chrX44384 3672 3151 705 33359 366 56 2192 164 --
NM_017849chr283231 3092 2942 2926 2913 2679 2280 2194 12209 ----
NM_017851chr1541191 1140 843 470 ------
NM_017893chr1031093 551 276 ------
NM_017896chr2093527 2761 2589 2373 819 788 708 654 382 ------
NM_017902chr1084855 2226 1397 1208 1196 757 635 375 24646 2181 14713 --
NM_017913chr9--169 ----
NM_017915chr122957 751 ------
NM_017918chr41114 ------
NM_017919chr9155763 5625 5595 5308 5095 5045 4305 4267 4103 3924 3749 1139 966 764 344 21522 1419 33833 1831 773 --
NM_017925chr931963 1326 236 ------
NM_017926chr141893 ----1327
NM_017933chr221218 481 11554 ----
NM_017938chrX31548 644 49 --1843 --
NM_017943chr1431018 836 35 ----1858
NM_017944chr1193019 2527 2195 2114 2089 933 884 523 414 12348 11928 --
NM_017954chr761449 1129 572 539 352 326 ------
NM_017958chr252661 2484 1228 643 73 --1237 --
NM_017972chr141893 ----1327
NM_017987chr1032036 1895 1481 41703 1662 1543 697 ----
NM_017988chr121695 --1926 --
NM_017990chr16134198 4028 3991 3789 3385 3331 2686 1632 1582 996 912 410 89 12827 ----
NM_017994chr762875 2858 2793 1914 897 296 --1380 --
NM_017998chr91944 --11168 --
NM_018010chr351532 1315 658 539 310 ----125
NM_018014chr251380 1130 891 437 353 193 ----
NM_018017chr1072653 2352 2041 1973 1901 785 723 ------
NM_018019chr1731663 581 197 21595 465 2447 89 --
NM_018043chr113931 162 112 1136 ----
NM_018045chr182840 2450 2279 2197 1993 449 279 31 12717 --22014 108
NM_018047chr53736 722 633 ------
NM_018048chr1242044 1691 1614 781 1797 11558 --
NM_018061chr121101 514 --1223 1612
NM_018063chr102467 33 1156 ----
NM_018078chr4173 1713 ----
NM_018084chr223275 59 2744 82 ----
NM_018086chr231802 1651 586 --1611 --
NM_018087chr12199 74 ------
NM_018092chr1631547 647 587 ----1521
NM_018098chr3--1150 11096 --
NM_018103chr11260 ------
NM_018105chr811097 1509 11074 --
NM_018112chr92865 163 ------
NM_018114chr31136 ------
NM_018120chr841113 998 486 386 11230 --11531
NM_018121chr1043062 2507 2430 1192 21164 169 12666 --
NM_018122chr14604 304 260 232 ------
NM_018126chr41153 --11298 --
NM_018128chr172430 318 --1957 --
NM_018133chr362141 1861 1494 545 448 207 1507 ----
NM_018144chr101104 ----1134
NM_018151chr23765 510 211 150 ----
NM_018156chr132991 2530 1173 ----1344
NM_018157chr1253169 1292 1151 958 837 ------
NM_018169chr122370 51 ------
NM_018172chr1181483 1327 1089 601 445 341 221 203 ------
NM_018178chr152066 1944 1897 1340 777 31539 382 111 11264 --
NM_018179chr123539 188 108 ------
NM_018181chr1861867 1717 1648 1387 326 310 --11773 1347
NM_018182chr1772038 1928 1808 1611 1395 532 313 31741 643 302 11732 --
NM_018184chr3101893 1455 1379 763 743 611 438 333 61 31 1662 ----
NM_018195chr1161951 1899 1864 1804 179 49 22148 219 32045 1672 1608 --
NM_018200chr1592540 2422 1956 1810 923 604 537 278 262 22480 490 ----
NM_018201chr962542 2492 2376 1985 1011 256 --2336 273 --
NM_018202chr14853 255 185 90 ------
NM_018211chr121850 375 21426 354 ----
NM_018227chr443079 2662 2512 2076 22283 1065 ----
NM_018241chr421036 794 2859 265 ----
NM_018243chr4175 43456 2535 1330 416 ----
NM_018246chr822754 1783 ----22199 288
NM_018247chr662962 2688 2416 2012 2001 870 ------
NM_018254chr15846 817 408 339 329 --11708 1980
NM_018257chr2092476 2102 2061 1940 991 801 673 448 279 22466 2172 --1153
NM_018264chr72933 195 1220 --160
NM_018266chr321124 65 ------
NM_018286chr172958 866 --1773 --
NM_018293chr362451 2359 2092 1894 1070 440 ------
NM_018299chr873198 1370 1239 1054 989 896 722 --13344 --
NM_018310chr83603 105 54 ------
NM_018312chr1162212 2118 2104 2046 588 553 21495 1357 ----
NM_018313chr382583 2502 2135 1803 1744 548 534 353 --12327 --
NM_018314chr112614 238 1291 ----
NM_018315chr42479 373 ------
NM_018318chr122662 185 1921 --1957
NM_018326chr72542 29 --193 --
NM_018330chr1041517 1058 334 73 ------
NM_018332chr1631363 538 489 ------
NM_018334chr72550 531 ------
NM_018339chr911679 --146 --
NM_018340chr16134976 4909 4894 4746 4695 4417 4202 3460 1944 1907 1450 631 285 25030 676 ----
NM_018351chr1294267 4178 3519 2876 1845 1706 1633 1013 584 22926 233 ----
NM_018361chr863644 3224 1450 811 357 236 181 1988 --
NM_018362chr1143833 3124 1438 1274 23732 188 ----
NM_018364chr1124107 3845 3801 2967 1313 1155 916 785 557 469 307 233 2869 587 ----
NM_018367chr1142412 2107 790 559 31029 705 126 ----
NM_018373chr1496255 6202 6154 5291 4589 1829 1788 1192 300 35641 4370 4330 25884 1432 1598
NM_018374chr7103734 3718 3663 3625 3430 3213 1548 808 663 440 44205 1748 1561 370 1155 --
NM_018383chr241637 332 114 54 --1311 --
NM_018386chr131146 ----1116
NM_018400chr1173679 3628 3269 3146 968 835 819 1813 1729 34523 1310 742
NM_018403chr393499 3160 3145 2617 1553 1384 1234 907 832 11292 11566 --
NM_018416chr1282329 2051 1043 857 219 203 178 123 --12524 --
NM_018424chr961843 1543 1499 1167 366 298 ----1291
NM_018429chr562875 2389 2021 1134 278 180 22666 173 ----
NM_018433chr23502 444 62 ------
NM_018439chr1882177 802 775 698 469 384 369 145 12370 21978 631 --
NM_018440chr8138701 8219 7874 7347 3400 3339 3308 2834 2218 670 558 464 53 13194 18536 1163
NM_018444chr842393 1899 1686 508 11820 ----
NM_018448chr122426 418 11142 ----
NM_018452chr6_random53486 2642 1478 1131 414 ------
NM_018453chr141111 1371 --1313
NM_018462chr32569 116 ------
NM_018469chr171108 --158 --
NM_018477chr141164 ----11014
NM_018482chr852332 1928 924 366 168 --11041 --
NM_018489chr141733 1506 539 331 11518 2786 678 --
NM_018509chr1741626 1219 480 326 ------
NM_018553chr1751729 1649 1213 589 45 ------
NM_018557chr251693 1353 1174 415 119 1135 11621 --
NM_018566chr174961 4832 4340 3467 1130 546 225 33579 1722 793 14804 --
NM_018569chr441553 1203 1030 276 --11249 --
NM_018593chr62513 161 ----1737
NM_018638chr12135602 5376 5368 4354 4219 3919 3606 3564 2254 1933 1683 811 652 ------
NM_018639chr123539 506 281 ----1427
NM_018640chr122939 425 22642 2246 1618 --
NM_018644chr11----141 --
NM_018650chr181942 1898 1791 729 354 312 250 239 1753 ----
NM_018652chr153653 266 203 2898 873 ----
NM_018660chr892911 2587 2377 2333 2213 1035 996 594 360 --41231 1169 468 29 11971
NM_018667chr1682816 2756 2662 2650 2188 967 510 351 --12469 --
NM_018683chr2041651 1497 379 262 11523 1688 --
NM_018684chrX41285 1127 176 161 ------
NM_018685chr741125 1046 322 177 ------
NM_018689chr1592636 2569 2499 2448 2404 2210 1935 892 243 --11716 --
NM_018695chr532331 1690 823 --1719 --
NM_018697chr752377 467 368 342 235 1293 ----
NM_018699chr42285 118 ------
NM_018704chr131618 707 672 ----1720
NM_018710chr82539 228 --148 --
NM_018713chr13948 911 77 1745 1340 --
NM_018715chr162290 1756 895 566 532 180 ------
NM_018718chr742268 668 153 34 ----1423
NM_018834chr53939 820 45 ------
NM_018837chr202953 719 --1725 --
NM_018841chr153911 3471 2585 1295 536 ------
NM_018846chr72146 129 1263 ----
NM_018890chr721306 294 11022 122 --
NM_018897chr2234 26 ------
NM_018937chr52630 259 ------
NM_018945chr653565 2712 2662 2401 794 199 --12656
NM_018948chr151383 1099 1015 1000 490 ------
NM_018951chr761270 508 352 214 176 105 1955 ----
NM_018970chr731237 1168 242 ------
NM_018976chr1272469 2460 2172 1999 1781 859 127 ----12203
NM_018977chrX11009 ------
NM_018979chr1252574 2522 2120 253 120 22442 1838 ----
NM_018981chr21177 1898 11242 --
NM_018994chr12397 27 ------
NM_018999chr1094550 4327 3822 1906 1887 1665 1362 755 371 --14255 24302 393
NM_019000chr51609 21393 190 11653 --
NM_019001chr384266 3535 3192 3130 3036 1562 1516 915 --14223 --
NM_019002chr2--174 ----
NM_019006chr153639 501 180 127 ----
NM_019016chr172215 92 ------
NM_019027chr442372 1715 876 555 1131 --11950
NM_019035chr432013 1362 1295 21405 672 ----
NM_019042chr72194 50 1909 ----
NM_019045chrX2646 40 --1272 1927
NM_019062chr12285 37 --1303 --
NM_019063chr222279 664 1433 11937 --
NM_019069chr372271 2059 1962 1864 1756 444 68 12625 ----
NM_019084chr1022098 1861 11804 1874 --
NM_019087chr521722 56 21651 625 --1679
NM_019091chr21722 ------
NM_019098chr831837 277 135 2572 283 ----
NM_019114chr952419 2310 2208 2150 143 22248 1903 --12465
NM_019116chr1663014 1340 637 605 513 208 23460 1131 13648 --
NM_019117chrX52783 1241 1009 92 85 22684 2544 ----
NM_019555chr321817 1515 ------
NM_019556chrX21413 472 ------
NM_019592chr91606 1661 1873 --
NM_019593chr2032713 2168 1120 --1149 --
NM_019594chr921536 1006 --1344 --
NM_019606chr71118 194 ----
NM_019842chr62360 34 ------
NM_019859chr1051033 604 566 186 105 21500 1450 1284 --
NM_019860chr1051081 652 614 234 153 21548 1498 1332 --
NM_019885chr252492 2427 1167 1096 346 ------
NM_019891chr121146 1119 21329 874 ----
NM_019903chr1011446 11276 ----
NM_020066chr13960 861 102 1108 ----
NM_020116chr421663 1172 ------
NM_020120chr221094 377 170 ----
NM_020122chr2145587 5059 4860 4507 4293 4244 2300 2013 1505 1460 1441 1211 1074 231 36039 5565 4179 14272 12323
NM_020123chr1051325 1092 518 412 397 31273 1154 181 ----
NM_020127chr151799 1139 603 460 437 41810 1456 1248 94 11686 --
NM_020130chr831446 1135 902 ------
NM_020139chr461924 1882 758 436 413 92 --21369 395 --
NM_020141chr141629 1530 712 324 22155 1758 ----
NM_020144chr751677 1433 682 196 23 11758 ----
NM_020148chr1893010 2493 2347 2327 1085 430 303 293 82 ----11133
NM_020159chr461706 1637 1605 1209 1167 443 1255 ----
NM_020163chr332165 2142 334 ----1173
NM_020177chr563260 1270 1156 745 409 372 ------
NM_020178chr1761199 1057 900 824 120 80 1373 11126 --
NM_020182chr2043301 1320 284 227 1494 13417 --
NM_020193chr113342 330 319 ------
NM_020198chr1731188 1018 482 ------
NM_020205chr143256 1350 1094 407 --33323 2378 981 --
NM_020226chr43708 519 492 1502 ----
NM_020239chr182194 1971 1925 1710 1563 1440 822 460 --31462 621 315 --
NM_020240chr551759 1697 964 837 158 22690 912 ----
NM_020245chr695031 4820 4477 4465 4317 3881 1819 267 206 55074 4666 4173 4125 1782 24308 459 --
NM_020307chr31148 1111 133 --
NM_020317chr13328 303 62 ------
NM_020336chr2093689 3677 3401 3379 3341 1206 1155 1086 504 23284 3198 --1661
NM_020337chr482714 2640 1196 984 587 460 373 48 1810 12374 --
NM_020338chr1052834 2394 698 414 376 --22755 1280 --
NM_020340chr661886 1857 681 657 521 259 --1800 --
NM_020341chr2051938 1401 453 355 163 11269 ----
NM_020342chr262612 2486 1603 731 696 61 31862 1673 574 ----
NM_020346chr1141344 663 621 214 ------
NM_020348chr1062811 2542 1924 1830 610 336 --12058 --
NM_020353chr351950 1548 1476 1433 508 11542 ----
NM_020357chr321548 1469 11590 ----
NM_020362chr11794 ------
NM_020390chr394516 4353 3850 3231 3114 1732 774 304 227 11422 ----
NM_020401chr122216 172 ------
NM_020403chr1331820 1591 667 --1685 --
NM_020405chr174668 642 333 79 --13959 --
NM_020416chr462425 2190 2183 498 312 293 ------
NM_020418chr32421 159 --1184 --
NM_020420chrY51827 1655 1372 254 200 ------
NM_020423chr12563 506 ----1528
NM_020424chr163560 165 22 2183 78 ----
NM_020429chr752861 2307 665 641 139 ----11221
NM_020431chr1452724 2497 624 330 305 --1559 --
NM_020432chr742284 1692 461 339 ------
NM_020433chr2051680 1664 1322 1213 1178 1281 129 --
NM_020440chr172963 2700 2528 2407 665 374 144 1210 ----
NM_020443chr1146613 6595 5730 4820 4775 4228 2707 2609 2497 1862 1516 361 320 292 11872 25152 155 --
NM_020444chr531241 993 37 ------
NM_020449chrX2595 209 169 ----
NM_020452chr132185 1348 826 ----1398
NM_020456chr1351582 917 756 496 30 ------
NM_020458chr261422 1341 787 491 452 175 11535 ----
NM_020466chr695008 4345 4063 3820 3731 1245 1007 748 210 14386 --11970
NM_020473chrX51830 525 329 192 143 1176 1765 --
NM_020474chr1862060 1634 1565 315 183 64 21444 408 1360 --
NM_020475chr82767 402 12386 ----
NM_020476chr82767 402 12386 ----
NM_020477chr82767 402 12386 ----
NM_020480chr82767 402 12386 ----
NM_020526chr121683 1589 ------
NM_020530chr2221051 924 ----1410
NM_020546chr552565 2540 1954 691 340 161 11208 --
NM_020630chr10----2708 59 --
NM_020640chr331875 538 73 11779 ----
NM_020647chr832263 2228 1667 12280 21840 316 --
NM_020651chr231235 705 89 2193 156 --1450
NM_020655chr1641400 1156 539 171 11086 11166 --
NM_020665chrX--2546 221 145 --
NM_020673chr20106473 5905 3078 3056 2446 2057 1321 1252 1091 357 12921 21446 406 --
NM_020686chr1623102 2474 11176 22509 356 12536
NM_020689chr2051722 1441 1212 210 40 --11575 --
NM_020697chr831291 297 144 --11192 2881 367
NM_020699chr175448 5231 3338 1873 836 327 213 34427 3520 3320 23667 1531 --
NM_020708chr2042437 2404 2065 833 ------
NM_020711chr241872 761 397 208 ------
NM_020717chrX144561 3671 3303 3185 3117 3058 1808 1620 1543 1453 969 836 676 77 --13274 --
NM_020718chr16166457 6327 6245 5960 5586 5062 4752 4403 2360 2050 1358 1183 894 568 510 405 56546 6212 4439 2296 1517 ----
NM_020728chr763150 3052 2537 510 216 183 --21235 557 --
NM_020732chr64862 307 285 66 --21018 72 --
NM_020734chr1242965 2930 1340 830 22800 2550 ----
NM_020739chr15114178 3798 3720 3465 3392 2745 2574 1272 250 61 43 2853 634 ----
NM_020742chrX52646 2190 1799 422 246 --12397 --
NM_020744chr2----188 --
NM_020748chr1731948 600 217 ----1179
NM_020750chr651367 1287 427 80 36 --11307 --
NM_020752chr1032154 1847 861 32379 2214 681 12715 --
NM_020760chr22799 486 21553 438 --1240
NM_020766chrX103759 3615 3536 3378 2890 1772 1596 1443 815 62 11083 --2505 93
NM_020769chrX----3669 279 62 --
NM_020771chr62402 146 1367 11475 --
NM_020772chr17198200 7070 7056 7003 6756 6664 6515 6179 5971 5775 5666 2370 2341 1968 1714 1614 998 845 31 37410 2925 2708 1352 28703 8491
NM_020773chr462227 1969 1927 1710 484 320 11805 12071 --
NM_020774chr1885410 4550 4326 2150 1999 1108 853 110 26029 2007 26204 1543 1561
NM_020778chr1564855 4846 4615 4549 3861 1688 --23245 1416 13320
NM_020782chr1253466 1716 1494 1319 906 23289 1084 11071 --
NM_020783chr1812378 12137 ----
NM_020791chr1711156 1333 --1408
NM_020792chr382401 2241 2109 2041 558 542 348 332 --1238 12375
NM_020794chr141415 1266 1130 277 --1244 --
NM_020795chr172675 379 11781 1769 --
NM_020800chr311326 11156 --11362
NM_020801chr532666 760 754 22433 2381 ----
NM_020802chr1143262 1285 1048 378 ------
NM_020803chr452034 1985 1865 1721 200 21949 944 ----
NM_020805chr1861843 1727 1481 683 553 206 ----2164 123
NM_020806chr143813 561 234 ------
NM_020807chr1611525 21657 272 1586 --
NM_020810chr1421433 489 33407 3127 799 ----
NM_020813chr1942801 1011 980 198 12417 ----
NM_020818chr141168 ------
NM_020824chr103574 312 75 ------
NM_020825chr16133692 2911 2773 2651 2634 2586 2485 1333 1154 792 725 437 237 22604 888 1192 --
NM_020826chr11113614 3289 2325 1279 870 555 520 256 150 63 27 --13598 --
NM_020830chr283244 3195 3032 2561 2394 902 681 616 32427 2026 454 23179 399 --
NM_020832chr12616 114 1228 ----
NM_020834chr1471940 1919 1707 1527 1189 657 123 21740 465 ----
NM_020839chr3----1608 --
NM_020841chr1242879 1596 1206 1140 13101 21569 1045 --
NM_020844chr8117074 5539 5517 2656 2516 2436 2305 1989 1719 1418 399 --24965 1712 --
NM_020845chr1242420 774 632 441 12086 ----
NM_020850chr1673132 2985 2723 2449 2400 1117 1067 --21152 368 --
NM_020853chr1262445 2111 1943 1047 809 436 12159 21812 983 --
NM_020854chr1841355 1260 459 57 21512 1485 2245 105 --
NM_020856chr1941398 1303 1293 99 --187 --
NM_020858chr1531936 1557 938 ----11943
NM_020860chr441020 372 269 255 ------
NM_020866chr131855 1299 ----
NM_020868chr241294 520 235 202 ------
NM_020870chr422038 358 --11762 --
NM_020871chrX32329 2165 887 12527 ----
NM_020872chr341768 1697 1649 250 ----11122
NM_020873chr3----1860 --
NM_020888chr121449 661 11304 --1556
NM_020899chr1751723 940 823 630 617 1932 11859 --
NM_020917chr1932699 1128 597 12476 ----
NM_020918chr1083331 2994 2659 2377 980 878 814 47 13447 ----
NM_020919chr23907 394 68 1484 1233 --
NM_020921chr1493437 3013 1443 1138 1131 848 607 466 422 1929 13525 --
NM_020925chr161395 1278 1066 910 451 139 ------
NM_020940chr1062891 2217 2066 648 331 160 1610 12075 --
NM_020946chr931436 573 551 11088 --1219
NM_020948chr183383 3028 2889 2544 2327 1415 1139 416 1445 12931 --
NM_020975chr1022021 1611 11858 ----
NM_020977chr471980 1943 1798 1697 441 226 138 ------
NM_020981chr24142 136 124 27 ------
NM_020983chr1252158 1719 1645 1571 406 --21913 686 --
NM_020987chr103462 425 334 ------
NM_020988chr1641338 300 167 111 --11287 --
NM_020993chr1231902 811 466 --11794 --
NM_021003chr143817 698 617 --1553 --
NM_021005chr1531084 435 420 ----1870
NM_021007chr232246 622 213 --21723 1652 --
NM_021012chr1782741 1985 1122 1051 882 859 837 139 1411 12054 --
NM_021033chr1353159 2974 2777 1175 550 ------
NM_021038chr353274 3042 2633 247 118 1996 12892 --
NM_021061chr884518 4432 3908 3751 2763 1211 744 356 13881 23791 162 11748
NM_021064chr611491 1610 --1329
NM_021069chr441971 1811 662 226 22123 2071 ----
NM_021072chr532526 2408 978 --1348 --
NM_021079chr1743353 2352 1088 665 12723 ----
NM_021083chrX83632 3313 2759 2565 628 471 243 40 ----13183
NM_021090chr22115040 4216 3578 1801 1694 1198 1084 773 343 170 42 14888 13161 --
NM_021097chr242984 2758 2138 845 ----12996
NM_021101chr352019 1905 778 754 702 11729 ----
NM_021111chr941341 1164 380 234 ------
NM_021116chr7109076 8692 8074 6995 6182 3344 1920 1002 760 293 11474 47823 5666 2106 1375 --
NM_021120chrX62054 1218 969 241 157 73 --1106 --
NM_021132chr102539 145 1449 ----
NM_021136chr143683 300 157 ------
NM_021137chr1742196 1666 580 236 ----12207
NM_021141chr27990 969 951 939 401 250 229 1317 1297 --
NM_021148chr722527 1711 11935 ----
NM_021155chr19152551 2509 2500 2453 2348 2275 2263 2215 1916 763 540 168 127 77 33 --32489 2297 2228 11866
NM_021156chr201415 192 ----
NM_021159chr42561 233 1615 --1624
NM_021165chr11780 ------
NM_021174chr81684 ------
NM_021180chr12741 228 ------
NM_021183chrX102525 2216 2042 2036 1834 1777 982 791 335 272 21746 999 12057 --
NM_021190chr12436 119 1904 11187 --
NM_021191chr1222006 319 31940 787 459 ----
NM_021198chr23345 299 274 1990 1360 11262
NM_021201chr1141907 1382 1335 658 170 21721 341 --
NM_021202chr2062606 2540 2115 1981 1225 125 22454 340 ----
NM_021215chr2052075 895 717 394 26 ------
NM_021227chr42213 173 2507 359 ----
NM_021238chr1231687 805 601 11408 ----
NM_021239chr1441443 1209 518 296 ------
NM_021240chr92166 39 ------
NM_021242chrX5637 312 306 298 83 ------
NM_021249chr1411283 41304 557 350 139 11327 --
NM_021252chr102471 53 32108 1375 361 --11754
NM_021253chr651412 1344 391 267 134 2507 417 ----
NM_021255chr1493899 3858 3519 3455 3362 1252 1219 1147 714 33550 568 555 12913 --
NM_021622chr1032211 1913 1649 ------
NM_021626chr172518 183 ------
NM_021627chr3139 21223 449 1331 --
NM_021629chr3105027 4851 4027 3572 1870 1322 1260 1224 1145 561 14105 13185 1730
NM_021637chrX----11342 --
NM_021638chr494963 4955 4846 4199 1794 1265 1169 1144 725 --14278 11753
NM_021639chr14879 593 173 76 ------
NM_021643chr241312 390 120 64 ------
NM_021644chr103828 432 166 ------
NM_021647chr484181 4025 3870 2944 955 492 429 296 12989 ----
NM_021649chr551788 1154 579 147 76 ------
NM_021705chr641581 1145 597 40 1528 ----
NM_021728chr142983 676 ------
NM_021738chr102556 288 ------
NM_021813chr6125840 5594 4366 4328 2240 2084 1964 1708 1580 1393 620 51 ------
NM_021814chr641495 1341 1161 200 ------
NM_021818chr1411370 1249 --11063
NM_021831chr21305 ------
NM_021911chr565327 4902 4640 2112 1725 516 45618 5549 1950 1841 ----
NM_021912chr1593988 3665 3192 1361 1202 1118 1054 598 552 13873 1764 --
NM_021913chr1941550 1440 1174 520 ------
NM_021914chr1442079 760 603 226 ------
NM_021935chr31228 ------
NM_021940chr621567 1530 ------
NM_021943chr642067 1680 184 34 11975 ----
NM_021946chrX2539 423 --1926 1483
NM_021949chrX52891 2410 1127 574 435 ----177
NM_021954chr1363665 2888 1441 1365 953 180 23179 220 --23459 2638
NM_021956chr63311 232 70 11115 21237 971 --
NM_021960chr132780 1121 808 12790 --12181
NM_021961chr11177112 6991 6930 6100 5537 4853 3010 2542 2532 2463 2456 2111 2094 429 329 253 243 17429 17380 --
NM_021964chr3156246 6085 5747 5612 5290 5217 4943 4328 4128 2649 2315 1841 1532 736 368 56569 5061 4923 2111 1426 14184 --
NM_021965chr921333 70 1933 ----
NM_021998chrX21345 1317 ----1331
NM_022037chr23832 719 234 1360 ----
NM_022048chr15106333 6194 5963 4286 2297 2165 1688 665 580 232 21996 1979 14466 25464 4644
NM_022049chr111176 --1236 --
NM_022062chr1141784 1770 461 163 ------
NM_022073chr1461282 622 474 233 163 117 2659 349 1498 149
NM_022079chr103941 648 60 ------
NM_022080chr20112766 2639 2532 2427 1964 1034 947 740 618 520 406 1239 ----
NM_022091chr622607 749 12530 12503 --
NM_022093chr14924 736 249 144 ------
NM_022114chr153906 3867 3228 1716 1202 --23195 1212 --
NM_022117chrX3530 435 167 ------
NM_022121chr641084 1020 868 66 --1358 --
NM_022123chr142605 591 --1468 --
NM_022129chr1031485 956 49 11153 ----
NM_022130chr561039 982 975 343 190 76 --1269 --
NM_022137chr143753 567 371 ------
NM_022138chr661524 1374 1021 488 476 27 21500 1035 ----
NM_022166chr16126313 6142 5535 5304 5109 5044 4847 2333 2081 1738 588 268 11938 16221 --
NM_022173chr23832 719 234 1360 ----
NM_022337chr112623 163 ------
NM_022351chr863747 3521 3488 2562 1200 50 --13756 --
NM_022444chr751892 1836 439 128 38 11634 ----
NM_022458chr773135 2491 2095 1965 1101 533 63 22110 191 12294 22386 566
NM_022459chr13126316 6058 5491 4402 4037 1082 728 721 712 696 397 36 24388 2197 36037 1890 1783 11469
NM_022461chr331092 442 393 ------
NM_022465chr1242144 1949 1181 431 22117 599 ----
NM_022469chr121233 491 1431 --1197
NM_022473chr1573971 3366 2790 1086 545 379 86 --33877 1251 184 24306 1076
NM_022474chr1472777 2535 2397 1730 871 306 128 1734 1217 --
NM_022476chr162713 35 1270 ----
NM_022477chr2031669 656 381 ------
NM_022491chr1283515 2703 2473 2423 2362 2292 192 35 ------
NM_022497chr342440 1502 848 472 ------
NM_022552chr231192 342 322 ------
NM_022574chr772061 2033 1833 1520 1480 1355 290 ------
NM_022652chr123994 331 52 ------
NM_022716chr142941 2172 1068 194 22308 506 1228 --
NM_022725chr115543 534 405 368 183 ------
NM_022726chr61437 11191 ----
NM_022728chr71225 ----1117
NM_022735chr141606 1380 1297 1171 1597 31796 1758 544 --
NM_022742chr72311 41 ------
NM_022745chr152899 2841 2833 2802 2145 11161 ----
NM_022748chr732414 2099 1842 42802 2392 1059 189 ----
NM_022749chr831121 547 232 ------
NM_022753chr162828 2544 1721 851 360 69 ------
NM_022755chr9102642 2595 2139 2111 1984 889 724 276 174 67 1829 11867 --
NM_022756chr161040 978 521 446 274 175 --11228 --
NM_022757chr33402 375 274 ------
NM_022758chr652356 2090 1055 838 74 12171 ----
NM_022763chr373221 3062 2850 1109 1102 984 755 12422 ----
NM_022771chr122251 132 ------
NM_022776chr32411 36 21332 96 21615 276 --
NM_022780chr241194 413 203 104 2368 217 ----
NM_022781chr982828 2339 2043 1312 1239 1188 965 37 --12725 --
NM_022818chr1631537 1194 635 --11378 --
NM_022824chr521719 785 1508 11317 11631
NM_022828chr551482 646 602 596 315 1652 ----
NM_022831chr151531 1140 701 565 301 2727 662 ----
NM_022832chr432552 2345 928 ------
NM_022836chr151398 1185 1159 561 263 11731 --11536
NM_022840chr183459 410 29 ------
NM_022841chr1552285 1971 527 168 134 ------
NM_022845chr1611992 11389 11959 --
NM_022893chr252899 2580 2572 2231 760 --13090 --
NM_022894chr241202 626 525 310 11595 ----
NM_022898chr14114706 4021 3838 3617 3608 1035 1021 725 474 289 227 ------
NM_022901chr931828 1677 145 1513 ----
NM_022902chr5--1142 ----
NM_022912chr232426 2378 101 21007 913 1481 --
NM_022915chr2--1180 1110 1551
NM_022918chr1111739 1368 ----
NM_022970chr1031471 1313 532 --1205 --
NM_022977chrX62573 2459 2392 1787 1755 774 32621 2438 1024 22643 2275 --
NM_023000chr1441656 1559 1437 166 ------
NM_023001chr1441656 1559 1437 166 ------
NM_023002chr1932038 1772 1707 --1635 --
NM_023012chr122505 42 --1528 --
NM_023016chr242701 576 329 311 32453 2415 1147 31008 956 249 --
NM_023039chr52386 42 ------
NM_023071chr122998 142 11043 ----
NM_023072chr193999 820 788 ------
NM_023076chr1672816 2285 2197 778 438 181 123 1698 22696 800 --
NM_023105chr882290 2129 2036 1795 1733 1701 136 100 22070 342 ----
NM_023106chr882290 2129 2036 1795 1733 1701 136 100 22070 342 ----
NM_023110chr882290 2129 2036 1795 1733 1701 136 100 22070 342 ----
NM_023111chr882290 2129 2036 1795 1733 1701 136 100 22070 342 ----
NM_023923chr132783 616 434 23476 690 ----
NM_023927chr511039 163 21357 179 --
NM_023929chr861895 1833 1728 874 522 439 22670 829 ----
NM_024007chr543184 1237 1195 804 12715 --12618
NM_024016chr173783 697 640 ------
NM_024019chr43167 156 50 2265 140 21105 409 --
NM_024046chr341091 992 338 246 11128 1272 --
NM_024052chr1753051 2594 1930 272 205 12437 1100 12392
NM_024090chr461875 1773 1765 1729 1514 701 1763 ----
NM_024095chr1231097 1035 207 11059 196 --
NM_024102chr121112 1055 --2406 169 --
NM_024294chr652356 2090 1055 838 74 12171 ----
NM_024295chr831422 373 138 1731 11927 --
NM_024324chr223194 163 154 ------
NM_024345chr9116091 6041 5842 4748 4155 891 757 613 295 259 118 35939 5176 4296 ----
NM_024408chr1112375 2367 2256 1480 1028 864 801 715 666 316 134 23354 3129 ----
NM_024416chr931098 648 367 11000 ----
NM_024423chr1873329 2883 2700 1530 1256 1094 1022 --21029 973 --
NM_024429chr71841 ------
NM_024430chr1831795 1743 1643 1623 11912 --
NM_024496chr144793 663 573 175 ------
NM_024511chr453052 2627 2559 866 312 21309 1117 ----
NM_024523chr771221 1120 1020 906 150 30 21 --169 --
NM_024524chr371272 1244 1158 835 628 613 505 2685 262 1850 168
NM_024529chr13892 273 23 ------
NM_024539chrX31194 977 66 1479 ----
NM_024545chr23692 198 111 --1552 --
NM_024546chr1331060 929 188 --1945 1884
NM_024548chr321683 1574 --1276 --
NM_024551chr1252581 1963 952 354 250 ------
NM_024551chr1252581 1963 952 354 250 ------
NM_024561chr132145 57 ------
NM_024563chr541884 1807 168 60 ------
NM_024567chr82104 83 ------
NM_024569chr192977 2713 2455 2421 2344 1796 947 904 739 --12288 --
NM_024590chr44580 573 497 41 ----11787
NM_024594chr531626 1479 659 ------
NM_024595chr12195 167 --1125 --
NM_024611chr1563983 3837 3384 2634 587 105 12901 13603 1438
NM_024612chr172744 410 ------
NM_024613chr851701 542 324 262 237 ------
NM_024616chr341458 1411 1315 962 1392 ----
NM_024626chr141583 1305 364 96 ------
NM_024635chr91107 1327 ----
NM_024645chr861550 1242 1227 1024 634 169 41030 614 240 93 11417 --
NM_024646chr143780 3088 1500 94 2383 324 1720 --
NM_024657chrX2671 624 ------
NM_024665chr3114642 4066 3387 3066 3040 1677 1313 846 827 530 351 24299 1589 21044 467 --
NM_024670chr1021386 443 ------
NM_024674chr142391 1189 940 773 23069 3049 ----
NM_024692chr281677 717 602 437 364 297 190 149 31880 1493 1173 ----
NM_024700chr14917 860 197 42 1733 ----
NM_024704chr201756 1746 ----
NM_024713chr1511400 ------
NM_024715chr531430 409 224 --1571 --
NM_024721chr832332 706 256 1777 ----
NM_024740chr1174167 3986 3696 2553 1558 1519 1414 14113 ----
NM_024743chr441356 1304 450 324 1251 ----
NM_024751chr472119 2112 1760 1524 1461 1389 561 --174 --
NM_024753chr2162 ------
NM_024755chr152718 219 ------
NM_024757chr961130 1076 813 328 321 123 ----1295
NM_024761chr9115177 4989 4899 4449 4024 3947 3846 2111 1119 899 813 24551 3240 11972 --
NM_024763chr12472 25 11183 ----
NM_024770chr2145911 5898 5581 5117 4870 4586 4444 1820 1771 560 256 189 114 72 25394 2600 ----
NM_024771chr1172076 1561 951 888 846 329 58 11900 2824 691 --
NM_024778chrX2189 61 1207 ----
NM_024779chr1241561 1320 1091 310 1164 ----
NM_024811chr1111526 21941 1858 1591 1325
NM_024812chr81349 1820 11908 --
NM_024814chr72351 132 ------
NM_024828chr931071 368 151 ----11283
NM_024835chr172162 126 ------
NM_024847chr1651304 1204 1043 457 418 21281 117 ----
NM_024852chr12444 269 ------
NM_024884chr1494584 4515 4307 4243 4219 3707 1674 1538 440 23536 1148 ----
NM_024887chr152129 1480 1448 1332 69 192 11614 --
NM_024893chr201939 ------
NM_024896chr962501 1668 780 547 128 57 1667 12342 --
NM_024900chr451696 931 726 495 407 ------
NM_024900chr451696 931 726 495 407 ------
NM_024911chr14741 243 188 123 ------
NM_024917chrX1841 1722 ----
NM_024920chr421409 47 11430 --1125
NM_024927chr172201 157 ------
NM_024930chr532738 2489 2216 ------
NM_024939chr1641366 1339 1146 99 ------
NM_024947chr3159182 8965 7946 6650 6006 5806 3377 3296 2799 2574 2091 1321 1198 796 584 12832 12913 --
NM_024949chr454619 4390 3850 3824 1466 11514 2827 386 13866
NM_024953chr1222162 771 ----11804
NM_024979chr1321647 1136 ------
NM_024989chr2127474 6400 6178 3188 2821 1547 1279 917 771 660 602 478 67175 5740 5041 4970 2961 1994 12797 27033 6661
NM_024991chr1073177 2206 1988 1156 875 860 281 32271 2008 719 ----
NM_024993chr251514 1186 1180 997 329 --1340 11077
NM_024997chr1641387 1284 1076 167 21131 911 ----
NM_025027chr1921179 23 --11115 --
NM_025054chr862919 1453 717 543 511 266 23690 341 ----
NM_025073chr184172 4052 3165 1752 1729 1461 281 245 ----12916
NM_025074chr462968 2467 2451 2254 1130 1093 33083 3029 428 1912 --
NM_025076chr23666 571 506 ------
NM_025083chr1531927 1270 116 ------
NM_025133chr23943 792 433 ------
NM_025134chr1622487 624 --11588 1187
NM_025137chr152402 27 ------
NM_025146chr362117 1732 831 696 587 24 11928 1116 --
NM_025151chr81463 --31804 795 32 --
NM_025154chr731209 998 556 ----1338
NM_025160chr164342 3435 2996 468 334 306 2898 132 13346 --
NM_025164chr1152149 1584 380 157 98 ------
NM_025179chr194706 4621 4462 3675 3386 1372 450 258 22 13413 13519 --
NM_025181chr21121 ------
NM_025187chr165538 532 345 261 89 --11166 --
NM_025191chr182758 1117 1083 1044 997 401 304 289 13013 ----
NM_025195chr841849 1209 616 484 ----11896
NM_025201chr1531369 1302 673 2804 381 1333 11450
NM_025208chr1132359 1949 1930 12163 ----
NM_025211chr9--1105 ----
NM_025222chr372946 2229 1904 1058 733 503 25 --22201 607 --
NM_025235chr1071733 1620 1581 890 807 356 195 --11632 --
NM_025236chr62204 81 2622 257 ----
NM_025238chr152322 125 11492 ----
NM_025248chr1743258 2934 468 455 22747 877 12307 --
NM_025250chr783019 3011 2977 2229 1116 877 791 735 ------
NM_025263chr651635 1345 699 564 318 1363 ----
NM_030579chr1653680 1433 960 667 282 22668 615 ----
NM_030594chr152449 274 --1157 --
NM_030621chr1464027 4018 1679 1369 1324 825 1627 22626 660 --
NM_030623chr2--21247 434 ----
NM_030625chr1042290 1882 1776 786 12509 ----
NM_030627chr584029 3987 3517 3506 2936 2553 273 170 ----13139
NM_030629chr1641409 1309 516 130 11880 ----
NM_030634chr162250 2139 1802 1618 911 589 1530 42119 2098 1921 904 --
NM_030647chr7116195 5863 4065 2023 2006 1796 1736 1472 1299 884 407 23816 2446 16092 --
NM_030648chr484715 4331 3684 3431 1578 1446 654 256 12139 --15528
NM_030650chr2123926 3859 3125 2940 2882 1695 1348 1209 731 639 303 296 11060 12747 --
NM_030651chr63584 181 55 --2638 100 --
NM_030660chr1461270 569 540 369 299 243 1462 ----
NM_030664chr1041954 418 379 341 1363 ----
NM_030665chr1731374 1326 1197 1539 1247 --
NM_030670chr1231803 1763 1435 12268 --11730
NM_030671chr1231803 1763 1435 12268 --11730
NM_030674chr1255322 2340 1953 1835 592 11717 24795 2023 --
NM_030751chr1031865 681 103 --11817 --
NM_030751chr1031865 681 103 --11817 --
NM_030755chr14102908 2544 2352 2238 1901 1157 1065 1020 853 717 21163 919 ----
NM_030758chr222467 152 ------
NM_030767chr982732 2358 2036 1954 1871 1066 798 105 1371 1419 --
NM_030773chr203432 63 45 41864 1613 1162 717 ----
NM_030780chr841758 1465 1253 165 ------
NM_030784chr62389 40 ------
NM_030791chr1431831 1500 1326 ------
NM_030796chr772177 2070 2032 2022 718 112 56 --1550 1209
NM_030797chr21114 ------
NM_030802chr171727 ------
NM_030806chr1158333 8020 6561 6313 6088 5922 3747 3478 3386 3240 2201 2010 1458 535 154 16750 ----
NM_030809chr1282474 2097 1530 666 653 631 321 254 ----12082
NM_030816chr153400 2370 2279 566 315 1180 --13522
NM_030881chr2242345 524 297 186 1383 12323 11546
NM_030884chr352234 1454 764 683 498 11712 ----
NM_030885chr361667 557 305 158 143 110 ------
NM_030915chr242314 1913 829 167 ----148
NM_030918chr1125372 5010 4872 4612 4289 4133 4116 3810 1798 1696 1562 1517 24729 1839 --1203
NM_030920chr142059 1776 798 66 --133 --
NM_030927chr1031339 1325 1204 --21277 150 --
NM_030934chr171429 1391 461 385 145 78 72 ------
NM_030939chr6157 ------
NM_030949chr631104 308 175 ------
NM_030952chr13890 442 274 --11147 --
NM_030963chr6156 1236 ----
NM_030964chr5123687 3439 3120 2772 2601 2432 2378 2318 1151 756 634 572 13033 ----
NM_030979chr131444 ------
NM_031203chr19155 ----1257
NM_031216chr1872262 1863 1565 1549 1389 735 239 --11594 1281
NM_031243chr741849 846 280 258 12047 11993 12076
NM_031268chr1695254 4896 4250 3416 2114 1930 1103 616 539 --11704 23507 3285
NM_031275chr112600 497 ------
NM_031284chr153734 646 323 127 ----
NM_031314chr1431587 778 334 ------
NM_031362chr252787 2489 1810 1026 289 1346 ----
NM_031365chr252923 2625 1946 1162 425 1482 ----
NM_031366chr252923 2625 1946 1162 425 1482 ----
NM_031371chr111305 1124 ----
NM_031371chr111305 1124 ----
NM_031372chr441421 1348 513 289 --1644 --
NM_031412chr1231171 924 275 --11219 --
NM_031417chr1982329 1952 1806 1789 1755 1133 741 488 12159 198 --
NM_031419chr341245 1238 366 107 ------
NM_031424chr201582 --1194 --
NM_031426chr922618 2283 32642 2486 67 ----
NM_031427chr1495071 4437 3810 3768 2221 794 479 167 106 34129 2180 406 --15952
NM_031431chr1341629 548 482 298 11680 11658 --
NM_031435chr1243169 2521 2181 335 ------
NM_031439chr881624 1315 1291 661 497 488 299 47 1368 --11503
NM_031442chrX63165 2693 2547 1017 705 376 22123 259 13010 --
NM_031445chr283306 3288 2772 2444 2145 699 687 81 --11067 --
NM_031453chr1041985 1741 785 183 21791 315 1746 --
NM_031461chr852267 2163 1940 1701 506 154 ----
NM_031465chr126912 865 833 268 162 41 ------
NM_031468chr7218014 7377 7080 6997 6876 6568 6372 6215 6053 5756 3108 2513 2470 2341 2332 2148 1867 1615 1549 681 609 32628 1764 1342 --11595
NM_031469chr684084 3647 3608 2798 1272 1264 1057 702 24015 3433 12683 --
NM_031476chr1662706 2624 1970 756 325 311 --22809 2543 --
NM_031479chr124975 259 224 164 21148 88 ----
NM_031483chr2063527 3256 2863 2210 548 522 13458 ----
NM_031845chr243567 2713 2561 982 --12463 1377
NM_031847chr243567 2713 2561 982 --12463 1377
NM_031858chr173549 446 304 --11604 --
NM_031862chr173549 446 304 --11604 --
NM_031866chr103881 819 264 1980 ----
NM_031890chr2292269 2135 1045 985 954 762 590 272 136 12614 ----
NM_031904chr1132159 2072 128 22045 741 ----
NM_031911chr442670 2301 2260 2233 1708 ----
NM_031919chr9--134 ----
NM_031934chr171265 ------
NM_031942chr261023 879 869 821 205 47 --21010 153 1279
NM_031989chr123259 120 32 ----172
NM_032012chr9105217 4853 4834 4040 4031 3714 1739 1328 1212 394 --11411 --
NM_032013chr2031669 656 381 ------
NM_032027chr11207 ----1299
NM_032042chr562868 2776 2431 1100 979 208 --12790 --
NM_032047chr32508 139 11741 ----
NM_032050chr223657 307 281 ------
NM_032052chr2211042 1962 ----
NM_032102chr1151208 1122 1068 1004 660 1840 1984 --
NM_032116chr13115518 5223 4677 4172 2133 2075 1952 1547 227 59 25 44904 1997 1615 1004 ----
NM_032121chrX62726 2433 2398 2010 1862 586 --11973 --
NM_032124chr181505 ------
NM_032138chr134487 74 66 29 ------
NM_032139chr191145 11139 11005 1134
NM_032144chr21279 2577 419 ----
NM_032145chr641582 1389 343 288 ----11355
NM_032151chr531819 397 89 ------
NM_032153chr3102799 2061 2007 1975 1875 1793 463 422 245 102 22373 959 21783 415 --
NM_032154chr10--3999 957 695 ----
NM_032160chr1873419 3390 2766 1369 934 806 432 11293 1245 1219
NM_032175chr531861 1299 492 1441 --11323
NM_032189chr1365084 4979 4276 3154 337 45 14523 ----
NM_032199chr1073582 1517 1511 1323 897 865 614 13194 12537 --
NM_032208chr2123525 3418 3020 2477 1440 1407 1255 1014 744 561 387 370 ------
NM_032211chr1021068 325 21139 1127 ----
NM_032217chr451122 885 282 268 156 1914 ----
NM_032221chr2052000 1427 401 128 42 ------
NM_032227chrX------175
NM_032228chr1163441 2968 2872 2813 2484 2300 2838 573 ----
NM_032229chr1331137 901 776 1335 ----
NM_032236chr13908 884 869 ------
NM_032239chr441166 424 171 128 ------
NM_032242chr373311 2796 2207 2198 2120 2081 171 --12087 --
NM_032268chr1642969 2957 2634 545 --22716 884 --
NM_032271chr1621501 616 153 21239 90 --
NM_032283chr121556 1532 --31847 1427 669 --
NM_032288chr352172 1888 1607 265 208 11507 11455 --
NM_032291chr121746 1200 1302 ----
NM_032294chr1741536 1479 709 235 21877 1669 ----
NM_032312chr2162 1747 1734 --
NM_032321chr262806 2043 1242 987 422 188 43289 2155 877 496 ----
NM_032324chr11235 ------
NM_032325chr1131930 368 320 11866 ----
NM_032328chr1--122 156 --
NM_032344chr11124 ------
NM_032352chr1451346 1255 1142 1117 257 ------
NM_032354chr172940 63 1758 --1910
NM_032373chr10105803 5416 5311 5192 4546 4198 1686 1645 396 166 24375 534 11760 1500
NM_032379chr112843 253 --1324 --
NM_032408chr71490 1132 11139 --
NM_032410chr891110 1025 946 781 508 328 172 126 100 ------
NM_032429chr101620 ------
NM_032433chr1951228 1032 536 384 318 --1338 --
NM_032434chr251575 1258 1114 323 199 11002 21212 341 --
NM_032435chr1102213 1706 1672 493 441 433 418 408 365 115 ------
NM_032436chr135906 711 652 208 166 ------
NM_032438chr631268 1182 375 11334 ----
NM_032439chr1021576 472 ------
NM_032440chr1031894 891 226 11872 ----
NM_032445chr152952 489 ------
NM_032446chr563836 2796 2376 1395 1255 58 ------
NM_032449chr192369 2259 2189 2082 838 458 275 156 95 ----1149
NM_032457chr463231 3079 3025 989 318 28 23211 2780 --13243
NM_032458chrX83422 2936 2908 2311 2296 1357 1142 631 --43358 2965 886 552 --
NM_032491chr1251110 1054 917 516 349 --3412 249 222 --
NM_032499chr1531639 238 65 1618 1166 --
NM_032505chr372798 2563 1947 1704 1095 642 226 12818 ----
NM_032509chr832327 613 378 1593 --1264
NM_032510chr1852489 2211 2045 1993 404 22236 1928 ----
NM_032521chr2082792 2411 1174 1168 849 800 310 280 ------
NM_032523chr22191 70 --191 --
NM_032557chr4--1149 ----
NM_032560chr1451053 812 417 379 343 ------
NM_032581chr731628 678 345 2196 95 21510 1415 --
NM_032590chr122260 221 1199 21132 322 --
NM_032595chr1741327 1287 229 51 ------
NM_032632chr1441868 801 751 542 41522 1410 1376 442 ----
NM_032638chr341436 406 353 222 --11077 --
NM_032646chr172570 72 ----11735
NM_032682chr393488 3358 3319 3090 3072 2440 806 767 694 13281 ----
NM_032689chr191179 21166 255 ----
NM_032711chr1763515 1634 1240 1131 936 739 22967 2845 23764 2781 --
NM_032727chr101589 2235 74 ----
NM_032737chr1942664 2481 983 620 ----2669 84
NM_032747chr10127 ------
NM_032758chr222678 641 1252 ----
NM_032784chr61250 ------
NM_032800chr152318 2267 2067 1972 408 1108 1781 --
NM_032804chr1062467 1866 1783 825 343 207 ------
NM_032813chr131984 --1943 --
NM_032826chr795157 4364 3407 3388 2073 1723 677 281 248 1289 14450 --
NM_032830chr16183 ------
NM_032837chr1731886 1804 654 -