TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-875-3p
miRNA Sequence: CCUGGAAACACUGAGGUUGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr511871 2831 555 --1359
NM_000052chrX153414 3251 3179 2620 2435 2200 2167 1172 923 821 760 654 222 162 75 22235 1385 21182 206 --
NM_000084chrX186962 6667 6452 6247 5810 5096 5038 4945 4630 2346 2100 1901 1870 1773 1674 820 452 87 --1749 1501
NM_000092chr2104501 3788 3762 3497 3268 1567 1339 499 461 108 43514 3370 867 648 13912 1717
NM_000108chr781834 1609 1570 1424 767 420 268 197 --21591 99 --
NM_000109chrX102600 2059 1936 931 803 755 738 668 227 218 --12498 --
NM_000115chr1372574 1929 1903 466 336 327 277 --1873 11835
NM_000125chr693800 3732 3683 3666 3377 2934 1539 876 712 12956 23641 699 1127
NM_000161chr1451853 1463 610 311 89 --1147 --
NM_000168chr7153100 2765 2708 2501 2411 2377 2310 2173 2080 2067 1231 1087 427 208 185 23307 2448 1690 --
NM_000176chr5133955 3833 3641 3399 3250 3113 2647 2531 1446 1162 998 359 111 33222 1545 1046 23439 202 1385
NM_000176chr5133955 3833 3641 3399 3250 3113 2647 2531 1446 1162 998 359 111 33222 1545 1046 23439 202 1385
NM_000176chr5133955 3833 3641 3399 3250 3113 2647 2531 1446 1162 998 359 111 33222 1545 1046 23439 202 1385
NM_000217chr12145301 4919 4776 4463 4302 4189 4013 3624 3455 1769 1164 975 661 252 1802 33714 2124 1413 13611
NM_000248chr3103084 2507 1037 1008 955 871 738 589 456 116 ----11191
NM_000259chr15136249 6170 5996 5709 5277 5216 5045 2485 2278 1690 1610 1596 992 24895 1955 165 15652
NM_000264chr942757 2388 341 170 ----21247 66
NM_000314chr1083070 3041 2806 2438 1101 1004 461 293 12852 ----
NM_000332chr6187181 6987 6913 6885 6401 6093 5990 4894 2736 2703 1892 1796 1646 1394 1266 1246 1064 181 14501 37076 6623 5546 21874 1058
NM_000337chr5126421 5791 5080 4875 4605 4585 4139 2523 2128 660 273 225 --11107 --
NM_000351chrX104276 4041 2912 2877 2832 1675 1141 1049 938 828 ------
NM_000362chr2263659 2619 2385 1166 467 223 13017 --1967
NM_000368chr9104314 3504 1563 1413 1357 1119 1100 1073 518 458 1654 23037 88 14486
NM_000390chrX43018 2484 2225 521 12787 12766 33422 3100 370
NM_000411chr2163196 3050 2455 2111 1310 1218 1890 22031 1268 --
NM_000430chr1762747 1518 1080 984 776 758 --23364 1313 --
NM_000441chr752238 1576 677 138 100 ------
NM_000448chr11183254 3205 3190 2670 2223 2160 2101 2007 1184 1097 1055 1034 985 843 820 708 523 379 13132 12140 --
NM_000461chr3114373 4010 3630 3543 2822 2810 1660 1624 747 480 449 --24487 693 23149 3070
NM_000462chr1561687 1646 1585 1561 570 207 ----11271
NM_000489chrX73356 3340 2661 2567 2353 899 759 23401 1151 32429 723 247 --
NM_000533chrX81707 1681 1626 1493 1441 1228 797 299 --11303 --
NM_000555chrX117886 7623 7233 6753 5827 5582 3151 977 918 670 247 --32988 1391 902 37251 5737 2025
NM_000610chr11122863 2656 2224 2148 2099 1855 1090 923 723 444 243 130 12110 22643 2416 22931 511
NM_000615chr1192953 2818 2791 2781 2616 2020 476 423 67 1410 2720 568 12852
NM_000668chr451046 1030 451 428 134 --1168 --
NM_000726chr241335 1052 977 345 --11380 1590
NM_000786chr731379 225 194 ----21491 299
NM_000794chr53163 151 128 1725 --1412
NM_000813chr5165576 5461 5451 5402 5322 4752 4500 3732 1985 1907 1747 1569 1538 1290 882 517 --1204 --
NM_000814chr1584037 3989 3298 3028 1520 1474 580 21 33916 2678 1170 33805 3517 877 --
NM_000826chr4112527 2519 2489 2108 1939 985 848 688 571 342 267 ----12593
NM_000828chrX82031 1822 1724 1707 858 840 523 285 ----31876 1585 1456
NM_000875chr15136621 6546 6538 6345 6184 5577 4841 4750 4587 2772 1690 1509 186 25959 2812 37043 1011 520 --
NM_000891chr17103697 3537 3426 3197 3131 2672 2559 2492 2428 263 --12703 --
NM_000899chr12104050 3850 3773 3281 2955 2936 1498 1434 948 435 --24006 1572 --
NM_000902chr382753 2176 2137 984 818 675 344 243 11213 23205 1078 1718
NM_000919chr51246 --1166 2645 609
NM_000933chr2071617 1587 1552 1526 1506 482 222 1697 --11116
NM_000950chrX112460 2370 2315 2272 1452 1427 1178 1035 931 793 471 --42532 1378 775 59 --
NM_000962chr953137 2323 2077 752 313 42626 374 184 53 23073 959 --
NM_000963chr152438 1710 718 553 366 1847 ----
NM_000965chr361276 1249 361 196 137 47 --2989 852 --
NM_001001132chr2171398 1082 1046 970 960 494 114 ------
NM_001001323chr1272970 2672 2574 2553 1208 865 351 --32443 2281 839 12687
NM_001001330chr103830 508 253 --2892 500 --
NM_001001331chr3102305 2183 1836 1755 1689 959 747 644 195 148 --21737 60 --
NM_001001395chr1242447 2292 1848 868 11132 3815 638 463 --
NM_001001419chr585109 4661 3666 3216 2063 1963 1652 118 22098 407 --1584
NM_001001481chr853260 1298 869 649 384 --12888 13385
NM_001001484chr1021583 247 --3627 343 64 11556
NM_001001549chr762810 2395 1936 1082 931 417 22506 952 22706 1748 --
NM_001001664chr2113992 3620 3127 2776 1655 1312 1234 937 562 556 146 --14030 --
NM_001001668chr1963356 1261 1249 1029 811 24 13556 33748 3393 45 --
NM_001001706chr651079 1038 421 99 70 --11005 --
NM_001001890chr2183751 3648 3594 3573 3001 2749 2699 498 33480 2919 1142 --14101
NM_001001974chr1062279 1919 1629 906 783 63 12304 11875 --
NM_001001995chrX61786 1659 1261 733 602 162 11624 11590 1683
NM_001002243chr23920 43 24 ----1371
NM_001002838chrX41702 322 221 141 --2311 50 139
NM_001002860chr14204648 4631 4452 4083 3908 3752 3733 3599 3433 3189 2968 1835 1710 1668 1488 1327 938 717 377 124 --33293 1405 525 --
NM_001003652chr18218461 8087 7954 6985 6642 6109 5700 2990 2979 2848 2840 2595 1660 1633 1562 1552 1422 1051 742 727 504 12335 45641 3012 2942 980 --
NM_001003674chr18176904 6868 6795 6644 6563 6389 5915 5436 4514 4407 4350 2434 2180 2010 1014 863 650 16518 24952 4839 --
NM_001003712chr1294026 3972 3758 3688 3620 3356 3299 1404 889 1844 33171 3155 229 --
NM_001003800chr963168 2378 776 760 753 444 12517 13678 11116
NM_001003800chr963168 2378 776 760 753 444 12517 13678 11116
NM_001004317chr651687 1632 1053 864 374 --23357 828 13804
NM_001004419chr1254170 3946 3259 1465 247 --24617 641 --
NM_001005404chr1784531 4492 4409 3520 3096 1717 617 234 --24373 3296 11689
NM_001005463chr1062232 1936 1909 763 298 237 1852 --22578 960
NM_001005473chr5226238 6216 6171 5418 5216 4874 4796 4776 4238 4033 2537 2294 2248 2115 1633 1166 1124 638 564 264 223 21 45814 5271 1147 701 46292 5428 4227 325 --
NM_001005609chrX63660 3623 2450 966 939 792 --11041 1178
NM_001005739chr23604 554 237 1640 --1739
NM_001005782chr25383 347 328 165 136 --2275 259 1405
NM_001005861chr31835 2816 115 1639 1188
NM_001006600chr562139 2080 1684 859 569 542 12074 11855 --
NM_001006932chr643054 1258 1156 342 1287 33387 2118 148 13329
NM_001007024chr17134281 3950 3838 3689 3388 3144 2980 2899 1478 467 368 301 193 --1240 --
NM_001007102chr641340 1288 656 381 1392 11025 --
NM_001007278chr13154336 4013 3554 3331 3261 2113 2004 1817 1738 1106 1065 948 819 809 85 14852 15051 --
NM_001007466chr6144968 4504 4095 3921 3336 3263 3239 2036 1737 1316 1225 365 320 28 25072 1967 ----
NM_001007466chr6144968 4504 4095 3921 3336 3263 3239 2036 1737 1316 1225 365 320 28 25072 1967 ----
NM_001007559chr1872030 1529 1373 1313 699 359 211 ------
NM_001008239chr18103648 3360 2914 2814 2603 2567 1451 1355 1319 341 1720 11445 12581
NM_001008392chr343166 2700 953 440 --13532 2518 457
NM_001008401chr1941459 1427 1283 1184 ----1523
NM_001008405chr731589 706 659 --1130 1557
NM_001008495chr852151 1904 1440 764 656 --22198 543 1441
NM_001008539chr8104734 4459 4337 4125 3876 3433 1943 1028 956 562 13383 24059 337 --
NM_001008540chr21464 --2447 440 165
NM_001008541chr1041898 1817 1571 1534 1899 1333 --
NM_001008564chr1361748 1729 1717 876 858 64 ----11629
NM_001008744chr1451410 1367 532 306 121 11054 11300 1593
NM_001008925chr473248 2548 1409 744 734 643 483 12808 2557 528 1999
NM_001009880chr22114620 4264 3750 3356 3267 3055 1194 1061 880 842 656 1599 14471 --
NM_001009899chr3136065 6024 5875 5829 5201 5100 4678 1967 1024 582 244 226 198 15193 34150 4048 122 15513
NM_001009909chr11103518 3303 3195 2848 1522 1494 960 145 105 87 23558 156 --11426
NM_001009993chr274567 4428 4364 1813 1571 1059 806 23916 3013 1555 --
NM_001010862chrX53304 3145 2928 2475 188 23187 2413 32351 536 73 12860
NM_001010867chr186282 4691 2300 2078 840 469 338 121 11507 21748 1531 15026
NM_001010888chrX113863 3816 3613 3519 3369 3201 2945 2907 2838 1678 826 1934 13784 --
NM_001010895chr961977 1596 699 631 582 21 ----188
NM_001010986chrX62499 2452 2415 2182 1835 701 --22381 751 --
NM_001011513chr4114067 3797 3737 3487 2975 2669 2653 1516 1006 855 132 ------
NM_001011666chr7116167 5857 5590 4723 4174 2245 2046 1654 1241 814 619 1472 36531 5417 4182 --
NM_001011708chr242735 2695 1138 214 --1254 1951
NM_001011713chr1451415 1122 474 459 101 --11531 --
NM_001011885chr1561529 1440 1418 1159 452 387 2679 184 ----
NM_001012393chr11105147 4576 4265 4114 3826 3131 1643 1596 1246 949 35007 3650 115 44542 3300 1971 165 --
NM_001012423chr1532792 228 128 11930 11991 12550
NM_001012761chr562512 2432 2085 1068 460 169 12317 12140 22378 609
NM_001012968chrX102494 2392 2136 2031 1979 1072 997 806 679 424 1763 12200 11892
NM_001012977chrX31429 1303 314 11293 1473 11329
NM_001013031chr1082974 2915 2722 2210 1334 1086 668 466 11248 13100 13040
NM_001013620chr12238486 8159 7762 7321 7240 7189 7060 6866 6510 6437 6267 6079 5795 5535 5343 3403 3289 3126 2995 2298 1032 514 53 --48429 5659 3366 1191 1237
NM_001014380chr13135787 5738 4822 4636 4385 4316 3756 3612 1879 1100 929 761 349 1743 194 11553
NM_001014434chr12693 252 --1811 1320
NM_001014797chr10137273 6156 3284 2043 1571 1180 997 950 831 770 764 734 420 --57390 6832 5448 5200 1394 26110 5745
NM_001015877chrX83048 2607 1106 666 545 442 75 65 22879 2738 21121 974 --
NM_001017440chr7147584 7429 7102 6150 5063 1524 1438 1314 1156 663 490 323 258 233 23302 2928 47049 6110 5886 1202 33244 1644 624
NM_001017923chr1421692 1558 1116 1129 1575
NM_001018053chr171487 1435 1264 613 588 425 387 ----11781
NM_001018056chr93582 429 405 ----1242
NM_001018067chr1124535 4257 3564 2148 1857 1838 1509 1179 574 550 304 237 15211 31894 1350 722 1248
NM_001018089chr1583873 3812 3507 3493 2813 1242 280 184 --22798 1130 32611 1546 726
NM_001020658chr141549 1250 336 83 1588 --11531
NM_001023567chr1572466 2184 830 700 628 229 128 11951 32008 1739 806 --
NM_001024647chr12227597 6527 6469 6128 6080 5964 5458 4854 4820 4696 2539 1827 1616 1151 980 963 464 421 352 302 208 84 25673 971 66644 6040 5982 3051 1369 1140 --
NM_001024649chr542789 2231 2106 1926 --32037 1980 1048 11870
NM_001024660chr331719 1037 511 1503 --21432 199
NM_001024847chr352312 1003 956 901 700 --11859 12129
NM_001024948chr1103525 3257 3237 2489 1013 1002 965 689 510 459 1432 ----
NM_001025076chr10206204 6155 6141 5983 5881 5474 5376 5354 5209 4923 4695 4599 4532 4405 2139 1922 1833 1513 1443 448 1957 25069 533 14933
NM_001025079chr364086 4008 3135 1452 306 289 --33373 3014 866 --
NM_001025108chr2104183 3928 3051 1562 954 679 498 368 357 242 13185 11145 13940
NM_001025109chr1----1372 21119 1065
NM_001025201chr21199 --2654 549 1572
NM_001025356chr12122890 2611 2165 927 829 689 596 572 525 415 335 148 --1142 --
NM_001025580chrX104098 3904 3541 3481 2998 2822 1543 958 644 115 23762 1194 13295 13006
NM_001029875chr562843 2462 1943 1909 988 108 12678 22402 721 --
NM_001030007chr16143836 3784 3678 3501 3462 2739 2733 2623 1186 817 762 535 398 248 --23223 2449 --
NM_001030055chr14164429 4367 3799 3692 3515 3429 3327 3250 1859 1618 1496 907 885 488 322 64 --44662 3768 1835 376 21419 1283
NM_001031679chr1263519 2969 2812 2337 656 89 22936 2295 12866 --
NM_001031695chr22104215 4004 2153 1517 1482 1214 816 699 482 287 35238 3401 1223 14882 --
NM_001031710chr731044 354 63 ----1807
NM_001031732chr4103633 3617 2972 2866 2801 2286 1107 1058 954 382 --190 23155 2822
NM_001031804chr1642924 2738 1486 559 23022 81 11468 --
NM_001031812chr531757 512 93 ----1301
NM_001032282chr81353 1265 1509 1477
NM_001032288chr2041492 1330 463 66 ----185
NM_001032380chr1051803 1706 1483 699 61 1335 11246 11492
NM_001033059chr661865 1689 1589 580 504 92 ----2467 65
NM_001033117chr394068 4054 3717 3556 3327 1958 1447 1157 1062 31894 1496 693 ----
NM_001033507chr151468 1430 1255 203 162 21215 671 1494 1659
NM_001033576chr1762505 2394 2027 985 431 255 1235 22496 2332 --
NM_001033602chr13112449 2431 2230 1972 1783 1031 519 495 453 312 286 ------
NM_001035003chr46530 524 437 390 189 167 ----1420
NM_001037132chr761902 1738 694 652 418 203 1809 ----
NM_001037174chr272268 2141 837 406 198 173 116 1513 ----
NM_001037954chr1193417 3239 3230 2690 2435 2357 2351 999 923 --33116 1354 99 --
NM_001038707chr172340 2026 1960 1952 1727 1693 521 --31982 596 51 --
NM_001039199chr2094984 4860 4669 3910 3289 1792 1701 1010 467 23841 3133 24973 366 --
NM_001039538chr2123646 3430 3224 2936 2429 1459 1306 1243 749 415 189 146 23586 2695 ----
NM_001039590chrX93548 3285 3276 3117 3081 2725 1608 1167 590 11253 23440 813 1581
NM_001039618chr1175769 5690 4919 4809 3965 3943 2191 24413 100 44073 1658 1512 804 24797 704
NM_001039762chr1062013 1937 682 516 369 68 1498 1482 --
NM_001039802chr121281 898 --11259 11400
NM_001039840chrX185580 5451 5045 4727 4664 3755 2362 2123 2017 1964 1879 1667 1077 868 849 749 345 330 11010 45590 4767 1939 365 --
NM_001039937chr1384139 3930 3572 3031 2786 2739 1555 144 14183 22939 2890 --
NM_001040001chr692052 1938 1927 1921 1619 1361 558 127 103 --146 21877 397
NM_001040142chr2112358 2279 2247 1926 1889 1535 953 628 220 214 21 --11581 --
NM_001040151chr1163724 2909 2898 1599 280 246 --24570 3096 11631
NM_001040157chr4112828 2635 2620 2203 2139 1862 1816 1171 991 532 237 --22520 26 11830
NM_001040202chr462495 2479 2062 660 424 74 2830 759 1378 1589
NM_001040214chr652066 1724 1558 1547 212 --12249 --
NM_001040284chr16135969 5893 5670 5146 4603 4396 3884 3830 3712 2354 1761 1513 879 12078 11986 --
NM_001040402chr4113251 3027 3013 2579 2402 1976 1295 1140 919 806 624 1415 3967 938 357 --
NM_001040409chr23882 712 190 --2691 320 1945
NM_001040429chr1373474 3384 3266 3183 2503 2297 160 --1458 1180
NM_001040441chr1104359 1995 1581 1430 1397 1271 1109 496 333 69 1283 14204 23534 3335
NM_001040446chr562391 2301 2193 876 525 162 --11801 --
NM_001040450chr1552485 2472 2225 647 163 --1125 22616 883
NM_001040613chr831372 1340 371 1301 --21213 604
NM_001040613chr831372 1340 371 1301 --21213 604
NM_001040624chr83620 556 492 32267 2220 832 --11010
NM_001040633chr73281 271 129 ----21044 208
NM_001040712chr983009 2795 1227 1039 633 546 161 102 --12786 --
NM_001040876chr441690 1311 524 269 --2491 291 --
NM_001042404chr141387 784 553 257 ----11261
NM_001042406chr631143 131 43 --11241 1820
NM_001042440chr542012 1957 1633 1498 --2631 387 2175 118
NM_001042494chr1553874 3597 2912 2519 745 11062 12682 11346
NM_001042506chrX41391 1338 1314 314 --2583 473 --
NM_001042555chr12124760 4641 3738 3118 1333 1070 900 836 643 229 78 72 14031 ----
NM_001042599chr2247689 7497 6580 6396 6168 5662 5649 5518 5147 3000 2695 2605 2447 2377 2083 1790 994 879 838 712 651 631 494 468 35181 3125 3040 22472 1389 16411
NM_001042603chr1285365 5191 4525 4297 1826 1155 1015 999 1912 14666 --
NM_001042604chr3144596 4451 4180 4091 3822 3135 3043 1894 1525 1501 1296 152 127 39 23784 1403 34777 3298 740 13663
NM_001042681chr142521 2175 1810 944 1993 31849 1781 600 --
NM_001042749chrX61770 1598 1465 760 582 40 ----1638
NM_001044385chr264019 3481 2862 2800 2608 1262 13796 1870 12937
NM_001046chr582968 2521 2465 2129 2104 1969 955 936 --22007 422 --
NM_001100108chr1108226 7240 5991 5384 2911 2757 1979 1840 1520 604 17312 68215 7264 7022 5763 2382 1341 33186 3134 83
NM_001106chr3159223 9153 8658 8640 8573 8537 7260 7103 3188 2549 1603 1472 1340 1239 857 26962 6716 47685 7591 7274 3389 18531
NM_001116chr1663026 2897 2460 170 126 78 11218 --12925
NM_001121chr1051714 1614 1196 662 432 21563 161 11305 --
NM_001125chr371653 1642 1617 471 390 279 76 21869 175 41746 1564 155 68 --
NM_001126chr13839 257 180 --21090 131 1141
NM_001146chr882306 2147 2051 1962 1900 778 564 109 22255 551 --1708
NM_001174chrX52283 2211 2146 1887 58 11516 11692 --
NM_001186chr2193120 2441 2305 2194 1093 980 894 411 166 --22934 2552 --
NM_001204chr2227638 7479 7200 7131 6457 5568 5496 4729 3105 2876 2157 2102 2048 1970 1670 1572 1554 1364 1338 1306 910 147 16275 26219 2024 27350 4741
NM_001230chr283810 3406 3353 3166 2649 2521 2475 1564 1103 23223 2487 --
NM_001256chr1762634 2554 2081 1035 976 375 22915 2285 21068 435 --
NM_001259chr7166359 6233 5025 4979 4763 4751 4577 4521 4499 3946 2355 2078 1803 694 301 113 1256 65908 4780 2475 2403 1533 1433 35353 4594 2038
NM_001270chr52454 391 --1133 2985 943
NM_001304chr17113604 3587 3177 3113 2946 2363 1163 884 839 580 443 33625 2735 2608 13282 23361 906
NM_001310chr12112672 2652 1988 1233 802 793 677 591 550 350 135 12004 12346 --
NM_001343chr551529 510 385 169 107 2426 307 21625 1244 --
NM_001356chrX3723 671 581 --22321 2199 22525 1765
NM_001364chr1131827 1366 746 --34695 3812 1614 11044
NM_001400chr131063 1036 239 1947 21256 1167 --
NM_001412chrX73333 957 589 540 399 299 130 12630 11346 2839 605
NM_001419chr19144821 4720 4539 4394 4257 4224 4031 3885 3874 3825 3499 956 689 96 1711 34211 2963 491 34614 4361 845
NM_001438chr193648 2760 2341 854 844 801 508 392 187 22497 154 42865 1360 1077 890 12679
NM_001455chr684845 3512 1923 1593 1303 632 520 420 --31127 885 737 --
NM_001497chr952395 2086 1926 604 503 ----21895 143
NM_001609chr10114169 3636 3070 2741 1693 1386 989 953 577 363 239 34221 3243 584 21072 172 13022
NM_001616chr272795 2338 2206 1049 1014 452 399 32814 1258 406 13131 --
NM_001621chr742878 839 674 563 --32429 2353 1032 32784 907 781
NM_001655chr1192162 1932 1661 1607 1499 1481 1422 778 167 --11874 137
NM_001656chr571659 1345 820 793 432 345 190 --21466 748 1275
NM_001663chr1482446 2222 2040 2031 1934 835 659 289 ----1900
NM_001664chr321033 84 ----1288
NM_001668chr162065 1900 1655 695 685 657 --11975 --
NM_001690chr352096 502 433 392 188 12316 12462 --
NM_001717chr1571512 1472 1416 1372 1124 136 40 --2960 437 --
NM_001742chr761866 1841 1568 1482 542 453 11398 ----
NM_001753chr761512 1472 686 672 411 148 --1453 --
NM_001759chr12104887 4803 4566 4410 3762 3487 3471 2046 1344 357 13362 14193 --
NM_001858chr6104099 3977 3153 2034 2019 1943 1723 1602 745 588 1395 14906 13911
NM_001901chr661084 982 962 112 82 67 --21057 876 --
NM_001949chr672881 2821 2687 2238 2180 2134 638 1806 32750 2325 759 --
NM_001957chr4102247 2228 2221 2088 1938 857 837 612 415 137 11850 --11422
NM_001977chr4--11545 2668 347 11508
NM_001981chr141829 1571 1501 963 ----1525
NM_002009chr1582813 2692 2505 1948 806 684 641 31 22365 2264 21999 501 --
NM_002015chr1383308 2671 2167 1347 1030 897 673 382 ----2738 308
NM_002024chrX72112 1414 684 519 392 263 40 --42172 1536 863 470 1178
NM_002040chr2173154 2826 2558 2439 2160 1064 1047 --1100 --
NM_002126chr1762952 2944 1173 1035 559 380 22970 2685 23561 1022 11467
NM_002137chr731669 847 347 --1286 11575
NM_002182chr362754 2747 2687 2266 721 396 22386 2100 12802 --
NM_002199chr41856 ----2645 209
NM_002210chr253334 2628 1139 1006 815 22446 1378 11305 1470
NM_002214chr7135644 4886 4377 4338 4060 3788 3757 3735 3549 2064 1743 1650 635 14625 14945 23649 188
NM_002232chr13979 890 851 --1273 2995 88
NM_002253chr491419 1216 1183 969 232 156 107 77 61 ------
NM_002264chr384101 3356 1705 1345 1102 957 474 104 33223 1597 1556 31959 647 522 --
NM_002267chr1382323 2049 1808 1571 965 958 516 465 ------
NM_002270chr5105098 4838 4626 4602 3916 3886 3648 2200 1860 1853 13532 1831 --
NM_002271chr1371822 963 904 583 245 183 173 11728 1576 --
NM_002293chr152214 2086 1104 850 400 21830 1113 2986 671 2711 90
NM_002296chr151216 437 338 251 41 --1719 --
NM_002345chr123534 248 56 ----1523
NM_002360chr732667 538 402 --22401 1923 12261
NM_002397chr531918 703 261 --11409 11859
NM_002480chr1271368 1276 1048 548 537 472 390 --11042 --
NM_002481chr1137622 6813 6746 6582 5053 2953 2882 2688 2448 2437 1380 694 121 16643 47718 7384 1224 65 --
NM_002522chr1783915 3885 3796 3765 3269 3161 3062 1370 ----11589
NM_002577chr3104057 3814 3269 1358 1068 975 349 246 40 33 --11043 1380
NM_002581chr995496 5121 4672 3908 1414 1151 952 607 271 --33872 1567 1428 --
NM_002583chr124474 218 161 145 --1125 --
NM_002594chr2052143 1970 886 154 69 --12077 --
NM_002639chr182941 176 1396 11108 186
NM_002645chr1172969 2801 2030 1963 1011 696 335 --12861 1582
NM_002655chr8144943 4258 3958 3851 1787 1620 1544 887 838 763 329 302 254 124 1543 13528 --
NM_002657chr2073895 3871 3742 3549 1397 695 122 2178 96 21165 553 --
NM_002709chr283471 2846 2536 2367 1185 842 408 155 --12408 --
NM_002716chr11123476 3092 2914 2621 2523 2431 1382 992 918 873 732 159 23628 328 23588 52 --
NM_002719chr1482280 808 669 644 568 485 443 375 ----22062 47
NM_002731chr1102534 2354 2139 2113 1263 825 649 443 392 283 1337 22095 1095 11247
NM_002734chr1751690 1572 1485 1423 157 ----1592
NM_002736chr751942 1755 627 184 103 11661 21866 488 --
NM_002740chr352627 2387 2361 1820 391 1198 21830 234 --
NM_002745chr2263077 1530 1078 964 681 340 14025 --14235
NM_002822chr1271196 680 619 411 239 178 130 31622 1233 300 11499 --
NM_002844chr671354 1272 1113 923 374 351 311 --21060 460 11369
NM_002868chr1242063 1757 1662 817 12075 21938 468 1343
NM_002886chr3195159 4804 4702 4513 4479 4235 4210 4199 4193 4011 3756 3651 3454 1925 1229 1144 1068 410 331 --41285 1209 551 461 --
NM_002906chr1172190 1696 1632 402 385 324 241 --11521 --
NM_002956chr124869 455 352 208 11182 1375 --
NM_002959chr164284 4235 1252 1192 805 329 --13300 21068 583
NM_002999chr2041226 762 539 274 11562 11189 11485
NM_003010chr175894 783 723 131 64 ----1317
NM_003012chr873150 1204 988 947 821 629 292 12348 23161 451 --
NM_003068chr821005 206 ----11063
NM_003071chr361482 791 642 365 284 260 1496 ----
NM_003074chr372108 2083 1546 1535 1447 758 94 --12290 --
NM_003095chr12163 1273 --139
NM_003099chr1556602 6107 5254 4098 1507 26199 1780 1300 --
NM_003101chr151472 1245 1149 524 422 --2500 72 --
NM_003108chr2127284 6786 6125 5712 5598 5288 5228 4744 4410 1821 1026 822 --66755 6667 5243 4472 1014 965 22110 787
NM_003112chr773024 2661 1997 995 516 132 107 --21228 1079 --
NM_003137chr652208 2159 2087 1725 1534 1898 31812 381 81 1111
NM_003144chr631398 547 179 12208 --12179
NM_003161chr17113554 3255 2927 2650 2590 2264 1426 1120 791 535 270 197 31105 726 443 --
NM_003178chr351989 1907 541 231 23 11729 1707 --
NM_003185chr2041241 1233 1036 126 11291 --11044
NM_003205chr1582263 2199 2118 1902 1729 890 870 600 1900 11996 11972
NM_003216chr2283155 3092 3031 2945 2648 851 435 256 ----23340 3009
NM_003234chr332323 763 459 1511 178 151
NM_003244chr183443 404 394 ----1307
NM_003246chr1551849 1717 1474 1332 176 1786 41977 1433 542 367 --
NM_003253chr2131670 1643 169 --11554 11463
NM_003274chr2172929 2902 2753 521 359 293 171 --11193 1506
NM_003292chr152274 2254 1908 1745 1475 --2464 137 --
NM_003298chr3175778 5701 4830 4684 4439 4350 4318 4164 2483 2033 1889 1195 1057 706 424 97 42 12264 45309 4028 2051 1389 14855
NM_003304chr351390 1185 1027 655 33 --11217 --
NM_003344chr71367 ----21264 24
NM_003350chr84825 759 323 105 1894 1171 --
NM_003373chr1061762 1604 1204 628 472 172 1392 1268 1529
NM_003392chr394354 3305 3287 3088 2661 1214 1080 550 391 1774 13925 13159
NM_003410chrX52812 1163 608 542 133 --11149 1519
NM_003411chrY61636 1584 1350 1239 508 128 --1259 1475
NM_003412chr342459 2301 872 562 --12228 1965
NM_003458chr362804 2521 1151 886 535 470 --23395 2909 1267
NM_003474chr1051479 959 520 267 53 22063 1615 --1795
NM_003483chr12112706 2554 2465 2196 1978 1086 1069 663 594 100 23 --2781 762 --
NM_003489chr2162522 860 706 613 518 115 ----1370
NM_003498chr1632425 2016 2008 22388 2000 12111 12765
NM_003528chr171752 1278 1086 655 649 634 127 ----169
NM_003574chr18145321 4787 4769 4393 4128 3886 3665 3502 1743 1492 1013 868 820 545 --34188 3984 1180 --
NM_003583chr1293805 3427 2882 2482 1374 1359 975 899 454 23927 208 31023 683 124 12637
NM_003590chr2103392 3376 3114 2850 2630 1617 1272 1175 575 161 31289 1225 122 23141 2917 1702
NM_003597chr251902 639 627 326 165 1201 41624 448 420 50 --
NM_003603chr482022 1972 1611 1493 644 473 441 104 ------
NM_003615chr393901 3476 3468 3044 2783 855 467 384 281 ----12508
NM_003617chr1124190 3600 3520 3437 3187 3145 2009 1297 1052 841 798 792 23587 1896 34427 1882 347 14647
NM_003644chr17156303 6237 6070 6027 5020 4913 4468 2066 1998 1928 1560 1440 1316 1166 811 44859 2018 1213 135 26613 2287 24237 2352
NM_003722chr372613 2547 2459 1861 698 616 562 ----11821
NM_003743chr211862 11926 22170 1803 11773
NM_003787chr1891490 1412 1060 638 627 601 550 514 46 --11054 11500
NM_003831chr183703 695 612 31706 1603 537 --21554 467
NM_003861chr1422221 1954 12500 22720 245 1914
NM_003872chr23479 439 38 1806 32900 600 471 22281 395
NM_003873chr1052571 2394 2311 1664 445 11655 21950 606 --
NM_003884chr371716 1521 1319 575 387 377 246 ----2358 161
NM_003887chr262248 1589 1523 912 681 189 --21840 551 --
NM_003895chr2191659 1531 841 747 698 660 597 347 335 --1544 --
NM_003899chr1332333 1673 542 --22340 417 1300
NM_003902chr16832 753 558 536 300 245 1692 --1792
NM_003909chr8103021 2699 2343 2334 2319 2261 1193 1040 771 750 --1152 21876 694
NM_003913chr6104323 4214 4000 3654 3232 2959 1500 1007 990 859 --24127 3361 --
NM_003939chr1094003 3715 3609 3023 2696 2527 1181 807 436 1325 ----
NM_003941chr772402 2245 1715 814 793 350 256 21962 1663 11970 12460
NM_003980chr641043 183 173 46 --21379 241 1104
NM_004050chr1452572 2433 1758 905 242 22317 1062 --1689
NM_004094chr1472743 2351 2051 951 372 280 118 --2314 81 --
NM_004112chr1741216 604 381 261 ----21490 403
NM_004113chr351968 1947 1267 536 74 ----1756
NM_004124chr1473510 2958 2429 2216 1369 901 266 13176 22806 2748 1704
NM_004133chr842715 2490 493 240 --32542 2480 2109 --
NM_004161chr241598 1514 1045 406 ----1199
NM_004172chr582038 1527 1407 775 655 560 187 62 1387 ----
NM_004274chr14102831 2704 2469 2257 2238 2226 1291 1259 1162 689 12482 12728 13078
NM_004279chr762352 2119 1874 770 746 520 21632 1482 1263 --
NM_004293chr993676 3147 2767 2600 2480 2358 1538 1095 315 23347 596 1546 --
NM_004331chr8102557 2390 2091 2029 1943 855 730 700 268 130 11016 11701 --
NM_004370chr672200 1741 1461 822 763 620 225 --1784 12055
NM_004379chr261366 1282 248 214 105 87 ----11175
NM_004405chr221100 944 ----1853
NM_004412chr10154953 4939 4750 4671 4602 4499 4133 1807 1764 935 780 443 416 389 229 15058 24257 2356 21688 50
NM_004426chr1231715 1618 685 --2698 428 11415
NM_004432chr952418 2001 1742 1578 287 --11945 --
NM_004438chr243169 2941 2220 1153 22928 2141 --12551
NM_004472chr52692 474 ----1671
NM_004480chr143276 261 64 --1830 1750
NM_004481chr16700 584 452 424 262 90 --12555 12664
NM_004491chr1933914 1550 713 ----14154
NM_004505chr1741271 540 517 207 --11613 11520
NM_004529chr941026 967 565 552 ----11247
NM_004571chr2193338 3238 3057 2922 2781 2403 361 323 68 13105 --21314 661
NM_004575chr461630 1206 1200 1192 99 73 --11128 1415
NM_004586chrX115340 5117 4774 4377 4150 4022 3327 2145 2105 1331 1267 --24307 3692 --
NM_004593chr34775 303 271 162 --1889 1212
NM_004598chr5113244 2872 2860 2501 2445 2190 1181 1144 1077 534 284 ----12343
NM_004612chr994460 4138 3955 3778 3612 3576 3177 1025 668 --21176 481 --
NM_004654chrY41120 980 955 561 ----1552
NM_004663chr1571018 513 491 433 262 192 122 ------
NM_004687chr1741852 1658 647 518 12006 21559 595 11485
NM_004717chr741338 1192 533 263 ----11392
NM_004734chr1393204 2991 2889 2780 2706 2586 1058 690 385 --43018 1215 481 243 --
NM_004736chr151533 752 210 204 120 1132 21634 85 --
NM_004745chr8176724 6687 5757 5453 5435 5252 4458 4389 2745 2735 2394 1968 1460 1402 1392 831 347 35020 2101 1409 21202 947 35201 4365 1105
NM_004774chr1753087 2880 2746 2555 349 ----1953
NM_004775chr18112205 2116 2028 1942 1925 1900 1610 1536 865 818 321 --22237 931 --
NM_004776chr2053260 3164 2679 1054 241 1479 23341 660 --
NM_004781chr131171 1123 376 2392 255 1134 1341
NM_004845chrX83640 3394 3267 2796 1588 553 448 208 11152 13929 11565
NM_004852chr184014222 13901 13544 13438 13424 13415 11610 11514 10892 10634 10485 10259 10109 9101 5511 5490 5370 5035 4730 4670 4500 4400 4199 4062 3620 3574 3049 2607 2569 2561 2488 2245 2068 1989 828 642 625 501 309 151 613915 11566 5146 4134 3914 2767 714293 14083 11125 9712 4983 1327 1144 413966 12906 11906 3670
NM_004863chr14145190 5123 4099 3939 3744 3536 3487 3473 3296 1279 1264 945 524 73 11311 65139 5107 4496 3606 1375 239 1771
NM_004884chr152116 69 --1631 1669
NM_004898chr492918 2849 2139 1033 1000 891 854 125 92 1512 2825 733 1484
NM_004929chr861049 472 446 434 327 157 --1147 --
NM_004932chr581716 1692 1674 1563 1293 1273 269 23 --1158 --
NM_004956chr794025 3875 3496 3043 1810 1197 956 881 789 24373 3057 14381 13912
NM_004973chr661578 1558 1381 1217 659 57 --11728 --
NM_004992chrX158454 7406 6808 6418 3336 3127 3011 2216 1969 1560 1311 946 936 252 129 37214 3022 2144 23375 2435 17230
NM_004999chr664240 3746 2820 1283 504 334 2585 577 --1486
NM_005028chr1061476 1437 788 597 341 195 11600 11682 12364
NM_005044chrX84566 4211 3998 3985 1338 1042 504 491 --11488 14598
NM_005063chr10113819 2952 2892 2822 2614 1383 1024 241 221 120 28 ----1888
NM_005065chr14105322 4580 3471 3456 3450 3342 1402 336 236 211 --1167 14084
NM_005095chr13884 543 25 --32187 2131 1456 --
NM_005116chr20124475 4462 4123 3412 3363 3342 3246 3075 2872 951 736 261 23662 3124 44171 4072 3390 1510 --
NM_005121chr1773519 2882 2706 1410 1153 937 175 --41095 1041 948 265 --
NM_005156chr9155245 4824 4786 4465 2137 1976 1533 1379 1202 1180 605 353 265 216 43 14351 44964 4870 4141 3582 33961 1702 870
NM_005164chr1292416 2299 2055 2041 1916 1780 1709 1673 1665 --22341 256 1161
NM_005168chr231728 1513 1147 11316 1500 21176 476
NM_005171chr125893 511 264 248 112 ----11153
NM_005180chr1011646 --11327 177
NM_005238chr1163305 3292 3043 2596 2349 1182 --22336 230 1103
NM_005259chr221541 519 11097 --1217
NM_005277chr4121824 1763 1749 1717 1436 1299 1290 1270 575 553 205 22 --11363 --
NM_005329chr1642277 2131 602 426 --42335 2153 1748 1472 1233
NM_005339chr473992 3943 3419 3385 3258 2900 2656 --23364 884 --
NM_005358chr1371687 1598 1588 1517 1487 1242 631 --1317 11762
NM_005359chr18176006 5964 5614 5390 5293 5078 5008 4572 4050 2528 2496 2409 2391 1876 1326 279 109 11619 35760 4937 781 --
NM_005388chr951616 1606 1371 1306 694 --51728 1444 1282 268 90 --
NM_005402chr731469 1334 1308 ----11198
NM_005433chr1892571 2493 2261 677 555 488 443 209 64 --11954 --
NM_005436chr1093335 1628 1122 583 555 491 376 281 205 12845 23416 1220 --
NM_005465chr162056 2048 1870 1691 390 282 ----1412
NM_005475chr1273027 2610 1161 814 632 378 345 194 1987 13314
NM_005502chr993255 3184 3168 2990 2984 2953 2835 2157 2068 22522 1245 --1515
NM_005506chr452926 2646 1080 569 523 22674 987 11090 --
NM_005522chr761393 1238 1134 492 114 89 1289 1879 1559
NM_005578chr3175053 4833 4628 4350 4334 4179 3899 3719 3654 3595 1624 1182 871 812 713 423 310 1857 21665 1653 13913
NM_005596chr974953 4800 4079 2238 1794 1774 591 34323 2346 1334 31754 1444 680 36178 4313 423
NM_005603chr1841971 1602 1426 669 11852 11707 11563
NM_005604chr652326 1903 1877 828 683 --21745 934 12111
NM_005610chr13943 603 156 --1228 1313
NM_005639chr1241930 1377 531 456 11313 31807 305 94 --
NM_005647chrX83350 3318 3068 2173 673 528 296 234 --2701 567 22712 537
NM_005665chr184949 4295 3662 1610 1301 1124 844 830 --11833 13420
NM_005668chr5164644 3754 3692 3581 3496 3364 3027 2813 1483 1375 1287 1271 1252 1149 851 90 --11008 14328
NM_005737chr252907 2864 2764 2189 2156 22795 790 21814 767 --
NM_005746chr772381 2091 918 435 427 408 263 12338 1145 11809
NM_005748chr1273381 3081 2980 2322 642 274 81 --22629 2276 21046 188
NM_005759chr264464 3955 3386 3271 1877 992 1519 14029 --
NM_005765chrX2734 671 ----1159
NM_005766chr1341171 508 382 22 --41385 1225 1082 500 1482
NM_005785chr1271686 1604 1445 1261 642 290 172 ----2615 301
NM_005813chr252670 2477 2225 1965 851 12278 12502 --
NM_005822chr692337 2257 1721 1623 847 584 499 340 218 1769 --11898
NM_005843chr251592 1512 1476 236 209 21610 258 1181 1505
NM_005868chr772192 2038 1962 1875 1631 259 111 --31592 247 212 --
NM_005871chr1041063 688 426 68 --1442 1345
NM_005898chr11153168 2920 2796 2730 2684 2353 2214 2200 2130 1097 1073 1017 163 127 99 12101 1483 12644
NM_005909chr5143699 3545 3465 3351 3228 3044 1421 1393 1322 672 608 566 200 74 12916 34205 4037 1662 145
NM_005927chr561170 890 814 522 356 107 --2399 190 --
NM_005935chr455283 5186 3225 1389 298 11125 14878 --
NM_005941chr8134186 3500 3435 3202 1606 828 813 778 650 505 339 285 246 33824 2701 1040 ----
NM_005955chr1145170 4881 4856 4435 4233 3955 3786 3656 1822 1585 1201 1015 1008 337 24059 127 35107 3440 398 14106
NM_005964chr172520 248 ----11469
NM_005969chr1151194 1079 957 205 190 1273 --133
NM_005996chr1241205 288 30 24 --21236 1068 1605
NM_006016chr6102260 2254 2156 1743 1728 1650 1482 519 118 102 2815 559 11418 12149
NM_006037chr284844 4803 4476 4200 3386 1549 1446 505 11380 --11771
NM_006038chr2052164 1930 1889 1830 1643 11839 11882 11897
NM_006047chr20113364 3199 3053 2722 2655 2462 2221 2143 890 687 125 --180 --
NM_006060chr763532 3522 3323 3085 1160 820 --34093 3670 418 1327
NM_006094chr832401 2272 673 11599 --149
NM_006096chr841506 1377 1081 1047 --1661 31681 1644 443
NM_006106chr1162925 2459 1382 631 544 68 32889 2452 1130 43152 2832 1005 89 --
NM_006154chr1532620 855 791 11984 2598 73 12648
NM_006166chr1292366 2063 1895 1754 1613 1043 812 324 177 --21644 494 --
NM_006241chr382427 2361 2288 2207 1957 1681 833 345 12027 ----
NM_006251chr553343 3220 2872 2597 455 12064 12690 12990
NM_006275chr2042000 769 427 321 --32137 1917 1796 11651
NM_006315chr474542 2945 1447 1152 1135 539 445 --1326 21727 1061
NM_006364chr1431315 795 69 1232 1460 1831
NM_006371chr3114923 4238 4134 3795 3559 1658 1577 1349 1043 862 552 15132 14406 1757
NM_006375chrX41745 465 381 86 2646 511 1293 --
NM_006379chr752195 2068 1973 1967 1718 11875 --12179
NM_006380chr1774211 3831 3537 3024 525 231 42 --24014 1423 13455
NM_006390chr121620 --21367 581 1439
NM_006420chr2043415 2476 916 237 --1297 22497 805
NM_006460chr1731123 520 392 --1626 1405
NM_006464chr2144537 4518 4012 3806 3626 1832 1667 1544 1425 1225 937 491 117 65 23115 2955 24614 3656 --
NM_006475chr132485 241 ----1614
NM_006532chr1992062 1944 1835 1659 1368 731 703 409 122 --1323 --
NM_006534chr20133448 3213 3159 2863 2672 2633 2479 2091 1209 1086 692 576 83 --22701 2262 12203
NM_006538chr283279 2776 1567 1288 898 795 335 193 53909 3340 1417 710 136 34041 3043 1297 --
NM_006546chr17116637 6161 5686 5652 5171 2419 2389 470 411 235 153 25223 2020 25753 5366 --
NM_006547chr762140 1952 1820 1766 1607 752 ----12113
NM_006572chr1762539 1371 841 613 310 287 1863 13221 --
NM_006575chr1441458 999 419 252 ----11358
NM_006578chr1521786 1580 31641 1292 74 1550 2577 365
NM_006599chr16197792 6759 6315 6153 5953 5644 5355 5123 5098 5073 5064 4982 2785 1903 1608 881 870 680 465 48119 7579 6999 2705 48142 1820 512 250 21860 655
NM_006609chr232892 2519 2314 12247 42501 1847 1183 973 --
NM_006614chr383675 3651 3290 3070 2686 1165 1156 824 11026 2625 215 --
NM_006618chr171333 577 474 403 372 307 124 --1148 --
NM_006624chr1051859 1696 604 591 64 21770 395 2254 183 144
NM_006626chr982035 2001 1982 1063 961 609 515 276 --32476 1855 424 12105
NM_006646chr1362763 2423 2365 2211 1861 532 11122 42412 2323 635 156 --
NM_006717chr953156 2468 2448 938 674 --42835 2739 2091 79 12175
NM_006729chrX195139 5055 5030 4825 4601 4566 4542 4451 4374 3802 2148 2121 1442 1127 1054 1043 911 742 638 1961 12043 12020
NM_006734chr631297 541 29 ----163
NM_006738chr1574009 3413 2980 2912 1560 1307 728 --44609 4547 3434 802 12865
NM_006750chr16297726 7435 7373 7168 7029 7008 6999 6931 6668 6649 6444 5501 4949 3002 2961 2950 2886 2575 2257 2140 1695 1649 991 760 323 314 275 194 49 37512 2264 474 47070 2798 924 686 --
NM_006751chr261038 912 895 720 160 98 1206 --1307
NM_006777chrX42899 2281 2271 861 31980 1971 55 1225 --
NM_006788chr1832116 1679 1545 --11789 1226
NM_006791chr152217 191 ----1635
NM_006838chr1251605 1347 1218 1174 413 ----2434 193
NM_006861chr1262098 2060 1862 1450 757 438 1697 11401 --
NM_006868chr1853150 3117 2405 630 388 22053 1016 23221 1061 11154
NM_006885chr16114035 3385 2913 2809 2574 1456 1423 1403 1280 1210 347 1587 1562 1531
NM_006902chr173348 2086 1345 1290 1277 996 736 --12753 --
NM_006947chr43600 354 115 --1293 21667 702
NM_006948chr2182348 2202 1537 734 693 659 639 72 --1901 --
NM_006956chr772170 1987 1551 953 874 779 36 --12393 --
NM_007007chr12103997 3784 3482 3085 3050 1533 1459 1217 1046 675 11695 1691 --
NM_007011chr15156740 6248 6116 5995 5888 5190 1925 1623 1383 1305 947 701 439 265 69 16526 ----
NM_007034chr121007 291 --1825 1416
NM_007038chr21176017 5647 5249 5186 4967 4863 2058 1836 1730 1364 1213 976 895 882 608 456 352 1771 33972 1764 740 35806 1343 516
NM_007039chr1462028 1638 666 612 360 188 --2771 423 1294
NM_007054chr521516 976 --13775 1904
NM_007073chr653791 333 319 253 73 21439 1283 23541 3238 1267
NM_007085chr341791 899 437 427 11645 2773 202 --
NM_007114chr383202 3194 3172 3166 3149 2698 2663 2322 --22386 2371 --
NM_007137chrX114976 4809 4035 3901 1954 1099 1041 695 584 507 445 12219 14518 14440
NM_007170chr13874 623 303 ----1929
NM_007173chr1142265 1765 1702 670 1971 --1814
NM_007195chr18113641 3440 3272 3177 3115 2808 2382 2325 1143 273 235 1121 1773 --
NM_007204chr13547 263 131 ----1154
NM_007238chr2084724 4432 1250 1032 848 690 644 221 1450 53099 1903 949 505 319 --
NM_007249chr13219193 8708 7958 7028 6980 6733 6498 3589 3567 3477 3419 3392 3347 3203 3175 2808 2558 2102 1416 1067 254 26999 1597 42910 2006 1852 1644 17141
NM_007315chr251490 1422 1283 1086 478 --194 11129
NM_007331chr462681 2632 2083 1934 1041 1014 22308 432 ----
NM_007350chr12154628 4620 4397 4106 2996 1779 1494 1482 1144 1098 670 396 376 181 65 1496 31522 1240 266 12825
NM_007375chr152613 2424 1830 101 53 --12199 --
NM_012072chr20104408 4035 3856 3550 3152 2971 2776 648 266 169 1290 24198 3818 --
NM_012073chr531477 1309 1029 ----1101
NM_012137chr152812 2593 2127 956 388 1752 22617 982 --
NM_012164chr9167308 7159 6482 6286 6226 6072 5965 5957 5441 4714 2683 1418 972 929 843 551 46611 5673 5526 2580 27095 5932 14603
NM_012193chr1175391 4921 4298 3619 1737 592 306 35254 3554 431 21765 1208 14988
NM_012214chr2206004 5983 5977 5503 5236 3902 2506 2400 2302 1970 1838 1702 1083 798 682 596 549 218 134 80 11661 1989 26302 4750
NM_012234chr393758 3439 3029 2887 2343 1071 440 408 304 --22453 1257 1957
NM_012238chr1071540 1256 652 522 423 355 145 --11625 11311
NM_012249chr283389 3010 2559 1278 1235 588 431 425 21099 1010 12331 12598
NM_012262chr1134914 4625 4546 4439 4350 4131 3612 2012 1709 1214 734 350 187 34717 3761 309 ----
NM_012281chr752087 1538 1521 969 328 11968 31910 1738 908 41783 1771 803 181
NM_012287chr384313 4108 3037 2939 1682 1624 1402 1034 ----13077
NM_012290chr261523 1317 1177 667 426 386 144 11351 11238
NM_012297chr4102593 2568 2141 2114 1919 1910 1797 1617 919 757 1651 22355 553 --
NM_012300chr561947 1591 1020 462 181 25 1118 135 --
NM_012302chr151274 1180 1159 802 791 --21025 305 --
NM_012307chr186961 926 901 840 263 121 --1283 --
NM_012309chr1194522 4477 4133 3841 1910 1490 1438 243 210 34242 3670 1553 1403 --
NM_012316chr175472 5449 4065 3533 3479 2236 394 35516 3762 465 13588 --
NM_012382chr544461 1812 995 896 24305 1507 23680 1413 2924 120
NM_012395chr763242 2730 847 819 662 224 --22759 280 --
NM_012420chr1051733 1505 907 373 240 31715 1663 1494 ----
NM_012463chr1251554 1531 1499 402 265 21292 30 11302 --
NM_012479chr762254 2030 600 545 413 362 --22650 445 2904 307
NM_013236chr225784 480 464 451 53 --1505 --
NM_013255chr7198124 7837 7571 7387 5701 3078 2898 2709 2638 2502 2409 2399 1993 1544 1163 1129 939 698 48 28406 5774 36330 2675 232 58747 7986 5501 966 323
NM_013261chr4103675 3547 3401 3378 3244 3094 2438 1448 1353 1178 ------
NM_013263chr16143 1136 --169
NM_013281chr2051368 1268 1192 410 177 --21522 1451 11153
NM_013283chr54747 674 369 120 --2616 343 1307
NM_013309chr1582516 2442 1769 1650 991 813 643 478 21874 535 --2605 198
NM_013381chr12122443 2373 2312 2295 1823 1646 1512 949 871 833 575 378 --32143 1729 105 12075
NM_013449chr1252535 1117 822 395 69 --1765 1581
NM_013995chrX112533 2486 2257 2247 2072 1928 1620 584 287 279 185 ------
NM_014016chr381687 1316 1300 1282 1247 1213 437 77 11664 ----
NM_014028chr642709 1053 176 166 31168 304 66 22036 203 --
NM_014048chr16164934 4862 4791 4759 4240 4186 4036 3954 3822 3628 3441 3242 1285 933 633 191 23472 1711 11634 1880
NM_014106chr1592827 2077 2018 1201 1051 1032 871 666 568 11148 --22987 1079
NM_014112chr895421 5402 3630 2193 2077 1665 1552 1030 849 34704 1940 548 24391 1491 13952
NM_014117chr16102353 2185 1973 1828 950 923 551 539 484 152 --22442 902 --
NM_014154chr341118 1043 1023 238 21500 564 1470 --
NM_014211chr561595 1556 1366 1150 591 374 --1457 --
NM_014253chrX32294 1853 1760 --12373 41665 458 264 80
NM_014268chr1851445 1364 1275 900 393 11125 --1292
NM_014292chr2221446 734 ----21911 1839
NM_014294chr861402 1135 403 274 61 48 --31345 1211 455 --
NM_014319chr122656 21 21230 130 --1276
NM_014325chr1231778 908 155 1125 11496 22271 758
NM_014331chr4217767 7639 7130 6924 6365 6339 6159 5240 5067 5040 4938 2655 2474 2118 1984 1219 1187 737 693 420 160 25368 1424 36832 2146 612 11178
NM_014372chr161965 1840 1505 1349 699 508 ----11898
NM_014388chr1155717 5530 4937 4869 4623 4013 2408 2279 2231 1714 1488 1452 1211 564 350 74812 3916 1723 1003 960 342 210 34229 728 151 --
NM_014393chr842100 1796 1641 251 1490 12227 --
NM_014423chr5225415 5341 5250 4961 4672 4505 4389 4164 4021 3608 3469 3419 2230 2188 2018 2005 1983 1396 513 270 243 185 55309 4773 4187 2181 1581 34649 4063 3805 2994 783
NM_014458chr131341 1207 174 --11399 1387
NM_014554chr12121753 1732 1687 1584 1504 901 847 764 695 488 284 256 --21926 1432 --
NM_014586chr21104673 4429 4044 3707 3591 3375 1716 1195 788 688 23453 1779 --14506
NM_014607chr251693 1676 1667 1550 96 ----12103
NM_014614chr221467 34 --11147 1207
NM_014615chr1673349 2920 2587 1279 734 138 79 12547 ----
NM_014636chr984392 4084 4041 4004 1145 1138 757 326 21519 1461 14304 13043
NM_014646chr1872963 2926 2680 1144 918 372 366 ----13021
NM_014647chr166850 725 657 427 212 153 --1539 1687
NM_014667chr331779 847 696 ----1901
NM_014670chr291578 1546 1209 1203 633 332 269 178 147 --1243 --
NM_014683chr1741842 1739 1476 1412 --11608 1699
NM_014701chr1583389 3010 2937 2851 2590 2584 220 188 ------
NM_014711chr1662125 2101 2085 1375 1354 785 --1827 --
NM_014729chr86585 495 340 330 50 24 11560 --12222
NM_014730chr12115272 4673 4634 4310 4164 3879 3470 1456 1379 732 80 --24329 1024 11641
NM_014755chr274152 3901 2863 1675 1513 592 357 --13893 22734 102
NM_014766chr763493 1043 970 635 418 279 ----12763
NM_014772chr1842714 2442 940 710 11068 13602 12469
NM_014795chr241380 1194 1164 106 --2517 39 --
NM_014804chr1741220 1172 945 82 ----2968 262
NM_014810chr122591 1396 --23541 215 22383 1203
NM_014822chr46639 534 456 424 228 34 --2570 122 2110 71
NM_014829chr522381 305 32047 769 273 --1210
NM_014838chr2272314 2144 2080 1985 999 928 631 --11947 12241
NM_014839chr172458 2066 1952 1656 1602 871 71 --1702 21681 136
NM_014840chr1283299 3148 2522 2443 2243 2234 1193 469 --22947 2842 --
NM_014844chr1454052 3515 3063 1612 1144 1168 14167 11673
NM_014873chr1104622 4384 4313 3651 3266 1794 1533 1189 925 419 --13395 34814 4130 1541
NM_014877chr17237735 7675 7623 7031 6928 6275 5448 5331 5072 4942 4908 4771 3110 3014 2908 2667 2581 2459 2382 2208 2164 1748 1137 11359 26825 5343 12836
NM_014893chrY42252 2096 821 315 11758 31609 684 176 --
NM_014897chr1752895 2070 2029 844 612 12811 3988 651 443 11180
NM_014901chr542102 1610 1522 598 12281 --1124
NM_014903chr1262377 898 887 840 203 67 1497 1785 11909
NM_014904chr1072500 1477 1458 1054 1028 731 343 13797 23055 1350 13316
NM_014906chr17103564 3242 3157 2737 1193 907 800 342 167 79 ----23691 2945
NM_014912chr10103378 3218 3157 3121 3080 3037 2622 2313 2232 997 --13385 1405
NM_014913chr184965 952 360 345 --2228 54 21498 371
NM_014918chr1551574 1457 1104 452 50 ----1514
NM_014920chr663438 3307 3049 2335 1372 360 1348 ----
NM_014932chr361821 1627 1486 1377 396 230 --11614 21895 1528
NM_014943chr841219 921 802 230 --31058 377 351 --
NM_014946chr2142541 2433 2224 2156 2128 1978 1193 1118 1112 935 777 633 433 340 --21076 896 12769
NM_014947chr162995 2219 2092 702 512 400 ----22248 310
NM_014951chr1052001 1692 991 612 55 12603 22552 330 --
NM_014989chr682087 1998 1265 812 574 504 486 130 1792 143 --
NM_014991chr473291 2926 2688 2319 2293 1026 450 ------
NM_015000chr1262865 2546 2419 1989 266 148 ----1982
NM_015020chr1653524 2713 884 781 419 11506 33558 3240 2516 --
NM_015025chr262484 1965 1013 865 859 208 ------
NM_015027chr163367 308 42 --1158 11830
NM_015032chr1382757 2732 2496 1970 1182 972 809 458 --12680 12923
NM_015033chr952513 2446 1053 742 550 --2901 705 13044
NM_015051chr992992 2836 2270 1369 930 841 808 469 77 --1399 --
NM_015074chr1114807 4801 4549 3779 1805 1505 1474 1430 1235 599 428 13480 53469 1824 917 726 143 --
NM_015076chr684227 2826 1329 1218 567 473 396 351 13303 14296 --
NM_015079chr1543042 2273 742 294 12952 32976 2084 391 22678 695
NM_015087chr1362638 2338 1864 990 794 232 1340 1481 --
NM_015092chr16114371 4315 3946 3879 3633 3530 3157 1397 1166 838 728 1555 11876 24685 882
NM_015116chr1321393 345 --11323 1158
NM_015144chr1673060 2806 2794 2669 764 685 334 23546 2586 13410 --
NM_015155chr1052954 2071 1269 350 258 11050 1183 --
NM_015156chr14124036 4006 4000 3884 3878 3724 3379 2788 1281 1157 394 136 21304 447 1734 1419
NM_015172chr111571 11174 --11190
NM_015176chr141792 1717 1620 103 2112 25 21474 629 --
NM_015199chr332089 1889 694 1187 154 22331 2001
NM_015215chr142097 787 464 54 12401 --145
NM_015267chr1252144 1759 1727 1454 558 21641 601 11369 21829 879
NM_015270chr1242347 604 591 257 --11573 22012 1820
NM_015275chr1241501 795 246 167 ----11973
NM_015277chr1881808 1790 1466 1250 634 601 308 238 --11149 1394
NM_015278chr682851 2377 2371 2339 1244 1085 719 561 11042 42507 1098 701 575 23113 252
NM_015288chr553639 3266 1196 932 568 13821 32693 2631 77 13026
NM_015291chr172922 2837 2472 1185 1144 510 481 21115 120 33008 1320 68 --
NM_015305chr1471957 1662 1646 1630 1616 516 349 135 ----
NM_015313chr1143394 1647 1287 807 11419 24566 3553 13406
NM_015317chr262529 2300 2072 2042 1003 890 12657 1792 --
NM_015326chr182811 1852 1818 891 742 613 386 267 125 1518 --
NM_015328chr752881 2645 2479 802 715 32178 1245 974 2930 391 --
NM_015336chr1272460 1685 853 591 428 291 144 1474 32482 2116 621 12062
NM_015344chr862120 2016 1996 828 809 158 --32092 1459 455 --
NM_015347chr1252362 2124 2082 1123 715 12476 --22978 2786
NM_015358chr2141066 1039 999 303 --1318 --
NM_015393chr463311 2995 1327 1091 768 350 --13088 13319
NM_015455chr593201 2688 2639 2620 2575 2557 1344 1311 284 --13281 2719 412
NM_015458chr8115309 5009 4454 4391 3422 1478 1325 1142 994 612 437 34574 3522 342 33754 757 490 --
NM_015460chr331535 1433 93 21935 1334 --11470
NM_015508chr341498 1228 524 254 --11284 1117
NM_015557chr1--1431 22506 41 23212 284
NM_015565chr2151704 1522 1430 677 245 --11630 --
NM_015570chr761696 1535 1451 1170 660 627 1363 --21766 190
NM_015577chr561303 1287 1198 697 454 130 1236 --11728
NM_015578chr1962040 1946 1458 303 145 66 --2783 37 --
NM_015657chr2--1823 2896 851 1427
NM_015695chr641864 1809 1660 1386 ----12035
NM_015886chr895363 5096 5051 4549 3716 1988 1376 512 196 34700 1661 1533 34560 2175 1428 14873
NM_015888chr1103259 3252 2970 2499 2252 2161 2100 1279 851 342 11215 32993 2370 315 11050
NM_015906chr1104865 4837 4711 4654 4488 3590 1872 1100 696 609 13951 2876 464 34169 1568 734
NM_016021chr672577 2532 2333 1959 881 557 397 1768 11016 --
NM_016072chr1272448 2183 1938 1897 938 867 284 --22031 416 --
NM_016075chr1342938 890 845 631 --32957 2262 2014 --
NM_016083chr6103609 3428 3039 2620 1495 1202 971 751 564 159 13972 ----
NM_016125chr172520 460 --183 1107
NM_016131chr262161 1889 1502 1456 632 261 --21629 1517 11765
NM_016132chr1583249 2800 2340 1134 1103 590 384 299 --32734 680 270 12412
NM_016133chr241206 1023 541 493 11551 11443 --
NM_016206chr3218764 8699 8660 8419 7809 7717 6773 6270 5868 5717 3138 2988 2878 2286 2090 1969 1735 1648 1585 364 77 37189 6077 1522 56927 6543 5841 879 581 26126 5585
NM_016217chr6123459 3107 3064 3025 2341 1467 957 856 582 551 370 97 13691 --11435
NM_016248chr1393903 3598 3295 3282 2445 1475 599 513 365 33925 3605 2458 43842 3454 468 284 22714 2603
NM_016255chr641147 762 575 24 --32949 802 312 12296
NM_016257chr1123173 2480 2194 1391 1328 1040 906 832 680 608 468 215 11183 --12322
NM_016271chr1882353 2048 1694 1481 806 686 497 296 1827 31756 1557 755 --
NM_016272chr2262770 2336 2307 1946 576 283 22780 124 12377 --
NM_016277chr641550 1491 1201 652 --21333 88 1155
NM_016289chr241617 696 609 124 1226 1145 1621
NM_016338chr521253 1122 134 --11217
NM_016374chr171382 1077 632 425 393 273 207 --11398 --
NM_016441chr272142 2002 1942 1659 1553 1470 574 --1836 --
NM_016486chr12446 424 ----1362
NM_016530chr15134096 3923 3666 3540 3269 2652 1214 1208 1181 805 322 192 155 1371 13157 33679 2871 627
NM_016626chr1851791 1531 1259 1140 419 --11321 --
NM_016929chr664625 4580 4172 1825 1616 375 1824 23358 1846 --
NM_016946chr173560 2827 2790 2671 2414 1347 1123 21361 435 --1644
NM_017412chr85971 926 464 413 104 1396 1229 11058
NM_017415chr584012 3979 3856 3038 2853 1237 773 272 --24233 3169 --
NM_017420chr14133833 3104 2640 2631 2421 2332 1184 1058 919 792 570 557 49 13526 1504 --
NM_017508chr113991 535 165 1956 --1682
NM_017580chr1042221 2110 1795 420 2752 409 1358 12318
NM_017594chr982618 2494 2329 2282 2090 2060 1250 828 --13333 --
NM_017628chr4155150 4968 4929 4754 4739 4651 4639 4120 3740 3534 3276 1161 1073 918 118 --34910 4055 3561 21797 1388
NM_017633chr673961 3619 3360 2800 2767 1157 647 139 23569 1505 13175
NM_017634chr841615 1301 770 179 --21672 563 --
NM_017637chr9269010 8683 8628 8401 8220 7968 7941 7884 7161 5961 5930 3440 3335 3273 3180 2763 2263 2045 2022 2015 1682 1309 1238 827 249 204 23003 2210 28441 6089 11013
NM_017643chr17102763 2282 1254 1246 968 800 593 253 186 119 1126 33052 2602 134 --
NM_017644chr3104852 4519 2045 1856 1792 1527 1501 1406 1312 444 34299 3280 1698 11121 23957 1383
NM_017650chr7155375 4985 4149 3876 3713 1987 1929 1708 1409 1247 1136 1121 999 828 465 24622 1425 35716 921 379 15948
NM_017658chr1474025 3428 2954 1117 903 769 471 11645 43800 3753 3653 381 --
NM_017666chrX72246 2006 1696 901 526 428 419 2295 152 1144 --
NM_017709chr1124094 4075 3598 3169 3147 1713 1699 1413 1274 1076 255 22 176 23754 1433 --
NM_017736chr1693167 3107 2933 2891 2157 1207 841 337 178 --12869 13187
NM_017742chr1861576 1365 1322 1227 130 112 ----11938
NM_017752chrX61563 1474 1454 566 509 470 ------
NM_017801chr322252 1007 ----12157
NM_017811chr962960 2745 2699 2295 1074 748 42734 2440 2359 2002 ----
NM_017813chr8145522 5150 4998 4950 4205 3763 3705 1571 1471 817 728 529 312 226 25428 4598 31762 1634 1176 14571
NM_017824chr1082549 2463 1716 1013 785 747 627 194 1616 22453 2257 1800
NM_017847chr12781 731 ----2846 206
NM_017848chrX104076 3998 3949 3792 3724 3261 2928 1649 1505 1455 24580 4105 23017 1806 21271 580
NM_017849chr232665 2637 199 --12681 22692 2108
NM_017902chr1085127 4442 4339 3589 1650 833 766 399 14141 25575 1021 --
NM_017987chr1072097 1904 1776 1592 439 195 182 --21610 594 11649
NM_017994chr7102979 2866 1915 1015 722 445 386 324 272 118 12968 ----
NM_018013chr642968 2503 2406 2164 12685 1662 1743
NM_018015chrX3954 361 79 1179 192 --
NM_018048chr1251665 1564 1502 1443 1279 --3674 536 291 --
NM_018084chr263265 3042 2390 2229 681 362 --33062 2844 773 --
NM_018085chr197960 7930 7317 6480 6049 5882 2637 1283 1020 --32627 881 532 15461
NM_018169chr123537 398 371 ----1473
NM_018184chr362099 1853 1414 807 319 22 --2440 359 1118
NM_018243chr4123963 3840 3464 2504 1549 1314 1116 949 928 899 804 554 --13504 1227
NM_018254chr162382 2372 1621 847 493 34 --21663 164 2220 97
NM_018263chr281996 1938 1892 1838 1831 818 283 105 21680 611 ----
NM_018287chr1051360 1120 868 394 259 ----11303
NM_018290chr431167 907 441 11118 11285 --
NM_018293chr342643 2066 1989 1938 ----52771 1912 583 222 150
NM_018323chr451840 1555 1245 184 178 --11614 --
NM_018351chr12104405 4375 4024 3792 998 902 727 562 410 178 ----24646 3239
NM_018361chr8103871 3614 3331 2642 2627 1378 1319 613 456 366 11114 --14038
NM_018362chr11114005 3889 3849 3758 3716 1495 1484 1478 593 450 249 1167 12506 --
NM_018364chr1123784 3732 3508 3421 3358 2515 1113 1070 1031 541 529 432 1710 ----
NM_018403chr3114082 3647 3269 2706 1648 1235 1187 1122 484 275 145 --23681 1448 --
NM_018440chr8208450 8160 7937 7861 7508 6832 6728 6677 6474 5320 2761 2465 2169 2134 1907 1683 1677 1230 810 488 1832 65659 5392 2565 1357 801 751 27952 1496
NM_018448chr122831 194 2510 180 1445 1794
NM_018482chr872571 2136 1980 1951 1759 925 755 --32550 2111 436 --
NM_018490chr1151788 1762 529 391 160 --1658 11900
NM_018557chr251694 1657 1518 634 370 --11614 --
NM_018566chr1125045 4543 4285 3990 3842 3813 3683 1800 1386 1010 547 63 11373 24644 1557 --
NM_018638chr12165568 5526 5389 4991 4493 3999 1996 1865 1684 1619 984 812 749 524 422 410 65094 4713 3864 3442 1302 838 34472 3914 779 --
NM_018683chr2031659 1440 589 ----11677
NM_018698chrX101889 1719 1524 1496 1454 1402 543 450 120 40 --3411 388 142 --
NM_018710chr841077 361 221 196 11229 ----
NM_018718chr771787 1610 1547 1530 498 471 409 11478 11823 282 46
NM_018844chr721831 195 1171 1372 1799
NM_018898chr542288 1745 835 565 ----1229
NM_018958chr15103913 3440 3166 3130 1597 1475 1167 571 329 84 22948 2882 --23481 3433
NM_018976chr12102831 2687 2627 2354 2294 2000 1782 1067 1001 695 1262 187 --
NM_018979chr1252425 2275 1868 1642 811 ----31747 1737 1615
NM_018981chr251377 1236 1125 1035 397 ----11161
NM_018999chr10104594 4420 4140 3823 3575 3380 1763 1111 592 106 1961 24584 3886 --
NM_019004chr762079 1981 1650 1546 917 560 2729 416 ----
NM_019012chr121718 1251 --2320 295
NM_019035chr491967 1888 1612 1539 695 574 513 444 29 1719 21900 1695 --
NM_019042chr751243 1195 1157 1104 987 ----11206
NM_019050chr472248 2198 1932 1842 867 692 536 ------
NM_019080chr1381539 1530 1485 1479 1156 1011 954 345 ----151
NM_019094chr1253605 3033 2362 598 121 --43270 2602 1023 291 2502 143
NM_019098chr881804 1786 1697 1163 485 410 302 212 11678 21380 137 --
NM_019114chr941836 725 441 199 --12401 1273
NM_019116chr1693654 3551 3299 2560 1435 1015 939 548 395 22755 84 --12649
NM_019891chr151182 1096 948 485 249 --1314 1516
NM_020066chr14961 842 645 370 --1976 1137
NM_020122chr2205322 5284 5036 4282 4245 4079 3987 3875 1827 1768 1733 1723 1616 1401 1376 1217 810 187 165 96 ------
NM_020144chr772029 1995 1695 1644 1593 646 494 --21404 164 --
NM_020182chr2063489 2909 1418 1019 944 269 33246 3208 708 22848 291 12279
NM_020198chr1731310 1022 547 198 --1215
NM_020228chr1141719 835 637 224 12062 21696 473 --
NM_020338chr1073750 3698 2719 2450 1471 360 68 43350 2509 388 349 23549 2306 --
NM_020341chr2031402 808 334 1101 21625 246 --
NM_020390chr3144078 3835 3764 3486 3203 3121 3058 1925 1528 1233 1223 905 858 455 --34423 3249 237 21564 125
NM_020440chr163248 2412 2076 1171 643 37 23072 2518 32428 1183 542 --
NM_020466chr653767 3268 3212 3050 27 --34282 1895 1013 --
NM_020640chr372072 1981 1769 1707 465 321 199 11911 ----
NM_020651chr251836 1758 1668 1264 411 11219 --11700
NM_020673chr20147624 7217 6695 6598 6345 5455 4960 3060 2543 2410 2108 553 176 86 --11013 11552
NM_020717chrX114680 4074 3968 3956 3706 3258 3186 1604 1454 481 111 1804 14435 13921
NM_020718chr16166338 6084 5909 5605 5063 4578 4353 2512 2446 2381 2361 2319 2271 1334 1153 967 24782 909 26345 1557 1304
NM_020734chr1262647 1228 1142 1071 313 55 --11342 --
NM_020742chrX52477 2303 733 698 333 11824 42737 2323 1685 194 --
NM_020752chr1082767 2246 2090 1039 1014 522 245 239 1556 11862 12444
NM_020768chr552280 1986 997 719 481 32200 1298 647 --2959 196
NM_020772chr17208421 7991 7975 6908 6778 5972 5573 5378 5310 5292 5255 3248 2512 2152 1917 1124 1070 966 901 649 11864 ----
NM_020774chr18156004 5912 5865 5782 5391 5338 4666 4314 3911 2283 2211 1058 979 846 96 22054 489 24347 2349 24926 627
NM_020783chr1841510 529 212 65 ----12066
NM_020794chr161475 1249 1201 1160 560 490 --21359 433 --
NM_020858chr1562179 1656 859 543 525 132 --21903 915 --
NM_020860chr421103 400 --1120 1470
NM_020871chrX42240 2166 1937 433 --21948 553 2475 268
NM_020872chr391807 1665 1659 1570 1341 1270 1199 112 91 --11699 --
NM_020917chr1993631 3361 3257 2836 2780 2605 1092 565 482 11250 1599 --
NM_020975chr1021901 639 --1382 21652 1592
NM_021038chr353093 3046 2902 2810 2215 --22666 279 2721 177
NM_021083chrX133655 2999 2539 1418 1222 990 921 915 533 484 406 265 247 --33441 2732 2276 1356
NM_021090chr22114936 4699 4410 4131 3610 1975 1699 1652 758 348 198 24866 954 24479 4047 14061
NM_021097chr2123077 2985 2821 2813 2735 2528 2213 1208 1016 983 916 797 1651 1305 --
NM_021111chr931381 952 881 21293 374 11209 --
NM_021116chr7109051 8937 8928 7877 7732 7027 2415 1754 802 233 11037 21949 299 11492
NM_021155chr1962430 2204 2161 2135 1979 541 --42704 2417 2308 2173 --
NM_021167chr752267 2225 2115 2036 1090 --2140 26 21062 1010
NM_021183chrX32509 736 265 --1977 12010
NM_021202chr2062577 2242 1904 1022 846 353 12134 12627 12543
NM_021227chr41550 1483 --1367
NM_021238chr1251546 1509 1455 838 545 ----1351
NM_021252chr1042061 817 753 437 --11747 11983
NM_021255chr1453859 3296 3063 1009 683 --63840 3193 2785 2715 1638 1507 12672
NM_021633chr131194 288 206 1510 1453 177
NM_021643chr251397 1174 296 68 33 ----11346
NM_021645chr1362356 2119 1963 763 394 203 --22376 1696 --
NM_021813chr6145790 5617 5522 5443 4931 4861 4683 4289 3749 3688 1273 639 377 262 25301 702 ----
NM_021914chr1482312 1986 1856 1848 1731 912 659 106 12100 1384 11753
NM_021954chr1393698 3283 2408 1455 1442 826 766 554 159 12589 22604 2389 13559
NM_021960chr161796 1037 821 763 572 224 1850 --11857
NM_021961chr11267392 7284 6656 6552 6538 6112 5639 5626 5408 5022 4622 2865 2776 2727 2507 2464 2291 2002 1785 1690 1478 1429 415 330 174 145 32971 1939 1494 22257 1151 17460
NM_021964chr3196334 6002 5239 5095 4670 4632 4316 4289 2556 2360 2321 2301 1917 1621 1510 1239 774 551 369 1664 35456 1260 379 11098
NM_022048chr15125187 5133 4904 4187 3891 2166 2154 1790 1747 1656 1531 997 24385 1590 45207 4960 4606 3946 --
NM_022133chr881908 1746 1526 1277 1203 1197 708 432 31698 1617 755 1565 --
NM_022140chr552288 1902 832 547 514 1720 12117 1853
NM_022166chr1655825 5678 4017 2243 284 11136 --26331 320
NM_022351chr863176 2867 2836 2729 610 187 --33276 2645 1142 --
NM_022444chr731979 1751 664 2454 368 21903 1576 --
NM_022458chr773136 2907 2603 458 311 138 84 12485 1210 22568 849
NM_022459chr13106277 6175 5224 4829 3882 3860 1509 1083 1054 251 11239 34607 2371 603 14702
NM_022465chr1252624 2457 1101 378 344 --11234 22642 2448
NM_022475chr42620 491 1472 --1135
NM_022484chr761310 1165 1140 941 437 254 --1343 --
NM_022491chr12102897 2731 2455 2387 2187 1172 776 736 410 241 33406 768 209 --22693 2365
NM_022497chr383747 3502 2865 2718 2640 1407 932 905 --23676 1453 1489
NM_022552chr231135 300 208 ----1311
NM_022739chr1731002 181 62 ----1285
NM_022763chr373029 2877 2757 2430 2211 443 301 ----1280
NM_022771chr123746 378 51 1348 --1942
NM_022781chr973003 2980 2234 1279 1047 860 89 13066 1956 --
NM_022893chr252893 2756 2673 764 49 --2436 104 12241
NM_022894chr231287 1127 451 ----21251 585
NM_022897chr55888 842 232 169 104 --1224 1865
NM_022918chr1192121 1890 1875 1782 834 624 389 122 104 11584 ----
NM_023016chr292806 2481 2469 2438 1135 792 688 632 443 12032 22554 2547 1182
NM_024345chr9115167 4790 4727 4088 2210 2078 2047 1890 1448 808 636 45983 5542 5199 668 25827 4164 --
NM_024524chr3113022 2537 2061 1236 1043 903 776 656 487 328 275 ----1252
NM_024539chrX61009 864 279 203 180 67 ------
NM_024624chr241363 1229 600 337 --11243 31078 399 280
NM_024636chr741973 1869 932 537 22870 1934 1952 12572
NM_024646chr193754 3580 3447 1344 1325 1263 246 236 95 ------
NM_024665chr3144502 4327 3952 3898 3730 3713 3639 3612 3349 3053 2864 1775 1358 547 --14630 14165
NM_024700chr141163 1113 1011 918 1305 --1237
NM_024749chr162309 2270 1851 1422 722 279 --2659 401 --
NM_024770chr295480 5065 5024 5007 4587 4445 4412 4351 1742 35466 5437 4947 45586 4260 612 441 12625
NM_024830chr582188 1778 1677 684 586 492 339 129 --2798 484 11916
NM_024921chrX61639 788 551 503 200 84 1304 --11289
NM_024947chr3299493 9352 8512 7615 6568 6421 6348 5921 5807 3828 2715 2682 2518 2430 2194 2031 1659 1647 1638 1529 1250 916 797 585 543 410 394 264 180 57772 7190 6479 2101 1928 23795 1013 --
NM_024949chr4114933 4837 4394 4362 3838 3728 1021 598 457 150 28 --11847 --
NM_024989chr2157900 7502 7046 6479 6173 5926 5779 3109 2845 2530 2243 1793 882 670 388 21284 1159 45604 1662 1643 1361 26962 6928
NM_024996chr371069 702 410 362 338 302 68 ----1974
NM_025054chr883718 3567 3365 3289 2840 512 302 202 33259 2758 623 14084 21427 942
NM_025134chr1692540 2397 2133 2108 965 803 625 515 112 2996 144 2860 644 --
NM_025147chr241108 1084 987 66 --1945 181
NM_025154chr731477 1279 430 --31149 591 502 21175 458
NM_025160chr184230 4044 3917 3688 2762 628 526 481 13615 33720 1467 991 11240
NM_025191chr163561 3441 3213 2702 1084 89 12936 1874 --
NM_025208chr1162447 2313 2057 2044 1661 596 --12083 2893 566
NM_025235chr1071989 1903 1792 894 495 227 184 1563 2784 204 22037 1776
NM_025237chr173543 315 141 11567 1473 11303
NM_030579chr16112894 2471 1257 1201 1096 978 961 896 399 331 253 ----13648
NM_030621chr1483854 3831 3653 2827 1271 1133 987 516 --23900 3672 13691
NM_030627chr5123975 3887 3730 3547 3518 3481 3149 3049 1387 1307 510 484 --33813 626 26 --
NM_030647chr7206188 5943 5555 5445 5088 5056 4777 4645 4566 4074 2400 2172 2152 1719 1444 1408 1245 988 878 150 14979 1305 --
NM_030648chr4135290 5015 4967 4142 4101 4050 2234 1832 1756 1651 1201 658 360 --2895 335 --
NM_030762chr1251948 1711 605 587 572 --11720 --
NM_030918chr185288 4990 4433 4290 1473 608 547 42 55390 5267 882 769 631 21673 268 24765 781
NM_030962chr1141404 1395 1175 231 ----11192
NM_030964chr543583 2915 2423 397 1821 33125 1329 213 1287
NM_031296chr472180 2149 2137 709 684 625 437 1695 1193 11776
NM_031445chr293253 3205 3029 2832 1242 1188 1168 657 479 --21030 985 --
NM_031469chr683038 2849 2649 2605 2597 1606 1412 1025 53613 2992 2673 1138 558 21390 818 52909 2838 1363 1085 615
NM_031483chr2083280 3151 3062 1302 1250 1115 659 162 --11071 1177
NM_032042chr5132889 2883 2732 2698 2273 1943 1902 996 819 807 618 461 455 42326 1871 739 442 11972 2956 161
NM_032102chr1162963 1257 753 517 283 127 12905 --12896
NM_032153chr392324 1095 1074 1061 816 464 292 204 140 --1304 1742
NM_032160chr1864209 3523 3005 2856 1728 1438 ------
NM_032199chr10113785 3616 3056 2471 2431 2416 1393 1309 811 746 422 11133 ----
NM_032221chr2041512 677 247 100 --11841 1631
NM_032268chr1642937 2408 671 264 1138 1813 1757
NM_032320chr114784 326 273 204 ----1293
NM_032373chr10115025 4914 4880 4839 2124 1858 1798 1328 1046 374 167 14949 21496 109 25054 4463
NM_032440chr1072784 2489 2477 2076 753 471 182 12573 --11965
NM_032445chr1562464 2080 1834 1721 693 670 ----12451
NM_032457chr443030 2475 1465 1093 33654 3267 465 21505 672 1793
NM_032458chrX73378 2937 996 875 772 405 395 23209 3068 11304 --
NM_032505chr362550 2346 657 591 502 180 186 --11082
NM_032557chr43718 687 95 ----1886
NM_032582chr1741275 551 528 219 --11636 11543
NM_032622chr421343 248 --1201 1446
NM_032632chr1461995 1896 1615 1579 1467 385 --2432 416 --
NM_032682chr383603 3588 2351 2326 842 517 195 116 11375 12523 --
NM_032737chr1962675 897 565 409 212 105 32625 823 587 --196
NM_032826chr745427 5002 4325 642 25179 1438 14299 11981
NM_032869chr83741 667 521 ----11550
NM_032968chrX154233 3758 3480 3406 2717 2689 2648 1690 1494 1157 1099 637 589 390 330 --22993 496 129
NM_032973chrY134225 3750 3680 3476 3402 2712 1494 1157 1099 637 589 390 330 --22988 496 129
NM_033030chr261601 1114 634 398 262 24 11499 1185 1593
NM_033055chr161039 846 176 81 50 26 --1900 --
NM_033081chr2071329 1154 1070 536 361 278 208 ----1260
NM_033083chr3113279 3168 2957 2681 2517 2299 1321 1186 1011 796 253 ------
NM_033132chr1332137 2004 640 ----11597
NM_033211chr551802 802 766 752 611 2543 199 --1743
NM_033222chr991449 1433 1398 1261 1111 1006 422 272 52 ----2976 251
NM_033224chr7197200 7148 7025 6906 6547 6260 5931 5477 5452 3090 2537 2357 2351 2159 1836 1616 1471 1214 794 --43144 1626 1507 715 37186 6418 1974
NM_033285chr8144474 3976 3381 3367 3011 1712 1666 1622 1572 1446 1282 1110 924 347 --24200 3923 1219
NM_033389chr1754295 3972 3501 987 564 23182 573 34200 293 149 3438 257 29
NM_033427chr74797 557 236 97 --1767 --
NM_033505chr2166357 6230 5342 4795 4187 2628 2507 2394 2374 2201 1813 1431 1258 1173 580 381 44868 2517 2330 344 24179 947 14110
NM_033631chr173928 2552 2428 2420 1518 884 828 ----22587 1163
NM_052860chr52991 362 --3775 150 126 --
NM_052879chr1264077 3677 3629 2900 2592 260 2997 800 33835 2986 624 --
NM_052896chr122362 694 11711 21780 1006 12432
NM_052907chr1294183 3794 3761 3473 1064 818 550 357 130 21437 1281 54265 3398 2953 2831 655 1365
NM_052917chr273294 2837 993 973 966 133 48 12419 --1146
NM_052937chr872592 2495 2061 2013 1687 970 500 --1732 --
NM_053002chr34963 900 400 98 ----2926 313
NM_053023chr1183278 3254 3066 2714 2625 327 285 121 1590 ----
NM_053064chr1483059 2899 2506 2435 2282 2200 2154 663 11118 22248 80 23104 973
NM_078470chr1052739 331 216 110 78 --1294 1502
NM_080546chr952229 2062 914 582 264 1485 --11695
NM_080664chr1461878 1684 1340 1257 797 782 ------
NM_080743chr642536 822 807 262 ----11735
NM_080867chr14195094 5088 5024 4941 4548 4375 4339 4105 3881 3659 3652 3284 3249 3098 1591 1011 978 471 86 24820 1045 1151 14768
NM_133265chrX123659 3344 3303 2656 2492 2262 2235 621 574 500 324 296 2729 333 13430 22588 2450
NM_133334chr4116292 5884 5684 4601 3968 2305 2011 1840 493 234 67 --35095 4515 2433 15746
NM_133468chr772533 2299 1577 594 475 468 358 --22008 227 1949
NM_133493chr6144105 4099 4040 3824 3787 3521 3465 3265 3011 2867 1007 771 669 115 23704 2827 34416 4021 40 31678 1476 533
NM_133496chr1124413 4332 4183 3927 1479 1411 1334 1211 1083 595 377 326 --11597 --
NM_133507chr121805 --2325 90 1374
NM_133638chr521292 1094 11206 --177
NM_133646chr2135494 5460 5025 4893 4739 4451 2041 1962 1570 1517 1399 1194 1004 --11038 24732 3374
NM_138286chr19104283 4266 4084 3910 3740 3644 3613 3257 2906 496 1278 23165 1620 24346 4159
NM_138333chr972543 2483 2240 855 672 606 441 2965 147 22349 425 1206
NM_138395chr231135 331 152 --166 1812
NM_138423chr1561784 1652 928 707 297 176 ----11588
NM_138426chr762408 1896 1777 1616 1577 420 32136 289 56 22492 1926 --
NM_138444chr1344736 4342 4210 3423 --54588 4090 1853 1803 753 14803
NM_138473chr12103328 3153 1928 1663 1296 1289 1251 1046 977 816 11520 23609 802 --
NM_138731chr1493618 3432 3366 3360 3157 2738 1194 657 442 23833 989 ----
NM_138771chr761589 1425 1176 338 191 121 11298 21563 1127 --
NM_138811chr721022 284 --1134 193
NM_139207chr1232030 1893 770 22199 1592 32171 506 364 21478 641
NM_139279chr263216 3159 3005 1325 1293 89 22878 916 53021 2885 2599 1073 685 --
NM_139283chr1272297 2115 2055 1000 939 302 256 --22526 527 --
NM_139321chr2083420 3338 2937 911 657 514 440 184 --23865 533 13736
NM_144571chr4216910 6793 6736 6668 6460 6355 6182 6139 6089 5844 5695 5386 5022 4326 1491 1432 1150 1000 432 352 322 25224 965 35305 4751 1451 --
NM_144578chr14115372 4929 4910 4618 4415 3665 3438 1474 870 380 236 ----34082 1753 1112
NM_144599chr15155254 4645 4627 4589 4148 4016 3871 3812 3541 1877 1489 658 638 254 248 13555 35545 5495 5230 13387
NM_144632chr261618 1528 1475 787 597 61 11947 12387 11791
NM_144633chr331495 1248 356 ----1178
NM_144642chr3151 1486 --21272 395
NM_144664chr1142369 1709 584 398 2385 327 --12574
NM_144778chr1342631 2608 454 290 1672 22574 2117 12207
NM_144963chr851084 829 758 722 661 --22528 2489 --
NM_144973chr12125340 4581 4511 4467 4410 3983 3773 2015 1101 810 600 204 --45309 4329 1258 579 --
NM_145117chr1173211 3153 3038 2647 2295 2017 1217 --23099 2992 --
NM_145176chr6113415 3376 3325 3253 2662 2598 2504 2163 1041 695 273 --22780 96 13200
NM_145206chr1073115 2970 2395 913 886 594 162 ------
NM_145263chr442144 2109 615 298 --12048 12321
NM_145307chr10134582 4341 4328 3920 3474 1643 1421 1176 1160 1005 989 945 746 14552 --31404 874 231
NM_145735chr1362374 2119 1867 1731 671 339 --1982 --
NM_145808chr7113035 2973 2800 2791 2651 2073 1989 1934 1263 727 244 --1313 --
NM_147156chr104615 484 448 383 11459 2424 333 --
NM_147188chr153967 940 469 ----2488 52
NM_148894chr441037 953 920 855 1201 1870 --
NM_152253chr2293932 3429 3380 3290 1706 1673 1437 1425 1175 23538 2736 1535 --
NM_152261chr1262048 1958 1719 622 284 202 1427 ----
NM_152387chr261136 985 978 913 855 241 ----1796
NM_152400chr461985 1762 1707 1475 1402 579 31299 696 378 1825 --
NM_152409chr573516 3236 2415 2311 2299 475 104 --11305 --
NM_152437chr1282332 2298 2045 1784 1612 737 501 256 --22307 2203 --
NM_152450chr1552171 1576 1503 1389 851 ----1833
NM_152556chr792549 1681 1022 913 694 470 319 143 25 --32595 1736 328 --
NM_152588chr1231716 1619 1216 --11174 11818
NM_152594chr1542287 2043 1548 680 21502 939 31953 1819 42 --
NM_152608chr172345 2240 2104 1861 569 395 204 --12375 --
NM_152622chr573384 3238 2854 2192 299 168 161 33504 1016 706 ----
NM_152624chr5106511 5957 4651 2974 2724 2016 1816 1170 836 389 36359 5518 1756 37161 1946 210 27058 1694
NM_152638chr1251263 513 485 468 259 ----21114 843
NM_152641chr1272365 2319 2167 1883 1159 570 460 1264 --1719
NM_152688chr65803 277 248 114 108 --2751 150 --
NM_152734chr685302 5118 5034 4151 3760 3722 2201 267 44869 4438 3688 33 --14676
NM_152737chr652140 1444 1362 1329 181 --12003 21906 1757
NM_152754chr7103235 3215 3146 2899 2776 1501 1098 949 636 188 ------
NM_152756chr5153664 3653 3453 3006 2880 2723 2709 2693 2668 1562 818 708 649 295 245 13446 23618 3050 --
NM_152765chr861825 1626 587 532 461 422 --1371 --
NM_152774chr752302 908 484 201 39 --22074 251 32317 228 191
NM_152787chrX53568 2571 799 566 96 --1554 --
NM_153029chr16103694 3680 3440 2828 1647 1145 983 469 177 160 --13943 14069
NM_153184chr351530 1241 671 477 81 21256 70 --11941
NM_153207chr1263922 3419 1498 809 356 227 11338 1699 11151
NM_153223chr551545 1083 608 241 102 --3617 326 232 --
NM_153262chr182923 841 663 616 529 503 67 46 23106 731 21960 1130 22501 2231
NM_153365chr482776 2586 2279 1886 1722 439 426 148 21807 326 3682 410 270 11877
NM_153371chr1332354 1742 834 11637 1336 22365 233
NM_153607chr542536 2126 425 66 --12403 2730 184
NM_153619chr1563417 2894 2650 2624 1370 446 1644 23141 2581 --
NM_153620chr751784 1629 1525 505 480 2680 218 11270 --
NM_153686chr441989 1749 989 805 --32349 1842 91 --
NM_153810chr1094252 4095 1880 1730 1204 1123 824 465 287 --13513 14361
NM_170665chr1264598 3727 1608 799 380 88 23636 689 24364 3821 --
NM_172071chr1176888 6878 6120 5542 5371 5248 4998 4598 2753 2743 2134 2061 1129 899 730 696 688 25710 489 46315 5477 1914 1331 36097 5461 600
NM_172373chr1371288 1165 381 292 255 98 49 1191 11224 --
NM_173468chr4156035 5384 5121 5022 4366 4231 4089 4073 3864 2131 1548 1425 1261 1157 739 31443 1391 962 45007 1718 1361 535 --
NM_173495chrX92610 2537 2478 1978 1925 1829 1754 1745 24 1446 32560 1785 180 --
NM_173496chr1083066 3003 2794 992 930 871 848 32 --11144 1288
NM_173511chr273880 3433 3299 3043 2929 2603 410 23080 2571 32886 543 111 1517
NM_173576chr1071878 1812 1605 1505 685 374 48 1356 140 22349 516
NM_173595chr1285257 4940 4302 3324 1962 1828 1281 951 ----11794
NM_173644chr20101966 1901 1792 1731 1691 1425 1311 1270 1233 795 42021 716 229 30 11809 11511
NM_173683chr841761 1726 1162 1114 --2701 195 --
NM_173797chr571308 1180 1038 487 425 111 96 --1243 --
NM_173854chr181954 1810 1738 1645 1549 614 137 41 --31880 683 102 --
NM_174900chr44392 343 286 87 1512 174 --
NM_175061chr762071 1951 558 395 369 210 --21841 73 11532
NM_175733chr1131429 102 77 ----2391 152
NM_175854chr1382503 2405 2356 2329 2249 1960 277 76 11913 22766 857 --
NM_175907chr1832344 497 281 21803 267 --1461
NM_176806chr53769 308 86 ----1977
NM_176814chr771459 431 316 289 200 182 123 --2561 461 --
NM_176823chr163883 1373 1204 1046 293 120 1741 53909 3494 3462 3297 2495 --
NM_178011chr10123093 2726 2701 2690 2033 2026 785 739 408 402 314 263 23141 584 22741 963 12312
NM_178423chr741154 875 436 254 2344 217 1848 --
NM_178426chr162165 2000 1755 795 785 757 --12075 196
NM_178505chr10103477 3357 3129 3079 2923 886 801 740 156 100 23365 3142 --11158
NM_178539chr1251788 1445 740 206 129 --21535 292 --
NM_181077chr1572177 830 700 628 359 229 128 11949 42006 1737 1517 806 --
NM_181354chr851698 1239 528 285 161 11249 ----
NM_181358chr164228 3336 3125 2862 571 350 --84219 3459 3352 3134 3099 2716 1581 975 --
NM_181504chr553069 2604 1488 841 824 --23322 3057 --
NM_181552chr73988 760 393 ----1658
NM_181670chr121559 --1197 11035
NM_181701chr932178 1810 1775 2713 290 22255 2048 11941
NM_181704chr2151174 933 481 114 106 --11347 --
NM_181705chr5105722 4845 4789 3844 3798 3553 1310 485 225 192 35126 5019 1917 --15027
NM_181723chr841977 1426 288 258 ----1441
NM_181784chr2102584 2131 994 820 813 632 599 409 348 150 --31805 1688 1630 --
NM_181787chr893901 1517 1385 1241 1087 837 688 660 576 1220 11283 --
NM_182485chr4153631 3533 3382 3247 3186 3174 3009 2953 2576 2296 1485 352 216 171 108 --23477 467 --
NM_182488chr135932 818 793 274 80 --1882 --
NM_182493chr16114785 4704 4228 4157 4143 3743 3646 1648 1578 1516 846 ----14353
NM_182569chr17------2273 87
NM_182644chr35603 552 308 284 56 1300 1534 --
NM_182765chr1052353 1438 440 174 72 ----1696
NM_182767chr1261462 445 397 315 282 272 11887 ----
NM_182830chr1421484 850 1193 22086 1831 12224
NM_182970chr2074325 3765 3405 2736 2630 1436 773 --11143 33479 3466 803
NM_194247chr2124443 4248 4200 3815 3722 3368 3025 741 582 410 385 309 --13912 21725 1105
NM_194285chr1173177 3015 2481 2185 2083 688 648 32571 703 30 1178 1168
NM_197941chr532761 2062 781 21911 1072 --12400
NM_198074chr11311 1924 --21226 153
NM_198081chr642736 2723 2646 625 1891 32852 1067 1021 --
NM_198270chrX73345 3002 929 593 293 190 133 --22346 1153 --
NM_198513chr861489 1369 1363 313 261 24 --11461 --
NM_198581chr2147567 7538 7485 7249 7234 7154 6860 4677 2724 1460 800 705 669 28 12111 1114 --
NM_198859chr3184779 4769 4706 4409 3876 3682 3359 3331 3291 3257 3207 1926 1412 1364 749 617 582 478 24236 1758 54020 1850 1719 1697 356 14717
NM_198935chr20133297 3124 3095 3089 3028 2548 2143 2096 1989 1300 1102 1050 960 1610 23207 286 12766
NM_199320chr422841 2705 1903 1436 1144
NM_199328chr2141233 940 228 166 1206 1446 --
NM_199461chr1073095 2740 1010 981 896 738 528 13064 62905 2630 2574 2241 589 219 11214
NM_203364chr1141087 845 237 123 --1256 186
NM_203390chr851539 692 577 427 197 --11804 --
NM_203394chr1242707 809 363 307 --21810 548 --
NM_203403chr931279 1256 507 1417 --31134 493 301
NM_203406chr562624 2611 2537 2264 2219 692 1633 12257 12915
NM_203446chr2172469 2341 2118 1157 1145 308 229 ------
NM_203458chr193787 3129 2850 2569 2432 2382 1207 862 683 31017 696 370 11272 --
NM_203463chr2114410 3823 3732 3457 3426 3291 3017 1300 1213 883 551 --24401 1201 --
NM_207009chr1051011 923 855 409 332 ----1375
NM_207015chr3112336 2031 1948 1669 1478 918 738 728 618 509 300 ------
NM_207325chr1952002 1893 1736 1353 243 --2508 364 --
NM_207371chr1031598 1412 154 1404 11298 11381
NM_207372chr1072286 2147 2072 1878 503 413 333 --1596 --
NM_207404chr392115 1790 1601 1458 1422 1401 864 662 585 --12256 --
NM_207429chr11102156 1727 890 877 871 825 811 720 98 25 12291 --11916
NM_207577chr1182914 2391 2279 876 715 570 415 133 ------
NM_207645chr113994 301 81 --31247 842 37 11316