TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-875-5p
miRNA Sequence: UAUACCUCAGUUUUAUCAGGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_030647chr775991 5715 5491 3941 2407 1838 1362 ----25331 2086
NM_030755chr1412935 22005 165 22318 331 1492
NM_152835chr142117 2111 2104 1786 --12219 --