TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-876-3p
miRNA Sequence: UGGUGGUUUACAAAGUAAUUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX76708 2142 2083 1360 1335 922 320 24255 1060 35124 4420 4387 36196 1414 1396
NM_000092chr243748 3357 1833 525 ----14361
NM_000109chrX41999 1773 874 304 1600 --12427
NM_000138chr1552590 2549 2016 1826 168 1800 1187 11051
NM_000151chr1751510 1411 1337 134 38 11524 21830 1666 --
NM_000153chr1411405 --2609 487 --
NM_000168chr783281 2841 2770 2696 2679 2271 849 777 --23313 240 --
NM_000176chr5103866 3537 3227 3165 3076 2987 1429 1273 719 550 13172 --2919 313
NM_000214chr2061802 1672 1587 1259 619 448 --11184 --
NM_000217chr1265125 4439 4027 1812 1806 1793 15111 14236 --
NM_000319chr12------11143
NM_000332chr654587 2585 1375 1259 588 26759 1366 16390 --
NM_000337chr5156337 6204 5530 5487 4894 2541 2477 2037 1375 1306 1222 1136 349 289 240 26386 1172 26076 4991 12349
NM_000376chr1262701 2622 2039 1167 851 125 ------
NM_000393chr241476 400 259 46 251 35 ----
NM_000399chr101933 181 --11150
NM_000428chr1472669 2422 2175 2160 1684 367 252 2379 207 2230 27 1507
NM_000430chr1742953 2754 1328 865 --1518 --
NM_000555chrX57256 6704 6093 2202 1986 25064 2684 37414 7120 228 15207
NM_000599chr214251 24113 3490 13554 23847 3605
NM_000615chr1162943 2332 1031 1012 812 373 ------
NM_000618chr1284689 4270 2520 1231 1024 493 305 37 15443 15969 15577
NM_000627chr2------1803
NM_000636chr6------1273
NM_000719chr12116019 5947 5796 4946 4250 4200 4162 2600 1950 964 373 35183 4847 1830 11337 --
NM_000814chr1552573 1235 1112 842 626 --1940 13617
NM_000827chr582631 2617 2049 1984 1821 1666 164 119 --1111 1102
NM_000828chrX22135 342 --142 1210
NM_000829chr1142234 2128 1817 476 --21418 640 --
NM_000875chr1575427 5316 5207 4314 2487 1931 1801 --1437 14505
NM_000891chr1743651 2262 397 186 11224 33378 834 704 --
NM_000899chr1283994 3939 3704 3396 1005 621 509 115 34113 3344 823 13086 11092
NM_000908chr5------1170
NM_000961chr2032447 1215 116 23364 2935 24033 3067 13497
NM_001001394chr2------1173
NM_001001433chr2043194 2633 2311 902 11171 32463 761 418 2831 617
NM_001001665chr22818 77 --12973 --
NM_001001713chr211287 ----1427
NM_001002860chr1442904 1742 1583 1074 --33579 2960 1468 --
NM_001003407chr1064691 4281 3804 1582 1513 1391 --44223 3980 3774 102 --
NM_001003682chr141056 519 461 128 --1941 --
NM_001004065chr943367 3075 2742 2630 --23910 2583 --
NM_001004304chr1242658 2222 1237 82 11269 12493 --
NM_001004317chr664107 4096 2930 448 146 108 14135 14121 11697
NM_001004360chr211584 1341 --11917
NM_001004419chr1254244 3836 3752 3551 580 24392 872 14345 21196 456
NM_001006600chr532159 2144 439 --1169 --
NM_001007237chr132673 2635 495 11987 22781 613 --
NM_001007466chr614185 24857 490 21383 1173 --
NM_001008392chr393185 2970 2617 2358 2236 1208 1199 1146 332 11013 --11309
NM_001008408chr785751 5743 5462 2553 2440 1661 1614 147 24320 233 45919 5248 2375 1924 --
NM_001008491chr241929 1327 486 350 --1735 2710 265
NM_001008541chr1051732 1635 879 703 236 --11494 --
NM_001009555chr431301 347 52 --1676 --
NM_001009880chr2244148 3000 1392 516 2672 78 24065 386 --
NM_001010000chr1853047 2890 2168 1071 278 --12803 --
NM_001010922chr154118 3764 1073 1012 229 --13086 1769
NM_001011666chr7126020 5509 4154 2454 1705 1607 1481 1465 1203 870 761 347 1554 16354 --
NM_001012426chr632859 2828 741 22692 2087 22990 374 23007 289
NM_001012761chr531713 693 454 11909 12157 12033
NM_001012977chrX11220 --21335 444 --
NM_001014797chr10137890 7854 7523 7300 6525 5396 3086 2736 2193 1973 1959 1365 215 35622 3010 542 22227 1004 --
NM_001015877chrX22040 52 21219 938 ----
NM_001017405chr42941 221 --1846 --
NM_001017999chr152224 1462 609 486 197 --12127 --
NM_001018050chr22113331 2800 2670 2641 1237 1132 1109 574 522 293 161 --32475 2243 722 22383 370
NM_001018111chr773401 2701 2525 901 356 257 170 12463 22880 52 --
NM_001024649chr512600 2375 116 ----
NM_001024934chr6------1239
NM_001024948chr173189 2942 2877 2732 1072 942 769 12208 ----
NM_001025076chr1085945 5687 5638 5596 4958 4399 4250 3937 35661 5196 5157 44143 4122 1344 606 --
NM_001025077chr10117303 7045 6996 6954 6316 5757 5608 5295 823 540 95 37019 6554 6515 55501 5480 2702 1964 403 --
NM_001025266chr333282 1934 977 23864 1731 --34052 3998 1862
NM_001025356chr123210 89 63 2979 442 1288 12526
NM_001025366chr6192 2113 105 1290 --
NM_001025580chrX43191 1608 1135 744 --23845 797 --
NM_001029858chr643238 3057 2900 1025 12835 ----
NM_001029859chr1132354 943 738 --22402 187 12257
NM_001030006chr1751881 484 226 108 28 1989 32248 1726 197 --
NM_001031695chr2265104 5064 4960 1324 841 325 34359 3373 1430 ----
NM_001031716chr2------2730 415
NM_001031804chr1631730 404 107 197 34392 3162 28 --
NM_001032288chr20--11350 31446 341 231 1558
NM_001032999chr2075209 4736 4421 3662 1229 991 928 44062 1513 875 305 --11644
NM_001033117chr334317 4150 249 43182 885 630 534 14735 --
NM_001033507chr12741 47 ----11835
NM_001033602chr1342556 2504 2315 2034 32384 1867 582 ----
NM_001033723chr882747 2716 2669 2445 2028 966 602 177 12663 11085 1672
NM_001035003chr441204 985 73 52 21346 1079 ----
NM_001035254chr952354 515 497 213 90 12479 --1238
NM_001035chr151318 838 377 349 252 --11047 --
NM_001037164chr711612 1229 --21603 1388
NM_001037954chr1153515 2603 2578 1371 1046 11207 11157 --
NM_001039465chr14266 49 1165 ----
NM_001039590chrX83948 3101 3040 2441 1220 622 459 321 ------
NM_001039618chr1145464 5177 4722 4450 --15931 --
NM_001039840chrX65696 2255 2077 1552 1047 833 --35202 2316 2212 --
NM_001040142chr242399 2178 729 594 1990 ----
NM_001040147chr18--1205 --152
NM_001040157chr432535 1983 416 22673 836 1996 --
NM_001040202chr462163 675 493 476 467 193 --1740 --
NM_001040284chr1675921 5689 5352 5112 4678 1970 1128 --12162 --
NM_001040450chr1562886 2706 767 455 272 52 --2889 27 --
NM_001040665chr764528 4193 3524 3038 1492 879 --13312 11134
NM_001040708chr82815 70 ----1424
NM_001040712chr942721 1168 291 113 --12750 1306
NM_001042383chr332662 2175 1152 13057 22269 224 --
NM_001042494chr15103750 3173 3054 2799 1442 1417 1306 1067 1021 243 32657 1171 79 13029 --
NM_001042537chrX167 12137 22408 1827 --
NM_001042543chr431007 337 265 --11538 11563
NM_001042555chr121758 23898 3291 14084 --
NM_001042599chr286781 6565 6521 5523 2901 2719 982 205 --36283 6033 5699 11616
NM_001042632chr2062526 2389 2352 1753 613 378 21840 415 ----
NM_001042646chr352038 1852 1810 1429 494 ----11949
NM_001044305chr6----11151 133
NM_001100108chr196929 6514 5998 5494 5389 1701 1110 776 181 --11177 17556
NM_001121chr1021924 1576 ----11268
NM_001148chr45855 759 614 429 200 --1599 --
NM_001177chr122482 41 12096 1187 --
NM_001186chr2142285 2279 147 78 --127 13140
NM_001198chr672233 2157 1797 1746 1677 834 758 11530 21559 945 --
NM_001204chr297624 7572 6200 6140 5808 5697 4767 2993 253 15527 25125 4810 35519 1705 742
NM_001222chr1021500 1254 1560 21855 289 --
NM_001259chr755660 4329 4209 1645 1199 24292 1372 34871 1727 156 --
NM_001364chr1133731 3632 3199 --11628 --
NM_001386chr841553 569 265 241 11773 12356 --
NM_001390chr1853286 2754 2337 1162 937 --22550 566 22244 155
NM_001406chr1731568 1284 358 --1576 11578
NM_001431chr6--187 2311 226 --
NM_001497chr92526 465 --31781 998 518 --
NM_001627chr362245 2195 1917 1562 859 643 1620 ----
NM_001656chr51496 ----12019
NM_001664chr331038 394 331 ----1958
NM_001701chr921393 989 ----11083
NM_001726chr1------125
NM_001731chr12198 ----1786
NM_001859chr963623 1550 1302 1065 705 571 13038 21209 247 --
NM_001949chr663216 3069 2071 1198 372 123 1857 1721 --
NM_001963chr41219 --1118 1801
NM_001981chr141638 803 591 351 --182 11547
NM_001987chr1231014 899 802 23419 2914 24123 179 13623
NM_002010chr13------144
NM_002025chrX128585 7578 7353 3286 2912 2174 1397 1357 1022 407 307 251 32878 2447 2189 28877 6498 18716
NM_002063chrX2998 213 --1474 --
NM_002131chr641236 1143 126 78 2155 105 1964 --
NM_002137chr731978 1944 862 22309 1829 ----
NM_002139chrX2648 490 --173 --
NM_002156chr22294 124 1348 --1135
NM_002158chr252845 2719 2449 2316 771 --13691 --
NM_002264chr354896 4429 1915 849 421 24483 1484 34841 1155 607 --
NM_002267chr1331637 737 605 149 1243 --
NM_002334chr1111471 1781 1174 12059
NM_002356chr642107 1959 719 662 ----1217
NM_002399chr1531111 570 196 ------
NM_002480chr1221377 1067 11247 11425 --
NM_002508chr121729 1510 1553 11929 --
NM_002556chr1142153 1998 809 700 ----1143
NM_002609chr551346 1329 1270 1252 758 --11780 --
NM_002613chr1674101 3886 1065 1043 361 172 85 14520 24775 3467 12133
NM_002655chr845125 5051 3452 175 14605 11284 11297
NM_002709chr222989 2556 --22257 80 23528 28
NM_002718chr32576 231 --1610 --
NM_002829chr91955 21205 284 1807 --
NM_002833chr1511296 --147 11101
NM_002886chr364242 3487 2083 1702 503 97 --54300 4115 3204 1823 1127 11667
NM_002906chr1122202 668 22068 477 --144
NM_003026chr921275 348 --3910 324 56 --
NM_003029chr141086 950 444 366 ----1212
NM_003043chr393668 3640 3387 2962 2950 1673 1421 1244 368 13399 24303 804 --
NM_003051chr121456 331 --21748 789 --
NM_003074chr341637 688 489 153 21700 36 12146 --
NM_003100chr5----182 196
NM_003107chr612089 21921 462 12138 --
NM_003108chr266816 6513 5733 5603 2594 1457 16719 26732 2478 16091
NM_003112chr742767 2579 1024 840 1599 ----
NM_003131chr631511 129 44 11903 1875 1639
NM_003133chr12940 379 ----1725
NM_003144chr641811 1705 1463 210 --1279 --
NM_003161chr1762735 2340 2259 909 677 324 --12246 --
NM_003205chr1541544 787 497 359 ------
NM_003257chr1531032 968 164 11349 164 --
NM_003305chr41288 --1107 --
NM_003320chr11134097 4076 3997 3966 3810 3731 3040 1614 1588 1378 1109 1050 947 --13765 --
NM_003369chr1132415 2187 1985 11933 22591 238 12729
NM_003389chr9271 39 ----195
NM_003413chrX21407 1239 --1781 --
NM_003473chr102369 211 ----1450
NM_003483chr1262525 1106 471 372 162 73 --22186 192 12271
NM_003489chr2173188 2378 1100 947 865 725 196 --23160 963 --
NM_003566chr1222887 2750 22923 1295 12613 --
NM_003583chr1243278 3150 2958 2720 12703 --13001
NM_003590chr22555 91 ----11311
NM_003597chr242062 1710 746 522 --11984 2412 264
NM_003615chr363732 2959 2635 1524 1452 109 --12550 --
NM_003644chr1796491 6034 5298 4877 4462 1911 1493 1182 551 34132 4027 563 42619 2562 1795 637 --
NM_003716chr32846 694 ----2269 98
NM_003831chr1831349 1333 194 --11789 11444
NM_003884chr311207 ----21500 695
NM_003885chr1772707 2276 1825 670 574 566 491 --2446 216 198
NM_003913chr633614 3059 1347 ----22815 547
NM_003966chr557712 6728 5748 2832 308 12982 26505 856 1126
NM_004060chr531188 1156 391 ----11294
NM_004063chr81927 1285 3786 407 56 --
NM_004232chr1853460 3357 2481 1204 254 23364 736 13033 --
NM_004241chr10------1100
NM_004282chr62616 455 --2602 96 --
NM_004286chr2292642 2489 1883 1786 1075 891 362 206 27 42147 779 87 53 32878 2279 1875 --
NM_004296chr14173690 3650 3598 3288 3115 2824 2794 2772 2443 1615 1403 779 574 521 490 475 446 13521 13253 13382
NM_004331chr83974 593 106 2330 280 --1384
NM_004432chr911547 ----21643 901
NM_004438chr232337 1247 374 1250 12665 --
NM_004440chr641813 1286 242 200 1166 11407 --
NM_004454chr351820 671 601 468 421 --1621 1207
NM_004469chrX------1481
NM_004484chrX1143 --168 1244
NM_004586chrX85104 4859 4367 4132 3373 1542 1229 281 14741 14143 13611
NM_004598chr553038 2428 2105 2064 932 --32673 2207 1236 --
NM_004612chr933758 3312 851 14826 --1433
NM_004687chr172116 97 ----11364
NM_004744chr483055 2405 1350 1296 738 289 215 138 11461 ----
NM_004824chr631286 194 55 --11036 --
NM_004845chrX64163 4087 3247 517 419 329 11308 21655 347 --
NM_004852chr182214103 13891 13234 12928 12733 12480 12008 11756 11324 11021 10573 9471 9321 9110 8785 5662 5107 4856 4146 3253 2446 547 212306 1064 413945 11071 5127 1456 313155 4216 1763
NM_004947chr352380 1858 992 334 52 31730 1705 962 1126 --
NM_004961chrX51259 312 287 281 234 21535 359 --11036
NM_004973chr61594 ----1395
NM_004992chrX88141 5595 2318 1332 867 706 682 461 37484 6885 2674 27336 1096 26337 1072
NM_004999chr674364 4023 3682 1357 289 130 77 --1423 --
NM_005056chr1295451 4984 3853 2208 1264 1109 698 286 186 14297 14743 1217
NM_005063chr1032957 1536 71 12399 13368 --
NM_005065chr14105330 4999 4797 4765 2152 2085 1894 1846 1165 966 11959 21945 364 13818
NM_005121chr1732433 1323 980 12824 --12901
NM_005156chr942082 1892 849 424 1997 --13558
NM_005206chr1721424 517 --21054 432 --
NM_005222chr71983 --1754 1825
NM_005245chr41171 ----2756 684
NM_005259chr211085 1418 1180 --
NM_005277chr41421 --3317 132 66 --
NM_005339chr484239 3747 3397 3355 2788 1553 1265 262 23458 492 23698 1715 --
NM_005402chr731817 1258 448 ----21715 434
NM_005433chr1842785 2044 789 601 --1149 --
NM_005436chr1053090 2943 2698 1465 1264 13301 11416 --
NM_005440chr1743354 2535 1020 874 13067 12661 22897 2170
NM_005504chr1275610 4642 4575 4305 1316 1085 920 14390 36428 5529 1243 --
NM_005573chr5------1545
NM_005596chr955791 5012 4339 492 264 --13958 --
NM_005599chr131417 1305 281 ----1448
NM_005610chr12191 120 2840 686 ----
NM_005626chr12426 353 --127 --
NM_005627chr6------1894
NM_005647chrX63364 3344 2543 2322 1363 1112 22736 711 13408 --
NM_005665chr161290 1066 1022 780 315 191 24836 646 14108 --
NM_005725chr131577 831 568 12105 ----
NM_005736chr1031580 605 364 2310 219 1181 --
NM_005746chr722158 184 --12024 --
NM_005759chr274148 3821 3622 2980 1227 691 501 14073 24716 4655 --
NM_005779chr563486 3469 3180 2410 2386 106 22530 1230 22440 2297 12288
NM_005880chr162597 174 --11599 --
NM_005898chr1131082 1010 541 12271 ----
NM_005909chr553515 2855 1723 1683 267 --22692 67 11572
NM_005920chr143202 1244 1056 57 12774 23686 3118 1428
NM_005941chr833505 3257 2916 11553 ----
NM_005986chr1342867 407 270 194 22135 541 22549 1957 --
NM_006011chr1574071 3905 3211 2684 1732 1478 982 13544 64133 4107 3639 2718 1126 385 21585 707
NM_006037chr284322 4016 3541 3062 1963 1456 532 138 14668 21411 460 --
NM_006047chr2062501 2332 2208 1246 272 251 1781 1848 --
NM_006080chr711961 22311 198 ----
NM_006094chr851980 1946 587 108 21 132 12054 --
NM_006100chr32511 404 --1437 1137
NM_006148chr1732939 2745 2707 11027 12378 --
NM_006164chr2------1354
NM_006206chr462205 2050 1989 506 426 40 --165 --
NM_006210chr19157 ----1958
NM_006212chr143334 2041 1049 976 ----183
NM_006237chr1321670 586 21502 575 --1440
NM_006254chr31323 ----1411
NM_006281chr821204 1044 ----150
NM_006393chr1014375 11039 1371 11206
NM_006420chr2053337 2902 2415 2245 428 ----12610
NM_006454chr453045 2651 2477 1098 42 1356 32309 1235 1017 --
NM_006467chr511596 --21836 145 12406
NM_006516chr131356 460 426 --1544 11300
NM_006520chrX11341 21312 1251 11090 --
NM_006526chr2041898 1755 1345 834 ----11825
NM_006544chr1475447 5091 4923 4873 1135 419 269 1189 1750 --
NM_006546chr17106641 6127 6092 5760 4889 2340 1590 1087 860 594 36493 6204 718 56649 4927 4437 4273 1636 --
NM_006547chr721576 94 1842 1564 --
NM_006557chr92632 203 --11435 1698
NM_006599chr1697517 7105 6786 6588 6224 5409 2637 1373 326 11399 28039 6364 27277 183
NM_006624chr1042030 1504 411 381 --1796 --
NM_006699chr142296 2003 979 602 153 11737 1735
NM_006713chr52622 215 --1629 --
NM_006729chrX12011 34514 4096 2265 25528 5402 34554 4481 4232
NM_006750chr16117143 6530 5794 5615 5453 2898 2465 933 912 720 138 22098 548 12495 17656
NM_006761chr172819 35 1309 126 190
NM_006772chr671592 624 571 441 260 151 83 ----168
NM_006806chr21------1116
NM_006814chr2052523 2411 2396 76 55 42368 1820 254 233 --12465
NM_006827chr1473417 2058 1334 1117 814 773 160 32635 708 95 11291 12770
NM_006856chr1231086 1064 771 --1285 1902
NM_006875chrX2839 674 2685 363 ----
NM_006888chr1462589 2319 1268 1257 744 242 11375 13452 1796
NM_006896chr74459 422 307 168 --1344 --
NM_006902chr152025 1300 1218 499 201 33105 887 371 --12289
NM_006915chrX------1771
NM_006943chr2063119 3104 2376 1208 909 795 ----1250
NM_006981chr922743 2235 ----22853 2213
NM_006999chr531959 830 62 --21280 772 11844
NM_007011chr1586497 5441 5195 4399 4267 2057 2011 880 66547 5270 1032 729 344 114 11640 22124 1772
NM_007038chr2164421 4085 1942 1142 902 620 11476 11633 12304
NM_007085chr342178 2028 1635 786 11717 --197
NM_007137chrX55568 5187 3600 1745 745 11387 24169 1936 25416 956
NM_007146chr1752605 2434 348 196 86 ----11039
NM_007159chr321547 77 1353 2512 384 --
NM_007175chr873349 3232 3208 2833 1400 842 86 1677 12765 --
NM_007212chr142250 2220 2162 2144 12005 --11585
NM_007249chr13119447 8412 8139 7563 6404 6180 5846 3450 3085 800 579 21580 105 36665 6593 5876 --
NM_007278chr172349 96 ----1428
NM_012096chr363067 3053 2900 2830 1412 1281 --13201 11034
NM_012164chr987062 6820 6033 5550 2900 2558 2129 358 36353 6144 1205 37282 6090 5405 27017 2492
NM_012223chr221214 1104 ----197
NM_012262chr184926 4448 4391 4362 3839 2081 359 259 ----11051
NM_012281chr742038 1731 828 391 ----31612 472 166
NM_012316chr175331 4805 3921 2266 2146 1552 614 31338 94 41 23946 188 1101
NM_012329chr17----11539 11662
NM_012334chr5114753 4724 4037 3881 3181 3121 1433 1337 1047 270 45 34044 1627 280 1899 --
NM_012338chr73503 181 26 ----1784
NM_012395chr742232 668 428 232 ----1487
NM_012402chr1121211 1007 11190 1274 --
NM_012405chr173535 3340 1388 1335 1301 1036 242 23109 2795 --12932
NM_012448chr1732184 1752 50 ----12430
NM_013231chr1454249 3124 1684 831 686 --1338 --
NM_013261chr453454 2717 717 580 415 12364 21431 588 --
NM_013402chr1142306 2162 1825 163 --32429 990 848 --
NM_013436chr2--1667 1740 --
NM_013450chr21447 --11097 1953
NM_013995chrX2236 156 ----12562
NM_014011chr221898 883 ----12512
NM_014028chr662978 2867 2314 1098 692 579 22820 2074 1537 --
NM_014112chr825173 225 25519 299 1254 --
NM_014231chr1232091 1963 124 --11577 11752
NM_014243chr411443 ----1219
NM_014253chrX52552 1877 1598 992 274 ----1506
NM_014286chr942850 2571 1454 60 23476 1435 4560 379 191 33 --
NM_014289chrX41452 1238 508 38 3556 534 515 ----
NM_014368chr931967 1836 1664 1135 1409 --
NM_014372chr1------22076 36
NM_014423chr575614 4913 4660 852 725 615 81 ------
NM_014469chr112725 645 1785 177 --
NM_014470chr121241 ----1200
NM_014491chr741005 872 842 67 --2933 57 --
NM_014554chr1262204 2196 1638 1597 906 784 ----1426
NM_014636chr9113891 3791 3728 3405 3086 1581 1331 1250 273 225 149 --34214 3313 3162 --
NM_014707chr712000 11753 12111 --
NM_014730chr1275095 4918 3202 1970 1145 903 178 --1825 --
NM_014746chr273720 3262 3093 2838 2742 1312 1168 --23397 542 --
NM_014751chr821813 339 ----12198
NM_014755chr263390 1555 917 491 225 182 11340 13607 --
NM_014766chr71762 32338 1357 1079 171 13291
NM_014772chr1863617 3571 3385 2961 978 844 23646 3220 ----
NM_014810chr173219 3165 2520 1208 817 800 619 1127 1458 --
NM_014828chr1451700 1670 560 515 214 --1739 12121
NM_014835chr2062226 1718 1694 1532 926 609 12291 1652 --
NM_014841chr62521 180 ----195
NM_014860chr232518 2138 1609 --1207 22421 2267
NM_014876chr223633 481 168 21701 721 1854 11828
NM_014877chr17157577 6733 6447 6186 5870 5453 5388 5374 2586 2297 1858 1822 1476 1375 1221 36054 5576 1885 11126 --
NM_014893chrY42153 1940 739 257 1292 ----
NM_014897chr1753133 2834 2822 1218 168 12963 1211 12746
NM_014903chr121875 21854 1727 2694 77 2551 160
NM_014924chr1452792 2457 881 411 324 13021 32735 2148 970 11944
NM_014943chr82119 92 1359 1395 --
NM_014946chr222977 449 ----1994
NM_014947chr153049 1983 1196 287 100 11063 12360 --
NM_014991chr432458 785 512 23318 2005 --1498
NM_015015chr1941497 251 234 112 --1336 --
NM_015020chr1663337 3091 2523 589 501 425 --22407 733 1393
NM_015040chr243146 1239 1130 101 --13072 --
NM_015042chr15114227 3758 3578 3105 3072 2919 2799 1724 328 247 180 32644 468 459 24044 2668 --
NM_015052chr751407 1386 1151 961 45 ----1429
NM_015075chrX71810 746 563 411 327 238 30 51880 718 207 157 151 --1663
NM_015090chr1106217 5788 5514 4796 4606 4352 3816 2328 1917 1056 23970 207 54784 547 280 161 68 3154 91 26
NM_015093chr631667 447 32 11528 ----
NM_015097chr362195 2070 1962 680 509 53 ------
NM_015100chr161860 1556 820 743 282 195 1125 1700 --
NM_015138chr1562309 2055 1045 289 182 148 12319 ----
NM_015170chr84862 727 664 91 ----1870
NM_015192chr2062378 2298 1886 811 636 88 12694 --1463
NM_015206chr1532730 1471 960 3978 649 38 11145 --
NM_015210chr183917 265 205 1272 126 --
NM_015231chr11258 30 1363 1278 --
NM_015267chr1231913 1592 546 11404 141 21870 103
NM_015272chr1651745 1701 1595 1566 205 --11451 --
NM_015282chr252694 2638 2190 1004 328 12260 --12822
NM_015310chr8128353 7407 7059 6205 6044 5987 5488 3170 2753 2611 1205 502 37966 6547 2267 27554 5266 --
NM_015313chr1174634 3399 3265 1691 1092 1060 729 --24819 122 --
NM_015317chr222649 36 --12681 --
NM_015331chr12432 202 ----175
NM_015347chr1242611 2053 1932 350 21913 974 21919 1139 --
NM_015355chr172803 441 11275 ----
NM_015435chr831032 61 30 ----1406
NM_015557chr192510 876 275 252 204 120 99 65 50 --33618 2672 1250 --
NM_015564chr562356 1293 1247 1139 170 24 12876 13065 --
NM_015568chr2084249 4018 3937 3336 2770 721 684 487 33405 3368 2923 11651 1572
NM_015569chr151550 1044 865 454 29 11278 14463 --
NM_015576chr341130 923 651 218 2903 131 --22851 720
NM_015695chr62718 367 ----11475
NM_015726chr131821 1208 659 11226 1555 --
NM_015850chr831888 234 76 1279 12431 11954
NM_015879chr18218635 8530 7287 7269 6490 6162 5529 5508 3319 3284 2941 2489 2355 1908 1246 1176 1052 653 529 513 193 46659 1951 1161 488 37859 7698 2583 16151
NM_015898chr1941958 800 261 71 11757 32392 1835 64 --
NM_015904chr22755 543 ----1628
NM_015906chr164818 4134 3762 3552 2958 1359 2910 639 --1937
NM_016019chr721003 179 ----1814
NM_016021chr672754 2138 1854 1110 1102 680 377 1653 22094 633 --
NM_016022chr12238 123 1954 --1863
NM_016023chr83815 483 367 1792 1102 --
NM_016073chr154862 829 389 36 1344 --1248
NM_016081chr452130 1819 883 760 510 ------
NM_016083chr643223 1253 1170 338 12835 13729 13136
NM_016089chr372115 1545 1539 1498 774 445 205 1542 ----
NM_016098chr62375 121 ----1331
NM_016131chr22597 35 1733 3807 128 68 --
NM_016248chr1342852 1436 301 198 --13565 --
NM_016252chr22390 265 --2286 216 --
NM_016277chr631188 1063 622 --11142 --
NM_016339chr1751826 1788 1261 392 206 21663 1174 ----
NM_016376chr1764173 3760 3700 2934 1176 318 11146 23369 3287 11441
NM_016396chr1542921 799 396 22 22875 294 --11126
NM_016488chr1221994 1268 ----11547
NM_016525chr93971 641 286 ----137
NM_016531chr443421 1302 1092 853 1622 13931 13769
NM_016544chr253217 1577 1522 1433 662 --13513 1616
NM_016626chr1831663 1539 713 --1367 --
NM_017444chr831846 1530 1335 11504 21392 1261 11194
NM_017582chr13704 516 39 11737 1227 --
NM_017610chr1522061 543 1605 11484 --
NM_017650chr785589 4836 4785 2433 1952 1127 534 185 14121 35623 657 205 1914
NM_017748chr172662 240 ----1110
NM_017752chrX31577 1313 219 1321 ----
NM_017754chr695074 4899 3911 3549 3527 1979 1895 1173 59 145 15044 1411
NM_017778chr811527 ----1249
NM_017799chr142583 308 ----11232
NM_017848chrX43612 2977 2831 1176 21438 536 ----
NM_017919chr9135641 5484 5293 5216 5075 4977 4068 3990 3572 2242 1951 1390 1302 --14688 24454 953
NM_017943chr14--1306 --1712
NM_017988chr122811 722 --1625 --
NM_017994chr722522 42 12059 --21832 454
NM_018013chr693081 2373 2182 2126 1057 634 314 95 55 22324 240 ----
NM_018061chr111743 --11667 11131
NM_018084chr243239 2648 2321 2265 --12675 --
NM_018110chr1631263 890 178 11019 --21151 426
NM_018121chr104993 811 537 361 --22384 1940 --
NM_018157chr1233127 3001 2490 --11224 22856 722
NM_018159chrX2588 162 --1390 --
NM_018293chr362649 2162 656 498 401 229 --1701 12593
NM_018294chr102579 202 ----1901
NM_018364chr123706 510 ----11566
NM_018375chr1421391 1364 11797 11258 --
NM_018388chrX21108 308 ----1222
NM_018398chr3----1241 1117
NM_018448chr122504 412 ----1219
NM_018566chr154851 4397 4229 257 33 11997 2644 112 23593 132
NM_018602chr1541597 1542 1496 1261 --1213 --
NM_018689chr1562416 1945 1918 834 171 24 12648 12269 --
NM_018712chr1131382 570 167 --11504 --
NM_018715chr131397 723 482 --21683 170 11695
NM_018841chr183795 3681 3080 2730 2465 1494 1205 1089 1530 194 12542
NM_018945chr643013 2577 679 92 13136 13645 22544 1357
NM_018970chr743031 2627 1093 633 12239 2539 229 --
NM_018976chr125416 364 295 219 61 --12248 --
NM_019046chr104984 609 317 128 1269 2387 135 --
NM_019084chr10--12420 31976 1751 789 --
NM_019106chr2273061 2821 1219 921 913 657 374 22309 62 42536 2390 2190 71 12765
NM_019106chr2273061 2821 1219 921 913 657 374 22309 62 42536 2390 2190 71 12765
NM_019106chr2273061 2821 1219 921 913 657 374 22309 62 42536 2390 2190 71 12765
NM_019592chr9----1116 157
NM_019610chr161775 1768 1469 694 657 291 --178 --
NM_019857chrX41429 1333 440 90 11567 11146 --
NM_020116chr421719 224 ----1611
NM_020310chr17112665 2241 2215 2171 1792 1060 827 682 475 240 175 12464 11832 --
NM_020336chr2052443 1040 1004 203 97 --11389 1124
NM_020338chr10103298 2712 1495 1425 1039 993 911 270 110 95 21341 534 22822 2363 13473
NM_020341chr2041954 766 755 307 --1624 --
NM_020429chr742565 906 227 108 32663 2031 40 32869 2338 1981 --
NM_020673chr2087744 7546 6267 5630 2997 2338 1944 414 35187 657 79 26082 5321 12946
NM_020689chr2041326 1263 1139 675 1690 --11644
NM_020699chr164761 4234 3795 3783 993 179 14477 1743 14338
NM_020734chr1212270 --23302 2991 --
NM_020772chr17118598 7832 7271 6521 5787 5276 3421 1553 450 118 106 --25229 2261 --
NM_020834chr1461362 633 426 348 263 75 --31539 1457 1249 --
NM_020845chr1272277 2214 1679 567 500 365 346 1217 ----
NM_020850chr1693145 2915 2387 1249 1084 849 762 174 98 --1970 1329
NM_020859chr463547 2620 2500 1517 1287 1018 13942 32835 525 81 --
NM_020899chr1772119 1957 1832 1675 1603 1543 37 159 1376 --
NM_020917chr1983883 3750 2995 2412 1285 938 854 726 12505 11340 --
NM_020973chr4------1227
NM_021045chr1032419 1040 482 12443 ----
NM_021079chr1752624 2551 2393 67 32 ----21048 141
NM_021090chr2255064 3150 3112 431 143 1448 1111 --
NM_021132chr1031174 115 53 --11301 1959
NM_021136chr14------1197
NM_021155chr1962939 2648 2597 936 357 335 1720 42374 2313 1839 856 --
NM_021202chr2042879 2364 1912 952 12505 12999 --
NM_021205chr132622 473 432 12637 12754 11824
NM_021629chr344990 4474 4250 3133 ----1146
NM_021648chr642758 1905 469 43 41913 857 786 530 1949 --
NM_021813chr675250 1782 1666 1635 1441 1382 304 ------
NM_021814chr621228 29 --11349 --
NM_021961chr1135124 5086 2414 --22586 956 --
NM_021964chr376527 6347 5842 5076 4265 4053 1313 12207 1512 24463 1248
NM_022048chr1565454 5048 4712 4668 4270 1861 35067 4346 3873 34919 4192 3960 11256
NM_022093chr1--137 2989 302 --
NM_022138chr651418 1212 1162 539 197 ----1549
NM_022351chr813796 12858 --13392
NM_022465chr1252814 2158 925 114 31 22610 2403 1788 --
NM_022658chr1231009 869 835 --1133 --
NM_022719chr2293657 3190 2878 2685 1429 1259 1058 937 648 ------
NM_022755chr932470 651 482 32349 2193 358 12428 --
NM_022763chr352194 1972 825 810 523 --1413 12449
NM_022780chr231438 1406 1207 ----11292
NM_022828chr5--11135 150 1137
NM_022831chr141842 1766 1296 42 1283 11250 157
NM_022841chr1532702 1099 1083 --12293 1349
NM_022893chr232662 747 54 --13121 --
NM_024007chr543090 2676 603 114 --1148 --
NM_024312chr1231093 1022 538 11267 123 1606
NM_024525chr13592 477 162 ----1647
NM_024563chr541232 757 275 54 11612 ----
NM_024645chr821449 558 --1398 174
NM_024674chr152670 2385 867 401 187 1133 2909 242 12370
NM_024713chr1561234 1149 1087 615 300 135 1372 --2382 150
NM_024900chr432378 1458 901 12051 --11649
NM_024989chr247558 5643 1071 496 45513 3253 2550 2328 --22462 529
NM_024993chr221428 79 ----1154
NM_025054chr833648 1494 667 --1403 13445
NM_025133chr221102 823 --1723 --
NM_025160chr143621 3370 2653 126 --11076 --
NM_025222chr3102905 2891 2771 2748 2556 2313 2244 2103 1965 971 ----22158 496
NM_025248chr1762727 2240 1181 417 329 261 ------
NM_025250chr792852 2695 2439 2235 803 715 466 254 78 1198 12717 1994
NM_030579chr1693717 3536 2790 2629 2382 2346 793 707 144 --1967 --
NM_030621chr1453926 2615 2579 612 258 14108 13659 13504
NM_030627chr521600 398 1675 11650 --
NM_030755chr1433086 2670 2039 12590 1541 --
NM_030761chr152418 2217 1995 273 76 1342 52558 2382 2366 704 31 11669
NM_030766chr122986 797 2672 142 1259 --
NM_030806chr189264 8505 7288 6964 6366 3124 1501 1439 19319 48954 8611 1010 975 26378 2103
NM_030918chr183466 3337 2112 1677 894 813 581 186 11974 15400 --
NM_030962chr1121421 310 --21605 1070 --
NM_030964chr572706 1374 1368 999 676 656 594 1157 12541 --
NM_031483chr2033170 2196 1175 ------
NM_032042chr532200 2169 2103 12332 ----
NM_032199chr1033842 3306 2802 13738 21489 555 --
NM_032217chr421300 51 1876 --1932
NM_032228chr1123235 227 --1104 1220
NM_032289chr53496 468 284 1460 11595 --
NM_032293chr9------1206
NM_032329chr2124243 3750 3691 3645 3227 3212 2910 1530 844 505 431 347 12998 185 1156
NM_032373chr1054130 2339 2003 710 486 --1206 --
NM_032457chr443340 3067 905 87 3805 493 475 1195 --
NM_032458chrX42370 2152 382 191 11268 ----
NM_032499chr1541195 513 473 207 1135 2529 378 11568
NM_032523chr23405 375 206 --1176 --
NM_032538chr682814 2526 2435 2326 1034 810 319 110 21994 932 12697 --
NM_032574chr21184 ----1176
NM_032578chr1021310 583 1442 --11131
NM_032646chr1721259 256 1349 21801 1468 --
NM_032689chr1971623 1560 1512 1488 1377 443 323 --21117 1060 --
NM_032859chr1323905 3003 ----1853
NM_032968chrX44144 3351 1059 946 11448 --21285 1124
NM_032973chrY33346 1059 946 11448 --21285 1124
NM_033030chr21297 1653 11535 --
NM_033285chr834457 4284 111 --11147 --
NM_033542chr205493 448 417 285 269 --1355 1733
NM_052848chr1951884 1826 1663 761 23 21922 128 11682 --
NM_052879chr1223404 2823 1712 1927 --
NM_052880chr2221025 106 ----177
NM_052896chr142213 2135 2020 1832 32234 28 22 ----
NM_052900chr81466 --11516 --
NM_052932chr1131841 971 841 --12020 --
NM_053056chr1152911 2343 1002 803 464 32531 720 29 32885 750 735 --
NM_058172chr421176 362 ----21540 1267
NM_058191chr211602 ----160
NM_080664chr14--2682 446 31605 1482 580 11567
NM_080669chr1723496 159 14701 13059 14168
NM_080872chr894046 3996 3401 1497 1170 804 784 616 580 13036 --11243
NM_080927chr342410 1296 296 146 ----12176
NM_101395chr2142770 1230 781 336 2202 181 ----
NM_130807chr1972342 2311 2270 1885 1807 1486 731 --51779 935 745 281 33 22053 77
NM_133264chr1773882 3864 1573 1154 808 599 255 ----13872
NM_133265chrX43124 2332 1194 1088 23337 793 22650 1169 --
NM_133478chr282397 1608 967 849 618 488 192 40 --21894 1030 --
NM_138395chr21292 --1312 1751
NM_138569chr61223 --163 --
NM_138731chr1452792 2679 2584 153 125 1813 1168 14178
NM_138782chr51209 ----11610
NM_139283chr1242571 712 285 80 --21790 1759 1169
NM_144571chr4126881 6578 6055 5882 5408 5146 4696 2771 2505 2326 668 364 14520 --16651
NM_144599chr1544929 1750 1075 219 24297 3783 --15119
NM_144628chr2062335 1003 705 602 256 122 --12308 --
NM_144775chr17114557 4492 4476 4360 3726 3471 3060 1016 783 648 568 24677 843 11008 1304
NM_144778chr1362618 2554 2149 2015 896 143 --1230 12478
NM_145113chr143359 277 182 --2135 81 11014
NM_145117chr1162133 987 488 217 101 67 --22301 674 --
NM_145203chr132675 113 --1748 1609
NM_145268chr71971 --1376 167
NM_145273chr1721396 1100 11263 2575 503 --
NM_145284chrX32464 1746 1551 --1874 --
NM_145296chr191877 1122 --1942
NM_145307chr1084623 4221 4177 1370 1330 1213 430 371 --24432 3287 --
NM_145316chr63587 545 84 1229 1816 --
NM_145808chr742366 2094 722 194 1153 12307 --
NM_152261chr1232254 1871 449 --22117 554 --
NM_152424chrX64527 4066 3997 3045 1664 931 24195 3324 34630 1547 509 --
NM_152519chr262169 2104 2078 723 277 168 --1535 --
NM_152581chrX2505 25 --1584 --
NM_152594chr1521523 230 --12302 --
NM_152622chr511130 33128 2431 360 ----
NM_152624chr557483 7126 6176 2684 1842 --26349 509 24870 1192
NM_152641chr1252929 1817 660 312 43 1495 ----
NM_152663chr11217 --2252 83 --
NM_152739chr72909 111 --1347 11003
NM_153035chr153233 3053 1261 365 263 --1511 --
NM_153235chr651869 1718 1657 924 839 ----1307
NM_153343chr421646 612 2587 37 11985 --
NM_153453chr64674 234 150 144 ----1900
NM_153607chr542094 432 344 195 --12358 --
NM_153619chr1592659 1218 866 624 591 460 389 300 265 11178 12857 --
NM_153686chr432030 1762 916 11737 1399 --
NM_153756chr141740 1729 1639 752 21786 1369 11990 --
NM_153832chr14626 601 204 63 ----2705 147
NM_170606chr731219 518 224 11878 --1427
NM_170662chr31480 ----1620
NM_173468chr4115773 4994 4760 4664 4646 4118 3830 2177 461 190 160 ----13753
NM_173511chr222807 1329 11552 1403 --
NM_173552chr341662 969 248 176 ----22141 61
NM_173595chr1294198 3329 1774 1700 924 752 630 591 164 14810 14997 --
NM_173808chr194249 3939 3161 3002 1555 1468 1330 1035 719 ------
NM_173854chr12945 859 --12060 1239
NM_174911chr843539 3382 1342 592 --24002 2437 --
NM_175733chr112470 127 11772 31615 185 49 --
NM_175767chr52757 53 ----1611
NM_176814chr71960 --2174 166 175
NM_178123chr2--1161 1878 173
NM_178454chr11827 --196 1698
NM_178496chr31473 1438 11523 --
NM_178565chr811568 21128 146 11469 --
NM_178566chr921429 628 --1648 --
NM_178835chr42187 91 1238 2745 70 1200
NM_180989chr1321530 303 --1908 --
NM_181670chr1231440 443 266 --1586 --
NM_181672chrX21650 763 --1550 --
NM_182503chr6105272 5060 4783 4429 2100 1968 1644 1290 378 288 ------
NM_182757chr632298 1403 1337 12729 --13444
NM_182765chr1021733 557 1949 --12086
NM_182830chr142909 756 ----2789 90
NM_194247chr264214 3978 990 960 588 202 --12869 --
NM_194286chr1275633 4817 4226 1879 1073 1028 901 11317 160 44922 1963 1675 241
NM_194449chr18134 ----1180
NM_197941chr522409 940 22593 874 32525 126 68 22255 1943
NM_198273chr5--11002 --12745
NM_198353chr42503 60 ----1353
NM_198465chrX22693 1177 1552 --1727
NM_198513chr841308 472 271 163 --1520 --
NM_198686chr1472547 2500 1985 1717 426 378 270 ----11867
NM_199000chr742136 1944 1577 1414 --1588 --
NM_199245chr1242497 2369 530 418 --21983 1667 12158
NM_203406chr552752 2027 2017 731 192 31862 1109 104 12099 --
NM_203453chr941797 1618 762 362 11278 ----
NM_205848chr162331 2313 2193 676 645 40 --1110 --
NM_206853chr653661 2748 1311 615 302 --1257 13052
NM_207015chr3----21717 496 --
NM_207043chr11530 11514 135 --
NM_207303chr1033473 1675 1254 1219 3944 685 409 --
NM_207306chr173660 2968 1836 1458 188 70 43 12897 --13030
NM_207406chr4105626 5515 5476 4995 4799 4170 2275 2189 709 222 11904 35139 4562 614 --
NM_212464chr1551940 469 330 271 36 21325 180 ----
NM_212467chr1532517 1833 170 11902 1282 --