TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-876-5p
miRNA Sequence: UGGAUUUCUUUGUGAAUCACCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr552049 1576 1493 652 30 11427 --1473
NM_000084chrX116700 5673 5212 2416 2162 2042 1907 1494 189 167 105 --32545 1914 343 --
NM_000109chrX31798 795 315 1177 --1551
NM_000176chr593946 2855 1437 1311 1127 737 378 252 227 23603 1491 ----
NM_000208chr19114780 4733 4420 4395 4115 3128 2920 1449 814 334 119 11738 12953 --
NM_000217chr12104317 3959 3783 3621 2101 1581 1227 968 947 399 1194 24902 406 14695
NM_000259chr15135670 5347 5168 4526 2244 1929 1790 1759 1656 1641 1270 326 125 11986 32413 1607 140 --
NM_000297chr431460 1358 238 ----21338 207
NM_000332chr677085 6429 5288 4462 2161 2050 346 25894 1698 21977 981 --
NM_000406chr453090 2911 2525 675 22 1881 22229 2061 12261
NM_000448chr1163017 2785 1303 832 756 363 33141 2039 991 --12419
NM_000461chr3134645 4350 4222 4126 3764 3490 1789 1753 1606 1106 823 709 151 22847 755 24508 717 --
NM_000489chrX103465 2821 2807 2676 2382 2251 626 507 260 64 ----12858
NM_000555chrX127510 6399 5791 5475 5404 5270 5069 4755 1917 1097 940 730 66279 6000 2260 963 415 38 11323 --
NM_000633chr1874782 4709 4447 3810 1657 1416 867 14757 33829 975 300 1552
NM_000793chr14134615 4507 3522 1974 1672 1490 1164 694 575 458 438 237 57 44001 3567 736 71 ----
NM_000813chr585482 4920 4885 4491 3807 1193 1064 554 --24827 4219 11275
NM_000868chrX82348 2024 1602 916 891 794 764 736 42369 1967 1655 414 1827 12400
NM_000875chr1556859 4688 597 532 494 25595 375 --34960 2171 1057
NM_000899chr1284257 3685 3502 3139 2898 1059 803 166 31609 1561 90 13718 33643 3316 1424
NM_001001323chr1253045 2864 2681 2120 33 --22767 2101 --
NM_001001419chr594770 4739 4573 3861 3836 1839 1527 728 246 14486 45106 3552 3420 1456 24924 3278
NM_001001484chr1032289 1975 1520 21717 706 --11536
NM_001001664chr273984 3823 3772 3344 3031 1096 945 13423 23947 1269 --
NM_001001938chr983126 3097 1387 1247 973 653 583 569 11220 22497 177 23427 3003
NM_001001971chr1021308 950 2299 223 1417 11159
NM_001002860chr14114412 4241 4163 4030 4002 3668 3315 2931 740 597 547 2965 572 1488 --
NM_001003652chr18127943 7584 6324 6274 5295 5288 2861 2649 1601 865 694 151 25803 2124 48314 6037 3485 605 37532 6457 5792
NM_001003674chr18117024 6254 6142 5878 5331 5147 4821 4359 1821 1404 495 ------
NM_001003681chr2272087 2067 1630 1525 811 275 223 1473 21878 1720 --
NM_001003800chr993663 2889 2652 2590 2513 2317 1414 914 690 12921 --22352 664
NM_001004065chr983872 3398 2974 1343 1234 1222 202 58 23993 612 1173 --
NM_001004346chr451149 1095 979 126 31 1910 --1918
NM_001004360chr271852 1692 1626 1582 1518 1357 244 31756 1481 165 --11877
NM_001004419chr1294577 4207 4182 3859 3444 1851 1423 1247 1226 13472 14568 11131
NM_001005473chr5186653 6249 6213 6156 5454 5391 5260 5126 4625 4013 2369 1898 1295 1257 1243 1143 546 411 76549 6340 5795 4914 4066 2065 216 26316 1606 26468 5351
NM_001006600chr53785 578 65 21924 909 --1838
NM_001007024chr1754197 3219 3088 1503 1428 ----14431
NM_001007097chr9114865 4527 4305 3991 3463 3152 2000 1730 1579 916 862 1633 1304 12027
NM_001008660chr1171035 480 418 331 159 96 57 176 ----
NM_001009554chr454132 4078 3277 3264 3219 33100 2895 1619 12994 --
NM_001009899chr3146455 6264 6092 5886 5859 5816 4373 3990 2078 1817 1270 904 290 280 ----26313 1753
NM_001009909chr1153314 3083 3044 1345 435 1385 33693 2404 1271 --
NM_001009959chr261694 1626 779 487 283 205 22525 167 122 --
NM_001009960chr772638 2627 2433 1033 683 329 76 4725 394 223 35 1239 --
NM_001010861chr152201 1904 1736 521 277 32814 2308 789 22571 338 --
NM_001010862chrX62127 2075 2044 675 410 42 1434 12892 11220
NM_001010891chr5166952 6945 6322 6313 5970 5020 4825 4376 4355 2183 1655 1478 1261 840 829 456 16271 14207 11612
NM_001010984chr162494 2276 2170 590 112 84 1248 12099 --
NM_001011537chr371664 1639 1581 953 561 373 299 ----175
NM_001011666chr785829 5611 5325 4383 4038 2439 2418 2317 65300 2626 1051 971 531 397 26255 418 --
NM_001013031chr1052921 2896 2301 1229 580 2286 70 33124 732 311 23107 2555
NM_001013620chr12148285 8274 7865 7710 7217 6961 2847 2621 2613 2572 1896 1640 827 162 68496 7879 6488 6344 3181 883 36671 5671 2094 --
NM_001013659chr1984726 3372 1685 1629 1593 964 753 61 14034 34537 4220 368 --
NM_001014380chr13105290 4977 4827 4690 4487 4353 3965 3564 2181 1158 35196 1054 129 31219 1087 56 --
NM_001014797chr1096878 3271 3223 2734 2430 2052 1730 1350 1176 42545 625 461 83 17817 --
NM_001017368chr1792486 2478 2427 2310 1981 1933 1748 896 729 1501 32714 926 404 --
NM_001018065chr976004 5076 4242 1206 612 519 102 44578 2305 1516 60 14169 --
NM_001024647chr12167016 6926 6752 6571 6233 5973 4898 4868 4805 2073 2059 1795 1508 842 567 397 47138 2591 2303 1672 26519 2429 16227
NM_001025076chr10135847 5618 4853 2170 1797 1637 1267 1184 1093 723 279 239 201 66014 5564 5382 4549 1587 297 14997 --
NM_001025077chr10147205 6976 6211 4855 2995 2625 2542 2451 2081 1637 1597 1559 702 52 67372 6922 6740 5907 2945 1655 16355 11194
NM_001025079chr363724 3656 3559 2952 2671 983 1927 --1233
NM_001025108chr244140 3125 1031 407 1397 23956 1408 --
NM_001025580chrX73378 3229 1729 1697 986 696 192 21121 519 --1558
NM_001029858chr693072 2691 2359 2177 991 909 829 730 129 12372 ----
NM_001029863chr662661 2521 2328 885 612 580 63146 3024 2719 1250 1048 566 12503 --
NM_001029875chr552454 1986 1213 865 412 32263 1972 462 22880 827 1430
NM_001030055chr1494224 4119 3679 2905 1696 1632 939 924 330 53954 1139 962 168 48 24137 3298 --
NM_001031732chr453622 3090 616 185 43 32739 2667 197 23523 2689 --
NM_001031804chr1694325 4209 4090 3868 3611 3140 1156 842 764 43552 3236 3214 2903 1290 14158
NM_001032380chr1051825 1722 754 428 80 21556 312 1524 --
NM_001033049chr2172264 1943 1598 883 523 347 301 --1363 --
NM_001033087chr20103213 2815 2513 2171 2062 989 979 902 437 100 --1120 --
NM_001033925chr1061525 1415 741 469 425 402 11795 --21811 718
NM_001039199chr2035050 2000 1922 44511 4195 3122 688 34641 3532 232 24896 3242
NM_001039538chr273554 3301 2832 2343 1372 1329 176 23465 348 12676 --
NM_001039590chrX83940 3824 3313 2930 2760 1428 1057 151 24054 1562 11283 --
NM_001039618chr1185910 5666 5061 4762 2259 1954 873 200 14294 32315 1583 1285 1415
NM_001039840chrX74989 4469 4063 3750 1716 1156 797 66091 5505 4747 3945 1335 1241 25118 2005 11582
NM_001039937chr1374161 4035 3965 3837 1424 252 136 43618 3097 1670 129 13918 13424
NM_001040284chr16105875 5331 5305 5270 4580 2380 2275 2099 1750 841 22057 1117 25749 3920 1423
NM_001040450chr1542713 2194 1023 416 11817 --1389
NM_001040712chr9113550 3292 3206 2638 2479 1395 852 492 344 289 217 23309 1433 188 13098
NM_001042413chr983819 3623 1504 1356 1349 1312 693 176 23967 3161 23729 3490 1471
NM_001042494chr1573519 3275 2987 1162 962 713 380 --11179 1321
NM_001042543chr411185 11148 1347 1483
NM_001042599chr2177135 6855 5468 5422 5176 5030 4914 3148 2614 2544 2039 1899 1753 1320 598 518 453 56901 6106 1932 1891 527 15590 27877 1017
NM_001042603chr1275273 5012 3778 1894 1706 1329 126 75180 5085 4676 1928 1725 1285 1115 33906 3804 679 --
NM_001042749chrX41481 56 32 21 21576 615 184 --
NM_001099678chr3145987 5121 4967 4816 3987 2513 2502 2406 2371 1754 1695 1297 963 359 --36289 3958 87 --
NM_001106chr389628 8588 7794 7002 6659 6374 3477 2018 29755 8555 180 13498
NM_001148chr431826 1630 647 2470 460 1525 11404
NM_001149chr102512 215 2401 87 41306 1132 331 54 --
NM_001167chrX76480 4534 2554 2488 2225 1528 1509 ----12093
NM_001174chrX21794 1707 11828 12300 11907
NM_001204chr2167171 6891 6124 6105 5917 5057 4902 4765 2863 2784 2538 1564 1440 1237 784 28 46394 6014 5995 5437 ----
NM_001259chr7126332 5877 5658 5522 5479 5065 4444 1234 1054 691 252 176 25673 2144 36077 3996 912 --
NM_001304chr1793723 3407 3148 2422 2411 1065 745 206 117 1378 13297 13793
NM_001351chr361760 1617 1527 668 522 447 2693 618 21387 80 --
NM_001396chr2142708 856 491 476 12403 --12133
NM_001412chrX133734 3638 3528 3483 2497 1505 1468 1407 843 658 451 349 326 --12445 11295
NM_001419chr1964303 3732 3446 1882 1875 1658 --1180 23088 248
NM_001460chr193441 3155 2984 2961 2912 2558 386 330 139 12892 22833 2548 12846
NM_001742chr761358 1272 1237 620 292 143 11183 ----
NM_001759chr1284361 4340 4248 3591 1822 1815 1209 108 15036 33607 3307 223 --
NM_001859chr963373 3177 2875 1548 1378 881 12702 43415 3344 2514 454 12740
NM_001977chr461710 1645 1615 1502 508 308 51459 1258 1201 1188 636 ----
NM_001987chr1263432 3204 3198 2853 437 257 --11311 23582 1522
NM_002006chr475064 3873 2205 1657 967 327 58 45701 5357 1912 1022 25480 993 23940 637
NM_002009chr1572680 2421 2090 1113 770 691 545 12226 1792 --
NM_002015chr1393110 2909 2829 2389 2283 1237 1129 311 250 --12377 12419
NM_002024chrX62219 2199 1903 1577 877 408 ----11858
NM_002025chrX189329 8544 8431 8089 7618 7128 6810 6641 6139 6050 5741 3251 2730 2424 1581 1067 761 151 78923 8858 8522 3556 3357 1212 994 37653 7600 2220 16215
NM_002040chr2143005 2919 2068 631 12901 --1620
NM_002069chr711884 --11849 21760 1634
NM_002158chr272661 2491 2476 1045 469 302 267 32799 1100 1024 2704 205 --
NM_002210chr273002 2258 808 695 620 611 563 43203 2311 648 91 11046 --
NM_002214chr785101 5088 4306 4245 4079 2010 1906 281 25756 3718 35726 4466 946 15212
NM_002264chr3114591 4505 4355 4291 3669 3661 3511 3210 1673 397 244 11771 24121 261 --
NM_002270chr595492 5394 4432 4249 4112 4032 2218 1638 1195 34871 4158 290 ----
NM_002336chr12105068 4690 4380 3690 3088 2009 1079 1036 624 64 44675 2000 691 405 14098 1556
NM_002356chr692775 2628 2478 2133 2008 1039 828 438 190 ------
NM_002397chr521536 640 --11773 12180
NM_002594chr2051749 1686 738 488 239 11761 11566 22028 605
NM_002595chr1281784 1675 1659 1472 1198 644 312 96 --21639 1330 11286
NM_002645chr1151166 869 850 764 727 22505 451 12236 --
NM_002655chr885002 4934 4842 4638 3991 3248 1336 294 11226 --24792 3972
NM_002709chr263495 3480 2565 2462 2217 987 53094 2958 971 227 221 ----
NM_002745chr2294245 3987 3892 3621 3479 3298 3035 1346 333 --1577 13469
NM_002760chrY115936 4824 4532 4525 4242 3652 1833 1267 1256 541 225 11222 1171 2846 351
NM_002886chr375150 4745 4023 3819 3220 1593 566 1769 23581 492 14390
NM_002956chr1211330 1124 --11067
NM_002977chr252924 1280 403 89 76 1379 1983 --
NM_002998chr841921 1428 130 32 1489 --12093
NM_003012chr863004 2794 2587 903 422 241 1563 12960 21949 1269
NM_003034chr12177773 7515 7301 7213 7179 5796 5481 4959 4936 3180 2827 2427 2041 1841 1404 937 513 43257 648 277 136 17114 --
NM_003048chr2102813 2514 2214 2103 2041 1897 1719 715 300 158 --11880 185
NM_003051chr131641 786 119 1405 12016 1589
NM_003108chr2116864 5523 4834 4800 4638 4423 2806 1622 1549 472 188 --1378 --
NM_003112chr763215 2585 1012 685 98 59 23156 380 1530 1638
NM_003161chr1763613 3502 2908 2387 1327 593 32999 2543 1340 ----
NM_003262chr3115078 5022 4189 3989 3917 3887 3846 3578 1954 1773 1003 35133 803 105 34470 4147 3870 1599
NM_003342chr1773139 2167 1200 1037 942 842 368 12893 ----
NM_003410chrX82718 2608 2486 2412 2127 1993 792 490 3990 950 53 12274 --
NM_003463chr673264 2810 2396 2281 2189 404 333 2653 297 1903 --
NM_003471chr372314 1716 1639 1609 1602 1513 1472 42159 412 363 194 ----
NM_003483chr1232535 496 160 ----2958 789
NM_003489chr2193356 2233 1323 1244 1047 817 683 374 59 --1270 --
NM_003574chr18145569 5386 4725 4373 3876 3869 2139 1881 1855 1686 1387 1272 741 675 11286 11947 1260
NM_003590chr274083 3993 3133 2719 296 212 133 43666 3660 2523 2473 11065 --
NM_003607chr133844 3126 723 33874 1622 165 44248 4006 3406 489 --
NM_003615chr3133780 3555 3194 3078 2708 2621 1594 1315 1226 777 612 380 299 23865 2473 11505 --
NM_003626chr112353 90 31200 164 58 --182
NM_003714chr582898 2466 1933 1238 1226 1201 711 430 11884 125 1547
NM_003743chr262253 912 879 759 464 24 ----22161 655
NM_003873chr1032521 2383 718 11611 --22283 350
NM_003913chr683830 3809 3383 1478 932 899 193 52 14076 ----
NM_003934chr931304 401 379 2957 452 --1811
NM_003966chr5187850 7371 7240 5956 5820 5416 5033 2924 2621 2283 2265 1530 1303 910 503 352 199 32 36433 1901 268 37752 5451 2589 21921 800
NM_004100chr692565 2058 988 705 427 374 236 130 111 --11907 124
NM_004124chr14133350 3286 3220 3138 2345 2270 952 919 863 655 162 128 55 --12482 1426
NM_004171chr11219426 9361 9291 8296 7711 7535 7480 7270 7018 6893 6858 6068 3674 3212 3127 2633 1398 1312 685 256 22 79623 6851 3636 3252 3238 2732 1637 --12676
NM_004229chrX41427 650 453 54 ----11750
NM_004392chr1382571 2539 2527 2287 2138 990 359 88 --12688 123
NM_004397chr11104296 3896 3745 3589 3520 3309 1146 593 512 365 13712 11223 --
NM_004430chr852764 2161 2063 994 711 --12582 1916
NM_004458chrX72666 2078 701 673 464 352 203 32681 1998 497 1248 --
NM_004464chr483584 3272 2982 1099 1069 866 654 121 23601 1026 2728 556 1975
NM_004501chr1103846 2731 2723 1574 1503 1129 1101 1023 915 54 1796 ----
NM_004529chr951161 1143 1078 1072 570 --41473 1332 992 247 --
NM_004586chrX83723 2110 2029 1208 1091 788 563 532 --11006 34099 1979 1926
NM_004598chr5123230 3166 2803 2705 2612 2268 2079 1312 862 814 801 240 12590 ----
NM_004650chrX71827 1807 1776 1324 1317 225 68 21185 83 ----
NM_004730chr572157 1859 875 394 287 257 86 ----177
NM_004744chr493836 3526 3390 2552 2396 1281 1019 604 136 1922 1614 --
NM_004745chr8127054 6524 6402 5379 4950 4789 2308 1989 1936 1909 735 647 15062 --16321
NM_004760chr741688 903 672 356 32276 2159 322 --11574
NM_004852chr182213986 13476 13195 13104 12795 12165 11322 11083 9255 9228 8736 5395 4710 4281 4196 2230 1759 1742 1358 1213 904 847 913581 13045 11690 10708 5014 4832 4658 2691 609 514336 12467 12125 3083 711 24589 4045
NM_004859chr1772901 2644 2597 2460 2264 879 414 ----1833
NM_004936chr983021 2603 2494 2466 2445 2426 685 544 --2893 318 --
NM_004956chr773563 3251 3225 1714 848 842 822 24613 2826 13973 --
NM_004992chrX108512 8441 8076 7179 7157 6652 5651 2794 2475 2084 26390 6297 35839 5163 2008 11706
NM_005065chr14105314 5251 5172 4730 4273 3966 3703 1667 1457 837 35182 4220 3658 --24204 4137
NM_005188chr11108241 7925 7916 6559 6014 5861 2255 1676 474 106 28207 1693 47949 6266 5404 322 --
NM_005233chr351974 1852 1786 859 850 1108 2822 411 --
NM_005339chr4114108 4030 3814 3710 3179 2786 1370 917 526 241 153 11113 ----
NM_005433chr18387 72 31 42819 2307 2038 403 22010 125 --
NM_005504chr12176643 6600 6163 5963 5945 5752 5388 4990 4919 4230 4093 2385 1605 1402 1144 918 520 15626 26274 1932 --
NM_005578chr3124962 4325 4249 3830 3809 3752 3679 1454 1442 1159 988 721 25088 4103 21811 406 --
NM_005596chr9135759 5514 4791 4595 4171 4023 2278 1593 1182 923 909 490 146 32350 1375 1214 3702 617 368 11502
NM_005715chr632761 937 70 --12168 12816
NM_005746chr732332 2122 2052 ----12564
NM_005759chr264806 3843 2962 2911 550 315 53103 2956 1626 1375 1303 ----
NM_005822chr672278 1659 1613 1537 1530 866 88 --1645 11920
NM_005909chr593832 3691 3190 1529 1447 1434 1128 217 64 1880 23508 50 12816
NM_005935chr495337 5272 5170 4836 4688 4310 3800 1640 418 11316 21356 1057 --
NM_005955chr175565 5256 4481 4298 1193 314 83 14443 35542 1792 115 1102
NM_006037chr283877 3802 3412 1639 1560 944 763 723 1985 11199 21345 965
NM_006047chr20113533 3318 3254 3196 3025 2476 2304 1051 1014 940 461 23107 649 1884 12809
NM_006080chr721148 753 22287 157 --1126
NM_006154chr1562932 2848 2652 450 290 55 42940 1153 839 709 ----
NM_006226chr241339 1008 547 199 1320 2392 308 --
NM_006246chr1441217 904 303 288 21328 926 11225 --
NM_006251chr563211 3016 2528 2093 1032 809 1877 13247 --
NM_006252chr197285 6699 6534 5793 5053 1346 892 798 143 77213 6524 1992 1663 784 374 216 2493 187 26128 2028
NM_006267chr251876 1560 1266 1204 739 11899 --11478
NM_006306chrX105944 5352 4517 3736 2248 2157 2058 1686 1094 181 24131 1429 --15470
NM_006345chr451383 1308 926 508 442 ----11340
NM_006380chr17124184 3675 3608 3437 2956 1192 1120 783 628 456 441 62 21553 285 1259 11172
NM_006460chr1751462 1299 469 328 294 1345 1121 --
NM_006526chr2071761 1531 1493 408 344 147 60 31831 581 571 1256 --
NM_006546chr1776054 4987 4523 4030 1355 743 49 21168 1152 56479 5340 4412 232 93 --
NM_006547chr721933 344 2395 371 --1646
NM_006595chr1161750 1648 817 684 107 32 ----1381
NM_006614chr353202 2337 281 246 121 72976 2961 2666 2390 1331 718 275 11236 13667
NM_006618chr141620 461 410 70 --1400 11229
NM_006646chr1332346 618 143 32354 2331 516 --12293
NM_006729chrX135451 4721 4560 4460 3599 1684 1503 1402 1090 842 607 340 292 24754 3719 11862 1522
NM_006750chr16157873 7601 7485 6706 6064 5967 5928 5010 2309 2279 1868 1021 930 910 812 25232 1876 25709 532 15602
NM_006851chr1251926 1156 788 258 148 ----12329
NM_006873chr263285 2881 891 741 409 68 --11412 11177
NM_006981chr952841 1889 1110 805 274 22347 2058 --1360
NM_007011chr15106772 5855 5613 5294 5203 4723 4474 2712 2546 1238 25372 627 22411 529 46019 5680 2229 804
NM_007026chr171563 1616 2551 234 1576
NM_007146chr1752716 790 415 346 92 2743 424 22531 216 --
NM_007197chr12--1389 1690 1144
NM_007249chr13189432 8896 8655 8526 7646 7589 7455 7024 6794 6323 3701 3196 2962 2790 2499 720 430 72 58351 7818 6049 5729 2065 27267 6018 --
NM_007350chr12134092 4052 3855 3597 3578 3451 1685 1422 1204 1161 1036 680 536 43989 3014 1370 651 --13331
NM_007375chr152314 1773 1760 440 426 12764 --11962
NM_012081chr583435 3223 2563 2513 1409 601 482 55 13111 --12434
NM_012104chr1153865 2958 2639 1029 317 23420 2891 22612 266 23328 2825
NM_012199chr174580 4333 3965 3796 3587 3288 3215 44459 988 561 72 33047 1301 192 --
NM_012234chr363606 2676 2535 990 616 286 23579 984 --147
NM_012301chr722242 2024 1104 22186 141 21788 637
NM_012302chr141167 499 406 277 ----1946
NM_012316chr154246 2128 1444 995 899 45431 5217 4914 1518 14554 21983 497
NM_012464chr472948 2669 2494 2443 2148 686 117 2779 466 1656 --
NM_013309chr1562438 2405 1619 854 669 459 --21870 91 --
NM_013374chr383017 2236 822 708 634 451 266 231 ------
NM_013381chr1262434 2323 2189 2030 1874 1525 21846 1812 ----
NM_013386chr141620 580 268 255 11324 1275 --
NM_013436chr22575 295 ----1771
NM_013447chr1961402 1024 731 613 336 46 12942 41054 822 604 182 1111
NM_014021chr193425 3082 2935 2501 2364 2325 858 478 445 31378 1277 163 1155 --
NM_014048chr16115133 4872 4709 4536 4392 3489 1878 1777 727 617 360 13801 24250 3683 21366 702
NM_014112chr855375 5147 1968 1944 477 --34905 901 127 14540
NM_014243chr472089 1951 1935 1882 1588 388 215 --190 --
NM_014331chr4127832 7333 7074 5472 2638 2312 1788 905 801 662 473 167 ----27182 5029
NM_014423chr5155201 5052 5038 4994 4447 3555 3503 1965 1789 1546 1428 1359 1210 299 217 21773 1677 2544 267 14209
NM_014517chr351853 1595 661 540 77 31274 591 70 11454 11215
NM_014612chr921554 1302 --11130 1130
NM_014613chr512104 --1798 33047 2975 102
NM_014683chr1752068 1824 584 531 459 12100 41409 540 376 181 --
NM_014701chr1543314 3207 2906 536 32231 471 208 23308 2125 12474
NM_014702chr633437 1090 387 11211 23018 1368 13155
NM_014746chr2114287 3729 3582 1666 1560 1441 1406 1091 1066 479 372 ------
NM_014765chr172644 1690 950 416 409 51 27 31640 813 148 --1117
NM_014774chr163134 2023 1312 949 759 750 23142 1254 --22112 202
NM_014783chr1531267 707 549 --11738 11226
NM_014824chr1161689 1638 1480 1341 772 229 --11805 11922
NM_014829chr572386 2051 954 938 486 372 100 1403 1153 --
NM_014832chr1331847 1650 344 11622 1367 1318
NM_014873chr184818 4467 3911 3620 2959 1678 1559 274 23171 160 23614 310 1114
NM_014877chr1797363 5761 5507 5149 5049 5028 4904 3104 855 87339 7065 7039 6410 5268 1256 1101 463 16962 --
NM_014906chr1784108 4014 3557 3383 2862 1528 732 459 22808 106 2383 366 --
NM_014912chr1043071 3017 1185 815 --193 12397
NM_014936chr662671 2322 1842 1137 1042 239 1689 1415 12022
NM_014961chr472120 1718 1679 1536 1390 249 30 11494 164 --
NM_014982chr1475027 4649 4457 3589 2105 1358 1219 ----1405
NM_014989chr611712 1271 12045 11581
NM_015000chr1232910 2689 426 13107 1129 1560
NM_015040chr232611 899 487 --33416 2513 566 --
NM_015092chr1683596 3394 2914 1500 1146 434 316 159 33969 792 716 23144 137 11260
NM_015093chr621455 1410 --1493 1194
NM_015144chr16113784 3490 1394 1306 1291 1235 1196 777 526 240 73 3788 715 143 ----
NM_015156chr1463959 3644 1606 1423 624 241 --13981 13801
NM_015192chr2032095 1099 26 43022 1126 259 120 22509 1979 1149
NM_015206chr1573676 3661 3263 2932 2408 1341 106 22960 2874 --23424 175
NM_015215chr1102887 2669 1212 971 904 649 521 274 157 136 --1622 --
NM_015271chr4104320 3357 3246 3084 3007 2693 716 635 443 106 23146 395 --13600
NM_015272chr1661662 1582 819 797 758 361 ----11575
NM_015275chr1282088 2042 1842 1634 1610 1551 838 34 2700 277 --1379
NM_015310chr8128351 6459 5380 5258 2938 2864 2661 1460 1145 571 515 411 38426 8174 1955 26616 448 1855
NM_015313chr1194688 3693 3195 2973 1804 1530 1521 303 139 --1744 23042 247
NM_015317chr292745 2640 2628 2565 1959 1920 1903 1808 822 12105 11062 --
NM_015335chr1262289 2116 1722 1628 1061 765 1694 22279 397 --
NM_015336chr1231913 923 883 21933 81 --22232 248
NM_015355chr1791996 1833 1343 532 483 464 416 300 38 11951 11901 --
NM_015378chr182889 2771 2018 1886 1170 884 165 138 --11978 32250 2111 915
NM_015455chr5103856 2785 2646 991 852 694 489 379 176 52 33756 2709 1153 1337 --
NM_015475chr25797 770 741 312 59 ----1997
NM_015526chr1961280 1222 1189 1001 963 398 1990 2974 956 --
NM_015553chr6104567 4505 4499 3557 2033 1992 1928 1444 1436 506 14001 24975 1193 --
NM_015564chr563172 3023 2456 2417 833 478 53369 3275 3102 667 591 22398 1357 --
NM_015565chr2132175 692 638 --1563 11885
NM_015576chr352237 737 703 519 289 1979 --12045
NM_015635chr952029 1910 1446 903 299 ----22150 1964
NM_015678chr1351712 1643 1614 1501 1491 --21484 1074 --
NM_015878chr882019 2013 1715 1612 1557 1528 1449 897 ------
NM_015879chr18137940 7437 6785 6759 6695 5325 3459 3075 2535 2434 2294 1377 1230 87706 7510 7257 6898 6590 6190 3020 2573 57628 7594 1552 1026 557 37200 5437 1301
NM_015886chr884364 4251 4123 3856 1698 1315 1073 453 35738 3470 1763 11525 11458
NM_015888chr143167 2742 2349 620 1640 --12469
NM_015906chr1103790 3717 3409 3001 1738 1725 1572 1302 1165 205 44462 4210 3484 1616 ----
NM_016009chr184242 3802 3107 1728 1608 988 537 219 41928 1792 695 341 13136 --
NM_016076chr1103156 2369 2239 2169 1210 1194 341 305 230 118 32631 1999 1278 ----
NM_016217chr653687 3517 2581 2527 851 ----22717 2596
NM_016255chr683120 2585 2531 1025 937 837 438 95 43306 2064 581 194 1323 --
NM_016275chr382725 2380 2114 1805 1727 970 648 385 12060 22563 555 1445
NM_016287chr152109 2059 1422 1382 42 ----136
NM_016289chr252040 1786 1534 471 160 31508 34 28 ----
NM_016297chr2112869 2770 2642 1308 1256 946 819 755 719 711 66 21200 1030 33723 1270 998 --
NM_016322chr963110 2808 2656 672 439 209 1228 12503 --
NM_016353chr872331 2316 1752 1703 825 761 214 3514 292 22 11599 --
NM_016472chr1441515 1439 263 64 --1329 2976 501
NM_016485chr662241 2101 1494 1480 440 347 --21997 126 11584
NM_016530chr1543537 964 830 699 23619 1404 13484 12518
NM_016544chr272578 2534 1352 1328 892 779 668 33898 2973 2795 12775 1311
NM_016653chr211026 1969 --1962
NM_017420chr1473741 3189 1287 1272 1101 845 44 23160 2970 --1885
NM_017599chr1281960 1927 1813 1654 1423 1328 341 156 22109 469 1266 --
NM_017637chr9129448 8865 7447 7288 6846 6158 5802 3765 3386 3074 1391 808 68133 7765 6727 5770 2984 919 28746 1342 --
NM_017643chr1753001 2824 1919 1037 182 11173 1293 --
NM_017645chr9113140 3077 2904 2836 2283 2265 2024 1180 1129 883 125 1706 12331 --
NM_017658chr1494703 4410 4254 3672 3626 3334 3100 2989 654 24148 1613 ----
NM_017848chrX84622 4473 4137 3974 1529 1275 793 314 14680 21473 1194 --
NM_017919chr9145514 5422 5145 4781 4647 3688 2149 1975 1604 1388 891 594 547 451 25238 1984 24774 4143 11619
NM_018014chr261303 1124 1080 1017 990 861 ----11190
NM_018027chr1082929 2819 2477 1272 922 781 769 149 --23230 2768 12412
NM_018084chr252750 1168 623 127 113 43016 1202 633 426 --1606
NM_018121chr10103171 2711 1982 1008 823 767 649 588 514 158 187 --141
NM_018133chr352066 1855 674 618 573 22203 1971 2667 600 --
NM_018211chr141629 1550 1473 808 --12220 1821
NM_018254chr141988 1735 532 158 11580 22355 2318 12405
NM_018351chr12124516 4492 4416 4317 4165 3836 3695 2964 1348 1062 558 133 2756 739 1981 13206
NM_018364chr132614 1469 537 43988 3300 2895 656 197 --
NM_018374chr7114695 3613 3364 3277 1920 1398 1111 1045 1027 616 452 --21058 688 1842
NM_018440chr8158084 6372 6035 5903 5524 3440 3289 2995 2973 2923 1770 1553 721 484 272 27619 3027 26107 3282 --
NM_018566chr131891 1703 1249 13920 43190 911 901 146 11523
NM_018590chr1031181 477 183 11309 31090 522 232 --
NM_018638chr12155680 5174 5154 5111 4458 4365 4210 4151 1616 1331 1153 730 644 225 89 1146 34858 1486 63 --
NM_018650chr141719 1688 493 390 2717 648 12092 1663
NM_018898chr56937 828 794 680 570 54 --21845 122 --
NM_018945chr6113577 3281 3187 3070 3044 3005 2848 2594 1010 518 354 ------
NM_018958chr1553673 3467 2816 1510 1449 13026 --12965
NM_018970chr742104 881 171 100 22659 2258 12943 189
NM_019012chr121723 1100 --1109
NM_019072chr573911 3589 3163 2828 2797 1260 163 33503 2974 2697 1779 --
NM_019094chr1273534 3526 2851 2337 1130 1098 156 1405 --2909 449
NM_019593chr20103053 3021 2577 2221 2011 1260 1210 617 469 305 2743 261 1365 --
NM_020122chr2145427 4586 4537 3806 3722 2333 2022 1703 1555 1031 907 757 720 582 75798 5732 5399 4404 4195 4162 2081 44102 2297 1943 296 25449 1524
NM_020144chr711482 31361 189 111 --1392
NM_020205chr193150 3017 2760 2199 598 517 501 463 356 --22127 640 --
NM_020337chr4113136 2989 2675 2630 2480 2473 2073 823 730 646 496 ----11257
NM_020363chrY61783 1644 1553 620 545 83 1714 21493 168 --
NM_020647chr872182 1694 1466 1430 667 403 285 1168 21806 23 --
NM_020648chr1892642 2610 2416 2307 2253 1793 739 301 92 22545 608 --12772
NM_020673chr20115540 5497 4836 4754 2847 1758 1728 1494 1141 1129 948 47349 7164 2504 2088 26814 3107 --
NM_020734chr1273190 3184 3144 2730 2433 467 189 --22960 516 --
NM_020742chrX62592 2018 1922 1841 1036 521 --1555 11830
NM_020752chr1082417 2129 1972 895 313 234 208 187 --32190 2042 396 --
NM_020768chr593005 2984 2952 2876 2303 769 678 217 47 32935 491 175 12918 --
NM_020772chr17168641 8446 6426 5958 5831 5815 3384 3321 3280 2903 2806 2654 1436 1349 1234 210 31051 1030 399 11226 --
NM_020782chr12104227 3126 3063 2996 1781 1375 1264 1236 577 355 44371 3498 1882 235 ----
NM_020783chr18112201 2189 2111 1756 1490 798 613 419 294 90 52 1437 1778 1845
NM_020796chr532501 1031 1021 42321 1191 954 853 --22400 810
NM_020861chr631154 1048 545 21063 438 --1319
NM_020933chr1951614 1375 612 466 448 41815 1566 299 106 --21793 126
NM_020935chr274660 3881 3814 3240 1604 1076 1035 23015 535 ----
NM_020940chr1032605 1068 606 22690 238 --12750
NM_021038chr363385 2927 2782 2729 2187 1024 --12263 1183
NM_021155chr1952956 2901 2056 2032 63 32918 2774 241 --22121 1896
NM_021183chrX82446 2187 1979 1754 1696 683 484 53 2232 182 11969 --
NM_021629chr3104645 4526 4165 3083 1210 1031 461 195 76 45 14550 34110 1292 498 1965
NM_021784chr20--1641 --2546 122
NM_021964chr3146665 6556 5918 5650 5534 5451 5308 4874 4824 4665 1049 603 407 352 45406 2340 1580 1303 34895 2457 816 --
NM_021998chrX51174 1162 942 484 478 1957 ----
NM_022048chr15125998 5910 5784 5508 5230 4724 4548 2003 1916 1564 1168 422 14054 14490 --
NM_022058chr241919 1789 1506 179 2729 199 11835 --
NM_022073chr1451293 1269 1035 443 63 11102 1230 174
NM_022166chr16126041 5933 5593 4718 4686 4490 4344 4080 4008 3959 2481 257 12199 --45689 3989 2173 395
NM_022459chr13116375 5290 4332 4086 4028 2153 1912 1752 1262 405 30 35268 4801 1252 25832 262 --
NM_022497chr333321 1439 1170 33547 3360 2994 1114 23624 495
NM_022753chr172334 1881 705 597 566 493 376 12166 1185 11934
NM_022781chr993099 2951 2852 2399 2040 1072 843 834 791 --1499 --
NM_022898chr1494458 4351 3262 3033 1754 1429 1090 1083 449 13957 1159 --
NM_022918chr1131826 1720 1634 ----22024 155
NM_024007chr5103000 2290 2223 2018 1995 1958 769 169 112 72 53133 3013 2722 729 264 ----
NM_024345chr9155969 5794 5616 5597 5531 3917 2406 2368 2237 1957 1844 1527 1437 961 110 45403 4605 4344 3963 1664 --
NM_024607chr8114456 4389 4053 3676 3005 1503 1182 1023 871 840 289 1165 13206 --
NM_024613chr871792 1590 1455 1447 1431 1187 46 11803 ----
NM_024628chr311155 ----2457 139
NM_024639chr662288 2098 2065 1935 871 75 22823 1023 1143 21031 200
NM_024665chr394346 4015 3589 3524 1129 915 676 566 221 33790 2852 121 23722 3029 --
NM_024770chr276070 5788 4736 4389 4083 1789 1096 86696 5470 4640 4359 4216 2616 2345 1782 26372 4148 1527
NM_024920chr441237 1130 544 383 21202 1144 1130 --
NM_025054chr8103780 3414 2632 1649 1374 1206 1155 1045 314 92 42584 1477 947 473 14017 --
NM_025160chr1104194 4014 3899 3714 1653 1103 1061 732 500 476 34154 3176 1621 11453 2931 855
NM_025191chr182640 2634 2412 2219 1376 1103 1041 153 23134 335 12660 1214
NM_025208chr1161847 1622 967 852 681 359 22305 2234 ----
NM_030751chr1061713 514 458 423 199 27 1572 --11668
NM_030806chr1129017 9000 8987 6686 6039 3719 3690 3583 2772 1727 718 283 88481 6624 5933 5903 3080 2366 2192 1586 166 12781
NM_030920chr131449 443 365 2673 261 21761 1717 11836
NM_031296chr482530 2121 2031 1978 1788 1741 1098 288 ----12713
NM_031442chrX63197 2956 2492 2110 2007 651 11158 2725 185 --
NM_031469chr673588 2988 2952 2602 1445 1434 934 11193 21549 620 --
NM_031483chr20103094 2992 2904 2643 2607 2584 647 466 243 181 22942 535 1362 --
NM_032160chr1893293 3114 3090 2923 2845 1338 1266 1180 22 ----11566
NM_032182chr1051269 1234 481 391 315 1461 --11640
NM_032221chr2061997 1971 1852 1709 1576 22 11693 11666 --
NM_032228chr1183536 3483 2710 2200 1266 1099 798 727 2682 208 ----
NM_032352chr141455 ----21311 1176
NM_032373chr10135440 3735 2075 1849 1595 1514 1392 1347 1308 1130 546 443 33 25083 4180 ----
NM_032859chr13113212 3069 2747 2528 1286 1136 965 945 903 739 587 23750 1044 --1641
NM_033030chr251629 1494 1482 1014 174 11231 --169
NM_033224chr7208002 7772 7745 7391 7333 7213 7012 6408 5442 5372 2761 2739 2692 2225 1408 1196 1146 756 471 327 27167 5823 1502 11334
NM_033389chr1774695 4328 4305 3959 1318 659 476 14607 21651 1481 1684
NM_033505chr2136776 5747 5692 5318 5016 4864 4663 2182 1689 1564 1490 1131 156 35518 4500 1367 ----
NM_033656chr2185874 5276 5206 4683 3830 3696 1005 830 35355 1998 1897 ----
NM_052879chr1274103 3693 753 633 561 425 305 1166 --13707
NM_052898chr841796 1624 1565 577 --1712 1559
NM_052917chr273404 3112 2497 1321 807 368 103 1624 1651 --
NM_052918chr1053120 3095 2500 1428 779 2485 269 43323 931 510 179 23306 2754
NM_052937chr871057 576 558 428 280 203 173 32560 2519 188 ----
NM_053064chr1472537 2324 1088 874 717 292 198 22210 978 --12422
NM_057175chr442595 2201 2149 299 2858 625 --12042
NM_057749chr831237 928 426 11127 --11040
NM_080867chr14115122 4893 4405 3562 3396 1643 1480 1334 784 321 115 64810 3922 3518 3472 1104 142 23343 949 --
NM_080872chr8123836 3747 3590 3204 3138 2970 2869 1633 1092 1047 1012 444 32997 2524 670 33767 2615 1145 21315 227
NM_080927chr363304 2664 2424 1344 759 287 23021 2655 23004 409 --
NM_130446chr384252 4172 4066 3706 1143 754 441 152 33215 3208 421 13573 24156 2709
NM_130809chr531945 864 187 2247 99 --1292
NM_133334chr4116389 6178 5632 5226 4714 4286 4231 1531 1464 1346 1323 --16352 11941
NM_133473chr1931947 1335 113 --2517 508 11936
NM_133496chr174454 4288 4262 483 427 238 95 24068 1227 21485 491 --
NM_133646chr275389 2171 2022 1733 1128 669 248 45505 4972 4136 715 --25524 5057
NM_138288chr1412159 1129 12045 1782
NM_138333chr972084 1930 1659 1621 969 601 385 12470 1125 11717
NM_138423chr1562182 1735 1714 1562 1516 48 11662 12106 --
NM_138444chr13124764 4713 4361 4185 3772 3009 1683 1385 1325 1312 457 183 --21482 419 14244
NM_138459chr6113627 3383 3079 3039 2963 2721 2650 2476 1098 649 531 13009 ----
NM_138468chr2156280 6124 4312 4130 4007 3951 2107 2042 1949 1935 1129 913 663 560 281 1727 14830 --
NM_138473chr1284382 4120 3665 1893 1490 971 835 218 34161 3404 1910 34646 3785 1449 11948
NM_138492chr531187 987 557 ----21214 1035
NM_138715chr892202 2070 1971 1717 1622 875 790 454 32 175 ----
NM_138782chr541462 964 611 403 32145 1699 543 ----
NM_139283chr1252278 1875 815 355 152 21020 616 1836 1216
NM_144567chr172653 2588 2565 1136 1119 257 214 22187 1058 12704 12773
NM_144571chr4106840 6379 5479 4407 1507 1486 1414 1257 1223 666 26478 6050 15669 --
NM_145011chr1072211 1663 312 295 268 229 100 1575 1411 1816
NM_145165chr1492820 2776 2657 2419 979 902 591 411 93 22438 2397 32828 1103 717 --
NM_145176chr663435 2453 1309 1182 813 733 23019 1171 ----
NM_145284chrX52345 1870 440 264 232 11826 2810 387 12088
NM_145307chr10134579 4470 4346 3982 3236 2965 2888 1600 1290 1205 982 575 547 84120 3035 1706 1147 1094 799 445 35 13622 --
NM_145808chr752763 707 692 535 145 12322 --1135
NM_152275chr252368 2333 1618 802 539 1479 21524 910 --
NM_152381chr251188 583 257 119 50 1110 21669 365 --
NM_152409chr553424 3232 2864 2600 1272 22392 1099 12293 11417
NM_152450chr1542143 1922 1747 523 1227 1237 11945
NM_152622chr593522 3515 3179 2663 2328 2189 1372 702 419 32719 2161 629 ----
NM_152624chr5137275 6954 5790 5657 5037 4866 2847 2399 2378 1630 1598 1313 821 46298 5272 1132 1027 34837 1508 1372 --
NM_152641chr1262191 2086 1832 532 276 167 21935 193 --12686
NM_152737chr6122 11726 11538 11763
NM_152756chr5124379 4021 3569 3472 2976 2768 2761 2632 1477 1448 1306 438 21730 1333 24132 3602 --
NM_152758chr852865 2808 2283 2164 579 ----12607
NM_152787chrX83880 3864 3814 2481 1442 1052 812 274 3997 909 897 2920 298 --
NM_152835chr192851 2474 2190 2151 883 685 588 529 254 1157 12090 --
NM_153207chr12124052 3840 3565 3491 2970 2952 2756 2689 1408 848 630 457 1128 ----
NM_153262chr192910 2805 2375 2299 2012 1157 1023 254 75 22219 592 --13161
NM_153367chr1043042 2657 1139 381 22582 566 1466 11555
NM_153607chr552784 2707 2286 1201 270 ----23116 2065
NM_153689chr211762 32031 1875 67 --1226
NM_172071chr1116995 6866 6658 5629 5196 5056 4855 4742 2772 1121 882 25350 4652 45450 5413 2926 721 2121 112
NM_173083chr141296 1180 117 110 1850 2497 413 --
NM_173355chr2--1188 2823 133 2779 362
NM_173468chr4146114 6032 5957 5662 5136 4753 4644 4475 4051 3951 1843 1494 1136 1053 25263 771 25608 358 25845 1465
NM_173473chr10102290 2122 1989 1705 1687 793 739 696 629 220 --1647 188
NM_173582chr11115804 5548 5436 5047 1467 956 851 805 795 633 419 24283 4035 35707 4486 4159 --
NM_173642chr1178970 8850 8476 7638 7548 7396 7018 6525 6492 6214 1804 1722 1202 1184 891 70 34 35831 5820 1041 28982 109 --
NM_173808chr1124266 4055 3856 3316 3035 1678 1281 1028 908 764 673 241 1896 --24438 3469
NM_173829chr5175678 5653 5339 4958 4206 3960 3813 2307 2235 1574 1437 1383 1173 860 835 506 439 25898 4119 22342 489 --
NM_174916chr1572303 1772 944 853 758 408 297 --11659 11558
NM_175061chr762191 2154 1942 1600 643 616 --2831 30 --
NM_175736chr12107827 7541 6953 6234 2960 2239 2153 2142 1550 1005 97444 6694 6075 5631 5549 5311 3120 2247 50 36164 2696 969 --
NM_175907chr1812204 22256 294 --12030
NM_177538chr2198922 8787 7258 7027 6780 6741 6591 5558 3470 3316 3291 3004 2985 2675 2534 873 345 323 74 164 18883 --
NM_178011chr1053013 2673 2082 516 109 42544 2426 2004 134 ----
NM_181504chr563993 3603 3519 3450 2955 299 23083 798 33421 3312 597 --
NM_181705chr5135531 4742 4046 3779 3653 2193 2072 1414 1100 1060 984 201 66 34957 3806 48 35097 4121 647 35183 4941 4311
NM_181723chr861753 702 542 485 343 131 12171 11794 --
NM_182485chr423643 1241 23098 2766 33355 3105 1366 --
NM_182758chr1573732 3198 1500 1325 1145 720 520 ----21056 48
NM_182765chr1072321 2251 1598 1494 905 835 192 42124 1661 631 213 --21941 1906
NM_194071chr795442 4449 4385 3306 1975 1375 1343 781 248 35298 4594 4204 14221 --
NM_194247chr2113687 2914 2852 1696 1323 1081 1064 914 730 565 116 23465 3204 ----
NM_194285chr1133433 2190 574 33292 1193 773 3903 188 26 --
NM_194314chr1145060 5000 4975 4926 4204 4135 3445 1951 1932 1006 891 488 319 112 25473 4908 14694 --
NM_194318chr1342024 1936 1712 585 --2576 320 12354
NM_198270chrX73016 2996 2468 2263 1064 863 376 22731 2663 1684 --
NM_198485chr392636 2066 1793 622 597 557 299 127 55 --2941 821 11684
NM_198581chr2116834 6807 6258 6215 5826 2903 1860 1848 1736 1339 1104 57163 7006 2992 2370 1964 22531 1085 17190
NM_198715chr1115014 4516 4276 2281 2208 2117 1622 1532 1451 864 152 --15437 --
NM_199005chr92866 75 11018 1143 21026 200
NM_199355chr1651488 1320 412 246 229 ----1710
NM_201263chr1102027 1765 1499 1459 695 629 433 329 55 23 --1119 --
NM_206853chr673880 3824 3493 3228 3020 1173 1036 --24115 2607 33245 1542 668
NM_207015chr362425 2279 1854 1677 628 573 --1260 11663
NM_207306chr1134458 3935 3580 3357 3065 1697 1140 960 888 748 676 604 532 14137 11806 --
NM_207406chr495570 5001 4055 1842 1487 1150 968 743 168 26188 702 1300 1146
NM_213606chr1052536 2306 1845 718 111 2709 652 --12511