TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-877-3p
miRNA Sequence: UCCUCUUCUCCCUCCUCCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr6126784 6562 5775 5254 5119 4714 1469 1287 919 817 357 215 12505 1837 --
NM_000368chr9154601 4440 4394 4233 4176 4141 3713 3605 3549 3113 3098 3042 1454 812 53 21582 463 53635 3615 3106 1087 835 --
NM_000599chr2144466 3755 3692 3659 3345 2964 1797 1647 1595 1477 1080 720 320 267 53728 1718 1709 288 276 33779 1600 438 14038
NM_000719chr12166613 6390 5892 5734 5457 5437 4936 4806 4515 4377 4128 951 812 647 439 294 45815 5076 1143 463 76596 4357 2435 2122 494 484 209 2492 207
NM_000793chr1454123 3896 905 671 621 44108 3670 897 713 24820 715 34596 1347 251
NM_000831chr1165824 5689 5582 5474 4982 4380 4202 3828 2333 1709 1668 1133 1036 784 720 643 2790 625 24775 1856 11854
NM_001001557chr882078 1576 1465 638 626 381 152 80 31890 796 254 --2372 90
NM_001005404chr1794013 1371 1305 1268 879 862 782 426 352 52746 1404 1033 990 388 31035 418 379 --
NM_001005473chr5125447 4954 1928 1913 1052 1032 1012 971 959 947 681 106 42467 1205 1076 137 ----
NM_001007023chr1454123 3896 905 671 621 44108 3670 897 713 24820 715 34596 1347 251
NM_001008701chr19112726 2528 2466 2438 2372 2355 2344 2216 1938 345 293 12426 62428 2258 2126 2072 278 73 21972 249
NM_001010891chr586094 6028 5571 5532 2197 1706 693 506 26452 869 14592 24729 536
NM_001013690chr1242504 2273 2130 128 --1643 4975 970 713 641
NM_001014797chr10128109 7341 7011 6936 6916 6118 5076 2868 2642 1131 877 525 26664 644 15329 --
NM_001017440chr7237502 7311 7298 7152 6985 6818 6721 6654 6448 6123 5301 5099 3184 3001 2377 2260 2135 1899 1289 1206 1136 453 362 15450 67746 5457 5407 2450 1808 480 13191
NM_001017995chr5124312 3961 3598 3338 3259 1941 1869 1078 828 683 398 149 1992 21536 997 11005
NM_001018111chr793737 2769 2690 1329 1292 800 490 97 78 12590 42582 1577 1049 327 1809
NM_001024455chrX52544 2419 1086 269 209 32507 885 448 11048 62163 900 897 894 876 586
NM_001025077chr1047518 6801 6468 5941 --1508 36862 5462 91
NM_001030007chr16123571 3423 3363 3307 2812 2565 1020 561 330 115 107 59 13271 11248 3962 334 130
NM_001031695chr22154822 4353 4311 4153 3456 2120 1908 1836 1500 1398 1168 1011 1000 454 353 65405 3659 3547 3538 2002 346 23686 333 1101
NM_001033087chr2092685 2676 2573 2563 2148 2024 845 774 645 13311 31126 476 75 21107 393
NM_001040152chr764456 4285 4177 3391 3126 306 --1782 31593 1590 1587
NM_001040429chr1352351 2231 2225 294 273 1287 13012 --
NM_001100108chr1127730 6509 6454 6254 5619 2709 2513 2167 2052 2028 1788 1581 78110 7747 7529 6563 2043 1922 1054 31143 197 47 16898
NM_001106chr386586 6236 3922 3123 2919 2088 2015 294 39747 3517 1073 38501 1828 1803 33813 640 471
NM_001128chr16123571 3423 3363 3307 2812 2565 1020 561 330 115 107 59 13271 11248 3962 334 130
NM_001271chr1572807 2628 2429 2160 2112 635 21 12057 --3949 536 265
NM_001543chr5114742 4613 4570 4557 4293 4144 3092 1363 475 414 275 33929 1711 534 74752 4681 4667 4573 3931 1633 1202 14663
NM_001609chr1063337 3211 3181 2811 1429 1237 22891 2844 11243 --
NM_001759chr12125211 5068 4100 3921 3802 3766 3730 3445 3366 1450 474 343 14493 13750 14241
NM_001969chr1463681 2554 2522 846 656 436 23420 3020 --23426 3423
NM_002035chr1883342 3310 2580 1420 1157 816 243 154 --1680 23847 1519
NM_002126chr1753899 3323 3155 1398 295 11521 12678 21526 1333
NM_002387chr561548 979 723 585 553 68 14426 23996 1398 295 92
NM_003034chr1287785 7450 6816 6270 6193 5839 1598 67 28013 7260 38015 6957 5864 15422
NM_003043chr3114291 3107 2683 1548 1451 895 877 815 630 597 586 23338 550 2693 250 14113
NM_003099chr15156293 5368 4838 4780 4739 4640 4271 4231 4191 4161 1992 1404 1020 987 688 35548 5322 651 36013 4972 4285 25502 4900
NM_003107chr671762 1629 948 504 356 88 24 11958 3821 718 260 5952 805 700 255 44
NM_004397chr1194153 3396 3094 1212 1119 687 433 297 156 21084 274 --23987 304
NM_004643chr14122 241 30 2174 144 --
NM_004992chrX248154 8040 7993 7986 7602 7565 7539 7296 7290 6125 5792 5737 5248 3215 2984 2594 2577 1592 1463 918 912 854 663 491 22849 385 68218 8195 6572 6564 2583 1421 1715
NM_004992chrX248154 8040 7993 7986 7602 7565 7539 7296 7290 6125 5792 5737 5248 3215 2984 2594 2577 1592 1463 918 912 854 663 491 22849 385 68218 8195 6572 6564 2583 1421 1715
NM_005076chr1164064 3764 3444 3225 1616 1482 1410 1338 1303 1166 1058 703 680 468 211 148 12798 33244 2787 302 --
NM_005197chr1455806 4284 4107 2306 866 11966 12309 41908 502 499 496
NM_005397chr793737 2769 2690 1329 1292 800 490 97 78 12590 42582 1577 1049 327 1809
NM_005819chr183493 2702 2556 2399 743 714 263 178 --22968 308 2193 54
NM_005840chrX117645 7478 7422 7365 6749 6335 5648 2733 2679 1233 85 37443 7236 6030 22021 77 --
NM_005910chr1782890 1595 1497 1278 797 761 646 616 --2344 332 3599 572 36
NM_005920chr173881 3462 3345 1522 801 779 40 23185 500 6934 792 782 323 283 206 13631
NM_005935chr494369 4361 4033 3890 3460 1504 1071 898 345 55291 5032 4272 1164 780 21601 206 34423 1264 737
NM_005937chr17164135 3462 2761 2608 1387 1377 997 890 644 589 487 434 263 173 143 100 33480 2667 1126 73678 3070 2931 2880 647 581 391 --
NM_006011chr1593957 2991 2785 1712 1601 825 665 652 489 --21276 492 2884 746
NM_006025chr124640 396 94 23 1818 2360 78 185
NM_006203chr535169 4833 2182 24375 459 --35205 5199 462
NM_006212chr185244 2096 1476 1086 1076 1025 893 633 14346 25178 560 2278 275
NM_006546chr17126368 4474 2590 2465 2358 2238 1946 1503 1311 1181 358 293 21930 1209 76332 5406 4707 4690 4182 1932 632 24070 946
NM_006599chr1687707 3303 3211 2909 1849 1801 688 534 16005 15208 22629 740
NM_006732chr194422 224 92 41 2171 77 --6258 68 65 62 59 56
NM_006902chr122614 2468 11008 13218 22686 319
NM_006924chr1743585 2723 1779 378 33560 1773 450 23120 1420 1460
NM_007050chr20177844 6993 6516 6298 6170 6099 5857 5702 2919 2636 1480 1385 1290 1067 853 556 400 26934 5445 22963 953 12034
NM_007249chr13127118 6263 6096 2881 2702 2585 2291 1364 999 922 783 237 27797 1497 28829 519 --
NM_012104chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_012104chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_012296chr11123689 2752 2672 2634 2600 2453 1259 958 708 520 336 28 22953 542 1609 23183 2933
NM_012316chr1115599 5142 4819 3896 1413 1293 1142 988 795 488 54 21214 307 24342 1027 33450 2094 224
NM_012384chr2052404 2104 1696 735 157 22267 131 --32270 1929 166
NM_013989chr1454123 3896 905 671 621 44108 3670 897 713 24820 715 34596 1347 251
NM_014240chr393849 3715 2815 2714 967 925 376 111 39 32551 1621 1208 42967 1447 338 102 1100
NM_014293chr22113805 3787 3569 3335 3077 3012 2591 1417 962 699 206 23512 2823 33894 3582 1627 33388 683 451
NM_014309chr22154812 4343 4301 4143 3446 2110 1898 1826 1490 1388 1158 1001 990 444 343 65395 3649 3537 3528 1992 336 23676 323 191
NM_014423chr544113 1753 805 765 22026 1745 24152 4047 13448
NM_014586chr21144665 4654 4437 4202 3823 3471 1559 961 810 795 755 591 408 195 --24643 3496 1544
NM_014630chr15113831 2756 2538 1565 1441 1315 1271 816 666 481 445 --21527 1114 11284
NM_014873chr134262 4079 3879 11005 11516 23510 270
NM_014909chr14173577 2846 2545 2514 1560 1551 1502 1479 1435 1392 1355 1309 1285 1204 610 123 111 11148 43001 1590 1158 660 --
NM_014921chr19112726 2528 2466 2438 2372 2355 2344 2216 1938 345 293 12426 62428 2258 2126 2072 278 73 21972 249
NM_014935chr193689 3447 3330 2907 1398 1078 828 786 716 43783 1389 937 843 63785 3413 2693 1208 1000 633 21392 428
NM_014974chr10------5144 138 135 132 126
NM_015035chr20156357 6295 6252 5977 5826 5442 4992 4489 2642 2255 1575 1424 575 124 61 15078 24588 1719 12272
NM_015068chr733308 3137 3029 11139 11184 41204 445 442 439
NM_015071chr5105934 5412 4346 3965 2364 1982 1823 1797 1381 224 35300 336 245 25651 531 12351
NM_015090chr1145488 5020 4889 4792 4500 4205 3955 2344 2302 2138 1679 1427 1065 218 34541 2039 1638 44469 3881 1615 45 24209 56
NM_015111chr5104024 3696 3500 3342 565 353 311 295 262 206 23643 1028 33647 882 135 2880 133
NM_015310chr8127478 7030 6960 6711 6399 5484 3180 2536 2349 2054 1375 782 37146 6688 687 1237 1235
NM_015313chr1164033 4025 3025 540 508 474 11923 --3836 523 520
NM_015315chr593135 2997 2819 2758 983 258 245 95 38 185 13011 23230 3009
NM_015332chr7113274 3154 3110 3101 2741 2349 1433 1357 983 912 823 1841 13082 3929 926 252
NM_015375chr1144965 4923 4488 4292 4093 4000 3814 3393 1249 867 689 657 291 169 33641 3581 671 --11639
NM_015852chr7162634 2410 1134 1050 966 882 798 714 630 546 462 378 294 210 126 42 --12682 --
NM_016206chr387139 3457 2519 2304 1577 1050 862 848 12911 --12245
NM_016263chr19143414 3200 3129 3051 2839 2786 2744 2692 2683 2635 2287 2273 1030 1021 22754 2383 73395 3206 3013 2886 2385 2189 1207 33204 801 732
NM_016834chr1782890 1595 1497 1278 797 761 646 616 --2344 332 3599 572 36
NM_016835chr1782890 1595 1497 1278 797 761 646 616 --2344 332 3599 572 36
NM_016841chr1782890 1595 1497 1278 797 761 646 616 --2344 332 3599 572 36
NM_016929chr673538 3151 1728 1715 1176 484 284 12802 --31755 1719 907
NM_017637chr9118541 7893 7819 7675 7640 7609 7600 7235 6063 1872 745 35868 1639 842 28785 1529 --
NM_018027chr1062527 2468 2089 734 448 269 2745 462 1553 2630 551
NM_018370chr1251768 1513 582 463 289 11615 1896 21985 1982
NM_018440chr8117956 7596 7438 6316 5864 2650 1429 938 628 173 65 --27166 127 16099
NM_018584chr121140 30 1169 --5184 181 178 175 172
NM_019072chr543988 3725 1169 398 ----23302 3299
NM_019116chr1693678 3252 3245 3191 2842 2652 2637 2346 1294 1944 33147 3029 60 23368 688
NM_020122chr265677 5070 3964 3947 1189 138 --13953 1284
NM_020182chr2033155 1276 754 22554 80 22835 466 43013 2894 506 71
NM_020443chr1126828 6624 6113 5597 5295 5060 4644 2369 2057 1201 621 121 44951 627 141 111 56911 2558 2334 2270 143 21099 129
NM_020956chr1994681 4388 4249 4160 3994 3896 3259 3143 2953 13531 104496 4304 4289 4172 4103 1253 1157 809 156 112 64284 4281 4278 4275 4272 4269
NM_020960chr9104931 3724 3070 3057 1847 1693 1467 462 453 387 ----2254 249
NM_021120chrX112748 2655 2386 2136 2004 1166 953 815 768 700 323 33079 1190 332 22583 2404 31193 791 335
NM_021813chr695391 5017 5002 4065 3891 3757 1896 1477 1167 34191 3839 2013 --21815 1812
NM_021960chr162720 1934 1757 993 191 170 22453 137 22486 2455 22484 262
NM_022062chr113526 494 434 21250 725 11255 41253 422 79 41
NM_022166chr1684320 3975 1985 1568 1421 1325 1311 673 24448 2184 65235 4838 4456 4127 2186 1460 34454 4451 4168
NM_022459chr133588 433 117 32061 1714 907 24221 160 2831 651
NM_022497chr383514 3156 2734 2599 2567 714 587 301 12581 2814 167 2265 165
NM_022648chr2103789 3610 3526 3476 3161 2922 1584 942 214 115 2414 93 73441 3191 3091 3081 915 141 40 --
NM_022716chr122458 2312 1852 13062 22530 163
NM_022758chr682915 2653 1290 1155 1135 785 469 69 23201 1208 23217 297 23017 139
NM_024294chr682915 2653 1290 1155 1135 785 469 69 23201 1208 23217 297 23017 139
NM_024408chr162934 2782 843 781 720 79 11452 --22462 729
NM_024770chr296572 6264 6254 5937 5794 5529 5237 1059 99 25549 1292 26109 1964 15425
NM_024947chr3127023 6944 3235 3199 2764 2702 2422 2409 2157 1612 575 427 19048 13248 13246
NM_025179chr1114641 4045 3179 3140 3047 1190 888 690 544 270 192 51740 1698 1563 804 601 63960 3373 1946 1259 133 30 13129
NM_030806chr1189086 8594 8378 7928 7886 6926 6919 6852 6796 6756 5772 2740 1847 1671 1526 1485 1236 932 47253 6826 3228 2666 ----
NM_030918chr1155335 5136 4952 4940 4773 4717 3954 3942 1747 1595 1553 1546 1532 910 411 23423 728 14202 14735
NM_031417chr19112669 2645 2610 2335 2039 821 693 638 542 530 334 12417 42243 2143 990 342 --
NM_031468chr7237502 7311 7298 7152 6985 6818 6721 6654 6448 6123 5301 5099 3184 3001 2377 2260 2135 1899 1289 1206 1136 453 362 15450 67746 5457 5407 2450 1808 480 13191
NM_032105chr1107454 7411 6869 6374 5956 5684 2843 2356 2222 1190 27487 1182 27489 7475 25734 2696
NM_032199chr1063157 2751 2356 1204 355 276 12522 23701 376 21242 1217
NM_032873chr1183768 3135 3097 1196 501 349 307 270 2729 359 34311 3787 3736 11556
NM_032932chr17126261 4899 4883 4751 2069 1758 1441 1424 1395 796 774 243 24153 525 75979 5010 1761 1736 1444 533 269 --
NM_033133chr17103507 3463 3429 3280 3158 3005 2863 2731 2519 33 --62737 2380 1425 1066 827 44 2472 40
NM_033551chr593135 2997 2819 2758 983 258 245 95 38 185 13011 23230 3009
NM_052906chr22215070 4638 4171 4025 4007 3631 3570 3220 1924 1322 1313 1157 1051 1011 910 823 539 513 403 337 61 14161 64650 4482 3713 2036 828 432 34645 3908 113
NM_080491chr11123689 2752 2672 2634 2600 2453 1259 958 708 520 336 28 22953 542 1609 23183 2933
NM_080669chr17154244 4234 4143 3436 3265 3248 3045 1450 587 520 495 480 324 309 241 44455 3772 1621 33 44069 1915 1266 312 --
NM_080676chr2092685 2676 2573 2563 2148 2024 845 774 645 13311 31126 476 75 21107 393
NM_133170chr20177844 6993 6516 6298 6170 6099 5857 5702 2919 2636 1480 1385 1290 1067 853 556 400 26934 5445 22963 953 12034
NM_133334chr4105556 5489 5435 5114 1871 1828 1763 1449 512 503 31846 646 426 22133 318 --
NM_138468chr255910 5593 5409 4206 2361 24046 1169 --2672 466
NM_138473chr1284787 4714 3809 3770 1524 1477 920 87 34274 4023 150 24185 136 21096 480
NM_138713chr1687707 3303 3211 2909 1849 1801 688 534 16005 15208 22629 740
NM_138714chr1687707 3303 3211 2909 1849 1801 688 534 16005 15208 22629 740
NM_138731chr1433895 3837 475 21111 669 --2883 880
NM_138971chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_138971chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_138972chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_138972chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_138973chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_138973chr1163146 2811 2765 963 777 416 1591 1601 22607 458
NM_139321chr2073160 2944 2765 1666 1470 1326 69 1983 53323 1431 1378 589 264 13818
NM_144599chr1574601 3697 1918 1625 1371 594 495 15301 23691 81 14506
NM_144973chr1284947 4917 4235 1795 1600 1214 1072 336 23340 996 24748 1001 21133 999
NM_145206chr1063013 2907 2507 2389 987 975 12031 12033 22500 339
NM_148955chr15156293 5368 4838 4780 4739 4640 4271 4231 4191 4161 1992 1404 1020 987 688 35548 5322 651 36013 4972 4285 25502 4900
NM_152734chr6115184 4536 4303 4190 4071 4029 2193 1881 1811 1719 1430 25218 57 33704 876 369 13555
NM_152826chr15156293 5368 4838 4780 4739 4640 4271 4231 4191 4161 1992 1404 1020 987 688 35548 5322 651 36013 4972 4285 25502 4900
NM_173214chr1687707 3303 3211 2909 1849 1801 688 534 16005 15208 22629 740
NM_173564chr76832 579 329 317 154 105 --4767 614 343 216 3765 214 211
NM_173642chr1138859 8628 8369 8087 7991 7722 6423 6352 6222 2259 2194 1619 1398 26598 3572 --23490 3487
NM_174911chr863877 3440 1317 1057 873 508 12822 12618 3180 174 32
NM_175624chr12117209 7176 6047 5437 3028 2628 1433 949 839 829 479 32872 1909 88 12732 15644
NM_175625chr12117209 7176 6047 5437 3028 2628 1433 949 839 829 479 32872 1909 88 12732 15644
NM_175736chr12127305 6492 5798 5700 3060 2909 2555 1478 997 782 600 235 66778 5754 2731 2671 519 334 22501 88 32677 2674 2445
NM_175910chr1991655 1543 942 860 697 613 529 193 109 11922 22197 1612 --
NM_181521chr16136751 6573 6296 6247 5530 5448 5250 2910 2064 1741 580 365 341 --25282 5272 15280
NM_183004chr1463681 2554 2522 846 656 436 23420 3020 --23426 3423
NM_194286chr12155732 5713 5592 4004 2416 2372 2295 1994 1285 817 666 574 461 376 152 45934 1494 705 473 44281 1162 736 144 1137
NM_198560chr383417 3064 3036 2820 2411 589 320 147 13022 63202 3024 2966 2651 1527 183 52649 2346 2343 179 151
NM_198900chr12127305 6492 5798 5700 3060 2909 2555 1478 997 782 600 235 66778 5754 2731 2671 519 334 22501 88 32677 2674 2445
NM_199169chr2033155 1276 754 22554 80 22835 466 43013 2894 506 71
NM_199170chr2033155 1276 754 22554 80 22835 466 43013 2894 506 71
NM_199171chr2033155 1276 754 22554 80 22835 466 43013 2894 506 71
NM_199462chr1144965 4923 4488 4292 4093 4000 3814 3393 1249 867 689 657 291 169 33641 3581 671 --11639
NM_206909chr8127478 7030 6960 6711 6399 5484 3180 2536 2349 2054 1375 782 37146 6688 687 1237 1235
NM_207380chr15123591 3473 3205 3159 3138 2809 2637 2620 1348 1068 690 580 33151 2693 612 43153 2529 2388 542 32696 538 39
NM_213589chr244757 3853 1676 1105 35039 1561 893 31218 582 295 1307