TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-877-5p
miRNA Sequence: GUAGAGGAGAUGGCGCAGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5162 11335 ----
NM_000021chr142899 36 --2886 799 --
NM_000024chr52447 213 ------
NM_000029chr1139 ----1130
NM_000037chr852277 2192 1660 923 159 --21918 139 --
NM_000038chr511323 12023 --1285
NM_000044chrX2171 56 1285 2109 85 --
NM_000051chr1181307 816 769 754 683 356 58 37 ------
NM_000052chrX73384 3320 2827 2360 1085 698 610 --32802 2515 2233 --
NM_000061chrX3153 131 33 ------
NM_000067chr8152 ----1687
NM_000068chr1951511 1495 1179 1142 259 ------
NM_000075chr123253 238 78 --1196 --
NM_000081chr121856 533 ------
NM_000084chrX226920 6682 6274 6164 6127 6011 5940 5859 5853 5821 5443 5411 5367 5250 4424 2097 1816 1634 1339 1047 907 177 1853 35564 2345 1498 1636
NM_000088chr1751155 1139 971 367 147 --11240 11177
NM_000089chr75704 660 105 64 50 ------
NM_000090chr23619 162 56 ------
NM_000092chr264478 3410 2920 2825 702 595 --2484 150 14472
NM_000093chr942275 2108 1747 952 --12131 --
NM_000104chr243026 2742 593 83 ------
NM_000109chrX2802 526 11809 32139 2029 594 --
NM_000110chr111047 1451 11000 --
NM_000112chr585189 5003 4906 4816 3701 1784 1634 131 33960 3471 3438 35483 3894 796 --
NM_000125chr6134022 3749 3680 3522 2704 1719 1599 1505 1220 690 513 181 174 1376 21632 1575 1439
NM_000129chr621364 973 11183 ----
NM_000133chrX51308 1258 504 353 126 --21322 511 11178
NM_000138chr1532449 2316 904 21996 1892 ----
NM_000141chr1031093 1035 967 ------
NM_000142chr461501 1355 1093 1086 564 367 ----11186
NM_000163chr511999 1623 ----
NM_000165chr631551 1144 1094 ------
NM_000167chrX41272 697 525 468 1297 ----
NM_000168chr7103322 3142 3036 2833 2575 2430 2374 2339 325 147 --1446 12650
NM_000170chr91479 ----1439
NM_000176chr533457 1099 344 42452 1515 1131 689 22474 535 --
NM_000178chr20251 28 --135 --
NM_000183chr22128 101 --1380 --
NM_000188chr10142 ------
NM_000192chr1241390 1340 623 596 ------
NM_000208chr19153987 3948 3553 3304 3030 1883 1877 1749 1396 1369 801 727 515 239 68 --153 11363
NM_000214chr2021543 675 ------
NM_000216chrX83828 3754 3288 3241 3093 2500 986 621 ----12675
NM_000217chr12114965 4937 3448 2076 1955 1659 1102 971 715 656 218 25042 4506 23595 1524 35230 958 679
NM_000220chr111987 137 ----
NM_000237chr841563 1444 754 273 11523 11226 --
NM_000238chr71152 ------
NM_000240chrX41937 838 670 419 --1629 --
NM_000245chr721967 823 167 --12149
NM_000248chr352621 2140 776 510 41 12663 --199
NM_000252chrX21382 147 1237 --1412
NM_000258chr31246 ------
NM_000259chr15165963 5042 5035 4926 4893 4815 4144 4073 2473 1992 1932 1457 1156 1011 692 652 --34021 3908 408 --
NM_000264chr983136 3092 2215 1263 1061 901 790 600 12916 32334 683 577 --
NM_000266chrX2936 204 ----1881
NM_000267chr1753320 3289 2814 1130 895 1721 1208 --
NM_000276chrX61910 793 646 449 408 237 --1155 12005
NM_000278chr1061647 1638 1628 1614 1567 1507 --11543 --
NM_000286chr171184 --1639 --
NM_000289chr123243 107 71 --1337 --
NM_000297chr481917 1887 1630 1616 1361 418 290 131 1721 ----
NM_000310chr161238 521 502 178 168 117 ------
NM_000314chr1073250 3010 2691 2680 2276 346 125 12916 ----
NM_000325chr42560 163 ------
NM_000328chrX1133 ------
NM_000332chr6136371 6213 6172 5800 5471 4949 4886 2760 1689 608 445 434 100 26084 4413 26433 291 --
NM_000333chr351047 1027 906 405 181 ------
NM_000337chr596493 6257 5813 5278 5179 4161 1092 1052 409 14964 1207 11153
NM_000340chr331358 1233 1138 ----1294
NM_000346chr1761978 1945 1588 1579 611 131 --2433 417 --
NM_000354chrX1244 ------
NM_000361chr2031660 456 396 --21664 134 --
NM_000362chr2283426 3141 2900 2887 2618 820 298 275 --23630 1105 --
NM_000367chr662178 1764 1566 1455 452 213 ------
NM_000368chr984495 3082 3014 875 712 313 289 133 ----14274
NM_000378chr111111 ------
NM_000379chr261270 1179 1172 376 352 26 ----1515
NM_000390chrX33447 1355 1166 ------
NM_000391chr1171667 1611 595 527 507 367 275 ------
NM_000393chr251764 1680 1583 744 360 --11325 --
NM_000399chr101818 ----1736
NM_000406chr482989 2685 1973 833 661 530 284 205 1222 12692 23054 720
NM_000408chr283423 2819 2745 2690 2124 1334 807 291 ----22528 2097
NM_000411chr2172956 2732 2163 1303 669 350 258 ------
NM_000428chr1492634 2298 1875 1697 897 885 845 573 154 ----11048
NM_000430chr1772531 2522 775 751 510 469 100 11349 138 --
NM_000435chr199864 807 719 276 260 100 82 66 58 --2880 183 --
NM_000439chr531566 765 113 --32437 1765 728 --
NM_000441chr772353 1745 1444 1433 334 137 22 --12127 --
NM_000447chr11431 ------
NM_000448chr1192156 1317 1009 759 637 559 435 81 48 --22114 1015 --
NM_000449chr131044 1019 473 2436 169 31319 945 118 --
NM_000460chr33494 419 379 ------
NM_000461chr354353 3100 1458 988 431 31701 1192 1159 1938 11764
NM_000462chr1531730 1391 1301 --1231 --
NM_000474chr72457 261 ----1531
NM_000476chr921083 192 11382 2433 301 11498
NM_000478chr15698 648 249 162 103 ------
NM_000484chr213432 292 218 123 ----
NM_000489chrX93217 3156 1222 1097 1081 794 694 687 206 1298 --22482 1058
NM_000492chr73473 467 99 --11120 --
NM_000493chr62426 385 ----149
NM_000500chr61153 --144 --
NM_000503chr881719 1557 1504 1384 1320 608 473 142 ------
NM_000522chr72158 136 ------
NM_000525chr1111324 --11503 --
NM_000530chr121091 245 --1713 --
NM_000533chrX6748 477 441 411 333 110 ----128
NM_000544chr6_cox_hap173262 3134 2934 1340 1109 913 27 --22624 985 --
NM_000555chrX187548 6961 6180 5932 5815 5692 5603 5528 5264 4938 2891 2206 1962 1357 1000 950 446 232 16944 45543 3026 785 179 --
NM_000575chr221148 408 --21042 79 --
NM_000578chr251513 1215 542 468 169 --31792 1726 1634 --
NM_000587chr561192 980 267 196 155 101 ------
NM_000594chr64726 628 86 52 ------
NM_000595chr62627 101 ------
NM_000599chr2154312 4104 3994 3981 3894 3496 3467 3238 3199 2837 1414 1025 909 609 156 1226 24275 571 1678
NM_000600chr72278 45 --190 --
NM_000603chr71294 1337 ----
NM_000609chr1092784 2489 2334 1239 961 648 533 453 319 --22143 856 1291
NM_000610chr1192818 2255 2218 2183 2108 2038 996 604 498 1294 12947 1790
NM_000615chr1142901 2417 2160 189 1153 1136 22505 2464
NM_000617chr1232149 1615 21 ------
NM_000618chr12105640 5301 4478 2614 2564 1906 806 510 349 49 16498 11741 --
NM_000618chr12105640 5301 4478 2614 2564 1906 806 510 349 49 16498 11741 --
NM_000621chr1321292 314 ------
NM_000627chr21903 ----2200 137
NM_000633chr1844198 4142 3623 3377 --24451 871 --
NM_000635chr1941581 1238 1048 363 21386 327 1293 --
NM_000680chr8176 ------
NM_000684chr1031249 500 232 --11118 --
NM_000685chr31176 1821 162 --
NM_000685chr31176 1821 162 --
NM_000686chrX51495 521 362 302 117 1435 --11359
NM_000706chr122829 637 ------
NM_000721chr152117 1989 1895 1838 32 --22705 2243 --
NM_000722chr7----1254 --
NM_000723chr1741543 1391 607 112 11559 ----
NM_000726chr221349 1062 ------
NM_000756chr82403 356 ------
NM_000759chr173536 105 34 ------
NM_000791chr532728 2144 144 143 ----
NM_000794chr52723 118 ------
NM_000795chr116951 920 896 866 377 109 --1324 --
NM_000800chr52362 212 31474 1441 140 ----
NM_000801chr204967 902 187 179 1699 ----
NM_000806chr531630 564 92 --134 --
NM_000809chr4208560 7411 7142 6837 6335 6153 5935 5609 3654 3223 2739 2305 1540 1530 1519 913 778 758 632 441 49275 9018 6512 3335 47062 5698 5631 2250 36969 6818 2233
NM_000813chr5105296 5011 4642 2079 1934 1772 1635 1166 528 372 23997 2042 13607 15053
NM_000814chr1563397 1312 1196 1155 560 523 12887 23844 1098 12699
NM_000816chr52493 172 --186 --
NM_000817chr24984 242 67 46 ------
NM_000818chr10177 1530 133 --
NM_000824chr42274 56 ------
NM_000826chr432498 2056 2015 --12405 12030
NM_000827chr561825 1803 1711 1698 1024 184 32115 1040 591 11028 1776
NM_000829chr1152044 1949 1941 733 104 ------
NM_000831chr1166234 5895 5861 5783 5626 5530 5267 5106 4392 1718 1633 972 764 553 526 205 35987 5113 727 25643 715 --
NM_000833chr1611282 ----1407
NM_000838chr642212 717 331 238 11055 11928 12190
NM_000842chr112654 638 --1205 --
NM_000844chr331068 803 353 ------
NM_000849chr173104 2986 2711 2233 2146 967 119 ------
NM_000860chr421690 1489 --21503 663 --
NM_000861chr382588 2484 2346 2236 1897 1732 719 572 --1999 --
NM_000868chrX72523 1716 963 295 283 275 60 ------
NM_000870chr561517 655 587 519 248 94 11199 --1155
NM_000872chr1051443 1321 1006 149 70 ----21367 1072
NM_000875chr15217025 6669 6467 5967 5743 5065 4632 4572 2392 1579 1498 1422 1399 1130 955 811 504 339 332 181 152 34783 2414 242 24898 2385 16420
NM_000876chr641396 943 376 86 1101 ----
NM_000891chr17113268 3255 2658 1278 1072 991 919 638 585 440 322 13140 12950 --
NM_000895chr12134 ------
NM_000899chr1263505 3371 3094 2719 1685 1546 ----21726 1689
NM_000901chr421702 564 1540 12571 --
NM_000903chr162598 290 127 11405 --
NM_000905chr71126 ------
NM_000914chr61138 1408 198 --
NM_000917chr101875 ------
NM_000919chr54519 239 62 55 ------
NM_000921chr12--1220 ----
NM_000927chr72576 421 ------
NM_000933chr203519 317 148 --190 21446 1387
NM_000935chr331071 1046 819 1262 --11136
NM_000938chr41139 ------
NM_000944chr452374 1813 1771 696 338 1103 11604 --
NM_000945chr292030 1862 1391 687 544 526 177 111 41 --21708 1402 --
NM_000949chr53718 650 118 --1301 --
NM_000958chr52973 481 ----11025
NM_000961chr2073668 2580 1360 953 667 441 35 ----13190
NM_000963chr152275 1863 762 714 101 1906 ----
NM_000965chr341060 386 257 248 ------
NM_000966chr1271046 1029 997 931 838 763 158 --1342 --
NM_000983chr151306 522 491 413 372 ------
NM_001001132chr2121339 264 ------
NM_001001323chr1242867 2789 2650 1945 --12136 12801
NM_001001331chr332478 2291 166 ------
NM_001001342chr1051425 1227 1042 984 324 11158 21011 560 --
NM_001001349chr1771471 1323 1107 1097 535 370 159 11556 11393 --
NM_001001389chr1192818 2255 2218 2183 2108 2038 996 604 498 1294 12947 1790
NM_001001390chr1192818 2255 2218 2183 2108 2038 996 604 498 1294 12947 1790
NM_001001391chr1192818 2255 2218 2183 2108 2038 996 604 498 1294 12947 1790
NM_001001392chr1192864 2301 2264 2229 2154 2084 1042 650 544 1340 12993 1836
NM_001001394chr23451 55 31 ------
NM_001001395chr1242235 937 768 757 --11130 --
NM_001001396chr1194090 3872 3682 3666 3540 3504 3139 2980 1513 1325 1192 1050 1016 868 615 576 418 296 259 33650 806 147 13447 13830
NM_001001419chr5104475 4302 4169 3732 1974 1932 1645 1624 1408 671 14795 --14603
NM_001001420chr5104475 4302 4169 3732 1974 1932 1645 1624 1408 671 14795 --14603
NM_001001433chr2073142 3118 2947 2722 2699 2559 2189 22669 1961 22650 486 22740 525
NM_001001438chr212365 134 ------
NM_001001481chr873046 2929 2740 2699 2546 2236 126 ----11093
NM_001001484chr1052474 959 847 176 148 --2856 595 --
NM_001001523chr12528 83 --1998 11330
NM_001001549chr792744 2568 1909 1795 830 782 733 551 209 --1712 --
NM_001001550chr792744 2568 1909 1795 830 782 733 551 209 --1712 --
NM_001001555chr792744 2568 1909 1795 830 782 733 551 209 --1712 --
NM_001001556chr1561137 556 495 421 409 158 --11571 --
NM_001001557chr841448 319 276 182 1877 ----
NM_001001664chr223786 430 ------
NM_001001665chr253387 2677 925 687 475 ----1378
NM_001001668chr19103988 3185 3158 3132 1192 985 674 480 129 23 14056 ----
NM_001001713chr211336 ------
NM_001001787chr12195 187 ------
NM_001001790chr92358 61 ------
NM_001001791chr1031546 1066 280 11481 ----
NM_001001924chr81683 11305 1466 --
NM_001001925chr81683 11305 1466 --
NM_001001931chr81683 11305 1466 --
NM_001001936chr1021140 480 ----21094 1001
NM_001001938chr983949 3440 3351 3339 3075 1563 1236 1095 43505 1415 969 537 11600 1319
NM_001001971chr1031237 1167 1094 21320 475 161 1517
NM_001001974chr1072298 1915 1814 861 62 49 31 ------
NM_001001994chrX1562 ------
NM_001001995chrX41515 1444 1391 148 ------
NM_001001996chrX1562 ------
NM_001002027chr17199 ------
NM_001002031chr12159 ------
NM_001002032chr17160 ------
NM_001002243chr22936 37 1880 ----
NM_001002255chr61293 --1123 --
NM_001002269chr91161 ------
NM_001002294chr12312 305 ------
NM_001002295chr103826 447 247 21116 945 ----
NM_001002296chr84356 175 98 80 ------
NM_001002814chr892665 2370 1445 1432 1124 776 693 654 644 2593 229 ----
NM_001002838chrX41208 403 239 80 ----11799
NM_001002843chr151387 ------
NM_001002860chr14144640 4597 4005 3992 3318 3214 2924 1880 1704 1496 1246 517 317 272 11231 34022 3545 1684 --
NM_001002876chr221408 ------
NM_001002909chr17101718 1642 1547 1491 750 378 323 274 228 207 11407 1336 --
NM_001003652chr18218412 8307 8247 8173 7879 7163 7082 6831 6415 6129 5709 5578 5335 2613 2444 2114 1618 1501 455 417 49 27666 1953 27308 6220 --
NM_001003665chr163552 2333 1394 1242 816 78 22506 2355 ----
NM_001003674chr18146560 6049 5946 5133 4710 4695 4546 2200 2025 1960 1745 1632 553 148 12637 22516 2315 --
NM_001003675chr18146560 6049 5946 5133 4710 4695 4546 2200 2025 1960 1745 1632 553 148 12637 22516 2315 --
NM_001003681chr2261911 1763 1486 1449 528 89 ------
NM_001003682chr14945 562 447 261 ------
NM_001003688chr44803 437 115 23 --11194 --
NM_001003694chr33572 85 44 ------
NM_001003712chr1254054 1119 1021 787 538 24069 2793 ----
NM_001003760chr652602 2265 1334 669 407 169 33398 818 347 --
NM_001003790chr83705 631 585 --3911 617 291 --
NM_001003791chr83705 631 585 --3911 617 291 --
NM_001003800chr973573 3134 2681 2284 1510 1220 820 ----1298
NM_001003805chr14167 149 ----
NM_001003809chr183342 317 271 --163 --
NM_001003810chr41346 1158 ----
NM_001003891chr223840 126 69 ------
NM_001003937chr281492 1430 1100 690 322 140 121 89 1250 ----
NM_001003940chr15113742 3638 2981 2940 2628 1253 1049 861 337 179 136 12825 12513 1651
NM_001003942chr15113742 3638 2981 2940 2628 1253 1049 861 337 179 136 12825 12513 1651
NM_001003943chr15113746 3642 2985 2944 2632 1257 1053 865 341 183 140 12829 12517 1655
NM_001004051chrX----1304 --
NM_001004125chr91782 ------
NM_001004127chr132635 127 --1820 --
NM_001004196chr321093 332 ------
NM_001004304chr12123074 3028 2280 1976 1252 1104 1014 928 816 772 553 63 ------
NM_001004317chr621640 1348 1664 31736 928 29 13705
NM_001004329chr1251006 380 347 290 155 11347 1494 --
NM_001004342chr1265351 5076 5014 4965 4747 4565 4024 3815 3755 2148 1992 1986 1483 1476 1423 1411 1032 979 846 782 771 752 721 715 699 669 24984 4827 1646 14623
NM_001004346chr421012 68 ------
NM_001004360chr241743 1410 434 283 ------
NM_001004419chr12124434 4252 4092 4048 3578 3533 3452 1507 1374 1327 847 521 --24104 4063 --
NM_001004720chr23669 243 104 --1960 --
NM_001004722chr23838 412 273 --11129 --
NM_001005158chr31389 ------
NM_001005159chr31389 ------
NM_001005207chr171222 ------
NM_001005217chr43448 362 63 ------
NM_001005266chr152486 210 ------
NM_001005267chr152486 210 ------
NM_001005268chr152486 210 ------
NM_001005269chr152486 210 ------
NM_001005271chr1761169 1126 1045 843 409 150 ------
NM_001005273chr1761169 1126 1045 843 409 150 ------
NM_001005290chr12562 35 1376 1405 --
NM_001005335chr192100 46 --154 --
NM_001005366chr122768 72 ----1775
NM_001005368chr102143 25 ----154
NM_001005375chrY2226 95 ------
NM_001005386chr262286 1882 851 605 445 351 --3688 459 50 1254
NM_001005404chr17134388 3752 3666 3658 3320 3241 3221 3082 2832 1078 757 541 223 23839 164 ----
NM_001005463chr1062091 1845 850 841 652 446 ------
NM_001005473chr596497 6306 5213 5187 4999 2372 2284 2110 222 24823 2439 1318 16350
NM_001005474chr331198 1149 184 11579 ----
NM_001005527chr351207 924 402 386 230 ------
NM_001005609chrX93478 3345 2376 1543 853 831 791 414 21 21077 70 13570 --
NM_001005612chrX3319 185 40 --1149 --
NM_001005732chr21--1641 ----
NM_001005733chr21--1598 ----
NM_001005739chr21243 1649 ----
NM_001005746chr221349 1062 ------
NM_001005747chr221349 1062 ------
NM_001005782chr22220 38 ------
NM_001005845chr831688 168 33 --1368 --
NM_001005849chr17----2151 120 --
NM_001006115chr382754 2239 1746 828 773 313 110 33 ------
NM_001006600chr512004 11814 ----
NM_001006605chr121116 947 ------
NM_001006605chr121116 947 ------
NM_001006610chr161860 --1769 1384
NM_001006612chrX2384 74 ------
NM_001006613chrX2384 74 ------
NM_001006614chrX2384 74 ------
NM_001006617chr961303 1264 1064 1045 911 393 ------
NM_001006619chr961303 1264 1064 1045 911 393 ------
NM_001006620chr961303 1264 1064 1045 911 393 ------
NM_001006621chr961303 1264 1064 1045 911 393 ------
NM_001006623chr241717 1694 361 238 1871 32278 753 133 1835
NM_001006636chr21366 ------
NM_001006641chr931328 1278 379 11781 ----
NM_001006642chr931328 1278 379 11781 ----
NM_001006643chr931328 1278 379 11781 ----
NM_001006656chr1961695 586 558 526 234 84 --11499 --
NM_001006657chr2102738 2304 2249 2109 1211 889 667 599 498 234 22566 1258 2581 461 --
NM_001006684chrX2589 407 ------
NM_001006938chrX179 150 2570 501 1591
NM_001006946chr241425 1307 180 125 --1528 11540
NM_001007024chr17134238 3926 3916 3734 3586 3091 1507 1310 1259 922 803 763 178 1481 21722 959 --
NM_001007025chr17134238 3926 3916 3734 3586 3091 1507 1310 1259 922 803 763 178 1481 21722 959 --
NM_001007067chr821059 999 --2674 257 1794
NM_001007068chr821059 999 --2674 257 1794
NM_001007069chr821059 999 --2674 257 1794
NM_001007070chr821059 999 --2674 257 1794
NM_001007097chr9134790 4076 4025 3881 3872 3838 3828 3821 3502 1357 892 323 266 --21680 1583 --
NM_001007098chr13318 299 243 --1193 --
NM_001007099chr12762 746 ------
NM_001007100chr12762 746 ------
NM_001007102chr661501 1467 1429 1177 619 357 ------
NM_001007156chr1571641 674 644 452 326 222 85 2145 56 ----
NM_001007214chr121859 1200 21576 119 ----
NM_001007226chr1721349 1261 1499 --11428
NM_001007227chr1721349 1261 1499 --11428
NM_001007228chr1721349 1261 1499 --11428
NM_001007229chr1721349 1261 1499 --11428
NM_001007230chr1721349 1261 1499 --11428
NM_001007237chr152736 2565 403 362 57 1940 12192 --
NM_001007245chr71184 ------
NM_001007246chr2131202 628 120 ------
NM_001007248chr193613 315 71 1822 1865 --
NM_001007255chr1254 24 ------
NM_001007464chr61120 ------
NM_001007466chr6115031 4463 3151 1841 1325 1186 1178 1048 310 302 170 24041 3859 1843 11329
NM_001007471chr92673 53 ------
NM_001007527chr5----188 --
NM_001007538chr1341561 1537 1169 106 --21750 26 --
NM_001007544chr11505 --134 --
NM_001007553chr131011 813 437 ------
NM_001007559chr181834 --1491 1839
NM_001007793chr101101 --125 --
NM_001007794chr12582 540 ------
NM_001008220chr563822 2629 2534 651 546 113 1397 23554 1036 --
NM_001008222chrX51335 1139 1002 536 426 1215 ----
NM_001008225chr71577 1185 174 --
NM_001008239chr18123719 3511 3394 2371 2354 1412 701 558 302 211 144 53 21019 873 21011 24 --
NM_001008272chr33291 95 55 ------
NM_001008273chr33291 95 55 ------
NM_001008388chr42816 134 ------
NM_001008391chr114581 211 177 159 1719 1284 --
NM_001008392chr3153390 3328 3224 3000 2820 2736 2709 2623 1344 1278 950 345 304 291 45 12325 ----
NM_001008408chr7136177 5944 5617 4824 3907 1665 1519 921 831 763 467 439 222 24926 4833 25309 3933 12237
NM_001008410chr262156 1946 1397 903 752 608 ----2831 809
NM_001008495chr831735 1514 826 --11520 22016 871
NM_001008528chr1741796 1359 1205 217 ------
NM_001008539chr8155302 5093 5065 4913 4235 4207 3975 3654 1981 1280 1099 1023 952 731 713 21270 833 --23398 1552
NM_001008541chr1081940 1866 1776 1716 759 326 320 95 --1535 --
NM_001008541chr1081940 1866 1776 1716 759 326 320 95 --1535 --
NM_001008660chr1121409 111 --1374 --
NM_001008701chr19132977 2897 2888 2847 2803 2740 1195 874 659 613 602 435 333 ------
NM_001008726chr14--21601 187 11733 --
NM_001008738chr522390 1032 1631 ----
NM_001008777chr172210 23 ------
NM_001008801chr1951794 1684 1678 1449 717 ------
NM_001008925chr473438 3124 2765 2737 2567 2328 59 --2656 416 1666
NM_001008938chr113388 370 173 ------
NM_001009185chr52623 567 --1161 --
NM_001009552chr81464 --1418 --
NM_001009554chr4134577 3889 3258 3222 3148 2973 2909 1830 1760 1502 1380 432 370 --33976 3432 457 --
NM_001009554chr4134577 3889 3258 3222 3148 2973 2909 1830 1760 1502 1380 432 370 --33976 3432 457 --
NM_001009566chr151063 961 529 222 178 ------
NM_001009569chr1041229 607 523 119 ------
NM_001009571chr771714 1569 1563 1114 654 235 190 --21572 1173 --
NM_001009880chr22124697 4561 4134 4007 3592 3335 1906 1563 1215 912 859 262 13157 11945 13857
NM_001009881chr12625 464 ------
NM_001009882chr12625 464 ------
NM_001009899chr3186436 5839 5393 5250 5214 5191 4981 4617 4500 4391 2056 1976 1963 1876 1733 870 546 131 24271 655 15295 22348 1239
NM_001009923chr201292 --1581 1692
NM_001009955chr13447 436 408 ------
NM_001009955chr13447 436 408 ------
NM_001009959chr262509 1962 869 853 658 598 --12469 11699
NM_001009960chr732553 2159 1788 1164 1772 --
NM_001009993chr2174388 4326 4277 3770 3749 3740 3662 3475 3057 2880 1662 1601 1580 969 818 790 99 13688 1940 --
NM_001010000chr1853483 3250 2523 839 283 12754 1687 --
NM_001010846chr1114004 3572 3513 3211 3141 3041 2878 1370 1303 911 30 31285 1212 667 1627 14634
NM_001010853chr643082 2528 590 512 13023 1477 1458
NM_001010854chr141182 ------
NM_001010861chr1112774 2741 2642 2487 2247 2057 1879 1826 712 373 341 12671 11719 --
NM_001010862chrX62683 2605 2599 2146 199 92 ------
NM_001010867chr1186273 5873 5799 5765 4866 4478 2340 2321 2276 2231 2063 1973 1964 1596 1218 964 635 61 15036 15950 --
NM_001010888chrX123739 3707 3494 3014 1865 1577 1298 1210 932 388 382 167 13326 24096 1632 43892 3800 3712 267
NM_001010891chr586505 6443 6261 5507 5036 2580 2130 1531 --11682 --
NM_001010895chr941999 1447 689 520 21779 168 ----
NM_001010908chr101644 1705 ----
NM_001010922chr194241 3989 3623 3050 2860 1654 1602 1547 1416 --23909 3331 11445
NM_001010924chr1051211 1199 925 456 51 1811 ----
NM_001010927chr61568 ------
NM_001010986chrX51982 1587 637 158 126 ------
NM_001011513chr484017 3782 3035 2931 1633 1250 1111 638 --13165 12905
NM_001011515chr421133 714 11041 ----
NM_001011516chr421133 714 11041 ----
NM_001011546chr20149 ------
NM_001011551chrX2428 379 1435 ----
NM_001011553chr7----1400 1759
NM_001011645chrX2171 56 1285 2109 85 --
NM_001011666chr7146093 5234 5044 4964 4732 4718 4710 1964 1790 1632 684 610 579 55 26005 5691 25869 4763 16125
NM_001011708chr2102763 2745 2712 2613 2243 1954 1126 1078 797 347 11792 22808 1175 12028
NM_001011713chr1441383 1163 638 609 ------
NM_001011885chr1511323 ------
NM_001012264chr148936 770 733 699 671 607 240 25 --1182 --
NM_001012333chr111320 ------
NM_001012334chr111320 ------
NM_001012393chr11165005 4655 4563 3532 2064 2042 1494 1349 1340 1309 955 946 890 733 597 292 1997 44848 2049 322 285 31708 1609 22
NM_001012398chr161895 1172 ----
NM_001012410chr32488 460 2164 70 ----
NM_001012420chr151984 --21110 734 22639 1020
NM_001012423chr151984 --21110 734 22639 1020
NM_001012426chr683148 3103 3078 1375 1174 1049 897 568 --43421 3201 2740 924 --
NM_001012427chr683148 3103 3078 1375 1174 1049 897 568 --43421 3201 2740 924 --
NM_001012642chr1571998 1790 1659 506 206 164 154 --12024 12108
NM_001012732chr431093 1007 904 ----147
NM_001012751chr1071745 1607 1578 1293 1260 708 425 --11317 --
NM_001012753chr1951107 900 479 127 27 ------
NM_001012755chrX105074 4569 4388 3629 3185 3179 1484 983 483 360 34686 4555 250 55080 4340 3198 1123 103 24077 286
NM_001012761chr592628 2565 2363 1875 1761 914 831 480 357 1824 12335 11034
NM_001012968chrX102687 2235 1937 1821 1758 949 814 664 488 329 --12714 11105
NM_001012977chrX81169 500 483 320 284 205 191 154 ------
NM_001012979chrX129 ------
NM_001012980chrX141 ----184
NM_001012989chrX2472 58 ------
NM_001013031chr1042621 453 402 244 33315 3202 486 11070 --
NM_001013415chr42599 311 11540 ----
NM_001013620chr12178277 7224 7204 6289 5912 5692 2361 2097 1899 1874 1736 1590 1573 1512 1024 1001 350 38388 6794 1257 23125 727 28362 710
NM_001013635chr1251157 1045 1013 861 286 1390 ----
NM_001013690chr12122396 2045 1740 1617 1541 776 655 501 461 406 395 386 --22372 2170 --
NM_001013699chr12------1465
NM_001013739chr73333 281 25 ------
NM_001014286chr13125 ------
NM_001014434chr12645 38 ----2192 101
NM_001014435chr163429 241 41 ------
NM_001014797chr10127916 7408 7232 7198 2177 1797 1145 509 500 368 275 200 --22260 1220 --
NM_001014809chr44879 683 341 325 2827 302 ----
NM_001014831chr193626 263 237 ------
NM_001014832chr193626 263 237 ------
NM_001014834chr193626 263 237 ------
NM_001014835chr193626 263 237 ------
NM_001015048chr1463068 2938 1195 930 240 52 22249 809 21144 593 11248
NM_001015049chr1463068 2938 1195 930 240 52 22249 809 21144 593 11248
NM_001015053chr1771271 1264 1119 569 266 191 22 --1130 --
NM_001015877chrX83078 3004 2246 1025 814 659 641 489 --1387 12158
NM_001015880chr1041651 1265 671 421 11551 ----
NM_001015887chr341518 1482 1403 1158 --1515 --
NM_001017365chr1153 ------
NM_001017366chr1153 ------
NM_001017367chr1153 ------
NM_001017368chr1772341 2204 2184 2165 1000 881 781 22306 1795 12094 --
NM_001017369chr42874 98 1136 ----
NM_001017371chr211074 ------
NM_001017392chr1931207 218 170 1991 1336 --
NM_001017395chr393221 3075 2855 2490 1353 1051 1014 899 34 22819 678 12714 22782 268
NM_001017396chr251877 1487 765 707 436 --11983 --
NM_001017415chr12563 120 ------
NM_001017416chr12563 120 ------
NM_001017424chr13556 506 270 1742 21505 49 --
NM_001017425chr13556 506 270 1742 21505 49 --
NM_001017440chr7187988 7559 6700 6250 5701 5648 5471 2511 2491 2343 1855 1741 1691 1555 1409 1169 1013 795 27339 7227 12578 46835 6572 6241 5911
NM_001017523chr1251896 1586 1478 1323 122 ------
NM_001017916chr17122042 1882 1712 1508 1404 1390 813 679 617 603 178 39 --1168 11572
NM_001017917chr17122042 1882 1712 1508 1404 1390 813 679 617 603 178 39 --1168 11572
NM_001017924chr1071398 1182 1119 956 880 383 60 147 ----
NM_001017926chr831819 1762 395 ----21242 272
NM_001017962chr101875 ------
NM_001017963chr141898 ----150
NM_001017973chr5174 ------
NM_001017974chr5174 ------
NM_001017999chr182153 2099 1961 1835 1747 646 391 201 1152 12024 --
NM_001017999chr182153 2099 1961 1835 1747 646 391 201 1152 12024 --
NM_001018000chr182153 2099 1961 1835 1747 646 391 201 1152 12024 --
NM_001018000chr182153 2099 1961 1835 1747 646 391 201 1152 12024 --
NM_001018001chr182153 2099 1961 1835 1747 646 391 201 1152 12024 --
NM_001018025chrX4693 335 254 35 ------
NM_001018037chr941407 1300 539 320 ------
NM_001018053chr171902 1800 1544 1261 548 520 334 ----1670
NM_001018054chr121246 1229 --11258 11070
NM_001018057chr1161416 1363 558 272 124 103 2929 358 ----
NM_001018064chr982140 1803 1678 821 627 535 241 214 ------
NM_001018065chr9155905 5685 5443 5433 5080 4728 4475 4015 3981 3961 3875 3739 572 544 420 23858 689 14778 --
NM_001018066chr9155905 5685 5443 5433 5080 4728 4475 4015 3981 3961 3875 3739 572 544 420 23858 689 14778 --
NM_001018067chr184889 4830 4511 4331 2109 1247 1170 31 35235 4725 1541 ----
NM_001018068chr184889 4830 4511 4331 2109 1247 1170 31 35235 4725 1541 ----
NM_001018069chr184889 4830 4511 4331 2109 1247 1170 31 35235 4725 1541 ----
NM_001018072chr1251896 1586 1478 1323 122 ------
NM_001018074chr533457 1099 344 42452 1515 1131 689 22474 535 --
NM_001018075chr533457 1099 344 42452 1515 1131 689 22474 535 --
NM_001018076chr533457 1099 344 42452 1515 1131 689 22474 535 --
NM_001018077chr533457 1099 344 42452 1515 1131 689 22474 535 --
NM_001018091chr1562901 2895 2183 694 652 433 12550 12339 1100
NM_001018108chr156861 783 774 687 530 417 --1789 1472
NM_001018111chr7123599 3526 3068 2529 2519 1435 1400 976 912 654 594 189 --13589 --
NM_001018837chr12164 33 ------
NM_001023560chr641038 145 138 132 21091 846 ----
NM_001023567chr1521787 992 --1212 --
NM_001023587chr33845 199 48 --1987 --
NM_001024024chr142763 168 ------
NM_001024070chr142759 164 ------
NM_001024094chr533457 1099 344 42452 1515 1131 689 22474 535 --
NM_001024218chr141230 ------
NM_001024226chr15984 936 916 37 28 ------
NM_001024227chr15984 936 916 37 28 ------
NM_001024228chr15984 936 916 37 28 ------
NM_001024401chr1662843 2449 2071 2063 1897 949 12564 12270 12884
NM_001024455chrX92692 2454 2409 1903 1653 968 767 389 327 ------
NM_001024463chr153401 257 102 --2850 739 --
NM_001024465chr6------162
NM_001024596chr1963608 3240 2447 1332 302 73 21124 880 12564 --
NM_001024601chr1136 ------
NM_001024649chr542960 1019 458 34 --21925 917 --
NM_001024660chr351523 1311 1217 1117 108 ------
NM_001024666chrX1448 ------
NM_001024668chr124794 723 280 176 ------
NM_001024680chr271669 1521 1466 1386 1367 1279 1165 ------
NM_001024736chr1581402 1384 1244 588 571 516 328 49 11485 11066 1247
NM_001024808chr1292206 2019 1904 982 892 822 479 445 86 1209 22637 321 --
NM_001024847chr382113 1979 1643 1587 952 932 612 499 ----11532
NM_001024855chr331904 1435 155 ------
NM_001024858chr1472759 2417 747 682 303 284 71 --21994 240 --
NM_001024934chr62473 47 ------
NM_001024935chr62473 47 ------
NM_001024936chr62473 47 ------
NM_001024937chr173589 197 180 1145 1593 --
NM_001024948chr143488 3146 946 337 --1430 --
NM_001025076chr10155927 5048 4905 4843 4803 4691 4385 4339 4272 3958 3830 2325 2214 1288 503 21969 1410 24981 4044 45525 5240 2453 1546
NM_001025077chr10197285 6406 6263 6201 6161 6049 5743 5697 5630 5316 5188 2646 1861 1225 1051 980 949 272 249 12768 26339 5402 36883 6598 2904
NM_001025079chr3183727 3501 3445 3357 3143 3134 2707 2677 2654 2556 2545 2525 1451 1309 782 700 328 321 --13539 1909
NM_001025081chr1851327 1181 1144 478 455 ------
NM_001025090chr1851327 1181 1144 478 455 ------
NM_001025092chr1851327 1181 1144 478 455 ------
NM_001025101chr1851327 1181 1144 478 455 ------
NM_001025105chr561413 1389 1380 1022 984 197 ------
NM_001025107chr192436 2153 2048 855 499 446 337 302 104 12335 32537 1754 1671 --
NM_001025107chr192436 2153 2048 855 499 446 337 302 104 12335 32537 1754 1671 --
NM_001025108chr262965 2684 1270 1192 1079 878 --13315 1634
NM_001025201chr22526 516 ----1530
NM_001025202chr73333 281 25 ------
NM_001025233chr1272432 2282 2042 1849 1813 941 423 21913 489 ----
NM_001025252chr882671 2271 630 424 371 193 173 125 --2358 214 --
NM_001025253chr882671 2271 630 424 371 193 173 125 --2358 214 --
NM_001025266chr3174836 4726 4666 4397 4310 3558 3359 3044 1662 1653 1568 1402 1341 1275 1052 157 69 14021 --13363
NM_001025356chr1262550 2239 2189 2025 2011 1965 1296 1369 --
NM_001025366chr661805 1709 1519 699 603 401 ------
NM_001025366chr661805 1709 1519 699 603 401 ------
NM_001025367chr661805 1709 1519 699 603 401 ------
NM_001025367chr661805 1709 1519 699 603 401 ------
NM_001025368chr661805 1709 1519 699 603 401 ------
NM_001025368chr661805 1709 1519 699 603 401 ------
NM_001025369chr661821 1725 1535 715 619 417 ------
NM_001025369chr661821 1725 1535 715 619 417 ------
NM_001025370chr661805 1709 1519 699 603 401 ------
NM_001025370chr661805 1709 1519 699 603 401 ------
NM_001025579chr174972 863 750 289 --21131 467 --
NM_001025580chrX64027 3632 3196 3028 1700 398 34303 3850 2618 13719 --
NM_001025595chr451650 1386 1118 237 223 ------
NM_001025596chr114537 471 127 38 ------
NM_001025603chr131044 1019 473 2436 169 31319 945 118 --
NM_001025780chr92995 34 ----1582
NM_001029858chr672720 2534 2224 2154 2117 998 507 12189 3942 621 540 --
NM_001029863chr662629 2174 2144 1158 1129 105 11307 1803 --
NM_001029871chr20121805 709 568 329 316 271 241 208 132 113 100 73 11828 4741 395 184 94 --
NM_001029875chr582705 2594 2457 2235 2027 1922 1172 528 ----12137
NM_001029955chr483366 2722 1102 569 487 366 233 209 ------
NM_001029976chr84150 75 53 42 ------
NM_001029989chr152819 359 1693 ----
NM_001029998chr421350 1338 ------
NM_001030006chr1752156 772 696 614 538 --22626 2417 --
NM_001030007chr1683805 3156 2983 2542 2470 411 235 183 31115 857 834 13721 --
NM_001030019chr7159 ------
NM_001030055chr1433209 1179 125 ------
NM_001030272chr11----1436 --
NM_001030273chr11----1436 --
NM_001030287chr12869 100 ------
NM_001031677chr52407 65 ------
NM_001031679chr1262427 2228 1247 786 639 132 12243 22853 360 --
NM_001031684chr2121 --21211 959 --
NM_001031690chr792827 2571 2461 2391 2116 983 450 411 132 ----1963
NM_001031694chr13697 618 255 --154 --
NM_001031694chr13697 618 255 --154 --
NM_001031695chr22185076 4926 4712 4465 4458 4043 3918 3851 3609 3479 1869 1512 1230 825 815 619 599 488 25191 207 41516 1422 1245 481 2832 193
NM_001031700chr4112311 1848 1831 1825 1751 1745 1723 1708 713 635 457 ----1229
NM_001031702chr34756 748 596 93 ----1653
NM_001031710chr7--1925 ----
NM_001031711chr551234 1225 734 728 70 11769 1492 --
NM_001031716chr23324 310 112 1253 199 --
NM_001031723chr4------1161
NM_001031732chr483641 3609 3038 2442 1298 1077 948 332 13587 ----
NM_001031738chr2154 --1457 --
NM_001031804chr16104420 4213 4171 3644 2858 2765 1033 1022 635 439 14124 23522 2995 --
NM_001031812chr541879 557 310 194 ----1183
NM_001031855chrX159 ------
NM_001032221chr951657 1441 1350 162 81 ------
NM_001032280chr661338 1194 1177 1062 636 604 ------
NM_001032282chr841091 920 487 242 ----1368
NM_001032283chr1221096 408 ------
NM_001032284chr1221096 408 ------
NM_001032289chrX3334 193 101 1111 ----
NM_001032296chr1392567 2278 2266 912 754 574 393 59 35 --12805 12853
NM_001032363chr162116 1592 1557 1542 179 93 1788 11535 --
NM_001032363chr162116 1592 1557 1542 179 93 1788 11535 --
NM_001032380chr1031308 493 443 11980 11482 --
NM_001032393chrX3779 171 148 ------
NM_001032394chr672637 1939 1023 945 931 534 84 ------
NM_001032395chr662504 1806 890 812 798 401 ------
NM_001032999chr20164117 3800 3494 3430 3300 3286 1729 1720 1444 1167 957 913 801 528 258 201 12046 ----
NM_001033025chr181252 1228 1216 1201 359 202 140 112 --11524 --
NM_001033044chr151786 1328 1203 349 206 21665 1414 ----
NM_001033045chr274075 3492 3169 2730 1776 460 120 --1262 --
NM_001033047chr462348 2275 2174 885 64 44 --12459 --
NM_001033056chr151786 1328 1203 349 206 21665 1414 ----
NM_001033057chr342041 1832 332 26 --1366 11752
NM_001033059chr662006 1442 639 409 223 206 ----11504
NM_001033081chr181587 1302 685 661 581 467 226 71 11360 --21926 700
NM_001033082chr181587 1302 685 661 581 467 226 71 11360 --21926 700
NM_001033087chr2062894 2730 2435 2157 1323 270 13209 22696 124 1204
NM_001033112chr5--1612 ----
NM_001033117chr3174789 4686 4483 4438 4302 4290 4043 3927 3885 3869 3658 3497 1613 1480 491 331 318 --24853 4805 14309
NM_001033506chr111331 --127 --
NM_001033557chr221296 38 ------
NM_001033561chr175828 797 785 774 168 ------
NM_001033564chr64799 791 392 97 11280 ----
NM_001033576chr1792741 2655 2516 1739 1727 763 575 160 144 12267 --11790
NM_001033578chr82709 61 1305 22171 148 1956
NM_001033581chr1--145 ----
NM_001033581chr1--145 ----
NM_001033582chr1--145 ----
NM_001033659chr1741457 1443 568 157 ------
NM_001033723chr852478 2181 1989 951 797 --11973 --
NM_001033756chr661739 1643 1453 633 537 335 ------
NM_001033756chr661739 1643 1453 633 537 335 ------
NM_001033910chr141759 1731 278 212 1547 ----
NM_001033925chr1031875 1751 128 --2545 165 --
NM_001033953chr112131 45 ------
NM_001034025chr123882 665 216 --155 --
NM_001034837chr55624 292 207 200 136 ----1661
NM_001034838chr55624 292 207 200 136 ----1661
NM_001034845chr41462 ------
NM_001034850chr531308 1302 666 --11521 11058
NM_001034852chr1452044 1460 416 409 234 ------
NM_001034853chrX1961 3796 753 397 ----
NM_001035chr151217 1196 311 292 65 122 ----
NM_001035003chr42910 186 ------
NM_001035004chr42910 186 ------
NM_001035005chr182649 207 ------
NM_001035254chr982459 2256 962 896 394 334 94 40 --22509 2397 1231
NM_001035260chr101455 11158 2488 216 --
NM_001035511chr162035 1757 770 717 343 166 --21849 1470 --
NM_001035512chr172142 1864 877 824 450 273 114 --21956 1577 --
NM_001035513chr172142 1864 877 824 450 273 114 --21956 1577 --
NM_001035521chr23793 695 119 --2796 670 --
NM_001037131chr241005 440 409 219 ------
NM_001037132chr732139 2034 1889 --3448 283 34 --
NM_001037133chr732139 2034 1889 --3448 283 34 --
NM_001037164chr751289 608 476 199 41 ------
NM_001037165chr7168929 8108 7901 7666 7580 7280 5619 5530 3132 2474 2274 2192 1769 1554 271 245 17718 36599 5536 3017 16564
NM_001037172chr341366 1337 310 65 ------
NM_001037174chr261900 834 614 603 356 248 --11825 --
NM_001037317chr1112774 2741 2642 2487 2247 2057 1879 1826 712 373 341 12671 11719 --
NM_001037334chr183898 792 426 ------
NM_001037339chr161624 1461 1238 675 470 370 1612 ----
NM_001037340chr161624 1461 1238 675 470 370 1612 ----
NM_001037341chr161624 1461 1238 675 470 370 1612 ----
NM_001037341chr161624 1461 1238 675 470 370 1612 ----
NM_001037494chr121242 ----1260
NM_001037495chr121242 ----1260
NM_001037533chr11255 --2260 222 --
NM_001037535chrX41472 522 84 38 --1539 --
NM_001037536chrX41472 522 84 38 --1539 --
NM_001037540chrX41472 522 84 38 --1539 --
NM_001037553chr21115157 4448 3463 3396 3309 3294 978 929 753 384 310 --13572 --
NM_001037637chr5--1116 ----
NM_001037738chr51198 --1111 --
NM_001037872chr21646 1464 ----
NM_001037954chr11113272 3096 2989 2774 2518 892 719 678 649 310 154 12573 ----
NM_001038493chr21571 --11478 --
NM_001038640chr15----2280 44 187
NM_001038702chr532787 1879 1795 12513 ----
NM_001038707chr192231 2213 1447 829 682 649 614 175 166 1608 1294 12245
NM_001038707chr192231 2213 1447 829 682 649 614 175 166 1608 1294 12245
NM_001039350chr751384 1261 1226 692 389 ------
NM_001039459chr76840 473 461 308 141 95 1817 ----
NM_001039479chr1472044 1617 1554 970 471 379 277 1572 1895 --
NM_001039538chr263574 2811 2715 2559 922 795 --13217 11334
NM_001039547chr3248006 7487 6982 6779 6447 6385 6166 5872 5819 5592 5007 2914 2607 2441 2012 1667 1498 1329 1298 1071 946 819 297 291 --37271 591 226 --
NM_001039569chr283002 2889 2359 2341 2291 2275 1245 970 1897 1769 --
NM_001039570chr2284240 2842 1464 873 692 108 101 78 --24094 403 --
NM_001039571chr2284240 2842 1464 873 692 108 101 78 --24094 403 --
NM_001039574chr15935 883 691 684 283 ------
NM_001039577chr153522 1643 1501 282 148 21092 241 23959 176 --
NM_001039580chr4124507 4501 3913 3818 3527 1362 1324 1303 1121 1110 922 381 23282 657 11442 --
NM_001039583chr222514 481 --1132 --
NM_001039584chr222514 481 --1132 --
NM_001039585chr173475 3463 1231 966 789 569 124 12761 21636 98 --
NM_001039590chrX43574 2944 1524 1163 1534 1401 11020
NM_001039591chrX43574 2944 1524 1163 1534 1401 11020
NM_001039618chr1175080 4817 3902 3771 1108 540 482 35820 5318 2092 15016 --
NM_001039690chr1672202 1975 1715 576 422 211 169 --12048 --
NM_001039709chr20164117 3800 3494 3430 3300 3286 1729 1720 1444 1167 957 913 801 528 258 201 12046 ----
NM_001039711chr161053 886 841 233 198 48 --179 --
NM_001039712chr161053 886 841 233 198 48 --179 --
NM_001039762chr1032251 1948 642 2728 545 11745 --
NM_001039772chr11163 ------
NM_001039802chr141234 1191 1039 431 ------
NM_001039840chrX115066 4324 4016 2376 2342 1726 1693 962 841 126 84 35260 1810 1720 44590 1677 1278 1182 13729
NM_001039888chr13791 727 560 1523 ----
NM_001039916chr1261012 170 156 124 83 53 1259 11040 --
NM_001039917chr1261012 170 156 124 83 53 1259 11040 --
NM_001039918chr1261012 170 156 124 83 53 1259 11040 --
NM_001039919chr1261012 170 156 124 83 53 1259 11040 --
NM_001039920chr1261012 170 156 124 83 53 1259 11040 --
NM_001039937chr13123874 3680 2930 2860 2736 2704 2620 1586 951 332 139 38 21073 318 1862 --
NM_001039960chr1281750 1321 1255 445 332 322 269 249 1623 11264 --
NM_001040001chr682064 1510 1376 1324 1272 652 557 333 --1484 --
NM_001040056chr162319 37 ------
NM_001040057chr71203 ------
NM_001040092chr81352 ----1160
NM_001040101chr4--21322 617 21175 252 --
NM_001040108chr14103311 2586 2540 2469 2412 2323 2110 1255 574 475 23187 54 2553 532 --
NM_001040110chr711753 ------
NM_001040113chr16140 ------
NM_001040142chr242014 950 918 159 --1523 --
NM_001040143chr242014 950 918 159 --1523 --
NM_001040144chr1672202 1975 1715 576 422 211 169 --12048 --
NM_001040146chr1672202 1975 1715 576 422 211 169 --12048 --
NM_001040147chr18199 --1708 --
NM_001040151chr11174421 4155 3996 3769 3589 3271 3090 2996 2932 2904 2893 2884 1843 1080 824 363 203 44215 640 179 165 23027 1456 --
NM_001040152chr765095 5078 4754 3798 1705 1270 35059 4912 3221 --23853 192
NM_001040157chr442641 767 568 248 12341 12891 --
NM_001040159chr4176 ------
NM_001040167chr741187 1104 379 224 ------
NM_001040172chr561517 655 587 519 248 94 11199 --1155
NM_001040173chr561517 655 587 519 248 94 11199 --1155
NM_001040202chr432052 554 104 --1539 --
NM_001040214chr672312 1883 837 418 369 207 138 --2622 347 --
NM_001040260chr441029 783 433 54 ----11100
NM_001040261chr441029 783 433 54 ----11100
NM_001040272chr951664 476 456 447 178 --1551 12347
NM_001040273chr1052097 1841 1831 424 359 11825 12110 --
NM_001040284chr1685909 5273 4638 4591 4387 1311 934 27 1750 --11065
NM_001040402chr492900 2798 2633 2572 918 793 782 179 97 --22916 805 12461
NM_001040429chr13102957 2909 2896 2726 2530 2384 2259 1204 477 43 23513 3203 ----
NM_001040439chr163568 542 410 ----1103
NM_001040440chr51178 ------
NM_001040441chr1114567 4141 3969 2055 1745 1562 1279 1266 890 269 249 23728 765 15121 --
NM_001040446chr542096 962 720 356 --1834 --
NM_001040450chr1582759 2348 2305 2285 2032 1146 558 335 --11846 --
NM_001040453chr1582759 2348 2305 2285 2032 1146 558 335 --11846 --
NM_001040455chr1171212 983 483 289 255 194 47 11029 ----
NM_001040458chr52702 271 135 ----
NM_001040619chr171319 550 237 224 131 70 49 --11184 --
NM_001040624chr842082 2071 475 56 --12451 --
NM_001040625chr842082 2071 475 56 --12451 --
NM_001040626chr842082 2071 475 56 --12451 --
NM_001040627chr842082 2071 475 56 --12451 --
NM_001040628chr842082 2071 475 56 --12451 --
NM_001040629chr842082 2071 475 56 --12451 --
NM_001040630chr842082 2071 475 56 --12451 --
NM_001040653chr392568 2523 1926 1750 319 274 240 76 39 ------
NM_001040665chr794855 4451 4249 1895 1727 1451 1199 511 64 23957 766 13091 13515
NM_001040666chr72557 153 ------
NM_001040708chr831133 1030 972 ------
NM_001040709chr1142281 2194 2133 2126 1921 1898 973 948 898 558 548 431 302 74 --1736 --
NM_001040712chr983256 3209 2990 2526 1304 807 101 61 23467 2290 ----
NM_001042353chr203408 395 389 --182 --
NM_001042355chr16124929 4671 4305 4220 3923 2144 1871 1161 904 503 367 139 --34310 3651 822 --
NM_001042388chr182846 109 ------
NM_001042403chr12----1289 --
NM_001042404chr12173 124 ------
NM_001042406chr64903 809 437 128 ----11164
NM_001042412chr16124929 4671 4305 4220 3923 2144 1871 1161 904 503 367 139 --34310 3651 822 --
NM_001042413chr983732 1331 1102 761 567 529 199 193 12929 14071 --
NM_001042414chr13154 ------
NM_001042425chr661338 1194 1177 1062 636 604 ------
NM_001042437chr21806 1637 ----
NM_001042453chrX21368 658 --1535 --
NM_001042459chr3156 ------
NM_001042473chr1031907 767 220 ------
NM_001042475chr61314 ------
NM_001042476chr1651971 1827 1795 1785 1634 ------
NM_001042481chr1462566 2503 2179 658 446 94 ------
NM_001042486chr2061510 1389 1218 462 412 249 11175 11532 --
NM_001042492chr1753320 3289 2814 1130 895 1721 1208 --
NM_001042494chr1583807 3578 3344 2588 899 753 660 576 --22701 823 11334
NM_001042495chr1583807 3578 3344 2588 899 753 660 576 --22701 823 11334
NM_001042496chr1583807 3578 3344 2588 899 753 660 576 --22701 823 11334
NM_001042497chr1583807 3578 3344 2588 899 753 660 576 --22701 823 11334
NM_001042506chrX81179 500 483 320 284 205 191 154 ----11463
NM_001042510chr842110 1499 1347 432 1580 141 --
NM_001042511chr842110 1499 1347 432 1580 141 --
NM_001042533chr333068 2648 1053 12746 12669 --
NM_001042537chrX52327 2027 497 435 303 ----22034 184
NM_001042539chr1631070 365 240 ------
NM_001042550chr951638 1425 669 615 124 ------
NM_001042555chr1294287 4277 4136 1894 1295 897 554 535 93 --24160 463 23973 1569
NM_001042599chr2247709 7618 7587 7574 7433 6439 6292 5755 5562 5452 5442 5304 5040 4788 4749 2828 2548 2446 1524 964 352 224 84 68 15163 56133 5367 1959 870 679 12165
NM_001042601chr333017 357 139 12845 --13299
NM_001042603chr12154776 3913 3898 1949 1785 1738 1570 1562 1542 1432 1202 1088 238 205 146 --21825 176 --
NM_001042604chr3114321 4313 3929 3754 3618 3003 1870 1383 1073 467 32 1544 --1792
NM_001042635chr14--150 ----
NM_001042646chr381671 763 732 318 306 106 97 48 ------
NM_001042681chr152616 2159 1872 1788 991 1689 12429 22196 106
NM_001042682chr152616 2159 1872 1788 991 1689 12429 22196 106
NM_001042682chr152616 2159 1872 1788 991 1689 12429 22196 106
NM_001042683chr641730 1153 582 169 ------
NM_001042728chr1271046 1029 997 931 838 763 158 --1342 --
NM_001042749chrX31919 388 347 --1627 2727 103
NM_001042750chrX31919 388 347 --1627 2727 103
NM_001042751chrX31919 388 347 --1627 2727 103
NM_001042762chr73936 878 43 ------
NM_001043318chr14114138 3946 3884 3536 3473 2511 1596 1384 1014 969 798 23783 3743 --12946
NM_001043351chr142132 882 707 123 3683 83 39 ----
NM_001044305chr651648 1392 1279 640 284 1350 ----
NM_001044385chr254070 3874 3668 3582 2742 --1781 --
NM_001044387chr1984164 4072 3117 2583 1515 1322 854 693 1917 ----
NM_001044388chr1984164 4072 3117 2583 1515 1322 854 693 1917 ----
NM_001044722chr541879 557 310 194 ----1183
NM_001044723chr541879 557 310 194 ----1183
NM_001046chr572810 752 463 370 321 255 219 1678 1974 --
NM_001049chr1472354 1860 1561 770 331 325 302 12424 --1291
NM_001050chr1741066 1019 385 104 ------
NM_001068chr3258 50 ------
NM_001069chr6------1140
NM_001071775chr1311478 11208 ----
NM_001077628chr12681 484 ------
NM_001078chr11603 ------
NM_001079874chr141550 435 318 310 ------
NM_001083620chr432496 2054 2013 --12403 12028
NM_001083621chr1124348 3511 3276 2991 2901 1171 1026 857 745 546 444 259 11702 24158 213 23374 811
NM_001095chr1261938 1299 1268 172 161 121 ------
NM_001099678chr3125990 5841 5574 5292 4848 4495 4180 4097 2479 1741 1706 635 14030 25125 1066 12115
NM_001100108chr1228328 8321 8238 7877 6165 5851 5523 5271 5175 3227 3195 2970 2752 1671 1613 1537 1303 1206 1154 1086 806 592 26795 673 1838 17894
NM_001106chr3249587 9152 8437 8100 7571 7399 7299 7287 7165 6960 6609 3448 3385 3172 2804 2199 2031 1839 1134 1015 522 488 341 316 18879 65967 2664 2205 1602 711 481 17718
NM_001111chr192436 2153 2048 855 499 446 337 302 104 12335 32537 1754 1671 --
NM_001112808chr12416 403 ------
NM_001113490chrX63054 2953 2478 2273 1175 771 22791 203 1913 --
NM_001116chr1663036 2601 2315 482 408 217 11896 1466 --
NM_001117chr1831844 1587 654 --11851 12009
NM_001119chr451494 1425 1306 446 205 --21375 1363 11263
NM_001121chr1041852 1811 1629 631 1465 ----
NM_001122679chr5162 11335 ----
NM_001126chr12937 927 1779 ----
NM_001128chr1683805 3156 2983 2542 2470 411 235 183 31115 857 834 13721 --
NM_001130chr192836 169 ------
NM_001135chr152664 82 ------
NM_001140chr174241 229 212 194 ------
NM_001144chr1641189 320 242 195 ------
NM_001146chr861995 1674 1574 898 415 187 11942 --1524
NM_001147chr82390 91 ------
NM_001148chr431498 641 329 --11512 --
NM_001154chr42177 67 ------
NM_001156chr101446 --1189 --
NM_001159chr21323 --1234 --
NM_001160chr1232090 1814 877 1186 --1527
NM_001167chrX65289 4561 4132 2537 1501 770 24499 2654 11442 12494
NM_001173chr1433209 1179 125 ------
NM_001178chr11----1436 --
NM_001186chr2142160 1139 727 646 33310 2427 237 1109 23298 138
NM_001191chr2031126 580 42 ------
NM_001200chr2041060 1054 953 796 ------
NM_001204chr2176572 6266 5368 5221 4934 2974 2671 2440 2113 2030 1503 1351 1299 1183 1044 682 491 16747 22065 1762 11492
NM_001206chr972866 2783 2405 1977 458 309 149 ------
NM_001207chr5--1116 ----
NM_001219chr791889 1734 1655 1554 1391 898 633 274 154 ------
NM_001221chr42110 102 ----133
NM_001222chr1021805 1301 12011 ----
NM_001233chr762132 1867 1727 935 787 428 ----1569
NM_001237chr431141 811 801 11071 --1359
NM_001237chr431141 811 801 11071 --1359
NM_001241chr242060 1714 1620 385 --1128 --
NM_001241chr242060 1714 1620 385 --1128 --
NM_001253chr6--1262 ----
NM_001256chr1762889 2328 1171 1032 745 65 1772 ----
NM_001257chr1631503 261 213 ----1198
NM_001259chr7166098 5948 5175 4633 4627 4617 2542 2206 1607 1601 1559 1313 916 894 577 125 25091 1028 35432 1631 1621 11300
NM_001262chr12233 31 ------
NM_001263chr41127 ------
NM_001268chr134803 770 254 69 ----11039
NM_001269chr13170 155 149 ------
NM_001270chr52858 807 --1104 --
NM_001271chr1572781 2520 2295 2224 1237 765 734 11028 --13001
NM_001273chr123438 385 55 ------
NM_001278chr1021127 338 1196 2963 825 --
NM_001280chr191614 ------
NM_001282chr1752156 772 696 614 538 --22626 2417 --
NM_001283chr74679 671 487 431 --2110 67 --
NM_001284chr51457 2552 493 ----
NM_001286chr172902 2747 2199 2191 1833 791 737 --22921 2912 --
NM_001290chr44850 319 280 151 ------
NM_001293chr113387 191 99 ----1438
NM_001294chr19--1397 ----
NM_001299chr191127 ------
NM_001304chr1763811 3511 1460 1096 140 56 2664 196 1468 --
NM_001310chr1252057 701 676 515 470 ------
NM_001313chr44879 683 341 325 2827 302 ----
NM_001315chr672179 1544 1527 1449 812 307 266 11917 11939 --
NM_001316chr203365 333 94 --1374 --
NM_001319chr1921069 31 ------
NM_001326chr112127 44 ----1481
NM_001329chr1021658 1635 1613 21231 293 --
NM_001331chr11132452 2334 2229 2067 1960 1869 1131 1070 975 943 871 671 77 11947 12649 --
NM_001332chr531251 1160 1140 --1453 --
NM_001343chr581452 1077 638 595 328 321 305 236 --1151 --
NM_001346chr362857 1912 1829 552 467 118 22680 2018 --22615 122
NM_001351chr32526 138 11663 ----
NM_001356chrX22496 755 1318 ----
NM_001357chr1--1255 ----
NM_001358chr43403 354 103 1300 ----
NM_001364chr11174468 4443 4369 3868 3804 3591 3338 3315 3308 3298 3281 3247 3171 3132 3078 3010 896 1257 33267 3235 1091 13374
NM_001365chr172500 124 --1164 --
NM_001378chr22466 156 ------
NM_001380chr102993 171 1253 --11036
NM_001382chr113184 144 36 --122 --
NM_001386chr891787 1682 1618 1587 780 736 725 352 80 ------
NM_001387chr572622 2515 1036 924 794 788 739 32711 2593 896 ----
NM_001388chr171706 ------
NM_001389chr212541 477 ------
NM_001390chr1872558 1454 1343 1129 1000 881 28 --21378 315 11217
NM_001391chr1831018 389 306 ------
NM_001392chr18----122 --
NM_001395chrX1195 ------
NM_001396chr2121913 229 ----1496
NM_001399chrX93478 3345 2376 1543 853 831 791 414 21 21077 70 13570 --
NM_001402chr61310 11799 ----
NM_001406chr17121485 1359 1244 685 666 467 436 423 386 275 241 219 185 1392 --
NM_001407chr321733 1211 ----21386 557
NM_001408chr151494 1462 1095 1070 428 ------
NM_001412chrX73705 3652 3376 3167 3047 2933 1410 23617 3228 --11414
NM_001415chrX61494 1327 1250 370 142 53 ------
NM_001417chr1261936 1356 568 523 72 35 1174 11870 --
NM_001418chr111487 ------
NM_001418chr111487 ------
NM_001419chr1963566 3007 1861 1088 486 280 33853 3194 316 --1225
NM_001420chr1942593 2526 2225 1193 ------
NM_001421chrX51678 1635 1396 1212 327 ----1548
NM_001422chr112204 90 ------
NM_001423chr1231594 1375 756 --21662 163 1769
NM_001426chr23590 570 534 --1230 --
NM_001427chr761604 822 788 771 739 729 ------
NM_001429chr222888 43 ------
NM_001430chr241539 361 297 30 1273 ----
NM_001431chr641254 1137 814 449 1231 ----
NM_001438chr1143000 1328 1035 484 472 459 444 365 258 252 236 230 212 205 32585 749 557 1311 --
NM_001439chr181252 1228 1216 1201 359 202 140 112 --11524 --
NM_001448chrX11357 --11651 --
NM_001449chrX2444 264 ------
NM_001451chr1631167 507 79 11340 ----
NM_001453chr62652 328 --11211 --
NM_001455chr694408 4252 3925 3567 3147 1278 628 603 402 13049 33300 3288 1732 14377
NM_001463chr24815 705 168 150 ------
NM_001478chr127936 818 690 342 181 133 115 ------
NM_001482chr155719 375 311 198 147 --1379 --
NM_001483chr721096 211 ------
NM_001493chrX4745 247 209 169 --2691 69 --
NM_001494chr101718 ------
NM_001495chr891046 982 930 919 904 811 780 300 155 ------
NM_001497chr962423 1964 1852 1083 1003 47 12770 ----
NM_001498chr64456 444 429 412 --1985 1927
NM_001511chr4----1146 --
NM_001518chr741099 845 458 105 1910 ----
NM_001521chr23793 695 119 --2796 670 --
NM_001527chr694804 4589 3935 3763 3689 3282 1484 1148 542 --44428 4135 3612 1187 --
NM_001530chr1441163 1100 983 24 ------
NM_001533chr192100 46 --154 --
NM_001540chr7187 ------
NM_001542chr152736 2565 403 362 57 1940 12192 --
NM_001543chr564621 4302 3289 3264 1805 1681 21827 1607 13701 --
NM_001546chr641481 1193 486 223 ------
NM_001550chr71184 ------
NM_001552chr1741098 1037 790 220 ----1421
NM_001555chrX2255 30 1111 ----
NM_001584chr1171215 1022 1012 985 874 494 76 ------
NM_001587chrX61910 793 646 449 408 237 --1155 12005
NM_001609chr1044337 3688 483 166 --13675 --
NM_001613chr10128 ------
NM_001614chr172481 255 ------
NM_001614chr172481 255 ------
NM_001616chr223138 2964 ------
NM_001629chr132255 88 ------
NM_001634chr662006 1442 639 409 223 206 ----11504
NM_001635chr73887 875 319 --1956 --
NM_001642chr1141259 1228 884 847 ------
NM_001650chr1853847 3626 1619 1521 880 13277 1354 --
NM_001654chrX2416 160 ------
NM_001655chr1181920 1604 1535 764 758 728 308 131 --3656 325 302 --
NM_001656chr52786 386 1554 11458 --
NM_001658chr15984 936 916 37 28 ------
NM_001659chr12172507 2433 2207 2097 1883 1019 784 744 673 403 382 359 342 316 286 161 81 --42670 2631 2233 914 --
NM_001660chr31220 1278 1649 --
NM_001661chr173627 292 209 --1534 --
NM_001662chr73285 152 126 ------
NM_001663chr147868 701 400 333 192 164 95 ------
NM_001664chr32989 197 --1224 --
NM_001668chr152281 1971 1920 502 93 1167 ----
NM_001674chr12869 100 ------
NM_001677chr12833 825 ------
NM_001678chr1771646 1406 1357 669 565 557 135 31638 1487 1448 31709 1413 739 1587
NM_001682chr1242581 2503 2364 1126 --11850 12515
NM_001683chr332478 2291 166 ------
NM_001684chr1173807 3589 3399 3383 3257 3221 2856 2697 1230 1042 909 767 733 585 332 293 135 23367 523 13164 13547
NM_001690chr362568 2103 1696 322 181 32 22227 982 21938 216 --
NM_001693chr851192 968 418 380 62 --11070 --
NM_001695chr884086 3710 3689 1387 1098 1015 869 96 33816 3459 940 ----
NM_001699chr1951725 1460 1433 1233 161 1362 ----
NM_001701chr921014 57 ----1261
NM_001702chr81553 ------
NM_001703chr1147 ------
NM_001704chr61555 --1532 --
NM_001707chr73676 362 37 ------
NM_001709chr1162704 2353 1908 882 873 337 ------
NM_001714chr123468 200 88 ------
NM_001718chr61474 --11313 11381
NM_001730chr13--11129 ----
NM_001730chr13--11129 ----
NM_001731chr124919 341 307 70 ------
NM_001735chr9176 ------
NM_001742chr71522 --11528 --
NM_001746chr542960 1019 458 34 --21925 917 --
NM_001748chr121085 938 ------
NM_001753chr761326 683 591 556 167 43 ------
NM_001755chr1662134 661 524 453 342 98 --21943 924 1421
NM_001759chr12175047 4939 4383 4288 4117 4016 3418 1888 1417 1265 1253 1043 887 710 605 591 52 14271 --11954
NM_001760chr64818 803 392 307 1375 ----
NM_001768chr241293 971 822 47 ------
NM_001773chr161388 1179 1104 1093 971 586 --1550 21213 1187
NM_001777chr3183727 3501 3445 3357 3143 3134 2707 2677 2654 2556 2545 2525 1451 1309 782 700 328 321 --13539 1909
NM_001783chr193301 152 84 ------
NM_001788chr7----1400 1759
NM_001789chr331391 193 51 ------
NM_001791chr141234 1191 1039 431 ------
NM_001797chr161566 ------
NM_001798chr124736 730 243 125 1100 --1789
NM_001800chr192194 75 ------
NM_001806chr1931115 984 929 11104 12928 1442
NM_001810chr203769 567 216 --1113 --
NM_001822chr22526 516 ----1530
NM_001829chr42872 617 --1103 --
NM_001830chrX83772 3157 2523 1390 1367 1346 1099 980 22799 153 21584 672 13360
NM_001839chr14562 153 146 34 ------
NM_001842chr93539 467 116 ------
NM_001845chr132168 45 ------
NM_001854chr131500 1108 256 ------
NM_001858chr61288 13110 25009 1307 11204
NM_001865chr6148 ------
NM_001873chr42651 192 ------
NM_001881chr101377 ------
NM_001884chr5--1527 ----
NM_001891chr42341 145 ------
NM_001892chr561413 1389 1380 1022 984 197 ------
NM_001893chr171280 --1355 --
NM_001895chr201424 ------
NM_001901chr61921 ------
NM_001903chr53665 308 203 1710 ----
NM_001904chr32873 307 ------
NM_001913chr72633 289 1675 ----
NM_001915chr17122042 1882 1712 1508 1404 1390 813 679 617 603 178 39 --1168 11572
NM_001920chr121772 --1648 --
NM_001921chr431093 1007 904 ----147
NM_001923chr113473 82 67 1496 1486 --
NM_001933chr143440 402 55 --21017 906 --
NM_001935chr21357 ------
NM_001936chr751384 1261 1226 692 389 ------
NM_001938chr1----2362 30 --
NM_001939chrX73587 2917 2870 1497 972 204 37 2254 227 1673 22678 828
NM_001942chr1861876 1262 801 711 241 199 21538 1339 ----
NM_001945chr551353 1138 1000 541 305 145 --11122
NM_001946chr125940 787 357 185 54 ----11003
NM_001949chr662150 2127 1231 978 930 530 --13199 --
NM_001951chr81409 136 ----
NM_001954chr63705 268 85 1117 1281 1621
NM_001955chr61220 --2894 102 --
NM_001962chr51236 1578 ----
NM_001963chr42660 106 ----1781
NM_001964chr55837 253 172 138 96 ------
NM_001965chr22435 78 ------
NM_001967chr32386 192 1423 ----
NM_001969chr1442416 1476 1159 1086 22529 1146 ----
NM_001970chr173489 418 237 ----142
NM_001973chr11155 ----1276
NM_001977chr43617 374 162 3283 219 151 --151
NM_001981chr152320 2205 1738 1471 40 12224 22159 507 --
NM_001982chr125907 317 200 68 52 ------
NM_001987chr12124106 3919 3496 3310 2953 1595 1476 1114 643 611 502 137 13521 23436 1604 --
NM_001990chr14138 130 113 36 ------
NM_001995chr44579 314 140 49 1443 --1332
NM_001999chr531335 1249 542 ------
NM_002006chr4135497 5448 5432 5238 4155 3719 3606 2021 1575 1185 557 465 446 44924 1757 1489 1422 24846 1506 11437
NM_002009chr1552583 2355 2262 87 69 ------
NM_002013chr141243 ------
NM_002014chr124615 516 469 106 ------
NM_002015chr1382594 2467 1260 1190 1177 1142 150 142 --11180 12107
NM_002017chr1111413 --1174 --
NM_002023chr181644 1218 635 524 478 399 130 121 ------
NM_002024chrX21928 1684 22085 1381 11789 --
NM_002025chrX279256 8869 8435 8040 7876 7569 7450 7444 6990 6784 6307 6257 6170 6085 2739 2364 2212 1200 1158 1136 1099 917 909 796 777 99 47 21561 1266 27549 3392 17777
NM_002028chr1451109 1050 503 465 123 21271 809 ----
NM_002033chr1153705 1468 1046 814 779 --23306 60 13025
NM_002035chr1873238 3121 2794 1506 924 639 441 11356 --11411
NM_002037chr61321 ------
NM_002040chr21102225 2150 1269 1060 1026 907 851 349 89 69 12852 12366 --
NM_002044chr1561137 556 495 421 409 158 --11571 --
NM_002045chr34349 148 124 69 ------
NM_002048chr93890 444 196 ------
NM_002051chr103826 447 247 21116 945 ----
NM_002055chr1781679 1610 1556 1083 1050 389 76 25 21565 1199 1136 --
NM_002063chrX1359 ------
NM_002065chr151786 1328 1203 349 206 21665 1414 ----
NM_002071chr186682 668 418 146 136 85 ----1639
NM_002072chr93938 754 224 ------
NM_002074chr131615 507 490 ------
NM_002076chr1252375 2173 1025 786 306 1802 33177 2183 227 --
NM_002077chr972036 1691 1636 868 783 511 427 21719 1336 11553 1295
NM_002086chr1792059 2009 1789 744 374 282 275 256 244 179 --12227
NM_002089chr41644 --1146 --
NM_002092chr464969 4920 4118 3116 1796 1266 1143 --11473
NM_002094chr16174 ------
NM_002103chr193889 755 205 ------
NM_002107chr12480 56 ------
NM_002111chr483270 3199 3049 2901 551 541 376 279 12407 ----
NM_002114chr6167 ------
NM_002126chr17104185 4138 4027 3198 2783 2662 1250 646 550 213 13396 1534 13595
NM_002129chr41142 ------
NM_002135chr12160 ------
NM_002137chr741894 1811 1764 963 ----1442
NM_002138chr41346 1158 ----
NM_002141chr7147 ------
NM_002145chr173297 152 24 ----1160
NM_002146chr171560 ----1451
NM_002148chr21658 ------
NM_002154chr51550 1165 ----
NM_002156chr2125 ------
NM_002158chr253616 2915 434 305 277 ------
NM_002167chr11344 ------
NM_002181chr21755 --1121 --
NM_002187chr511310 1960 ----
NM_002193chr221423 1313 1712 ----
NM_002196chr204407 191 181 146 1742 ----
NM_002196chr204407 191 181 146 1742 ----
NM_002199chr43885 166 77 1669 ----
NM_002202chr52815 714 ------
NM_002207chr34784 757 121 85 ----1206
NM_002211chr1011103 ----1854
NM_002214chr7165729 4951 4892 4648 4632 4469 3967 3529 3465 1570 1471 1244 1041 872 657 643 --44885 4623 3985 2202 1286
NM_002222chr311036 --1546 --
NM_002223chr1263942 3860 3717 2754 650 322 ------
NM_002224chr62732 707 ------
NM_002227chr12810 190 ------
NM_002228chr111196 --1882 --
NM_002229chr19--1410 ----
NM_002230chr178982 959 826 745 169 122 106 48 ------
NM_002232chr141392 950 210 198 --11254 --
NM_002235chr1221468 1112 ------
NM_002240chr21265 26 ------
NM_002241chr1132938 2358 2265 2131 1019 943 934 858 661 610 393 121 43 21143 778 129 12345
NM_002245chr11639 ------
NM_002246chr241103 866 393 381 1838 ----
NM_002247chr1042240 1962 666 432 22246 1690 12331 --
NM_002249chr13472 449 204 ------
NM_002252chr23172 34 26 ------
NM_002253chr441210 1055 226 204 --1155 --
NM_002254chr292246 2063 2052 785 579 406 278 161 150 --1173 --
NM_002264chr394573 4212 3703 1591 1549 1159 1024 764 57 2356 199 33336 1595 571 11123
NM_002266chr17----165 1174
NM_002267chr1362155 2132 2062 2022 1786 348 21747 126 ----
NM_002268chr3--21361 1269 ----
NM_002270chr5155125 4916 4593 4256 4115 3730 1983 1657 1573 1506 1204 1029 691 95 70 55062 4554 4543 1401 1269 22179 1611 12004
NM_002271chr131122 --160 --
NM_002274chr177277 253 244 113 56 32 23 148 1313 --
NM_002280chr171163 ------
NM_002285chr262965 2684 1270 1192 1079 878 --13315 1634
NM_002293chr182802 2694 2634 2381 1773 1094 1050 126 2503 33 22175 104 11713
NM_002294chrX1166 ------
NM_002296chr111673 1589 21097 460 --
NM_002310chr5155818 5417 5280 5040 4434 4144 4041 2458 2190 1882 1827 1818 1807 1619 455 34810 791 492 21268 507 15029
NM_002312chr13--2361 31 ----
NM_002317chr51302 ------
NM_002332chr12----2747 621 --
NM_002333chr195904 456 254 84 76 ------
NM_002334chr1121512 407 --143 --
NM_002336chr1284967 3522 1691 1422 933 699 684 633 --3851 721 548 11311
NM_002345chr121557 ------
NM_002349chr221554 269 ------
NM_002355chr1221056 145 1578 3997 947 195 11095
NM_002356chr621821 270 --32828 1947 258 --
NM_002358chr43479 266 153 ------
NM_002359chr17123616 3325 3074 2950 2730 1529 1079 741 719 118 85 74 13860 21617 1122 --
NM_002361chr19--1213 1222 --
NM_002373chr1521226 72 --147 --
NM_002374chr263574 2811 2715 2559 922 795 --13217 11334
NM_002375chr392110 2067 2058 1607 1598 1515 775 628 342 11551 ----
NM_002376chr14------1103
NM_002382chr1461314 1061 519 495 111 58 2418 311 ----
NM_002384chr18--1959 ----
NM_002385chr1851327 1181 1144 478 455 ------
NM_002387chr5115060 3678 3587 3300 3130 1776 1265 956 418 372 301 --1400 24179 3168
NM_002391chr111320 ------
NM_002397chr542067 1941 1790 276 11867 ----
NM_002398chr2--1454 ----
NM_002399chr1521313 970 11360 2900 543 --
NM_002406chr54910 859 746 396 ------
NM_002408chr141727 --131 --
NM_002409chr2263159 2364 2342 2190 724 360 --1872 --
NM_002430chr2272561 1763 824 722 438 85 40 11994 3296 138 25 --
NM_002442chr1231724 1112 295 11187 1444 --
NM_002445chr8101547 1470 1434 1159 313 211 189 160 99 62 --21478 30 11677
NM_002451chr972837 1427 1201 656 490 319 271 --23402 3373 --
NM_002469chr121312 --171 --
NM_002479chr13749 482 309 ------
NM_002480chr121574 1504 1529 --
NM_002481chr1267947 7379 7225 6684 6666 6148 5524 5142 5092 4973 4891 3122 3093 3076 2964 2159 1941 1445 998 700 686 551 498 358 162 143 57095 6466 1994 1720 1022 11702 32391 1645 406
NM_002486chr972284 2275 1763 1571 1555 243 99 12155 21624 760 --
NM_002487chr15--1144 1638 --
NM_002495chr5--1111 ----
NM_002499chr156986 913 901 695 348 138 --1587 --
NM_002500chr21931 --1215 --
NM_002501chr19113927 3893 3839 3804 3647 1602 1519 1249 1173 799 183 ----21651 35
NM_002505chr661583 1511 1450 569 424 103 11097 ----
NM_002506chr1134 ------
NM_002507chr1711534 --1121 1675
NM_002508chr141820 1573 510 24 --187 1181
NM_002509chr203768 697 627 ------
NM_002514chr831122 806 145 --21186 457 1858
NM_002515chr1431541 1431 1263 21849 1322 31842 212 41 --
NM_002516chr193107 50 32 ------
NM_002518chr241165 977 400 203 ------
NM_002519chr1141388 1219 1104 1058 11330 ----
NM_002520chr5178 ------
NM_002522chr17123463 3137 2957 2574 1369 1098 979 886 588 394 206 77 --12447 12539
NM_002526chr63645 581 295 21251 23 ----
NM_002527chr121103 ------
NM_002531chr2041949 435 254 224 1278 ----
NM_002536chrX41103 1069 313 265 ------
NM_002537chr15--1707 ----
NM_002542chr32215 60 ------
NM_002545chr11165005 4655 4563 3532 2064 2042 1494 1349 1340 1309 955 946 890 733 597 292 1997 44848 2049 322 285 31708 1609 22
NM_002547chrX83561 3364 3333 3081 1450 745 195 66 13682 11659 --
NM_002556chr1181986 1969 1531 1357 864 663 306 295 ------
NM_002568chr81309 ------
NM_002569chr1531406 1280 247 1365 ----
NM_002570chr153913 366 200 ----1828
NM_002572chr11176 ------
NM_002575chr181113 1396 --1208
NM_002576chr1121211 87 ----1910
NM_002577chr3133793 3120 2965 2947 2882 1527 1512 985 902 723 445 409 136 23193 3129 23727 1544 --
NM_002581chr9125583 5315 5221 4871 4707 4582 4274 1475 791 667 606 566 24697 135 24294 2141 --
NM_002585chr13277 137 70 ------
NM_002586chr641569 374 317 236 1190 1308 --
NM_002588chr571797 1682 1393 1297 669 486 385 ------
NM_002594chr2062272 2066 1619 491 116 50 --11642 11623
NM_002595chr1231751 215 119 ------
NM_002599chr1141136 1067 1057 361 1264 ----
NM_002600chr161624 1461 1238 675 470 370 1612 ----
NM_002605chr154799 468 355 84 ------
NM_002608chr2261582 1388 1108 622 574 259 --11254 --
NM_002613chr1685324 5114 4823 3334 1859 1415 1354 1124 34510 4260 1498 34972 2120 1263 --
NM_002622chr53688 619 201 --187 --
NM_002628chr331072 440 388 ------
NM_002633chr12381 224 ----1476
NM_002634chr172720 190 1157 ----
NM_002636chr63437 388 222 --1391 --
NM_002643chr21168 ------
NM_002645chr1152740 2631 2575 2307 387 --32690 1126 768 --
NM_002646chr132176 789 139 1599 1187 11967
NM_002648chr631207 978 237 1833 --1988
NM_002655chr8104489 4405 4185 3957 3654 3603 3209 1737 1517 979 44278 997 610 456 ----
NM_002656chr61424 ------
NM_002657chr20133467 3239 2883 2520 2512 1446 1339 980 778 508 372 315 290 --23741 3396 13198
NM_002668chrX2128 21 ------
NM_002669chr4121 ------
NM_002670chr321005 423 11545 11442 --
NM_002674chr121162 ------
NM_002687chr1421324 432 1337 ----
NM_002690chr81104 ------
NM_002693chr152311 305 1153 ----
NM_002698chr19122675 2583 2343 2323 2304 2297 2278 2245 2225 1966 199 77 12811 1327 --
NM_002699chr161510 1461 1382 1335 1082 496 1600 ----
NM_002705chr162661 79 ------
NM_002706chr22579 161 ------
NM_002707chr2----179 --
NM_002709chr263535 3342 2568 1037 990 100 2433 117 --12398
NM_002710chr122226 218 ------
NM_002711chr73734 331 106 ------
NM_002713chr131051 274 227 1848 ----
NM_002714chr62981 362 1918 ----
NM_002716chr11123697 3504 3497 3274 3149 2834 2776 1449 1194 722 376 27 --23533 2351 13298
NM_002719chr1432352 1762 618 2954 869 ----
NM_002721chr94498 360 70 42 ------
NM_002726chr62348 173 ------
NM_002729chr101111 1262 ----
NM_002730chr1941359 1192 462 242 ------
NM_002734chr174786 654 239 32 --1917 --
NM_002736chr731632 752 115 ------
NM_002738chr163451 240 171 --11155 --
NM_002742chr141537 ------
NM_002744chr1--145 ----
NM_002745chr22103422 3310 3102 2760 1547 1313 1047 336 119 56 11462 34461 1695 1655 13029
NM_002747chr1821505 1416 1180 1511 --
NM_002752chr52437 215 ------
NM_002753chr41345 ------
NM_002755chr151843 ------
NM_002763chr12208 155 ------
NM_002776chr1971783 1489 818 773 194 131 80 2279 150 1316 --
NM_002790chr1126 ------
NM_002796chr1178 ------
NM_002815chr17123 ------
NM_002823chr21581 ------
NM_002824chr123397 324 129 ------
NM_002829chr94942 440 143 27 1121 ----
NM_002833chr153627 499 320 --11163 --
NM_002834chr12103480 3423 2764 1240 1153 1143 973 904 522 241 ----13785
NM_002835chr72672 272 ------
NM_002836chr202180 126 140 ----
NM_002837chr12104170 3540 3013 2896 1740 1438 821 744 611 199 12887 12871 --
NM_002839chr983256 3209 2990 2526 1304 807 101 61 23467 2290 ----
NM_002840chr141312 386 326 295 1376 11381 164
NM_002841chr32434 184 ------
NM_002844chr631362 1163 475 11024 ----
NM_002847chr731505 1441 458 --185 --
NM_002849chr122687 69 ------
NM_002850chr1951144 1111 769 240 48 ----1947
NM_002855chr1193508 3456 3377 3201 1024 814 772 283 259 1904 13066 --
NM_002859chr1281794 1747 1613 1246 1230 1185 531 190 --21444 1322 --
NM_002867chr13760 471 162 1591 ----
NM_002868chr12162410 2331 2266 2256 2238 2092 2032 1990 1933 1846 1670 1659 924 917 538 416 --12073 1889
NM_002869chr1121765 595 ----1513
NM_002874chr932056 2002 261 1654 12424 --
NM_002880chr32565 125 1577 1762 1730
NM_002886chr395032 4667 4380 3365 3303 1876 1866 1141 582 34977 1216 61 ----
NM_002890chr5175 1241 ----
NM_002892chr1431433 235 157 ------
NM_002894chr18--1162 ----
NM_002897chr21589 ------
NM_002898chr127638 630 615 589 264 186 171 ------
NM_002902chr153679 463 36 1452 ----
NM_002906chr1151611 805 720 442 410 12374 ----
NM_002911chr1941571 1366 552 346 --1325 --
NM_002912chr61134 1768 ----
NM_002918chr191302 ------
NM_002924chr13590 237 210 ------
NM_002928chr131437 1307 524 11502 11485 --
NM_002930chr18189 1178 ----
NM_002938chr441916 1663 1286 151 11634 31996 1477 217 --
NM_002941chr321316 130 21293 1250 ----
NM_002942chr32470 177 --1275 --
NM_002943chr15123 ------
NM_002945chr172647 255 --1569 --
NM_002956chr1251239 946 886 535 159 --11180 --
NM_002957chr993576 3281 2893 1129 821 740 678 95 66 ------
NM_002959chr194031 3857 3335 3094 3070 2858 2851 1584 794 23050 1268 ----
NM_002968chr162927 239 1413 ----
NM_002970chrX159 ------
NM_002971chr341022 743 366 73 --1181 --
NM_002973chr12255 46 ------
NM_002977chr263274 2248 957 718 690 92 11332 ----
NM_002979chr12762 746 ------
NM_002995chr12141 116 ------
NM_002996chr1661820 1643 1220 779 631 392 --2488 245 --
NM_002997chr241425 1307 180 125 --1528 11540
NM_002998chr861719 1360 788 700 404 21 12069 1410 --
NM_003001chr172142 1864 877 824 450 273 114 --21956 1577 --
NM_003002chr112121 50 1750 1816 --
NM_003010chr1752432 2230 1945 1816 1686 --22381 707 --
NM_003011chr97659 589 473 422 384 206 31 --1139 --
NM_003012chr852995 1930 1237 944 613 12162 12972 --
NM_003014chr721391 1378 21025 462 11185 --
NM_003016chr1731576 713 424 1283 ----
NM_003017chr621377 1043 1295 1172 --
NM_003024chr215762 639 250 219 74 ------
NM_003026chr93955 185 29 ------
NM_003027chr15188 ------
NM_003028chr983322 3237 2632 2483 2439 703 388 141 --1775 12640
NM_003029chr151504 1431 1321 373 43 ------
NM_003030chr321414 762 11747 --11776
NM_003031chr161860 --1769 1384
NM_003034chr12177226 7056 6942 6476 6326 5968 5596 5465 5310 5285 5092 3051 2578 2086 1033 635 599 25318 5273 38112 8103 5447 --
NM_003036chr121082 998 1365 1258 --
NM_003042chr352055 1767 856 412 363 11805 11735 --
NM_003043chr364331 4228 3812 3756 2892 382 ------
NM_003045chr1363660 3175 1530 1262 337 261 --24688 2021 --
NM_003046chr8155302 5093 5065 4913 4235 4207 3975 3654 1981 1280 1099 1023 952 731 713 21270 833 --23398 1552
NM_003048chr252791 2195 1722 725 272 --1682 --
NM_003051chr151961 1948 1936 1701 1545 ------
NM_003060chr571200 1071 1025 871 815 412 113 --1192 11037
NM_003068chr82277 203 ------
NM_003069chrX----1763 --
NM_003074chr351740 370 290 146 106 21677 655 ----
NM_003075chr12--1304 ----
NM_003076chr1271691 1639 1180 610 584 260 167 ------
NM_003077chr173848 115 54 --2685 226 --
NM_003081chr204763 390 267 177 1747 11158 --
NM_003088chr73716 326 295 ------
NM_003091chr201233 ------
NM_003093chr61178 ------
NM_003098chr201477 ------
NM_003104chr152987 90 11179 ----
NM_003106chr31945 ------
NM_003107chr632218 1056 686 ------
NM_003108chr2187028 6454 5996 4969 4784 4438 2582 2430 2207 2072 2000 1874 1843 1805 1764 1614 259 27 --66303 6073 4622 1062 676 283 15009
NM_003110chr17----11050 --
NM_003111chr211074 ------
NM_003112chr742762 1015 262 26 --32670 1047 414 --
NM_003113chr2169 ------
NM_003115chr11464 ------
NM_003128chr2102631 1961 1936 1910 1893 909 469 400 310 30 1763 11136 --
NM_003131chr631962 1880 522 11702 --1374
NM_003133chr13334 279 192 ------
NM_003137chr672105 733 618 506 349 312 70 --21858 748 2628 296
NM_003140chrY2108 47 ------
NM_003144chr641762 861 841 328 ------
NM_003145chr14308 104 46 24 ------
NM_003149chr361156 1041 580 532 303 52 11664 --1592
NM_003150chr1742045 701 321 233 21725 1583 --11853
NM_003152chr1741174 892 266 23 11106 ----
NM_003153chr121190 --139 --
NM_003155chr872528 2419 2255 2228 2119 617 356 42810 1945 1843 507 1261 --
NM_003161chr1742886 635 362 249 ------
NM_003162chr23999 254 25 ------
NM_003165chr961756 1540 1449 1214 261 180 ------
NM_003170chr172118 82 133 ----
NM_003173chrX11380 --11228 --
NM_003178chr371873 1595 1489 745 405 296 212 11398 1157 --
NM_003184chr8126 21099 862 167 --
NM_003185chr202493 302 --11349 --
NM_003188chr61159 ------
NM_003189chr1103150 3036 2836 2811 2425 1356 1336 1102 393 149 11261 ----
NM_003199chr1875133 4640 4086 4037 3649 1696 1494 25637 1705 ----
NM_003202chr521736 509 --1571 1701
NM_003203chr2101687 875 712 564 387 374 341 138 85 54 --21883 1702 11842
NM_003204chr1731284 1165 119 --11337 --
NM_003211chr1221259 1141 11570 1633 --
NM_003216chr22133335 2885 2816 2358 2259 2058 2043 1333 832 777 413 294 48 22868 2170 --12975
NM_003217chr1261895 1699 1626 528 58 36 1551 2253 135 11602
NM_003220chr661338 1194 1177 1062 636 604 ------
NM_003221chr6104067 3540 3243 2865 2659 1647 985 801 595 547 13885 13623 13893
NM_003222chr201284 --1180 --
NM_003223chr162603 21 ----1311
NM_003234chr352431 2146 1676 861 238 --21696 683 --
NM_003236chr2103240 3158 3018 2403 2292 2150 1297 931 686 327 --22648 2257 22365 518
NM_003239chr1441046 723 711 150 ------
NM_003242chr382113 1979 1643 1587 952 932 612 499 ----11532
NM_003243chr121195 253 ------
NM_003244chr181341 ------
NM_003247chr631634 639 86 ------
NM_003250chr172337 60 ------
NM_003253chr2141611 1501 380 223 11724 ----
NM_003255chr1762367 2168 2056 481 215 152 1647 ----
NM_003257chr1521094 1060 --11215 --
NM_003269chr641115 503 360 354 ------
NM_003270chrX3348 257 28 3484 298 38 --2998 442
NM_003274chr2162768 2571 2407 1836 520 489 1811 12773 --
NM_003286chr203795 401 333 1822 11121 --
NM_003288chr2011585 1963 --11366
NM_003290chr1941021 836 78 57 ------
NM_003292chr12592 182 --1532 --
NM_003297chr12------1210
NM_003298chr3136012 5819 5362 5222 5091 4827 4253 4068 3834 2311 799 705 177 35342 2166 1897 34361 3817 780 24796 4151
NM_003300chr141445 --143 --
NM_003304chr321246 1046 ------
NM_003305chr41111 1127 ----
NM_003309chr671752 585 516 292 148 132 89 1332 --11883
NM_003320chr11134159 4101 4080 3978 3545 3013 2772 2753 2704 1243 986 168 161 --24168 84 13577
NM_003334chrX1155 ------
NM_003336chrX2185 153 11009 --1770
NM_003337chr551285 1238 1196 606 479 --11444 --
NM_003338chr1021952 1343 ------
NM_003339chr5265 26 ------
NM_003340chr421192 64 ------
NM_003342chr1772692 2605 1290 992 985 688 540 --22543 1000 1434
NM_003344chr731341 538 155 11561 ----
NM_003345chr163498 429 416 ------
NM_003348chr1241378 403 129 58 ------
NM_003350chr83922 209 42 ------
NM_003352chr22220 38 ------
NM_003359chr421345 914 ------
NM_003368chr12563 120 ------
NM_003369chr1152572 2344 581 557 243 --1692 1667
NM_003370chr196757 579 261 235 71 32 ------
NM_003373chr1091950 1386 627 565 524 364 357 242 36 11665 21583 1557 --
NM_003374chr51198 ------
NM_003375chr10----1322 --
NM_003376chr661805 1709 1519 699 603 401 ------
NM_003376chr661805 1709 1519 699 603 401 ------
NM_003387chr262189 1984 1855 1151 402 381 --11863 --
NM_003390chr113888 737 203 ------
NM_003392chr3103935 3389 3152 2970 2935 2690 1522 1022 459 433 ------
NM_003399chrX31063 954 281 ------
NM_003400chr2129 ------
NM_003403chr14178 ------
NM_003404chr2021757 1626 ----1596
NM_003405chr22--1759 ----
NM_003406chr831737 1596 119 21725 1683 31751 1446 542 11759
NM_003407chr192580 494 ------
NM_003409chr18----1328 --
NM_003410chrX52909 2592 2078 1238 132 32648 2407 2156 --1331
NM_003411chrY61831 1583 674 665 507 127 11713 --1316
NM_003412chr362674 2284 1064 1035 189 120 ------
NM_003413chrX2790 256 ----11903
NM_003418chr3364 55 26 ------
NM_003427chr61581 ------
NM_003430chr1941569 1351 315 250 2650 401 ----
NM_003442chr11147 ------
NM_003453chr132677 569 ------
NM_003455chr1161697 1460 1444 1357 568 258 --21466 183 --
NM_003458chr3193847 3735 3452 3406 3241 3175 3032 3007 2921 2801 2742 2566 1318 1133 1016 946 932 586 553 22938 1351 13785 --
NM_003463chr622750 162 ------
NM_003466chr262457 2361 2307 2258 1716 546 ------
NM_003468chr283493 1398 1383 1130 1090 997 959 172 11031 ----
NM_003469chr2281 63 ----1163
NM_003470chr1631619 157 82 21400 1336 ----
NM_003471chr322342 114 11439 ----
NM_003472chr621130 87 ------
NM_003473chr101231 ----11090
NM_003474chr1052166 2056 1466 1460 790 ------
NM_003477chr111253 1641 ----
NM_003478chr1152939 2372 1210 349 339 12530 22544 2358 --
NM_003481chr124509 361 108 88 ------
NM_003482chr1272487 2478 2124 1777 775 557 196 --21781 541 --
NM_003483chr1282924 2786 2066 1054 1040 880 622 540 --32878 702 500 12799
NM_003487chr173184 88 22 ------
NM_003489chr2162630 1165 1075 750 610 343 ----22557 688
NM_003503chr131318 471 203 --1925 --
NM_003505chr741638 1568 574 133 ------
NM_003525chr6------146
NM_003532chr6139 ------
NM_003549chr3128 ------
NM_003557chr161584 524 441 180 171 150 --21301 93 --
NM_003558chr91529 ------
NM_003559chr1783116 2870 2829 2753 2407 1481 1026 841 --13546 --
NM_003563chr1721349 1261 1499 --11428
NM_003564chr13236 168 108 1148 ----
NM_003566chr1262543 2276 923 668 503 454 11264 3976 492 167 --
NM_003567chr1121 ------
NM_003574chr1875139 4127 3499 3493 2051 694 42 2350 141 2479 251 15333
NM_003576chr1392567 2278 2266 912 754 574 393 59 35 --12805 12853
NM_003580chr82375 182 ----1597
NM_003581chr23669 243 104 --1960 --
NM_003583chr1283209 1339 1043 849 807 797 784 398 --31239 1100 547 --
NM_003587chr6137 ------
NM_003590chr273690 2815 2709 1623 1608 1528 142 1905 2574 98 --
NM_003597chr262299 2053 1719 1449 911 73 ------
NM_003603chr432120 1902 1511 1583 ----
NM_003607chr173883 1610 1587 1375 896 736 54 11003 14252 --
NM_003613chr152135 25 --1575 --
NM_003615chr363924 2889 980 926 885 817 11520 23853 477 --
NM_003618chr221003 963 ------
NM_003621chr112506 22 1184 ----
NM_003622chr122775 712 --1219 --
NM_003627chr111421 ------
NM_003629chr173128 3067 2986 1328 1109 828 29 2632 344 22490 184 --
NM_003632chr174836 671 287 89 ------
NM_003633chr532613 2303 1756 1537 12088 --
NM_003635chr104391 191 155 105 ------
NM_003637chr161140 605 337 290 227 102 ------
NM_003644chr17116387 5945 5421 2535 2185 2171 2147 1699 1253 1055 485 21597 416 52471 2461 2026 1358 715 --
NM_003655chr171713 --1487 --
NM_003659chr22788 317 ------
NM_003660chr192671 260 --3642 313 266 --
NM_003663chr362621 2124 1110 995 848 446 13411 1925 --
NM_003664chr51354 ------
NM_003670chr361206 1000 982 926 486 222 --11356 --
NM_003671chr983090 2994 2924 2763 2337 2228 735 273 ----13081
NM_003672chr13784 633 32 1485 ----
NM_003677chr1241499 743 737 421 ------
NM_003685chr191358 ------
NM_003688chrX1263 ------
NM_003705chr22796 119 --1694 --
NM_003711chr5--1102 ----
NM_003713chr131368 1243 703 --11184 --
NM_003714chr582770 2684 2639 2540 2324 844 410 265 11205 ----
NM_003716chr32720 702 ------
NM_003718chr72549 453 ------
NM_003726chr172107 38 1238 ----
NM_003728chr41251 ------
NM_003735chr571797 1682 1393 1297 669 486 385 ------
NM_003736chr571797 1682 1393 1297 669 486 385 ------
NM_003737chr111363 ------
NM_003743chr232131 1522 583 21911 875 21763 519 --
NM_003746chr121242 ----1260
NM_003749chr1341919 834 348 337 1815 12018 --
NM_003750chr102812 311 ------
NM_003758chr1541358 1275 1127 70 --21018 1009 11500
NM_003758chr1541358 1275 1127 70 --21018 1009 11500
NM_003759chr4124048 3518 3388 3144 3071 3009 2610 1042 435 428 376 280 1775 13074 --
NM_003763chr2073142 3118 2947 2722 2699 2559 2189 22669 1961 22650 486 22740 525
NM_003768chr161827 1744 1512 1472 591 196 ------
NM_003774chr1283342 3292 3226 2417 2358 2175 737 251 --13313 1719
NM_003778chr32788 128 --1678 --
NM_003779chr13446 349 191 ------
NM_003783chr11279 ------
NM_003784chr18199 --1708 --
NM_003787chr1821701 622 1186 11489 --
NM_003794chr34772 718 431 21 ------
NM_003796chr193461 244 208 1509 ----
NM_003798chr9----173 --
NM_003799chr1854104 3050 259 208 84 13238 33383 1509 890 --
NM_003800chr642398 2055 921 423 --1765 --
NM_003816chr811302 ------
NM_003822chr142620 2023 516 497 22998 2115 11976 12844
NM_003825chr1541394 1361 583 196 11146 --1101
NM_003829chr92453 196 ------
NM_003850chr131210 ----1518
NM_003860chr111313 --177 --
NM_003861chr1492899 2709 2498 2107 2026 575 369 241 147 --42855 2743 2058 1987 1604
NM_003862chr52333 255 ------
NM_003872chr292711 2224 2002 1197 1102 538 434 242 76 42436 2405 942 634 --31880 892 529
NM_003873chr1041653 1001 744 311 11716 ----
NM_003877chr123897 689 239 ----1699
NM_003884chr31149 --21690 716 --
NM_003885chr1792501 2308 2154 2016 1984 1906 1694 716 344 ----11031
NM_003887chr262303 1924 911 489 375 288 1473 --1114
NM_003888chr1571739 1459 1305 1253 1098 343 58 11361 11153 --
NM_003895chr2151895 1578 1352 303 215 11408 12067 --
NM_003896chr21806 1637 ----
NM_003900chr581386 1013 895 561 334 96 36 21 11080 ----
NM_003901chr10102684 2555 961 837 591 470 282 269 171 160 --32335 1887 1828 12688
NM_003902chr12670 125 ------
NM_003908chr2041342 1032 453 443 ------
NM_003909chr852978 2812 2398 1885 1022 1925 1120 --
NM_003913chr654170 3743 3208 1581 495 --12905 --
NM_003916chrX2950 262 ------
NM_003918chrX41465 238 116 83 2448 326 176 --
NM_003919chr7172 ------
NM_003921chr14724 297 227 167 ------
NM_003922chr15130 ------
NM_003924chr451633 1418 1404 662 650 --11380 --
NM_003927chr181935 1868 ----
NM_003929chr141625 1327 582 246 1562 ----
NM_003930chr742033 2004 826 26 ----1162
NM_003931chr62473 47 ------
NM_003932chr2251935 1852 1803 1351 698 191 --11735
NM_003934chr91334 1471 ----
NM_003938chr193985 208 183 --1396 --
NM_003939chr10173868 3103 3089 2982 2677 1054 888 738 691 651 635 569 558 435 297 289 281 --24026 240 23465 2862
NM_003941chr732009 1695 451 --22252 187 --
NM_003947chr351232 1140 240 205 102 --1208 --
NM_003948chr472622 2198 1975 1946 843 147 55 --32678 2523 2426 1705
NM_003949chr1791897 1862 1805 1788 1768 1699 1363 1308 575 1107 1295 11272
NM_003953chr172790 2632 2265 939 824 475 307 1880 ----
NM_003954chr1731219 1055 277 1504 --11177
NM_003955chr1751482 602 536 301 144 --11394 --
NM_003958chr6133741 3649 3088 3030 2992 2938 1328 867 741 685 427 282 70 32514 1154 389 23108 888 --
NM_003971chr17368 62 41 ------
NM_003977chr111100 ------
NM_003980chr62590 65 ------
NM_003983chr16114457 4399 4145 3691 3225 1616 1219 1145 1042 981 402 --2867 457 --
NM_003987chr1061647 1638 1628 1614 1567 1507 --11543 --
NM_003988chr1061724 1715 1705 1691 1644 1584 --11620 --
NM_003989chr1061583 1574 1564 1550 1503 1443 --11479 --
NM_003990chr1061583 1574 1564 1550 1503 1443 --11479 --
NM_003994chr1263505 3371 3094 2719 1685 1546 ----21726 1689
NM_003998chr42497 158 ------
NM_004006chrX2802 526 11809 32139 2029 594 --
NM_004007chrX2802 526 11809 32139 2029 594 --
NM_004009chrX2802 526 11809 32139 2029 594 --
NM_004010chrX2802 526 11809 32139 2029 594 --
NM_004011chrX2802 526 11809 32139 2029 594 --
NM_004012chrX2802 526 11809 32139 2029 594 --
NM_004013chrX2802 526 11809 32139 2029 594 --
NM_004014chrX2802 526 11809 32139 2029 594 --
NM_004015chrX2802 526 11809 32139 2029 594 --
NM_004016chrX2716 440 11723 32053 1943 508 --
NM_004017chrX2802 526 11809 32139 2029 594 --
NM_004018chrX2716 440 11723 32053 1943 508 --
NM_004019chrX2332 52 --198 --
NM_004020chrX2802 526 11809 32139 2029 594 --
NM_004021chrX2716 440 11723 32053 1943 508 --
NM_004022chrX2716 440 11723 32053 1943 508 --
NM_004023chrX2716 440 11723 32053 1943 508 --
NM_004028chr1853847 3626 1619 1521 880 13277 1354 --
NM_004034chr101446 --1189 --
NM_004035chr1784411 4387 3934 1820 1095 1076 556 251 --15189 13321
NM_004040chr251241 1208 1175 1166 138 1341 --11146
NM_004050chr1482287 2080 2038 967 921 870 609 585 --12315 --
NM_004059chr94433 407 124 53 ------
NM_004061chr53643 534 146 ----1578
NM_004063chr81660 ----1124
NM_004067chr731585 1257 575 1303 ----
NM_004077chr122374 293 182 --11000
NM_004080chr731483 567 299 ------
NM_004081chrY2226 95 ------
NM_004085chrX2806 594 ------
NM_004086chr141638 ----1152
NM_004087chr361510 1350 1340 475 459 24 --170 --
NM_004090chr1742795 2673 2496 386 22934 2904 11176 --
NM_004093chr1342379 674 478 303 1777 12177 --
NM_004096chr1091544 1536 1341 824 778 668 643 445 186 --2653 141 --
NM_004098chr102978 806 --11192 --
NM_004100chr672574 2568 1764 1004 960 378 75 12031 --11962
NM_004112chr173574 556 454 21405 1227 ----
NM_004113chr342017 1599 764 153 --11967 --
NM_004114chrX1795 --165 --
NM_004115chr131139 ------
NM_004116chr23451 410 138 ------
NM_004124chr1463456 2730 2279 689 519 354 12583 13174 12324
NM_004130chr32646 460 ------
NM_004132chr1051067 928 835 273 194 --1847 --
NM_004134chr51651 1578 ----
NM_004136chr1562710 2361 2303 2190 486 166 --1912 --
NM_004156chr81464 --1418 --
NM_004161chr221316 348 ------
NM_004162chr331127 1002 33 ------
NM_004170chr91420 --11347 --
NM_004171chr11229524 9281 9225 8769 8506 8299 8244 6579 6532 6319 6192 3526 3173 2894 2464 2031 1705 1645 1448 1439 1179 463 36983 6829 2885 38885 2777 1112 17397
NM_004175chr222106 30 ------
NM_004180chr22459 245 ------
NM_004185chr13635 625 111 ------
NM_004199chr5174 ------
NM_004200chr1163231 2956 2885 2074 1197 808 13213 ----
NM_004210chr1092099 1714 1654 1606 845 573 265 88 36 --2394 117 11564
NM_004215chr8--1504 ----
NM_004228chr191114 ------
NM_004229chrX41530 1406 668 346 ----22174 1618
NM_004232chr1863887 2899 1516 980 883 302 22692 1462 21067 676 --
NM_004235chr9----1218 --
NM_004236chr152426 374 ----1480
NM_004239chr141124 ------
NM_004241chr101117 ------
NM_004253chr91873 1929 ----
NM_004255chr15----1112 --
NM_004261chr12773 28 ------
NM_004272chr511814 ----1650
NM_004274chr1452488 319 287 216 99 --23191 1028 --
NM_004277chr62179 168 ------
NM_004279chr742386 1940 799 179 1143 12334 --
NM_004287chr1752307 2245 2133 885 644 1866 12009 --
NM_004290chr531120 1032 521 1376 1880 11036
NM_004295chr1731244 425 406 ------
NM_004296chr1483970 3952 3432 3003 1410 1027 902 239 23624 1129 ----
NM_004301chr3230 21 ----1239
NM_004302chr1282720 2624 2579 2482 2458 2256 2187 104 ------
NM_004304chr22345 24 ------
NM_004308chr1171744 1707 609 316 189 133 31 ------
NM_004311chr1072977 2947 2792 2756 2065 691 341 --31221 1192 226 12053
NM_004316chr1231185 831 467 1391 ----
NM_004320chr162336 72 ------
NM_004321chr252486 1288 1112 730 204 --1703 --
NM_004326chr181038 992 924 828 804 760 342 325 ------
NM_004329chr10--1184 21033 556 11259
NM_004330chr1531176 776 306 ------
NM_004331chr811791 2993 318 --1906
NM_004338chr18146560 6049 5946 5133 4710 4695 4546 2200 2025 1960 1745 1632 553 148 12637 22516 2315 --
NM_004342chr712132 11441 11733 --
NM_004349chr811078 --11267 --
NM_004352chr161522 1380 --1120
NM_004354chr42867 124 ------
NM_004364chr1931184 1126 971 --1166 --
NM_004369chr22295 216 1526 --1645
NM_004370chr631830 1627 592 --11834 --
NM_004371chr13620 189 142 2385 71 1146 --
NM_004380chr1642409 2360 2209 647 --1737 --
NM_004383chr151449 ------
NM_004384chr541879 557 310 194 ----1183
NM_004385chr53679 664 600 ------
NM_004386chr1991975 1913 1895 1653 1470 515 186 155 140 --146 --
NM_004389chr23589 230 101 1635 1593 --
NM_004392chr1342655 1626 348 91 1541 ----
NM_004393chr312340 21706 379 ----
NM_004395chr55714 698 230 181 57 ------
NM_004397chr11134169 3755 3611 3482 3462 3226 2978 2883 1670 1584 763 570 73 23707 3115 1942 --
NM_004399chr124853 808 664 40 1816 ----
NM_004414chr212484 393 ------
NM_004417chr51594 --1131 1599
NM_004420chr1172198 2088 1620 1591 1553 612 458 --11542 --
NM_004422chr17--1322 ----
NM_004423chr3162601 2454 2391 2249 2242 2141 2107 1814 1095 1014 422 383 370 305 201 56 --1221 --
NM_004427chr121114 780 11099 ----
NM_004428chr12548 251 1271 ----
NM_004429chrX61030 960 940 227 215 59 ------
NM_004430chr852608 2235 1043 796 395 22174 968 ----
NM_004432chr91408 ------
NM_004433chr161484 1294 627 549 256 198 11606 ----
NM_004437chr193267 2298 1406 1234 1079 1046 608 574 188 --23271 171 --
NM_004438chr252647 2530 2139 926 352 2295 100 --1796
NM_004440chr651621 1568 593 413 282 1274 ----
NM_004441chr331276 1195 418 ------
NM_004442chr161588 1452 541 370 357 48 --1470 --
NM_004446chr1265 33 ------
NM_004447chr124731 454 436 160 ------
NM_004449chr2111110 ------
NM_004451chr111585 1744 ----
NM_004454chr331929 661 380 --42012 1729 887 510 --
NM_004457chr251702 1633 1079 606 188 ------
NM_004458chrX4845 467 222 58 --22311 1943 --
NM_004459chr1761790 1660 1515 1384 1338 537 ------
NM_004463chrX1491 ------
NM_004464chr453645 995 892 657 443 13044 --13556
NM_004468chr13541 73 58 ------
NM_004472chr52193 51 ------
NM_004474chr14924 691 649 295 ------
NM_004480chr142701 179 --1533 --
NM_004481chr182469 2454 2290 2125 2110 2016 1816 206 ----1985
NM_004482chr22759 753 --1765 --
NM_004484chrX2333 305 ------
NM_004485chr1153861 3807 3212 2985 2892 2812 2773 2764 2758 2751 2681 1065 443 180 28 ------
NM_004492chr152173 34 ------
NM_004494chr191207 1197 1017 815 808 370 239 197 119 --1123 --
NM_004497chr192591 539 ------
NM_004500chr1442050 753 187 84 --1532 --
NM_004501chr163950 3299 2894 1106 488 120 13851 ----
NM_004504chr231923 663 500 22440 186 1516 --
NM_004505chr1732013 1515 422 ------
NM_004514chr1762810 1927 806 587 436 246 11043 11199 --
NM_004519chr81193 --1248 --
NM_004520chr51176 ------
NM_004521chr10189 ------
NM_004525chr221260 375 ------
NM_004529chr931413 1110 233 ----1575
NM_004535chr2021493 347 ------
NM_004540chr212697 104 ------
NM_004561chr1131849 689 183 21643 502 ----
NM_004566chr1052460 1665 854 549 217 21895 906 ----
NM_004573chr155773 547 250 217 49 ------
NM_004575chr441461 1260 583 52 21080 484 ----
NM_004576chr51288 ------
NM_004583chr172631 242 ------
NM_004584chr111645 ------
NM_004586chrX65153 4017 1595 1243 1082 154 64687 3900 3671 2050 951 878 45140 3656 2178 1952 --
NM_004588chr11103973 3716 3452 3219 3096 2925 2644 1630 1228 1084 12632 23676 2802 --
NM_004593chr31896 --1774 --
NM_004598chr5113023 2562 2189 2121 1105 868 817 422 268 114 98 1901 12928 --
NM_004600chr141553 1508 1042 541 --21083 231 11334
NM_004602chr2021426 561 ------
NM_004612chr983575 1612 1521 700 244 190 114 28 13652 23247 1272 --
NM_004616chr12--142 ----
NM_004619chr141759 1731 278 212 1547 ----
NM_004622chr24699 553 285 182 ------
NM_004626chr113602 552 481 ------
NM_004630chr1181131 1103 1040 960 939 256 250 241 ------
NM_004631chr121246 1229 --11258 11070
NM_004634chr33572 85 44 ------
NM_004637chr351329 1288 1156 1115 80 ------
NM_004639chr61100 ------
NM_004641chr1041229 607 523 119 ------
NM_004643chr142728 537 ------
NM_004645chr173746 536 276 ------
NM_004654chrY164 --126 --
NM_004655chr1721390 1120 ------
NM_004656chr381221 1196 1143 1102 1068 964 851 395 ------
NM_004660chrY12082 ------
NM_004663chr152616 411 --11458 --
NM_004667chr152638 222 ------
NM_004670chr1041651 1265 671 421 11551 ----
NM_004671chr18159 ------
NM_004673chr121157 451 ------
NM_004685chr1352025 1979 1109 630 559 ------
NM_004686chr861560 1385 614 437 391 348 ----1681
NM_004687chr1762119 2002 517 502 470 52 --1183 --
NM_004690chr62653 154 ------
NM_004698chr12177 53 ------
NM_004703chr1752082 1888 1567 529 135 12352 ----
NM_004705chr114725 606 306 222 ------
NM_004709chrX71548 1438 1297 543 241 221 179 ----1235
NM_004715chr182707 691 ------
NM_004716chr114858 810 783 34 --1716 1106
NM_004718chr22484 55 --1648 --
NM_004723chr111031 ------
NM_004725chr1021322 478 --11246 --
NM_004726chrX135321 5167 5121 4002 3837 3485 1086 978 813 734 660 541 144 --2569 295 14703
NM_004730chr542131 2003 1928 528 --12122 --
NM_004734chr1372289 2281 1255 925 655 596 268 1437 12159 --
NM_004736chr141958 184 73 52 21718 344 ----
NM_004738chr2022450 1608 1124 21005 833 --
NM_004742chr361567 656 362 302 127 112 11487 ----
NM_004744chr463529 2688 2434 1577 709 188 13451 ----
NM_004745chr8126601 6491 5999 4953 4793 4713 4430 4397 4293 2744 1594 313 15429 46962 5018 4871 1925 16635
NM_004746chr183342 317 271 --163 --
NM_004747chr1041484 1400 400 146 ------
NM_004755chr142870 38 --1874 --
NM_004756chr1921146 472 11338 --11499
NM_004757chr4----1113 --
NM_004758chr1741129 401 317 162 11099 --1973
NM_004759chr1122020 1568 1419 1406 726 673 570 443 420 353 104 53 171 --11540
NM_004760chr752211 1555 742 626 67 1668 12434 --
NM_004762chr1751860 1286 283 232 52 --21491 97 11484
NM_004764chr122646 204 ------
NM_004768chr12964 52 --1322 --
NM_004772chr541402 1361 1273 448 ------
NM_004774chr17112488 2445 2435 2398 2147 1118 898 768 608 338 214 ------
NM_004775chr1851476 828 420 166 106 ------
NM_004781chr141724 672 483 210 198 ----
NM_004781chr141724 672 483 210 198 ----
NM_004783chr16----1520 --
NM_004785chr161493 ------
NM_004788chr11122540 1910 1863 911 719 351 291 285 265 97 87 67 31045 1032 537 12043 --
NM_004789chr92375 361 ------
NM_004792chr2----173 --
NM_004796chr1442312 2250 1978 744 1189 22300 1816 --
NM_004797chr3133362 3273 3264 3232 3224 3208 3191 3004 2877 741 633 459 103 21158 691 --12757
NM_004798chr20113547 3534 2724 2577 2409 929 691 345 333 306 190 --1864 --
NM_004801chr22456 82 1483 ----
NM_004805chr241413 913 241 115 ------
NM_004821chr54628 594 586 188 ------
NM_004822chr1793914 3741 3270 3082 2844 1524 926 658 541 ------
NM_004824chr651332 1068 1016 544 398 ------
NM_004831chr192755 720 1395 1927 --
NM_004835chr31176 1821 162 --
NM_004835chr31176 1821 162 --
NM_004839chr156618 452 180 171 151 76 ------
NM_004840chrX62368 1652 675 365 144 136 ------
NM_004841chr15803 741 323 203 63 --1718 --
NM_004845chrX183913 3812 3717 3402 3322 3070 2953 2939 2913 2887 2874 2868 2841 2831 1587 1118 207 159 13601 13939 11087
NM_004850chr221622 183 ------
NM_004855chr151206 ------
NM_004857chr1484008 3392 3306 1586 1225 747 366 105 1343 13456 --
NM_004859chr1732735 2155 108 1593 ----
NM_004862chr1641083 438 129 46 ------
NM_004863chr14125095 4770 4083 3964 3926 3511 1841 1628 1136 1121 629 191 3532 209 181 33327 1031 654 --
NM_004865chr6--129 ----
NM_004866chr564208 3594 3532 1009 817 404 1587 14653 --
NM_004871chr17134238 3926 3916 3734 3586 3091 1507 1310 1259 922 803 763 178 1481 21722 959 --
NM_004872chr1--1425 ----
NM_004873chr1463068 2938 1195 930 240 52 22249 809 21144 593 11248
NM_004874chr82526 122 ------
NM_004887chr52970 299 --11006 --
NM_004896chr103621 609 370 11073 2403 131 --
NM_004897chr104928 649 640 144 ------
NM_004898chr452754 2273 2082 1950 696 --52591 2415 2138 1958 537 --
NM_004902chr201212 ------
NM_004904chr7146093 5234 5044 4964 4732 4718 4710 1964 1790 1632 684 610 579 55 26005 5691 25869 4763 16125
NM_004905chr12932 875 1642 ----
NM_004906chr61561 ------
NM_004922chr1031004 844 664 ------
NM_004924chr1941060 874 348 159 ------
NM_004926chr1471780 1748 1495 1318 451 214 69 11583 ----
NM_004929chr811492 1319 ----
NM_004930chr12219 50 ------
NM_004932chr531119 532 91 ----11416
NM_004938chr931103 262 152 ----1379
NM_004947chr351605 796 688 429 248 22376 997 1258 --
NM_004952chr13777 636 153 ------
NM_004953chr31300 ------
NM_004956chr784497 3549 3055 1135 878 816 630 42 --13127 11841
NM_004961chrX101456 1310 1297 1253 604 572 551 523 244 197 ------
NM_004964chr14524 484 474 83 ------
NM_004968chr73642 634 194 ------
NM_004973chr641067 551 492 120 ------
NM_004976chr11165195 4826 4486 4208 4188 4057 3593 3568 3560 3302 3253 1636 1481 1398 1102 661 14632 21847 636 --
NM_004978chr141598 1546 1354 1347 1481 11261 --
NM_004979chrX71049 1035 804 458 397 51 31 3788 737 447 1815 --
NM_004985chr12104205 3275 3058 2964 1799 1429 1339 1322 666 553 1417 1480 23690 179
NM_004990chr12167 ------
NM_004992chrX247777 7687 7162 7088 7075 7051 6996 6805 6685 6470 6376 6170 5878 5671 3060 2369 2048 1996 1829 1568 1306 1256 1216 61 28249 5199 35382 1802 957 17982
NM_004992chrX247777 7687 7162 7088 7075 7051 6996 6805 6685 6470 6376 6170 5878 5671 3060 2369 2048 1996 1829 1568 1306 1256 1216 61 28249 5199 35382 1802 957 17982
NM_004993chr1451369 1244 1016 553 453 ------
NM_004996chr1641714 1210 672 577 1455 ----
NM_004998chr154942 649 385 315 ------
NM_004999chr6103941 3654 3431 2983 1593 1384 1228 537 275 104 24359 1615 1314 24473 236
NM_005004chr10------130
NM_005010chr732139 2034 1889 --3448 283 34 --
NM_005011chr711753 ------
NM_005020chr73566 529 78 ------
NM_005023chr511539 ------
NM_005027chr1971112 1055 313 195 187 152 138 11035 ----
NM_005028chr1022244 826 11634 22253 777 --
NM_005030chr161267 ------
NM_005032chrX1184 1825 ----
NM_005040chr112333 29 ------
NM_005044chrX73714 3011 1276 905 516 124 93 23812 3439 1256 13025
NM_005056chr12155020 4157 4142 2193 2029 1982 1814 1806 1786 1676 1446 1332 482 449 390 --22069 420 --
NM_005060chr12528 83 --1998 11330
NM_005063chr10143275 2991 2454 1421 1199 956 673 443 264 238 210 200 173 24 21256 527 1220 --
NM_005065chr1474038 3758 3312 1978 636 321 160 --34885 2003 1904 --
NM_005066chr11199 --1718 --
NM_005067chr32632 291 --1392 --
NM_005068chr6--1221 11462 --
NM_005077chr91372 ------
NM_005078chr1541475 1452 1369 1173 ------
NM_005079chr882671 2271 630 424 371 193 173 125 --2358 214 --
NM_005080chr222737 299 152 1783 --
NM_005088chrX2911 268 ----1232
NM_005093chr20164117 3800 3494 3430 3300 3286 1729 1720 1444 1167 957 913 801 528 258 201 12046 ----
NM_005095chr152173 1584 876 807 96 ------
NM_005096chrX91114 1011 885 817 801 417 204 167 118 --2441 145 --
NM_005097chr10179 ------
NM_005099chr141253 517 245 133 ------
NM_005105chr162157 1913 1377 745 241 28 ------
NM_005109chr362531 2228 2113 1785 159 62 --11971 --
NM_005110chr56803 640 557 530 182 145 ------
NM_005112chr451036 860 781 173 21 --176 --
NM_005114chr41236 ------
NM_005116chr2084231 4098 3959 3859 3458 1487 685 375 ----1447
NM_005117chr113712 323 72 ----1357
NM_005121chr1743259 2996 438 81 ------
NM_005124chr61136 ------
NM_005126chr322151 369 1103 11953 --
NM_005128chr212653 247 ----1662
NM_005134chr182846 109 ------
NM_005135chr1583807 3578 3344 2588 899 753 660 576 --22701 823 11334
NM_005151chr183898 792 426 ------
NM_005153chr161749 ----1753
NM_005154chr151466 ------
NM_005156chr9104773 4741 4706 4245 3798 3643 3440 1930 1151 957 45343 4915 1007 395 --1624
NM_005157chr981924 1881 1749 1329 715 567 460 370 --21956 1585 --
NM_005159chr1532134 1998 1721 31401 672 138 21907 436 11947
NM_005160chr2295781 5743 5642 5100 4705 4640 4395 4384 2104 1584 26059 551 --
NM_005168chr211300 --1404 --
NM_005171chr1211008 ------
NM_005175chr17199 ------
NM_005176chr12159 ------
NM_005180chr1041259 1219 544 241 ------
NM_005181chr82767 653 ------
NM_005182chr163429 241 41 ------
NM_005184chr1991423 1410 1233 1065 350 302 216 49 34 11438 ----
NM_005187chr16111654 1569 1488 1322 807 410 389 380 371 365 344 --21310 374 --
NM_005188chr11237735 6788 6033 5973 5929 5692 5659 5437 5320 3141 3128 3076 3056 2984 2782 2465 2311 2258 1917 1383 1367 1228 86 57889 6802 2034 1237 911 57264 7131 3284 1920 585 --
NM_005191chr351212 1044 367 113 69 ----11050
NM_005197chr14175509 5469 4992 4949 4808 4532 4374 2495 1734 1715 1494 1471 1457 1262 904 169 141 34384 2221 1709 25379 757 --
NM_005202chr152187 1799 811 281 41 12161 ----
NM_005204chr10166 1728 ----
NM_005206chr1731098 931 410 11059 ----
NM_005207chr2253419 2417 1012 77 55 31253 953 945 13169 13305
NM_005215chr181759 ------
NM_005219chr581566 1348 1122 572 465 413 288 131 --193 11284
NM_005222chr79960 847 390 271 220 214 189 171 142 ----1633
NM_005227chr1----1458 --
NM_005229chrX21093 201 ------
NM_005230chr122480 241 ------
NM_005233chr32825 510 --11007 --
NM_005235chr2247709 7618 7587 7574 7433 6439 6292 5755 5562 5452 5442 5304 5040 4788 4749 2828 2548 2446 1524 964 352 224 84 68 15163 56133 5367 1959 870 679 12165
NM_005238chr1142661 2175 1399 867 12582 13042 --
NM_005239chr2132032 1544 1348 ------
NM_005241chr341241 1087 958 389 ------
NM_005249chr141130 1291 ----
NM_005252chr141305 ------
NM_005254chr1551285 1087 1077 494 433 ------
NM_005257chr1861286 1270 1156 930 352 121 --1886 --
NM_005259chr21993 ------
NM_005261chr8----1271 --
NM_005264chr104768 170 146 68 ------
NM_005268chr11225 ------
NM_005271chr1041001 862 94 32 1247 1264 --
NM_005274chr11128 ------
NM_005277chr431603 1415 1285 176 --11331
NM_005278chrX1562 ------
NM_005296chrX2983 217 ------
NM_005302chr71302 ------
NM_005308chr10----1348 --
NM_005311chr792744 2568 1909 1795 830 782 733 551 209 --1712 --
NM_005313chr1511008 2868 321 1363 1150
NM_005328chr83706 699 593 --2556 50 --
NM_005329chr1652262 2213 1645 1575 884 ------
NM_005334chrX91656 1557 1519 587 242 145 139 128 30 --1572 --
NM_005336chr232029 843 407 ------
NM_005338chr7123556 3406 2630 2508 1616 1514 1194 1167 1140 927 917 435 33889 3248 2949 23123 1620 13158
NM_005339chr484077 3518 3335 3257 1166 813 664 40 --24069 427 --
NM_005342chrX32542 1928 862 12685 32518 2046 865 --
NM_005347chr921208 475 1376 11447 --
NM_005348chr141898 ----150
NM_005349chr41483 ------
NM_005358chr1331856 672 509 ------
NM_005359chr18186461 5234 5190 5178 5056 4985 4874 4365 4351 4227 2527 2161 1950 1896 1711 1395 771 185 24202 302 25963 1953 --
NM_005370chr193523 327 321 11262 ----
NM_005373chr1101622 1505 1471 1464 1390 419 243 236 119 56 --21394 228 2467 378
NM_005374chr1762107 2094 1919 1804 1782 614 --22364 391 --
NM_005375chr61163 ------
NM_005380chr141300 1174 1037 273 ------
NM_005385chr352443 1936 1073 991 898 12017 ----
NM_005386chr203855 698 682 ------
NM_005387chr113261 236 183 --2601 205 --
NM_005388chr951603 1344 536 80 73 ------
NM_005389chr62680 23 ------
NM_005392chr941726 1187 490 322 --11672 --
NM_005397chr7123599 3526 3068 2529 2519 1435 1400 976 912 654 594 189 --13589 --
NM_005398chr1011273 1555 11436 --
NM_005399chr194242 3210 2801 2789 2765 1326 1083 705 561 54270 756 619 129 22 33480 1086 487 22927 582
NM_005400chr2112972 2761 2752 2675 2669 2492 2250 2140 1962 956 656 1520 ----
NM_005402chr731868 1747 1373 --2389 335 --
NM_005406chr1811378 ------
NM_005407chr1461584 1286 1228 307 300 238 --21251 410 1102
NM_005409chr42421 368 ----11079
NM_005410chr51676 --1752 2620 599
NM_005412chr122490 182 ------
NM_005413chr24430 365 86 77 ------
NM_005415chr2----1268 --
NM_005417chr2081854 1749 1722 1311 757 523 139 99 ------
NM_005430chr124967 848 811 382 --1951 --
NM_005433chr1872570 2194 2151 1947 689 309 90 --12810 --
NM_005436chr1083941 3474 3244 2809 888 703 417 78 43012 2872 1421 746 14088 --
NM_005437chr103915 420 116 ----11108
NM_005439chr124516 509 222 74 ------
NM_005440chr17113270 3201 2846 2484 2333 1049 703 433 393 385 186 12443 ----
NM_005442chr32619 71 ----1138
NM_005443chr41467 ------
NM_005445chr101125 ------
NM_005453chr61224 1232 1110 --
NM_005455chr131435 1223 743 11614 ----
NM_005458chr932187 1882 421 --12162 --
NM_005460chr53146 100 74 ------
NM_005474chr1771271 1264 1119 569 266 191 22 --1130 --
NM_005475chr1292874 2640 2275 2051 1261 1076 504 339 150 ----11134
NM_005476chr94519 208 149 29 ------
NM_005477chr1572427 2213 896 743 38 31 24 --12430 --
NM_005477chr1572427 2213 896 743 38 31 24 --12430 --
NM_005479chr1041589 1213 1017 618 ------
NM_005483chr19----1365 --
NM_005486chr171626 2587 52 1488 --
NM_005487chr2261911 1763 1486 1449 528 89 ------
NM_005493chr62860 716 ----1271
NM_005494chr71147 ------
NM_005497chr17106139 5870 5579 5239 4335 4029 3962 3831 1693 927 11457 11574 1713
NM_005499chr19172 ------
NM_005502chr942802 2635 2343 54 1645 --12252
NM_005504chr12116180 5392 4754 4370 4287 2040 1707 1578 762 616 289 --25192 4293 --
NM_005506chr442814 2577 2060 1019 ------
NM_005507chr111441 1350 ----
NM_005509chr51429 --2402 78 --
NM_005512chr1171523 1478 1416 1285 1266 557 134 --11302 --
NM_005517chr151196 1171 350 251 232 --11336 11370
NM_005520chr52771 726 ------
NM_005522chr741006 346 285 111 --11284 --
NM_005524chr31328 ------
NM_005530chr1581449 1295 1261 1188 1170 1024 313 58 --31471 1201 561 1456
NM_005537chr131130 --1849 --
NM_005542chr721710 1336 ------
NM_005544chr2154 ----159
NM_005552chr144184 167 122 88 1588 1536 --
NM_005561chr134855 370 45 38 1768 ----
NM_005562chr11676 --1493 11711
NM_005563chr12835 578 ------
NM_005565chr54406 193 132 40 ----1139
NM_005568chr17152 ------
NM_005569chr2221100 53 ----11238
NM_005570chr1841140 1041 826 473 21030 242 ----
NM_005573chr52601 145 --2664 102 --
NM_005574chr111134 ------
NM_005578chr3144965 4809 4796 4788 4764 4083 3873 3742 3415 3202 1952 1921 991 485 --2954 855 --
NM_005584chr13------1115
NM_005587chr151122 ------
NM_005593chr122438 196 --1449 --
NM_005595chr11876 ------
NM_005596chr9146191 6138 5918 5762 4367 3946 2510 2008 1678 1407 811 792 629 394 12196 --14235
NM_005599chr131362 529 154 --21314 1190 --
NM_005604chr652174 2051 820 775 576 186 --1190
NM_005607chr82977 714 --149 --
NM_005610chr13287 104 45 ------
NM_005611chr16--154 1924 --
NM_005613chr152136 1888 1598 868 146 ----11609
NM_005614chr74912 669 417 97 ------
NM_005618chr62630 34 ------
NM_005625chr821059 999 --2674 257 1794
NM_005626chr12206 152 ------
NM_005634chrX2239 206 ------
NM_005637chr181834 --1491 1839
NM_005638chrX31518 680 120 1511 11406 --
NM_005639chr1231555 212 83 ----11279
NM_005647chrX62326 1336 858 843 588 544 13024 13304 --
NM_005655chr841091 920 487 242 ----1368
NM_005660chrX138 ------
NM_005662chr8181 ------
NM_005665chr163659 3621 3107 1472 1436 892 13362 13050 --
NM_005667chr2----121 --
NM_005668chr553830 2837 1334 578 534 11235 13309 12848
NM_005669chr551809 1753 955 350 240 --12290 --
NM_005684chr12283 139 ------
NM_005686chr151451 1424 514 287 250 11283 134 --
NM_005688chr331021 483 403 --1486 --
NM_005697chr153224 189 34 ------
NM_005711chr52441 250 ------
NM_005715chr682443 2299 2248 2034 1774 1003 697 193 --1431 --
NM_005717chr12223 103 1831 --1167
NM_005721chr2--1352 ----
NM_005722chr262286 1882 851 605 445 351 --3688 459 50 1254
NM_005725chr131585 876 438 --1672 --
NM_005730chr12113405 3290 3064 3000 2951 1244 1153 980 791 345 60 12758 12585 --
NM_005734chr112644 203 1284 ----
NM_005735chr23652 619 161 159 ----
NM_005737chr282897 2879 2861 2818 2056 1796 1065 1002 ------
NM_005738chr751289 608 476 199 41 ------
NM_005739chr1561887 1807 1524 897 868 175 --1455 --
NM_005742chr22634 275 --179 --
NM_005746chr732662 2073 1867 ------
NM_005748chr1273350 3045 2776 2548 2298 1256 473 13205 1318 --
NM_005749chr17----1515 --
NM_005751chr7147 ------
NM_005754chr551187 997 805 467 187 ------
NM_005756chrX61378 1032 1000 561 485 442 ------
NM_005765chrX1575 ------
NM_005768chr123576 134 70 1513 ----
NM_005772chr92749 538 ------
NM_005776chr141245 --1852 1297
NM_005778chr31371 --1483 --
NM_005779chr573400 3147 943 771 728 319 92 --1435 1801
NM_005783chr21420 --1227 --
NM_005786chr184990 886 212 93 177 ----
NM_005789chr1721916 436 12152 2468 198 --
NM_005796chr162252 45 ------
NM_005797chr1131804 371 152 ----11528
NM_005801chr172613 64 ------
NM_005802chr91257 --1530 --
NM_005808chr3153390 3328 3224 3000 2820 2736 2709 2623 1344 1278 950 345 304 291 45 12325 ----
NM_005813chr231930 985 312 1709 ----
NM_005814chr141446 1093 941 74 --11264 --
NM_005817chr192113 35 ------
NM_005822chr682056 1844 1697 1645 820 371 275 36 184 21770 452 --
NM_005826chr11174 ------
NM_005828chr17194754 4636 4224 3971 3874 3751 3744 3738 1969 1790 1681 1647 1601 779 737 577 234 173 52 11544 34702 1929 340 --
NM_005832chr31255 --11035 --
NM_005834chrX2237 181 ------
NM_005839chr11376 ----1300
NM_005840chrX307655 7392 7207 6866 6860 6522 6472 6272 6188 5608 5467 5202 4804 2919 2495 2448 2406 2155 1833 1713 1077 664 617 566 527 501 494 481 234 202 67142 7034 6883 6236 5498 4647 34717 2159 1949 2683 400
NM_005841chr461059 917 873 226 152 114 ------
NM_005842chr132580 513 ------
NM_005843chr241831 1588 1538 1325 11736 21774 266 --
NM_005852chr1761169 1126 1045 843 409 150 ------
NM_005859chr531354 444 183 ----11491
NM_005862chr31823 --1968 --
NM_005863chr1031423 283 192 ------
NM_005864chr147711 680 654 325 282 159 52 ------
NM_005866chr92864 678 ------
NM_005870chr1341323 1297 1105 63 195 ----
NM_005875chr3------148
NM_005880chr1611228 ------
NM_005884chr193626 263 237 ------
NM_005885chr54178 59 44 34 ------
NM_005895chr1253227 2710 2577 1593 1089 33854 1000 119 11032 --
NM_005896chr23808 643 631 ------
NM_005898chr1183090 2764 2745 2301 2229 2144 2129 915 12089 11244 12721
NM_005900chr44803 437 115 23 --11194 --
NM_005901chr18218412 8307 8247 8173 7879 7163 7082 6831 6415 6129 5709 5578 5335 2613 2444 2114 1618 1501 455 417 49 27666 1953 27308 6220 --
NM_005902chr1594598 4580 2894 1818 1424 1081 1072 709 366 24615 1714 --14268
NM_005903chr5104475 4302 4169 3732 1974 1932 1645 1624 1408 671 14795 --14603
NM_005904chr1831042 594 140 --11055 --
NM_005907chr62490 61 --31629 442 188 3683 541 356
NM_005909chr584165 4089 3906 3531 3043 2712 1294 1219 ------
NM_005910chr17103885 3707 3527 3001 1011 911 738 399 297 90 13691 ----
NM_005911chr231182 410 100 ----11202
NM_005916chr72124 31 ------
NM_005920chr1133586 3497 3386 3319 3056 3050 2972 2898 2841 2533 1444 104 21 13089 --21476 849
NM_005923chr62525 59 ------
NM_005926chr151368 ------
NM_005927chr551015 1004 871 295 176 2456 429 ----
NM_005933chr11102835 2715 2425 2246 2078 2071 1955 1948 731 119 --22839 2482 --
NM_005934chr1961827 1724 945 939 545 73 --12131 --
NM_005935chr465280 5217 4007 1932 1767 1515 2845 510 34352 3566 3391 13219
NM_005937chr1764009 3589 3529 3274 2576 1114 --13652 --
NM_005941chr853323 2804 1312 327 221 14118 23327 258 12948
NM_005943chr651412 1139 646 516 192 --21399 162 --
NM_005944chr321093 332 ------
NM_005955chr1124966 4609 4564 4057 3406 3394 1709 1630 1469 1055 771 24 --35169 4347 1165 11536
NM_005962chr1081940 1866 1776 1716 759 326 320 95 --1535 --
NM_005962chr1081940 1866 1776 1716 759 326 320 95 --1535 --
NM_005964chr1731397 1231 1178 --11298 --
NM_005966chr22951 24 --1954 --
NM_005977chr131320 2977 241 ----
NM_005982chr141195 ------
NM_005986chr1342260 2171 2079 1035 ----1736
NM_005990chr5102751 2685 2191 2183 2062 1080 1005 734 333 61 22787 1813 12642 --
NM_005996chr123624 174 105 --11051 --
NM_006011chr15154212 4123 3827 3773 3605 3455 3364 3322 3020 2913 2827 2669 966 909 410 13849 23930 3886 --
NM_006015chr161258 1249 929 828 155 74 ------
NM_006016chr6----12185 --
NM_006020chr1481167 1073 863 483 446 297 286 21 --21308 519 --
NM_006022chr132421 346 --11030 --
NM_006036chr21177 11813 12293 1385
NM_006037chr2114822 4697 4678 4097 3560 3128 3112 3000 1648 524 25 1585 ----
NM_006039chr1721050 899 11130 ----
NM_006040chr164886 531 440 265 1514 11108 --
NM_006041chr171207 ------
NM_006047chr2042745 2375 887 520 1951 1751 --
NM_006048chr141206 1116 496 23 --21232 896 --
NM_006051chr51103 ------
NM_006054chr114524 331 273 148 1156 11381 --
NM_006055chr262958 2495 2434 2418 1280 409 --33059 2987 464 23090 756
NM_006060chr784285 3776 3750 3680 3311 3240 2724 892 1835 ----
NM_006064chrX1110 --1113 --
NM_006067chr1631022 889 180 ------
NM_006071chr222894 251 --1161 --
NM_006079chr61287 ------
NM_006080chr742987 888 607 289 1857 ----
NM_006089chrX61818 588 576 418 358 73 ------
NM_006090chr12582 540 ------
NM_006091chr1551771 1400 1251 1136 552 1160 21631 646 --
NM_006094chr872219 2106 1758 811 685 669 320 ------
NM_006095chr443006 1524 1488 915 23925 39 13844 14503
NM_006106chr1183022 2629 2598 2400 1179 983 422 311 12941 22508 141 --
NM_006110chr161130 ------
NM_006113chr141550 435 318 310 ------
NM_006116chr2251592 1573 1557 1308 1055 --1110 --
NM_006118chr12164 33 ------
NM_006129chr81532 ------
NM_006134chr2151609 1466 1345 1272 28 --11316 --
NM_006135chr151441 1198 572 463 181 1499 --11008
NM_006136chr711170 --1263 --
NM_006139chr21406 --1561 --
NM_006141chr1622259 934 12790 ----
NM_006142chr12473 175 1305 ----
NM_006145chr1941079 825 410 336 ------
NM_006147chr12319 27 --1410 2313 101
NM_006148chr17102761 2442 2259 2071 1954 763 314 308 222 159 --22445 185 --
NM_006153chr3--1255 ----
NM_006157chr111379 ------
NM_006158chr851464 1324 1249 358 172 11157 11819 --
NM_006159chr122646 211 ------
NM_006160chr1761577 1469 1384 635 236 210 ------
NM_006161chr52270 239 ------
NM_006166chr1252149 1661 1042 843 436 11968 22594 1724 --
NM_006167chr872029 971 952 841 617 607 57 --12327 12041
NM_006177chr142900 76 ------
NM_006180chr982140 1803 1678 821 627 535 241 214 ------
NM_006183chr12----1107 --
NM_006185chr112244 89 ------
NM_006186chr2--1459 ----
NM_006187chr1283200 1033 1023 945 847 512 344 263 33002 2661 704 ----
NM_006191chr123920 694 83 ------
NM_006194chr1441316 532 183 141 1455 ----
NM_006195chr921361 1263 1922 ----
NM_006203chr583841 3832 3743 3492 2229 1960 551 345 13610 21972 1654 14086
NM_006206chr432428 405 44 1952 1804 --
NM_006209chr81352 ----1160
NM_006212chr1175203 4757 4539 4240 3784 3662 3504 2062 2013 1661 1424 758 660 643 508 329 108 23618 3375 32166 1328 1009 --
NM_006216chr22510 61 ------
NM_006224chr1782294 1917 914 907 867 672 619 317 --21619 940 --
NM_006226chr22440 180 ------
NM_006228chr82441 315 ------
NM_006237chr1352159 2133 1424 727 155 --169 11676
NM_006238chr6121972 1864 1469 1425 445 394 338 311 281 267 231 152 ------
NM_006241chr33913 904 830 21827 790 22178 855 1973
NM_006243chr14738 732 313 21 --1898 --
NM_006245chr64862 381 175 111 --1335 --
NM_006246chr1421030 852 1149 1472 --
NM_006247chr191142 ------
NM_006251chr553194 2488 2420 2062 400 22246 2133 33020 1285 1037 --
NM_006252chr196703 6547 4974 4804 2861 2488 1479 1112 810 16481 --11871
NM_006256chr142733 2383 1738 465 ------
NM_006257chr10178 ------
NM_006267chr251843 1788 699 519 330 --2662 522 --
NM_006268chr118916 736 373 354 244 177 90 45 --1398 --
NM_006275chr2032421 1908 84 1679 --1530
NM_006279chr11843 ------
NM_006281chr81224 1285 ----
NM_006281chr81224 1285 ----
NM_006282chr20134767 4726 4657 4248 4226 3866 3394 2963 1652 1131 1002 821 315 14271 ----
NM_006283chr8104423 4015 3569 1884 1556 1497 783 360 348 47 11130 34031 1895 895 14387
NM_006287chr242613 726 542 299 --22522 358 181
NM_006288chr1141224 269 201 62 ------
NM_006292chr11356 48 34 --1184 --
NM_006306chrX95086 4781 2208 1722 1467 1364 730 635 584 34978 2285 211 --12094
NM_006310chr1721159 99 ------
NM_006311chr172325 44 ------
NM_006313chr12--21276 609 1130 1299
NM_006315chr4103751 3429 3362 3193 1499 1348 475 314 223 81 --11509 11253
NM_006317chr59782 639 607 118 104 91 83 71 48 ------
NM_006320chr43322 311 295 ------
NM_006321chr35715 661 495 417 163 ------
NM_006323chr41488 ------
NM_006325chr121315 ------
NM_006327chr10279 53 --187 --
NM_006345chr42330 76 1392 ----
NM_006350chr51353 --1331 --
NM_006352chr141949 1926 218 56 ------
NM_006357chr24470 128 74 45 ------
NM_006359chrX52327 2027 497 435 303 ----22034 184
NM_006361chr1751992 1930 1701 1387 416 --11695 --
NM_006364chr142911 64 11032 ----
NM_006366chr641037 865 486 41 --11191 --
NM_006367chr161067 967 820 675 196 111 --184 1443
NM_006369chr13409 119 99 ------
NM_006372chr61109 1159 ----
NM_006375chrX41483 1403 390 101 --2509 443 1619
NM_006378chr981462 1026 1013 320 191 182 154 140 ------
NM_006379chr751891 1826 1776 814 344 1881 11780 --
NM_006382chr171270 ------
NM_006386chr22112439 2311 2084 1859 1675 1660 1512 189 100 76 65 ----1710
NM_006389chr11121292 1219 858 519 508 434 410 380 290 187 112 53 --11063 --
NM_006393chr10103230 2970 2831 1233 1161 553 386 255 162 119 13625 22920 872 11334
NM_006400chr122132 80 ------
NM_006405chr144210 168 73 31 ------
NM_006407chr331056 496 474 --1560 --
NM_006409chr71230 ------
NM_006410chr111486 ------
NM_006420chr2052585 2533 2355 1336 139 --12771 --
NM_006421chr84828 347 92 39 --1871 --
NM_006422chr12288 29 ------
NM_006430chr23508 485 201 ----199
NM_006439chr43526 448 354 ------
NM_006449chr231576 1529 23 ------
NM_006451chr52382 343 ----21108 311
NM_006457chr484017 3782 3035 2931 1633 1250 1111 638 --13165 12905
NM_006459chr1051943 1741 1615 1431 226 ------
NM_006460chr1731550 1363 223 ------
NM_006464chr2154477 4069 4045 3240 1779 1664 1618 1607 1491 1115 680 589 449 264 252 24411 3377 31553 1543 170 34426 1074 299
NM_006465chr1562344 1994 1697 799 722 483 1600 21786 870 --
NM_006467chr541998 1741 458 214 1205 ----
NM_006469chr111442 ------
NM_006471chr18163 ------
NM_006478chr22385 48 42 1268 ----
NM_006482chr1283209 1339 1043 849 807 797 784 398 --31239 1100 547 --
NM_006489chr1431541 1431 1263 21849 1322 31842 212 41 --
NM_006496chr141248 1239 690 490 ------
NM_006504chr10112937 2577 2567 2476 2463 2356 2272 2240 1980 1909 331 32043 2003 297 12991 --
NM_006510chr671039 1020 868 854 668 411 157 --3744 352 148 --
NM_006516chr161425 1210 1028 642 436 123 11456 11434 --
NM_006517chrX42073 1500 631 612 --1601 --
NM_006519chr6392 39 31 ----152
NM_006520chrX2344 57 ------
NM_006526chr2061888 821 621 460 259 79 ----1467
NM_006527chr41102 ------
NM_006532chr1962027 1775 1691 1538 1466 539 ------
NM_006534chr2043210 3202 2562 2387 1983 31285 511 411 12810
NM_006539chr161447 1187 ----
NM_006540chr831159 597 188 ------
NM_006544chr1485496 5343 4279 2210 2133 1672 1364 1058 35572 5282 1408 46003 3685 1272 38 1263
NM_006546chr17205949 5422 5221 4646 4596 4382 4335 4240 2512 2498 2287 2155 2143 2018 1879 1868 1673 1555 1518 418 25527 2269 26198 4666 16529
NM_006547chr741951 1682 606 317 11564 ----
NM_006548chr311199 --11710 --
NM_006549chr1252970 2864 1986 144 44 1872 12444 --
NM_006557chr941767 1205 1124 491 ------
NM_006558chr82495 389 ------
NM_006559chr131243 398 135 ------
NM_006560chr114537 471 127 38 ------
NM_006561chr10155927 5048 4905 4843 4803 4691 4385 4339 4272 3958 3830 2325 2214 1288 503 21969 1410 24981 4044 45525 5240 2453 1546
NM_006565chr1641105 884 358 33 ------
NM_006570chr93386 295 123 --158 --
NM_006572chr1753397 2779 2399 406 236 42788 2494 1204 1113 22983 1370 --
NM_006575chr1421442 1349 --1245 --
NM_006578chr1581547 1334 1290 1262 1228 700 171 72 --21579 422 --
NM_006584chr17127 ------
NM_006591chr1161827 1662 1606 628 562 501 1209 1385 --
NM_006593chr26664 647 624 315 299 252 1832 ----
NM_006595chr1132065 1468 435 21604 142 11495 --
NM_006599chr16208229 8152 7850 7565 7411 7180 5638 5586 5382 5243 3223 2575 2541 1787 1737 1704 1491 1437 816 671 11085 --17497
NM_006601chr125895 777 454 317 47 --1982 --
NM_006602chr202333 202 ------
NM_006603chrX31919 388 347 --1627 2727 103
NM_006609chr2102887 2388 2158 743 543 512 343 131 58 27 --22981 966 --
NM_006614chr322674 1368 22871 2851 12563 --
NM_006618chr171319 1171 1055 991 565 524 501 --1510 --
NM_006620chr6103585 3203 1870 1675 1146 690 586 357 167 52 13161 --13150
NM_006621chr161664 1605 786 335 90 81 11816 1675 --
NM_006624chr1021435 800 2300 114 ----
NM_006626chr96960 838 792 755 323 255 1150 ----
NM_006628chr15154367 4237 4014 3992 3516 3263 3030 1808 1740 1308 1156 388 371 256 80 34352 3098 1282 23857 1420 --
NM_006629chr1832446 1004 356 ------
NM_006633chr51776 1637 ----
NM_006644chr131569 ------
NM_006650chr563822 2629 2534 651 546 113 1397 23554 1036 --
NM_006651chr451506 1371 1226 553 250 1611 21447 205 --
NM_006654chr1294287 4277 4136 1894 1295 897 554 535 93 --24160 463 23973 1569
NM_006660chr152128 66 ------
NM_006662chr16----1326 --
NM_006667chrX--1451 1247 --
NM_006695chr171290 ------
NM_006698chr2071293 956 461 445 438 426 362 --1449 --
NM_006699chr1112741 2728 2605 2580 2506 2308 2288 2080 697 655 98 ------
NM_006703chr63527 183 99 ------
NM_006706chr53620 257 220 1562 ----
NM_006709chr63293 276 103 --158 --
NM_006717chr943410 3305 2636 2239 32901 1058 785 ----
NM_006718chr61424 ------
NM_006722chr352621 2140 776 510 41 12663 --199
NM_006726chr451134 1082 1075 917 64 --168 11138
NM_006729chrX135374 5338 4920 4901 4787 4694 4572 3930 3904 3684 3524 1343 959 65605 5407 5190 4497 4474 4314 54879 4565 3612 3438 1555 --
NM_006731chr9165345 4487 3555 2152 2034 1775 1647 1400 1272 1229 1076 421 279 255 153 30 85782 5373 4192 4031 3881 2240 1024 745 24346 2213 35126 1483 1086
NM_006732chr1972060 1837 1787 1701 556 413 138 11760 ----
NM_006735chr74362 232 97 44 ----1121
NM_006736chr23674 542 510 11714 ----
NM_006738chr1574399 3871 3652 3078 3013 2901 1831 31867 1375 585 ----
NM_006745chr42874 98 1136 ----
NM_006746chrX41472 522 84 38 --1539 --
NM_006749chr821168 1109 2461 404 ----
NM_006750chr16228099 7890 7608 7333 7055 6516 6231 5847 5457 5414 5238 4904 3175 2680 2402 2357 815 682 674 635 582 369 25001 2821 1990 15193
NM_006751chr21266 1994 1894 --
NM_006754chr71365 ------
NM_006756chr831401 1293 277 ------
NM_006761chr171698 ------
NM_006763chr131934 1712 863 --21589 463 --
NM_006766chr882626 2417 2402 1844 1645 735 607 162 12449 11651 12266
NM_006769chr1--1681 ----
NM_006772chr691721 1571 1451 1286 1247 1105 566 32 26 --1307 --
NM_006775chr643120 1042 410 394 122 ----
NM_006777chrX72438 2178 1933 1055 815 776 550 11088 ----
NM_006778chr621924 184 --1424 21680 28
NM_006783chr132251 49 ------
NM_006788chr1871813 1678 1519 561 512 428 111 --1131 --
NM_006790chr52380 150 ------
NM_006791chr153460 175 167 ------
NM_006805chr5--2195 133 1162 --
NM_006807chr172267 108 ------
NM_006814chr2052638 2255 2081 835 262 22479 1057 11781 --
NM_006815chr1241027 1019 301 293 ------
NM_006818chr16792 246 177 94 73 63 ------
NM_006823chr851343 1283 534 251 189 ------
NM_006825chr125855 719 694 260 188 1964 ----
NM_006826chr22471 433 ------
NM_006827chr1463039 2263 1064 969 469 345 ------
NM_006828chr6145 1107 ----
NM_006838chr1281913 1633 1548 1467 1242 540 377 30 ------
NM_006851chr1272949 2806 2442 2407 2200 847 86 22579 254 32307 792 702 --
NM_006852chr1772364 2353 1921 1111 942 932 825 11155 ----
NM_006856chr1241139 1078 1035 339 --1967 --
NM_006861chr1261501 1385 695 514 493 112 21789 706 ----
NM_006870chr20149 ------
NM_006873chr2113582 3317 3241 2868 2677 2506 1131 729 710 553 373 1459 11284 --
NM_006874chr421214 1127 ------
NM_006876chr111532 ------
NM_006884chr321414 762 11747 --11776
NM_006885chr1694214 2940 2815 2757 1698 1515 1094 1067 257 198 23115 2698 --
NM_006887chr24739 462 198 185 ------
NM_006888chr1463132 2901 1196 548 33 21 32585 2255 1024 ----
NM_006892chr2041283 1198 1099 250 ------
NM_006892chr2041283 1198 1099 250 ------
NM_006894chr12312 305 ------
NM_006901chr151505 ------
NM_006913chr6197 1330 --1438
NM_006914chr951536 1166 1094 618 248 --1586 --
NM_006915chrX42472 2223 715 250 1333 ----
NM_006920chr221957 492 --182 --
NM_006922chr252335 2029 982 865 309 ----1664
NM_006924chr1753763 3686 3678 1380 1221 1995 32849 871 52 --
NM_006930chr531917 1280 559 11702 ----
NM_006931chr1271809 1666 1611 1529 867 204 116 --1486 --
NM_006937chr17----2151 120 --
NM_006939chr141449 --2917 436 --
NM_006940chr1291475 1401 1245 759 573 553 543 488 472 ------
NM_006943chr20133307 3298 2958 2948 2894 2820 880 819 669 644 397 357 285 22830 2316 ----
NM_006947chr451679 1394 681 431 345 --21286 263 --
NM_006948chr2132431 1736 721 22066 89 22046 701 11799
NM_006950chrX4775 698 213 44 1650 ----
NM_006955chr1023416 1241 ----1550
NM_006958chr84150 75 53 42 ------
NM_006973chr102143 25 ----154
NM_006979chr62554 34 ------
NM_006981chr942913 2633 503 33 --2658 522 12923
NM_006987chr1731228 1054 174 ------
NM_006988chr2121036 784 1221 ----
NM_006990chr1112534 1758 1568 798 749 712 571 553 509 299 184 3877 595 361 21784 615 --
NM_006991chr31254 1912 --174
NM_006996chr12457 23 --11455 --
NM_006997chr101124 --1452 --
NM_006999chr531799 593 36 --11654 --
NM_007005chr931596 1539 61 11009 ----
NM_007007chr1274731 4246 3668 3237 3174 2945 1419 --14334 1542
NM_007008chr21582 ------
NM_007011chr15176762 6472 5869 5622 5297 4704 4628 4542 4364 2149 1922 1873 1572 1434 1396 533 254 21244 990 55494 4358 1987 823 39 11910
NM_007013chr831010 411 165 ------
NM_007023chr231079 797 263 ------
NM_007026chr173471 446 79 ------
NM_007033chr142306 2075 869 546 ------
NM_007034chr12750 335 --1840 --
NM_007035chr121593 ------
NM_007036chr51844 ------
NM_007039chr1422034 1580 --1304 --
NM_007042chr372586 2532 2491 2038 997 471 314 ------
NM_007043chr1252168 1671 1604 692 36 2388 301 21778 414 --
NM_007050chr20137639 6333 5906 5246 2719 2349 1784 1632 1526 1314 745 493 218 36163 5051 981 36619 5994 420 36867 3156 1530
NM_007052chrX2620 229 ------
NM_007054chr573629 3581 3434 3265 3189 2722 704 23200 951 43519 1044 1013 87 --
NM_007064chr351523 1311 1217 1117 108 ------
NM_007067chr17121588 1360 1219 1161 1155 1131 1083 1056 317 304 109 75 11212 21559 1170 1347
NM_007078chr1072639 1134 751 616 544 151 84 --12198 11150
NM_007084chr1341455 1197 602 409 11487 ----
NM_007106chr1322652 2433 12359 12117 1678
NM_007107chr352315 2083 1607 428 369 1116 --1517
NM_007114chr352594 2202 2071 1314 1168 12250 --1542
NM_007123chr15828 485 468 310 61 1845 ----
NM_007124chr621441 215 11884 11835 --
NM_007129chr132369 337 ------
NM_007144chr1731274 481 469 1510 181 --
NM_007145chr1921400 1150 ------
NM_007146chr1742672 2446 377 220 ------
NM_007147chr1921072 69 --1984 --
NM_007158chr131011 813 437 ------
NM_007159chr3288 36 ------
NM_007166chr1121409 111 --1374 --
NM_007172chr2252994 2555 2032 425 79 2996 157 1508 --
NM_007174chr1241782 421 406 110 11520 ----
NM_007175chr8123354 3304 3050 2447 2302 2221 1405 737 393 277 258 92 13650 ----
NM_007184chr3----1558 175
NM_007187chr132932 300 ------
NM_007189chr71418 --11381 --
NM_007191chr121159 ------
NM_007192chr1441015 764 273 85 1452 ----
NM_007195chr1893659 3439 3232 3200 3139 2892 2571 919 893 --21142 75 --
NM_007200chr1574399 3871 3652 3078 3013 2901 1831 31867 1375 585 ----
NM_007202chr172681 541 ----1614
NM_007207chr13811 605 287 ------
NM_007212chr162293 1897 1620 346 173 158 ----1217
NM_007214chr62550 253 ------
NM_007217chr3154 ------
NM_007221chr12404 393 185 ----
NM_007222chr831819 1762 395 ----21242 272
NM_007231chrX21701 249 21539 1522 ----
NM_007236chr1572063 1556 835 658 614 409 64 1805 3768 681 507 --
NM_007245chr162757 123 ------
NM_007249chr1399174 9107 7728 7640 7458 6332 3257 2425 1355 59331 8723 8418 5871 2696 48985 8686 1398 268 22607 1886
NM_007250chrX3599 371 78 ------
NM_007257chr8111971 1021 798 778 218 211 198 167 160 152 144 147 22337 2095 --
NM_007260chr13732 133 118 ------
NM_007269chr1--1547 --1440
NM_007271chr641294 1231 1142 62 11248 1422 --
NM_007275chr321117 439 ------
NM_007276chr71262 --21143 221 --
NM_007278chr172342 141 ------
NM_007281chr41188 ------
NM_007285chr162502 459 ------
NM_007286chr572125 2006 1897 1489 696 651 333 ----12041
NM_007292chr1784411 4387 3934 1820 1095 1076 556 251 --15189 13321
NM_007294chr1751154 1072 1054 101 83 ----2992 403
NM_007295chr1751154 1072 1054 101 83 ----2992 403
NM_007296chr1751154 1072 1054 101 83 ----2992 403
NM_007297chr1751154 1072 1054 101 83 ----2992 403
NM_007298chr1751154 1072 1054 101 83 ----2992 403
NM_007299chr1751154 1072 1054 101 83 ----2992 403
NM_007300chr1751154 1072 1054 101 83 ----2992 403
NM_007302chr1751154 1072 1054 101 83 ----2992 403
NM_007303chr1751154 1072 1054 101 83 ----2992 403
NM_007304chr1751154 1072 1054 101 83 ----2992 403
NM_007305chr1751154 1072 1054 101 83 ----2992 403
NM_007313chr981924 1881 1749 1329 715 567 460 370 --21956 1585 --
NM_007331chr412342 --12510 1498
NM_007332chr831107 1052 1026 128 1162 --
NM_007341chr211336 ------
NM_007345chr184894 587 495 201 21927 24 ----
NM_007347chr1562974 2553 2308 2189 992 822 2184 92 ----
NM_007350chr1284462 3644 3617 3234 1425 1340 1007 160 13660 --13441
NM_007358chr131514 1268 728 ----11832
NM_007363chrX1753 1237 ----
NM_007365chr1102087 1660 1579 1459 869 821 799 675 555 544 1322 --1178
NM_007372chr172898 884 --2727 284 --
NM_007373chr1041764 1221 682 326 --1564 --
NM_007374chr141449 ------
NM_007375chr142150 1718 1128 431 11784 22364 2322 --
NM_009585chr31176 1821 162 --
NM_009585chr31176 1821 162 --
NM_012064chr1251176 1120 1106 391 153 ----11144
NM_012069chrX62703 2550 2523 1000 682 227 --12646 --
NM_012081chr543438 3385 3161 2383 --1899 --
NM_012084chrX194 1573 ----
NM_012086chr2157 ------
NM_012090chr11367 ----1935
NM_012092chr26633 453 429 200 116 70 --21444 698 --
NM_012095chr1033511 3110 2139 12778 --13371
NM_012096chr393337 3310 2569 2485 2450 2350 2337 1478 444 12576 11236 1607
NM_012097chr261900 834 614 603 356 248 --11825 --
NM_012102chr152616 2159 1872 1788 991 1689 12429 22196 106
NM_012104chr1173079 2483 2464 897 881 338 134 22761 1232 21085 1036 1313
NM_012104chr1173079 2483 2464 897 881 338 134 22761 1232 21085 1036 1313
NM_012105chr214693 641 334 141 ------
NM_012111chr141182 ------
NM_012117chr12128 ------
NM_012120chr642877 2525 2412 528 --12114 --
NM_012125chr152729 680 1496 --152
NM_012129chr741836 1830 835 92 1386 2552 486 1724
NM_012137chr192871 2166 2137 2053 2028 1887 940 441 346 22658 596 52207 2056 989 589 498 --
NM_012141chr13123874 3680 2930 2860 2736 2704 2620 1586 951 332 139 38 21073 318 1862 --
NM_012153chr1182378 2360 1611 1018 741 687 271 95 2969 136 11772 --
NM_012154chr81825 ------
NM_012156chr20153348 3330 3162 3147 2913 2889 2837 2755 2549 2330 806 764 658 461 273 1474 ----
NM_012158chr13--11611 1350 --
NM_012160chr62490 197 ------
NM_012161chr431182 349 176 --1467 --
NM_012164chr9126807 6695 6677 6343 6283 5693 4822 2968 2874 1192 1149 66 45181 1936 1556 1157 36897 6216 5524 26926 1197
NM_012175chr112221 85 --2803 251 --
NM_012176chr5--1225 ----
NM_012180chr41537 ----2672 545
NM_012188chr51933 ------
NM_012189chr183472 152 74 ------
NM_012192chr1142226 1489 810 131 ------
NM_012193chr11194898 4694 4008 3575 3451 3348 3333 3320 1880 1873 1817 1556 1532 1445 709 685 673 523 401 11134 24346 3459 --
NM_012199chr1154684 4231 4145 3637 3302 3269 2953 2930 2924 2878 1871 1375 1070 637 133 14013 32966 1483 1442 11543
NM_012210chr93588 423 26 --11013 --
NM_012214chr2146367 5910 5450 5217 4926 2525 2519 2419 2374 1992 1715 1370 891 884 16440 --24057 861
NM_012215chr1041335 698 228 86 11556 1731 --
NM_012216chrX134 ------
NM_012223chr221309 38 --1251 --
NM_012233chr261063 784 762 457 338 321 ------
NM_012234chr382608 1429 1068 963 600 418 405 92 ------
NM_012236chr13697 618 255 --154 --
NM_012238chr1011255 --11354 --
NM_012242chr103532 288 30 ------
NM_012243chr1177 ------
NM_012244chr1451624 1425 1404 1161 500 11309 11292 --
NM_012247chr101950 ------
NM_012248chr162256 248 1595 ----
NM_012249chr231288 1244 39 --13227 --
NM_012250chr114507 144 57 49 ----1227
NM_012252chr7114723 4696 4213 3726 3720 3560 2119 1519 861 396 212 14506 --13353
NM_012255chr20128 ------
NM_012259chr671460 941 427 343 175 164 67 --11296 --
NM_012262chr194674 4397 4287 2007 1681 1533 873 421 388 13692 23906 3715 --
NM_012281chr752152 1966 1669 982 632 12017 ----
NM_012286chrX1173 --1449 --
NM_012287chr374578 4093 3629 1582 1321 911 270 12962 1664 14492
NM_012288chr6175070 4967 4537 3967 3740 3574 3492 2041 1916 1471 1293 1021 347 219 174 163 29 --25443 4645 13883
NM_012290chr211467 ------
NM_012294chr743913 1476 1021 474 33180 2739 784 --11198
NM_012296chr1163365 2885 1488 844 315 100 --33197 301 194 --
NM_012297chr482349 2031 902 871 822 546 321 301 ------
NM_012300chr581714 726 683 591 552 481 405 190 2356 175 ----
NM_012301chr732085 1411 49 --1878 21873 810
NM_012302chr11119 ------
NM_012307chr181871 ----185
NM_012308chr1172301 1924 1824 979 676 582 192 12120 1141 --
NM_012309chr1164106 4020 3743 1609 1125 908 23553 1574 44071 3840 1052 395 --
NM_012311chr103629 589 225 1563 ----
NM_012316chr1154421 4274 3686 1947 1763 1711 1316 1310 1102 1087 977 384 172 111 64 54724 4577 1135 925 708 24184 411 11925
NM_012323chr2261576 1332 457 151 96 76 ------
NM_012325chr2051545 1294 1021 160 128 ------
NM_012326chr2177 ------
NM_012328chr731326 1233 384 --1254 --
NM_012329chr1761293 1197 1056 1047 610 361 ------
NM_012330chr1051694 1159 406 243 194 ------
NM_012333chr161539 1295 1192 1185 574 466 --11481 1617
NM_012334chr584056 3463 3422 1558 1014 404 154 50 12894 11410 --
NM_012340chr201178 ------
NM_012342chr103495 148 122 ------
NM_012345chr1341881 1756 743 155 --11868 --
NM_012382chr564439 4052 3549 3395 3343 582 1394 14042 24202 3665
NM_012384chr2052374 1862 1551 728 488 ------
NM_012394chr1--146 ----
NM_012395chr7113195 3117 2806 2371 2359 2286 1379 765 525 314 176 11008 23165 3104 --
NM_012398chr1972172 2085 787 731 684 422 368 32966 2868 2388 ----
NM_012399chr2251804 1658 1343 733 498 --11366 --
NM_012402chr1151240 367 115 101 86 --1420 --
NM_012405chr133784 2726 121 ------
NM_012407chr222514 481 --1132 --
NM_012412chr71829 ------
NM_012414chr12180 115 ------
NM_012417chr172230 69 ------
NM_012420chr1041775 1426 714 551 1256 ----
NM_012425chr1052300 718 647 59 40 ----1882
NM_012428chr154730 701 250 85 ----1287
NM_012434chr62211 27 ----1615
NM_012443chr102569 119 170 ----
NM_012444chr205455 448 435 329 200 ------
NM_012448chr1762158 913 685 674 501 86 21868 1684 21572 733 12556
NM_012454chr61568 ------
NM_012461chr142192 65 --1480 --
NM_012463chr12----11612 1339
NM_012464chr452290 1026 903 844 496 1598 ----
NM_012465chr1093443 3032 2845 2790 2443 2261 843 477 394 12873 12337 22801 358
NM_012473chr223677 558 245 ------
NM_012478chr173698 250 38 ------
NM_012479chr752575 2370 828 793 649 1274 --22666 2023
NM_012482chr1------134
NM_012486chr11431 ------
NM_013227chr152664 82 ------
NM_013229chr1232090 1814 877 1186 --1527
NM_013230chrY21608 565 ----245 28
NM_013231chr1444288 3864 1427 1204 1793 11448 24329 3625
NM_013233chr221150 399 --1210 --
NM_013236chr224790 472 387 180 11188 160 --
NM_013242chr162273 45 ------
NM_013243chr1521469 959 2282 68 ----
NM_013245chr163719 229 122 ----1651
NM_013248chr201210 ------
NM_013253chr1161416 1363 558 272 124 103 2929 358 ----
NM_013254chr122611 75 --1285 --
NM_013257chr82709 61 1305 22171 148 1956
NM_013259chr33291 95 55 ------
NM_013261chr4103424 3386 3015 2970 2776 2624 2284 1064 788 678 12741 12729 --
NM_013262chr631379 1061 984 ------
NM_013269chr12124361 4179 4019 3975 3505 3460 3379 1434 1301 1254 774 448 --24031 3990 --
NM_013272chr151153 ------
NM_013275chr164747 637 607 195 --1198 1616
NM_013277chr1241014 973 818 309 1798 1350 --
NM_013279chr1162324 2217 2061 2052 903 609 1579 ----
NM_013281chr2011191 ------
NM_013283chr52890 671 1843 ----
NM_013300chr121215 ------
NM_013302chr1684712 4471 4079 3331 1659 1480 944 901 34634 4621 1073 ----
NM_013305chr184919 858 699 620 ------
NM_013309chr1532196 1929 899 22035 909 --11821
NM_013313chr2283041 2771 2547 965 472 292 180 24 32691 680 102 13521 23240 2159
NM_013341chr2102763 2745 2712 2613 2243 1954 1126 1078 797 347 11792 22808 1175 12028
NM_013351chr173715 113 103 --1223 --
NM_013353chr1290 68 ------
NM_013354chr811405 ------
NM_013357chr84714 120 88 71 ------
NM_013361chr192212 182 ------
NM_013363chr3161 ------
NM_013364chrX61993 1967 1945 1421 1359 1280 ------
NM_013368chr191117 ------
NM_013372chr15123084 2823 2770 2363 2214 2141 1285 1130 496 467 443 362 --32810 1041 937 1395
NM_013374chr342115 2056 939 387 ------
NM_013381chr1212138 21897 218 1200 --
NM_013382chr1462234 2144 2011 1903 1799 1770 22079 470 --12378
NM_013388chr23403 143 46 ------
NM_013396chr2121046 1039 --1971 --
NM_013399chr1681875 1719 1260 750 520 312 167 134 ----11525
NM_013400chr751062 1028 877 843 301 --1344 --
NM_013411chr131737 1093 777 22770 2225 ----
NM_013423chrX197 ------
NM_013427chrX197 ------
NM_013433chr1921785 1774 --11663 --
NM_013434chr241739 1697 487 275 11792 ----
NM_013434chr241739 1697 487 275 11792 ----
NM_013437chr82556 235 ------
NM_013438chr931810 1436 1418 --11354 --
NM_013443chr961111 997 904 893 301 79 ------
NM_013444chrX41139 344 217 189 1845 1267 --
NM_013445chr21146 ------
NM_013446chr73422 146 84 ------
NM_013448chr141173 ----1642
NM_013449chr12132945 2816 2722 2439 2299 2113 1186 696 634 589 338 187 154 ------
NM_013450chr21352 134 1845 --
NM_013937chr66900 725 348 295 115 103 ------
NM_013951chr262457 2361 2307 2258 1716 546 ------
NM_013952chr262534 2438 2384 2335 1793 623 ------
NM_013953chr262534 2438 2384 2335 1793 623 ------
NM_013992chr262534 2438 2384 2335 1793 623 ------
NM_013993chr63705 268 85 1117 1281 1621
NM_013994chr63705 268 85 1117 1281 1621
NM_013995chrX51967 1619 871 839 412 22619 2298 ----
NM_014000chr1091950 1386 627 565 524 364 357 242 36 11665 21583 1557 --
NM_014005chr5103017 2231 2225 1043 954 827 638 616 321 38 --1312 --
NM_014011chr242552 1755 570 483 ------
NM_014016chr341393 1294 348 107 ------
NM_014021chr173442 3347 3258 2968 644 375 282 191 ----
NM_014023chr1032129 1848 511 12757 1223 12277
NM_014030chr1751052 1000 421 299 230 1484 1832 --
NM_014034chr61258 --1264 2982 199
NM_014038chr71295 ------
NM_014043chr321488 252 ------
NM_014048chr16105072 4923 4780 4517 3544 3468 2027 1657 1121 287 13336 ----
NM_014055chr121463 ------
NM_014057chr941114 604 453 374 --11048 --
NM_014059chr133256 121 22 ------
NM_014110chr131051 274 227 1848 ----
NM_014112chr8104702 4590 4380 3512 3349 3334 1900 1683 711 528 --1685 --
NM_014117chr1672529 2267 2247 2042 1968 1947 846 ------
NM_014141chr795054 4199 3503 3495 3457 498 442 434 428 15236 23236 1895 11186
NM_014145chr201292 --1581 1692
NM_014154chr32562 337 ------
NM_014155chr11107440 6210 5660 5373 2182 1496 1096 988 877 868 25996 1877 66868 5787 1833 1222 258 84 --
NM_014166chr133943 880 822 ------
NM_014178chr142382 27 ------
NM_014181chr232581 2196 876 ------
NM_014182chr122479 73 1103 194 --
NM_014184chr11112 ------
NM_014189chr451494 1425 1306 446 205 --21375 1363 11263
NM_014190chr461846 1777 1658 1154 557 319 151 21727 1715 11615
NM_014191chr12--1955 ----
NM_014212chr124893 617 172 85 --1901 --
NM_014216chr1451234 1205 229 138 111 --21352 659 --
NM_014217chr13556 506 270 1742 21505 49 --
NM_014223chr13727 507 195 ----1215
NM_014231chr12101928 1896 1794 1585 1473 736 717 388 136 60 11846 21703 53 --
NM_014232chr1771377 652 512 439 401 356 347 ----11256
NM_014232chr1771377 652 512 439 401 356 347 ----11256
NM_014233chr1711731 21533 1353 ----
NM_014238chr1761372 573 546 311 179 118 1271 11294 --
NM_014240chr3103787 3088 2876 1050 805 658 508 411 310 206 1991 24088 3581 22921 151
NM_014243chr452093 1954 766 172 93 21830 1434 ----
NM_014245chr34303 233 188 131 ------
NM_014246chr2242273 1708 577 413 11646 1790 --
NM_014250chr2261911 1763 1486 1449 528 89 ------
NM_014252chr132164 131 ------
NM_014253chrX22407 338 12123 1332 --
NM_014258chr202118 43 ------
NM_014267chr115869 807 676 337 241 1266 ----
NM_014268chr1841317 569 197 51 1457 11123 --
NM_014271chrX3615 344 111 ------
NM_014278chr41300 --1324 --
NM_014279chr92818 631 ------
NM_014283chr1----1327 --
NM_014285chr91306 ----1423
NM_014288chr11214 ------
NM_014289chrX31139 1078 124 --11153 --
NM_014294chr821335 1085 ----21149 465
NM_014299chr1982042 1771 1450 736 549 503 383 273 --32048 863 284 --
NM_014300chr151400 2445 331 ----
NM_014309chr22185066 4916 4702 4455 4448 4033 3908 3841 3599 3469 1859 1502 1220 815 805 609 589 478 25181 197 41506 1412 1235 471 2822 183
NM_014316chr1651971 1827 1795 1785 1634 ------
NM_014319chr1221378 72 11782 ----
NM_014323chr22----1394 1703
NM_014325chr1261541 746 738 708 610 447 ------
NM_014329chr162280 87 1290 ----
NM_014331chr4147766 7539 6200 6087 5310 5286 5166 5064 4848 3091 2424 1458 1193 1062 --27518 300 22628 1857
NM_014333chr1182819 2665 1103 896 853 578 364 327 ------
NM_014335chr1521103 992 ----11005
NM_014342chr1131386 1265 194 21150 485 ----
NM_014344chr114840 225 175 71 ------
NM_014345chr64950 933 163 44 --1939 --
NM_014352chr1161395 963 509 271 141 69 ------
NM_014361chr112366 178 ------
NM_014365chr124665 562 350 51 ------
NM_014368chr961796 1614 851 386 288 213 ------
NM_014374chr751062 1028 877 843 301 --1344 --
NM_014381chr14103311 2586 2540 2469 2412 2323 2110 1255 574 475 23187 54 2553 532 --
NM_014382chr321656 488 11531 11122 --
NM_014392chr4--21322 617 21175 252 --
NM_014393chr84419 234 218 174 --2788 270 --
NM_014397chr92218 61 11152 11426 --
NM_014405chr1772259 1942 1899 1593 703 526 339 ------
NM_014408chr14583 561 69 58 ------
NM_014410chr18----1348 --
NM_014411chr772051 2002 1994 1549 1482 1328 1243 --2781 163 --
NM_014415chr321218 396 --11632 --
NM_014417chr194953 384 298 90 ------
NM_014423chr5115041 4688 4384 4222 2107 1955 1792 1382 1164 1152 1137 64918 2215 1973 1437 177 26 53691 3468 2171 1512 599 --
NM_014426chr202543 225 ------
NM_014432chr61205 --21093 140 --
NM_014445chr31537 1565 --11962
NM_014447chr451649 1385 1117 237 223 ------
NM_014452chr63214 184 67 11093 ----
NM_014454chr61874 --1128 --
NM_014455chr13431 357 144 ------
NM_014456chr1031545 320 225 --11916 --
NM_014469chr111256 ------
NM_014470chr121640 ------
NM_014488chr113623 563 509 ------
NM_014491chr731043 955 192 ------
NM_014494chr1682007 1894 1668 494 412 346 308 109 ------
NM_014496chrX2278 253 1269 ----
NM_014504chr7112033 2026 1993 1837 1728 1494 1379 1349 792 757 540 1861 1279 --
NM_014505chr121381 ------
NM_014506chr921228 619 --11663 --
NM_014515chr1221048 255 --1217 --
NM_014517chr331734 1617 1332 ------
NM_014553chr2153227 3220 2893 2875 2835 2552 2349 1145 1121 956 608 596 427 215 203 21227 1198 2611 439 23348 2691
NM_014554chr1271971 1785 1682 1662 692 166 95 ------
NM_014562chr2199 ------
NM_014569chr731381 1248 142 --21517 124 --
NM_014570chr222226 40 11036 ----
NM_014572chr1331799 1166 1129 --1673 --
NM_014574chr1431000 454 320 ------
NM_014575chr31493 ------
NM_014584chr1421614 1356 ------
NM_014587chr1661526 1416 1409 1403 205 174 11311 ----
NM_014588chr204753 739 252 108 ----1604
NM_014591chr1021091 76 --21324 902 --
NM_014592chr55624 292 207 200 136 ----1661
NM_014603chr1741687 1516 1340 91 ------
NM_014607chr231396 445 39 1839 ----
NM_014608chr15145 ------
NM_014612chr941254 995 298 97 ------
NM_014613chr5102465 2305 2137 2041 1221 951 866 755 443 264 --22678 589 --
NM_014614chr221259 99 ------
NM_014616chr343429 2747 875 40 --1387 23420 628
NM_014618chr91405 ------
NM_014620chr123194 128 120 ------
NM_014621chr21211 1217 ----
NM_014630chr15183800 3767 3500 3451 3295 2926 2801 2721 2469 928 898 850 641 628 541 475 429 344 11473 21097 1043 12476
NM_014632chr11279 33 ------
NM_014634chr2283374 3208 2724 2662 2264 738 450 50 12782 ----
NM_014636chr973300 1700 1369 1351 1219 1019 873 --33497 3283 473 14181
NM_014637chr831371 559 115 ------
NM_014646chr1892459 2118 2035 863 648 486 244 140 70 12866 --11996
NM_014647chr163197 191 82 --11573 --
NM_014657chr201267 ------
NM_014659chr153401 257 102 --2850 739 --
NM_014660chr73765 263 130 ------
NM_014661chr1093641 3539 3478 2475 1348 1273 1254 825 503 12773 12621 --
NM_014665chr8113692 3293 2946 2864 2434 2351 2285 928 371 364 298 --11163 --
NM_014666chr52420 266 1344 ----
NM_014667chr362384 2351 894 747 683 376 1277 ----
NM_014670chr221107 1077 --1253 --
NM_014674chr3113844 3325 3292 3257 2837 2768 2625 2509 1087 613 175 11511 ----
NM_014677chr871109 1032 1017 913 343 325 106 21330 1150 1501 --
NM_014683chr1742013 1896 1885 1691 --11361 --
NM_014686chr1912457 1171 12266 --
NM_014689chr21412 2152 29 1540 --
NM_014690chr792827 2571 2461 2391 2116 983 450 411 132 ----1963
NM_014701chr1563263 2536 2268 2218 871 22 --31214 1184 376 12362
NM_014702chr6103334 3291 3204 2887 2478 2333 2223 1291 994 89 13357 ----
NM_014705chr741914 1374 767 258 ------
NM_014707chr742291 1626 481 148 1281 162 --
NM_014709chr21473 ------
NM_014711chr1662100 1958 1702 1471 707 160 ------
NM_014715chr114869 828 349 33 1322 ----
NM_014720chr1071346 1172 735 356 127 114 63 ------
NM_014721chr697164 6826 6506 5957 5360 2631 2085 1325 683 11451 ----
NM_014723chr20113212 3205 3057 2338 2296 2046 2005 1132 996 714 283 12677 ----
NM_014729chr841693 1539 773 212 --1193 --
NM_014730chr12315057 5038 4822 4762 4679 4608 4325 4285 4159 4062 3785 3681 3648 3591 3516 3437 3427 3417 3232 1488 1320 1063 892 877 811 758 597 343 244 237 210 21934 700 21330 898 --
NM_014730chr12315057 5038 4822 4762 4679 4608 4325 4285 4159 4062 3785 3681 3648 3591 3516 3437 3427 3417 3232 1488 1320 1063 892 877 811 758 597 343 244 237 210 21934 700 21330 898 --
NM_014731chr2051799 1765 1522 1503 1225 11515 --1122
NM_014733chr551932 1709 803 688 586 1839 ----
NM_014735chrX72109 1708 1510 1491 1450 730 516 ------
NM_014736chr152844 384 1718 ----
NM_014739chr642882 1143 720 328 24093 3780 ----
NM_014743chr452720 2462 592 141 101 --12956 --
NM_014746chr2134379 4365 3980 3775 3097 2815 1444 914 823 781 482 346 286 32704 1356 1305 ----
NM_014747chr1165354 5123 4538 4396 4002 3979 3795 3771 3685 3508 2185 2030 1956 1291 1256 550 --35509 4050 701 --
NM_014751chr861682 828 763 676 384 143 --1780 --
NM_014755chr2123763 3368 3248 3211 3155 3068 2932 2879 1284 1272 1108 992 --13442 13252
NM_014756chr113388 370 173 ------
NM_014757chr551802 1572 951 851 543 11710 32317 2205 918 --
NM_014759chr88995 652 529 361 311 223 167 84 --1270 --
NM_014761chr1641031 436 184 139 1931 ----
NM_014764chr1231232 463 275 ----2404 268
NM_014765chr122500 473 ------
NM_014766chr741173 536 524 115 13812 13132 --
NM_014767chr1083572 3167 2457 2386 2333 1028 954 320 11364 ----
NM_014772chr1842996 2463 948 825 12674 13438 --
NM_014774chr1103299 2840 2712 2318 2200 2135 2009 1077 283 276 11007 186 11282
NM_014776chr1272726 2483 2425 2269 2049 950 576 33111 2718 469 22131 25 --
NM_014782chrX2283 113 ------
NM_014784chr111117 --124 --
NM_014786chr1151230 1068 822 277 201 2945 263 ----
NM_014787chr152102 843 742 511 219 --1949 --
NM_014790chr5--126 ----
NM_014795chr22484 424 --1473 --
NM_014800chr76840 473 461 308 141 95 1817 ----
NM_014802chr1221025 73 ------
NM_014803chr1042883 859 786 361 22385 877 32542 2010 397 --
NM_014807chr115783 659 629 102 31 1525 ----
NM_014810chr173439 3158 2625 1102 780 659 639 3463 435 303 --12652
NM_014812chr12173 124 ------
NM_014819chr542133 1815 1666 864 157 32212 1782 1728 --
NM_014820chr341902 1425 626 587 41836 1300 546 517 11895 --
NM_014824chr1131962 1885 1528 ------
NM_014826chr173883 1610 1587 1375 896 736 54 11003 14252 --
NM_014827chr131429 349 254 2617 131 ----
NM_014828chr1442393 1640 994 531 ------
NM_014829chr522073 767 ----1226
NM_014830chr1263401 2873 2833 2675 727 314 --23408 2655 --
NM_014832chr1322094 1319 21677 1352 11763 --
NM_014836chr1031308 493 443 11980 11482 --
NM_014839chr152320 2274 2161 744 603 11696 12015 --
NM_014840chr1272738 2543 2317 2201 1192 833 181 12891 --12516
NM_014841chr62421 128 11377 ----
NM_014844chr1464157 3836 2982 1574 1345 111 --14098 --
NM_014847chr13552 209 33 ------
NM_014850chr3174789 4686 4483 4438 4302 4290 4043 3927 3885 3869 3658 3497 1613 1480 491 331 318 --24853 4805 14309
NM_014853chr1721501 106 --11155 --
NM_014858chr14848 783 411 139 21103 742 --11207
NM_014859chr1751184 1122 326 200 94 ----11293
NM_014860chr2102560 1911 1650 1624 858 746 738 668 638 616 22390 877 1641 --
NM_014862chr15124085 4078 3467 1591 1475 1414 1363 1315 1272 873 850 399 11332 24140 3669 14008
NM_014868chr122870 617 ------
NM_014870chr1124348 3511 3276 2991 2901 1171 1026 857 745 546 444 259 11702 24158 213 23374 811
NM_014871chr12136 ------
NM_014872chr951977 1797 1675 1553 603 ------
NM_014873chr154154 3821 3764 897 561 13805 1402 --
NM_014874chr151854 1399 752 736 285 ------
NM_014876chr2272204 2051 1936 1749 1725 1528 65 --146 12127
NM_014877chr17127601 7583 7194 7007 6318 4964 2955 2688 2504 1866 956 907 16401 26839 1566 37199 1156 502
NM_014878chr92125 45 ------
NM_014885chr4175 ------
NM_014887chr133850 718 204 --1814 --
NM_014890chr3156 ------
NM_014892chr61136 ------
NM_014893chrY51902 1780 773 428 30 --21989 751 --
NM_014897chr1753072 733 525 367 107 --12045 --
NM_014898chr1951767 1761 530 422 22 ------
NM_014899chr552762 834 593 142 79 33076 2565 2177 12447 --
NM_014900chr21284 --1315 --
NM_014902chr2061510 1389 1218 462 412 249 11175 11532 --
NM_014903chr125955 942 432 367 326 --22396 1792 1379
NM_014904chr1053912 3145 1337 778 748 41357 1187 924 571 23304 119 --
NM_014906chr1763938 3920 2931 1418 1001 142 22514 1331 33953 3749 3610 21339 1005
NM_014912chr1042672 1247 564 553 ------
NM_014914chr241005 440 409 219 ------
NM_014917chr13869 832 695 ------
NM_014918chr1551282 1134 1067 530 188 11153 --1133
NM_014920chr693597 3121 2691 2542 1496 1362 1239 337 127 1695 1540 --
NM_014921chr19132977 2897 2888 2847 2803 2740 1195 874 659 613 602 435 333 ------
NM_014924chr144899 530 311 47 --12175 --
NM_014925chr125755 683 246 235 198 ------
NM_014926chr341139 1032 746 81 ------
NM_014932chr331576 1465 677 ------
NM_014935chr1103480 3469 3461 2896 2833 2821 2771 2491 1433 445 --52710 2515 1504 911 73 --
NM_014936chr642773 2574 740 716 1482 22304 303 --
NM_014938chr1282605 2310 2168 2020 1855 812 544 432 --1254 --
NM_014939chr1811192 1392 ----
NM_014944chr151063 961 529 222 178 ------
NM_014945chr591899 1863 1283 329 244 229 178 79 57 11487 ----
NM_014946chr23576 388 276 12023 --23021 2253
NM_014947chr143032 2811 2598 2047 ------
NM_014949chr12850 40 1674 11014 --
NM_014950chr1421083 605 11469 11781 --
NM_014952chr156832 589 575 551 504 275 ------
NM_014959chr1973474 2819 2795 2483 1407 883 221 --22336 1171 21426 1357
NM_014961chr461817 1606 825 755 563 339 11752 21766 749 1463
NM_014964chr1742228 1712 973 777 ----1248
NM_014969chr11455 ------
NM_014974chr1041751 1403 491 418 21572 1313 ----
NM_014977chr144501 444 352 153 ------
NM_014978chr1021576 1342 11227 ----
NM_014982chr14135233 5196 4609 4032 3722 3623 2108 2082 1911 1142 895 450 153 --13594 24100 1416
NM_014988chr452586 859 845 311 124 12770 --1444
NM_014989chr631935 1362 1277 21719 241 ----
NM_014990chr1421126 429 --1152 --
NM_014991chr462503 2249 2148 2096 1126 605 12437 12377 --
NM_014992chr141876 147 ----
NM_014996chr3--1366 1318 --
NM_014997chr7102582 2353 2267 2241 2174 2132 2021 1946 1032 318 --31858 969 55 --
NM_015000chr1253091 2322 1140 1041 929 22914 340 12397 --
NM_015001chr13632 271 264 --1168 --
NM_015005chr1441616 596 301 237 11099 11779 11334
NM_015008chr393221 3075 2855 2490 1353 1051 1014 899 34 22819 678 12714 22782 268
NM_015012chr112348 84 ------
NM_015013chr1----165 --
NM_015015chr1942049 1737 493 265 ------
NM_015017chr11131 ------
NM_015018chr6186 ------
NM_015020chr16123724 3295 2849 2824 1473 1085 932 788 690 608 188 76 --43353 1416 791 356 --
NM_015023chr171553 1272 1217 661 613 364 47 --31779 1569 1468 --
NM_015024chr821402 1278 --21380 1338 --
NM_015025chr232161 2032 855 22754 919 ----
NM_015026chr12104585 4576 4566 4554 4479 4445 3291 1342 1071 66 ----24604 125
NM_015032chr1362800 2765 898 806 426 25 1608 ----
NM_015037chr102265 228 ------
NM_015039chr1103498 3405 3103 2861 1524 1499 1339 1299 451 61 1594 33551 3345 198 11508
NM_015040chr241183 681 636 478 --23324 777 --
NM_015042chr15124297 4286 4245 4074 3860 2879 1514 1483 1335 912 270 240 11746 24254 1119 --
NM_015044chr1643258 3050 1079 801 32239 2011 137 33100 2627 2494 1574
NM_015045chr1041510 1425 861 460 ------
NM_015046chr962395 2142 746 453 336 150 11905 1259 12000
NM_015052chr771126 1100 1094 492 415 196 93 --1202 1174
NM_015056chr2182457 2126 2104 935 815 675 634 161 165 ----
NM_015057chr132591 204 ------
NM_015059chr15123653 3567 3404 3327 3288 3012 2604 2592 1202 418 412 339 24012 1042 1214 13781
NM_015061chr91205 --1238 --
NM_015064chr12113145 2837 2760 2701 1443 1213 911 895 563 362 115 23276 1151 --1716
NM_015068chr773947 3930 3606 2650 1318 557 122 33911 3764 1431 11479 12705
NM_015069chr161493 ------
NM_015070chr131144 11397 21569 1152 --
NM_015071chr5105889 4963 4491 4322 2176 2086 766 620 460 79 56463 5899 1354 1118 576 14657 --
NM_015072chr142396 205 ------
NM_015074chr1133954 3788 3148 3016 1738 1677 1517 1185 893 565 457 358 65 33042 1456 391 23132 1904 --
NM_015075chrX52048 1572 878 181 173 --11381 --
NM_015076chr684322 4224 4174 3662 3151 1460 240 165 23644 3085 24006 3635 1960
NM_015079chr1563181 2778 2610 1989 1241 460 21271 425 1193 12439
NM_015080chr113933 385 118 ------
NM_015082chr541994 875 481 330 ------
NM_015086chr1251370 1290 1133 89 81 1356 11393 --
NM_015090chr1176037 5712 5135 4710 2437 2396 2354 1646 1152 1136 923 773 655 615 551 477 419 ------
NM_015091chr141720 --1779 --
NM_015092chr1674322 3614 3482 3291 3013 996 682 --23545 2984 --
NM_015093chr641588 749 679 22 ----126
NM_015094chr22114325 4299 3057 1872 1805 1773 1374 571 553 125 27 13519 1610 --
NM_015097chr382305 1939 1865 1526 1519 907 690 90 --11511 --
NM_015100chr151891 1715 1318 830 617 1705 ----
NM_015107chrX82373 1931 1887 1741 1665 1510 165 31 12223 21559 1541 --
NM_015115chr492900 2798 2633 2572 918 793 782 179 97 --22916 805 12461
NM_015130chr441290 1231 1195 61 --21267 541 --
NM_015132chr761884 1751 1281 728 152 62 ----11578
NM_015133chr163568 542 410 ----1103
NM_015138chr1582428 819 753 492 478 471 168 64 12488 1391 --
NM_015149chr171754 1680 1434 729 638 471 214 ------
NM_015151chr213732 308 146 ------
NM_015153chr62791 678 ------
NM_015155chr1093308 2929 2572 2523 2327 914 584 414 139 --12768 --
NM_015156chr14133517 3408 3360 3051 2568 1620 1063 912 886 861 633 541 445 ------
NM_015157chr113445 275 181 ------
NM_015158chr96771 751 732 201 188 21 --1801 --
NM_015161chr1641343 1101 312 287 --11537 --
NM_015170chr832015 769 260 11582 --1783
NM_015172chr121323 1088 --11050 11657
NM_015176chr13635 561 102 --11590 --
NM_015178chr882055 1941 1083 838 545 329 136 59 --2943 728 --
NM_015185chrX62750 2731 1065 911 560 553 --32391 830 634 --
NM_015191chr1132570 2437 1853 11948 --12733
NM_015192chr2052582 2472 1893 503 312 --12913 1446
NM_015198chr711002 21074 229 ----
NM_015199chr3102579 2437 2313 2288 2072 1973 1961 1954 945 185 22957 2043 12707 12910
NM_015200chr472435 2269 1910 1793 1742 518 156 ----1179
NM_015206chr1572977 2778 2443 1219 1071 505 434 12715 --13000
NM_015208chr1843914 3359 508 95 --1845 --
NM_015209chr182153 2099 1961 1835 1747 646 391 201 1152 12024 --
NM_015215chr163029 2128 593 309 256 141 --12411 --
NM_015225chr952867 2587 1002 843 380 42857 968 458 327 1947 1557
NM_015226chr1693199 2259 1241 1129 1011 881 489 435 180 23355 938 33012 346 330 13141
NM_015227chr2173489 3301 3259 2122 506 133 65 --1474 --
NM_015230chr421763 272 ----11597
NM_015231chr111694 1939 ----
NM_015234chr631144 1022 272 ------
NM_015236chr431331 226 216 ----1115
NM_015245chr692258 2037 1884 1787 1100 961 418 329 130 --12043 --
NM_015247chr16124929 4671 4305 4220 3923 2144 1871 1161 904 503 367 139 --34310 3651 822 --
NM_015250chr941875 1436 586 229 ------
NM_015252chr25883 738 337 161 128 --1598 1623
NM_015254chr892909 2768 2234 934 662 560 510 177 160 --32984 2228 638 --
NM_015256chr52623 567 --1161 --
NM_015260chr1951582 1554 1497 1005 114 ------
NM_015264chr22124697 4561 4134 4007 3592 3335 1906 1563 1215 912 859 262 13157 11945 13857
NM_015265chr262466 2152 1939 1853 426 269 ------
NM_015267chr1251450 885 354 241 224 ------
NM_015268chr31120 --1259 --
NM_015269chr12625 464 ------
NM_015270chr1231721 1660 934 21484 660 ----
NM_015271chr473385 2788 1636 860 638 575 187 --33011 1267 208 1449
NM_015272chr161517 --21683 180 --
NM_015275chr1252137 1604 1593 1582 738 --21780 818 11597
NM_015277chr1851831 1549 533 305 270 ----11401
NM_015278chr672963 2204 1259 537 378 209 164 ------
NM_015284chr13822 774 275 12136 1339 21626 542
NM_015285chr1831888 1821 528 32322 2181 390 11824 140
NM_015288chr563665 3616 2720 2688 2507 979 --1177 --
NM_015291chr183156 3056 2752 874 823 480 279 146 --32488 215 118 --
NM_015292chr122198 184 ------
NM_015299chr1483730 3400 3243 2721 1556 747 371 78 21597 712 22528 1080 12818
NM_015305chr1471820 1555 617 608 464 175 29 1501 ----
NM_015310chr8218025 7882 7466 7341 7182 6679 6223 3298 3234 2821 2676 2621 1764 1720 1363 1263 1149 864 436 288 275 36758 6299 5891 27996 1534 23190 2741
NM_015313chr1164402 3449 3187 3123 709 603 11585 --11264
NM_015314chr731922 1614 435 --1722 --
NM_015315chr5153436 2769 2712 2666 2437 2333 2172 1035 997 737 666 582 490 208 188 --12244 1241
NM_015317chr262887 2708 2464 2387 1942 459 --12870 --
NM_015321chr1984915 4292 3733 3317 1890 1462 1195 921 11599 34878 4742 3652 --
NM_015323chr641197 662 615 299 21449 1413 11371 1667
NM_015326chr172552 2166 2027 1009 937 728 195 12096 ----
NM_015327chr15967 519 507 467 419 ----11260
NM_015328chr792688 2317 2289 1965 1190 1137 617 599 318 33036 2170 2124 12431 12783
NM_015332chr7103426 2921 2665 2248 1399 784 689 543 377 118 --11012 12950
NM_015335chr1292441 1002 723 400 358 329 196 94 21 ------
NM_015336chr1242156 2092 916 89 ------
NM_015338chr2051856 1845 1450 419 152 --1754 --
NM_015339chr203304 193 77 ------
NM_015344chr841916 678 403 193 --12156 --
NM_015345chr682761 2675 2447 1994 1053 500 453 184 11985 42461 978 690 647 11018
NM_015346chr1461611 604 465 441 339 100 11434 --21737 193
NM_015349chr622515 2129 --1206 --
NM_015355chr1721570 589 ----163
NM_015359chr8122843 2746 2708 2240 895 821 741 527 310 291 232 199 --1343 1841
NM_015365chrX64027 3632 3196 3028 1700 398 34303 3850 2618 13719 --
NM_015375chr174853 4846 4228 1045 803 222 29 23283 330 23541 1493 --
NM_015378chr132674 2145 1947 --22909 412 --
NM_015381chr2232080 1902 101 --31440 813 747 --
NM_015382chr141516 ------
NM_015384chr51119 ------
NM_015388chr63269 235 29 ------
NM_015393chr4103727 3452 3429 2887 2398 2345 1227 495 485 386 13607 23436 150 --
NM_015394chr1271963 1849 1636 1581 889 449 198 --1747 --
NM_015396chr32270 82 ------
NM_015397chr941865 1789 1564 1513 --1364 11405
NM_015401chr122782 50 ----155
NM_015415chr11173 ------
NM_015416chr124794 723 280 176 ------
NM_015428chr1961695 586 558 526 234 84 --11499 --
NM_015429chr33898 745 416 --11003 --
NM_015435chr821326 1024 ------
NM_015436chr483257 2943 2584 2556 2386 2147 1314 1251 --2475 235 1485
NM_015443chr1721030 573 --21278 275 --
NM_015444chr32613 107 ------
NM_015446chr111456 --1345 --
NM_015455chr5104033 3866 3393 1529 1289 1002 606 449 406 323 13092 1266 --
NM_015458chr8124869 4584 4572 4433 4308 3520 1861 1820 1507 370 314 56 14383 25267 3623 14355
NM_015460chr331586 1440 1383 ------
NM_015464chr71178 11021 ----
NM_015465chr54758 487 277 59 ------
NM_015466chr3----1192 --
NM_015472chr31127 ------
NM_015472chr31127 ------
NM_015475chr22932 217 1258 ----
NM_015483chr71974 ------
NM_015485chr11103 ------
NM_015488chr281689 1635 1615 1464 1389 1364 1311 1155 --21376 1183 --
NM_015497chr152830 69 ----1350
NM_015503chr161586 ------
NM_015508chr311549 ------
NM_015514chr143435 409 390 2508 201 ----
NM_015517chr113438 391 99 --1452 --
NM_015520chr372739 2530 1890 1881 1798 1030 724 --11064 12450
NM_015523chr111191 ------
NM_015525chr63883 857 253 ------
NM_015527chr163776 514 253 ------
NM_015534chr141045 810 88 31 ----1788
NM_015535chr274129 2879 2850 1318 1205 208 122 ------
NM_015541chr321160 37 ------
NM_015542chr103884 249 168 1891 1504 --
NM_015550chr733564 2728 2292 --13301 --
NM_015553chr6185052 4821 4684 4626 4465 4413 4267 4116 3851 3840 3681 3409 1335 735 727 680 300 24 15023 --11810
NM_015554chr1562781 2698 2631 1913 501 32 32274 957 152 ----
NM_015559chr182690 110 ------
NM_015564chr552867 2641 1042 448 289 1615 --12600
NM_015565chr213811 739 120 11444 21514 1429 11592
NM_015567chr1351196 516 494 368 220 ----1171
NM_015568chr2054350 3726 2690 1730 785 --22877 872 --
NM_015569chr184715 4667 3584 1932 1724 753 494 483 23905 3608 24092 3687 11943
NM_015570chr711761 --11450 --
NM_015571chr61417 21032 281 1767 12505
NM_015575chr251467 649 387 352 140 --1371 --
NM_015576chr372376 2279 2200 1035 862 682 612 12244 1622 22404 1825
NM_015578chr1921922 465 ------
NM_015604chr143608 238 214 --1120 --
NM_015607chr12200 159 ------
NM_015609chr192787 2419 2336 2104 2022 1925 917 830 464 ------
NM_015634chr102389 91 1405 ----
NM_015635chr972199 1941 1900 876 347 194 173 1742 ----
NM_015640chr184889 4830 4511 4331 2109 1247 1170 31 35235 4725 1541 ----
NM_015642chr31282 1297 ----
NM_015652chr102629 183 ------
NM_015660chr72273 220 ------
NM_015670chr172474 78 ------
NM_015676chr141331 ------
NM_015677chr21250 1638 ----
NM_015678chr1311211 ------
NM_015680chr24604 590 581 547 ------
NM_015686chrX62435 2083 1920 1561 824 419 11992 ----
NM_015687chr6--1521 ----
NM_015691chrX32454 2346 725 22909 1824 12946 --
NM_015695chr6102152 1839 1802 742 558 547 532 504 490 66 ------
NM_015704chr22144 ------
NM_015716chr173589 197 180 1145 1593 --
NM_015719chr192202 152 1306 ----
NM_015723chr7----1527 --
NM_015834chr213914 863 243 1205 ----
NM_015840chr192436 2153 2048 855 499 446 337 302 104 12335 32537 1754 1671 --
NM_015841chr192436 2153 2048 855 499 446 337 302 104 12335 32537 1754 1671 --
NM_015844chr18--1959 ----
NM_015846chr18--1959 ----
NM_015847chr18--1959 ----
NM_015850chr852131 2121 1613 475 185 11642 ----
NM_015865chr1821064 156 ------
NM_015872chr121258 466 ------
NM_015874chr41483 ------
NM_015878chr822229 96 11544 ----
NM_015879chr18208456 8297 7969 7168 7017 6649 6385 5615 5512 2794 2723 2517 1484 939 747 677 506 482 370 134 37430 2193 696 27061 458 --
NM_015881chr1161416 1363 558 272 124 103 2929 358 ----
NM_015886chr8105699 5191 5160 4344 4310 4061 1240 171 130 118 35644 4795 211 --15265
NM_015888chr143249 3029 2746 534 12283 ----
NM_015889chr223840 126 69 ------
NM_015891chr612047 ----1581
NM_015906chr174200 3720 1869 1742 1472 1354 279 --14055 14613
NM_015912chr882490 2271 2095 2036 1943 1685 946 527 22236 1973 21739 730 --
NM_015933chr3261 36 ------
NM_015948chr61399 ------
NM_015952chr61120 ------
NM_015955chr23503 130 69 ------
NM_015959chr113725 617 27 2668 525 ----
NM_015960chr10188 --165 --
NM_015975chrX2595 278 --11128 --
NM_015984chr11384 ------
NM_015993chr163224 128 25 ------
NM_015995chr15105242 5044 4970 4391 2069 1960 1750 659 527 59 1869 24767 1442 1890
NM_016002chr1174 --153 1732
NM_016006chr33267 195 177 2244 229 ----
NM_016009chr184245 4223 3468 1734 1612 662 255 222 ----13857
NM_016018chr852812 2179 2070 1999 464 ------
NM_016021chr692387 2161 2050 1930 1864 972 667 273 115 ------
NM_016022chr161073 876 728 324 146 93 1165 --1705
NM_016032chrX51335 1139 1002 536 426 1215 ----
NM_016038chr7--125 ----
NM_016040chr13973 702 85 --32055 1812 490 1760
NM_016041chr173387 313 70 1259 ----
NM_016045chr2031650 1320 1290 1170 ----
NM_016059chr63180 55 28 ------
NM_016072chr1251933 1880 894 559 182 ------
NM_016073chr153421 296 150 ------
NM_016075chr1352817 2416 836 565 23 32379 2048 509 1913 --
NM_016076chr183016 2967 2259 1955 1134 586 245 206 --32262 2231 81 --
NM_016083chr653840 3672 1315 772 623 12956 --12797
NM_016090chr1121080 1050 1799 ----
NM_016094chr33535 512 271 ------
NM_016096chr842110 1499 1347 432 1580 141 --
NM_016099chr84356 175 98 80 ------
NM_016104chr61120 ------
NM_016107chr511048 --1447 --
NM_016120chrX3324 287 147 ------
NM_016125chr171572 ------
NM_016127chr83721 644 60 ------
NM_016131chr262326 1979 1497 741 545 46 11486 ----
NM_016132chr1543076 2525 877 508 --21252 755 12480
NM_016133chr241258 1132 461 211 ------
NM_016146chr111258 ------
NM_016147chr113873 232 85 ------
NM_016152chr341060 386 257 248 ------
NM_016156chr1162251 2219 1743 1667 938 135 --12271 --
NM_016162chr123741 307 260 --1671 --
NM_016169chr10123265 3098 3026 2808 2646 2558 2329 1290 1267 1178 615 495 --32988 880 455 1476
NM_016194chr1581547 1334 1290 1262 1228 700 171 72 --21579 422 --
NM_016201chr362281 2170 1451 456 329 35 --2838 46 --
NM_016206chr3228763 8582 8111 8072 7278 7269 7196 7187 5454 3388 3377 3364 3326 3084 2981 2972 2864 2178 1605 1252 873 247 48563 6677 3300 547 12877 16840
NM_016213chr15169 ------
NM_016217chr663435 3063 2929 2902 838 94 23057 2496 ----
NM_016224chr641805 741 478 230 --21530 488 --
NM_016226chr122350 130 ------
NM_016227chr1----1327 --
NM_016230chr6----123 --
NM_016231chr1721118 1080 ------
NM_016235chr1651293 1267 1217 1040 34 21421 1414 1324 --
NM_016248chr1363998 3580 1138 1022 633 391 22915 2699 22844 214 13468
NM_016252chr21797 2705 641 ----
NM_016257chr1113276 3254 3170 3089 2502 2315 1025 576 500 449 329 23126 804 42401 2207 214 127 23006 2545
NM_016258chr12553 218 ------
NM_016260chr2117586 7333 6526 5219 5182 5132 2865 2464 2215 1049 847 32029 1924 760 46312 5939 1977 1112 --
NM_016261chr173550 122 69 ------
NM_016269chr44873 863 733 67 ------
NM_016272chr22112488 1945 1908 1738 962 851 717 679 476 122 108 --22554 2442 --
NM_016275chr362774 2538 2468 1990 713 436 1491 ----
NM_016277chr641636 1526 1146 174 ----1207
NM_016279chr52345 73 ------
NM_016281chr122909 859 --1233 --
NM_016282chr951757 1481 675 528 84 21384 250 ----
NM_016284chr163730 387 79 ------
NM_016287chr1102065 1852 1798 1653 1612 1425 601 518 267 261 --1688 --
NM_016289chr221906 205 ------
NM_016300chr31208 ------
NM_016303chrX2384 74 ------
NM_016308chr131771 369 327 ------
NM_016316chr21646 1464 ----
NM_016319chr122707 557 --1157 --
NM_016320chr1131094 274 91 ----1250
NM_016322chr9113137 2935 2506 2359 1121 1115 1011 629 578 82 42 ------
NM_016329chr31389 ------
NM_016338chr51397 ------
NM_016340chr52168 130 ------
NM_016353chr84876 741 269 145 32189 2034 462 21890 1882 1504
NM_016374chr11568 --11367 --
NM_016374chr11568 --11367 --
NM_016376chr1784406 4262 3491 3064 2897 2869 710 500 13917 22905 1544 12673
NM_016396chr1593025 2527 2492 2064 2006 1969 1026 528 364 --1651 22308 1198
NM_016410chr92202 104 ------
NM_016413chr131445 ------
NM_016418chr2283526 3321 3137 2827 2380 316 277 258 ------
NM_016422chr1142774 2293 1053 677 21952 308 --1533
NM_016424chr173724 308 153 --1729 --
NM_016427chr182328 321 1102 ----
NM_016436chr2042261 1942 455 237 ------
NM_016448chr131374 686 294 --2426 297 --
NM_016454chr151331 ------
NM_016463chr51118 ------
NM_016468chr14277 23 ------
NM_016470chr202556 489 ------
NM_016480chr5--1612 ----
NM_016483chr34321 278 227 213 ------
NM_016485chr631828 1635 286 --1784 --
NM_016487chr6192 ------
NM_016499chr11----1211 1180
NM_016506chr113525 219 36 ------
NM_016507chr1793095 2917 969 857 791 757 555 60 33 --12220 1459
NM_016513chr693597 3121 2691 2542 1496 1362 1239 337 127 1695 1540 --
NM_016516chr21243 1649 ----
NM_016519chr4------1366
NM_016522chr1121455 1090 ----11143
NM_016530chr1573914 3857 3421 1606 1161 669 54 12971 13292 --
NM_016531chr463629 3230 1268 1012 588 415 ----1175
NM_016542chrX21368 658 --1535 --
NM_016544chr283425 2866 1427 1340 1307 1216 1153 603 --52927 2846 1222 1123 582 22803 1262
NM_016545chr14919 619 280 130 --1341 --
NM_016559chr331429 1018 425 ------
NM_016569chr123624 174 105 --11051 --
NM_016571chr6----125 --
NM_016574chr116951 920 896 866 377 109 --1324 --
NM_016577chr3124001 3326 3007 2928 1714 1682 757 704 520 429 408 120 24397 569 24074 1014 --
NM_016578chr111201 ------
NM_016587chr71262 --21143 221 --
NM_016588chr63721 149 101 ------
NM_016596chr122782 50 ----155
NM_016603chr581659 569 483 406 304 277 229 220 ----11440
NM_016604chr52985 340 1463 2147 26 --
NM_016605chr592716 1875 1807 1785 1727 1717 943 584 140 1952 1913 --
NM_016607chrX31481 253 84 1488 ----
NM_016612chr83243 116 39 --1453 --
NM_016618chr21399 1114 1423 1230
NM_016620chr1--11472 11258 --
NM_016621chr11184152 4117 4044 3849 3838 3768 3410 3385 1690 1640 1562 1534 1480 976 768 654 599 284 13759 13461 24236 4105
NM_016623chr84563 259 210 127 --1120 --
NM_016626chr1821410 32 11688 ----
NM_016628chr102638 627 ------
NM_016631chr21----1884 --
NM_016641chr1621347 1112 --11476 --
NM_016651chr14144 1175 ----
NM_016652chr2031810 1778 1297 ----21751 1202
NM_016654chr1551285 1087 1077 494 433 ------
NM_016656chrX1110 --1113 --
NM_016733chr2221100 53 ----11238
NM_016819chr32522 367 ------
NM_016824chr1041852 1811 1629 631 1465 ----
NM_016827chr34630 572 32 24 ------
NM_016834chr17103885 3707 3527 3001 1011 911 738 399 297 90 13691 ----
NM_016835chr17103885 3707 3527 3001 1011 911 738 399 297 90 13691 ----
NM_016836chr21589 ------
NM_016839chr21589 ------
NM_016841chr17103885 3707 3527 3001 1011 911 738 399 297 90 13691 ----
NM_016929chr694107 3939 2849 1613 1519 980 384 371 315 14460 23928 78 --
NM_016931chr111348 ------
NM_016936chr1671800 1763 1551 1538 1515 754 106 1798 ----
NM_016937chrX31010 890 359 --155 --
NM_016950chr4176 ------
NM_016952chr1163952 3639 3070 1613 1567 1455 ----13579
NM_017412chr821403 903 ------
NM_017413chrX112477 2162 1823 1775 1682 647 636 284 201 140 73 ------
NM_017415chr5124436 4039 3692 3504 3137 2954 1810 1210 551 490 443 405 23597 3590 33508 636 339 34572 350 131
NM_017420chr1452462 1514 1377 706 216 12832 ----
NM_017423chr451705 811 795 313 273 ------
NM_017426chr4142 ------
NM_017439chr72431 63 ------
NM_017447chr2183711 2692 1620 792 756 548 453 35 --23333 176 --
NM_017449chr161588 1452 541 370 357 48 --1470 --
NM_017450chr1721442 515 --11159 --
NM_017451chr1711016 ------
NM_017452chr2021426 561 ------
NM_017453chr2021426 561 ------
NM_017454chr2021426 561 ------
NM_017455chr154730 701 250 85 ----1287
NM_017456chr1751860 1286 283 232 52 --21491 97 11484
NM_017457chr191114 ------
NM_017488chr251625 1556 1446 604 370 21377 196 11171 --
NM_017491chr451036 860 781 173 21 --176 --
NM_017519chr631280 232 214 --21287 117 --
NM_017520chr13130 --178 --
NM_017522chr121246 1229 --11258 11070
NM_017526chr11115 ------
NM_017548chr3--11760 11521 --
NM_017551chr1042251 2228 2145 658 --22540 1766 --
NM_017553chr1541288 1225 413 304 11046 ----
NM_017558chr163442 401 40 ------
NM_017563chr3106004 5806 5225 5210 4969 4674 4410 1529 727 162 150 25584 2438 --
NM_017569chr13162 ------
NM_017575chr1771591 1536 1193 641 553 444 124 --1597 11528
NM_017577chr371496 1366 1166 590 432 267 192 11248 ----
NM_017580chr1072217 1928 920 911 546 405 168 --11753 --
NM_017582chr161793 1724 1712 652 358 86 ------
NM_017588chr941622 1194 445 130 ----11975
NM_017590chr2262386 1640 606 524 391 147 ----12541
NM_017593chr42429 100 ------
NM_017595chr1771471 1323 1107 1097 535 370 159 11556 11393 --
NM_017596chr1174590 4292 4220 3558 2917 1792 1562 1464 1191 1101 999 773 188 124 118 50 27 53321 3299 2839 1021 324 31447 1366 445 --
NM_017599chr1241944 1915 377 40 ----11691
NM_017602chrX3771 656 143 ------
NM_017610chr1531979 646 640 1406 22023 450 11870
NM_017617chr941106 365 302 32 ------
NM_017628chr4214964 4634 4549 4032 3929 3848 3332 3243 2121 2100 2033 2002 1980 1894 1873 1217 1060 1007 936 759 446 44424 1369 1304 1205 24638 3886 1506
NM_017629chr171379 1298 1260 661 370 344 75 1515 21551 108 --
NM_017632chr41139 ------
NM_017633chr683736 3588 3170 3045 2976 2766 209 199 --11432 --
NM_017634chr861854 1846 1714 1517 1402 1238 --11446 --
NM_017635chr1121364 97 ------
NM_017637chr9189058 9026 8823 8816 8187 7067 6453 5781 5745 3471 3266 2608 2597 2508 1992 1845 1508 214 23159 273 27992 3611 48212 5752 1347 1332
NM_017640chr62112 94 2771 279 ----
NM_017643chr17113025 3005 2755 2422 1922 1186 853 839 797 661 540 ----12704
NM_017644chr354032 3416 1862 1150 87 11168 14496 1782
NM_017645chr932324 1042 189 --33144 2217 2103 11236
NM_017650chr795872 5006 3864 1369 1133 930 858 464 260 --25899 730 1264
NM_017657chr22936 37 1880 ----
NM_017658chr1453871 3132 1170 1163 968 14513 ----
NM_017660chr1972708 2397 2373 1166 938 268 253 12880 13075 --
NM_017661chr151387 ------
NM_017666chrX31969 1763 257 --32053 815 562 --
NM_017668chr164778 537 145 94 ------
NM_017679chr174607 552 543 195 ------
NM_017684chr1531430 1351 208 --1105 --
NM_017686chr121141 366 2856 349 ----
NM_017693chr1341284 1179 653 214 --11263 --
NM_017694chr231794 380 285 31632 1400 120 ----
NM_017700chr44501 414 136 32 ------
NM_017709chr1104208 3462 3390 3278 2879 1588 1024 454 141 74 12938 ----
NM_017719chr322082 998 ------
NM_017724chr31685 ------
NM_017728chr1742305 2019 1143 688 ------
NM_017730chr31691 --1532 --
NM_017734chr14631 615 64 29 ------
NM_017737chr122197 1855 ------
NM_017738chr941040 960 864 268 ----1819
NM_017740chr1641833 1472 1178 568 --11348 --
NM_017742chr183767 185 137 ------
NM_017744chr172388 1779 1599 743 574 311 220 ----12212
NM_017745chrX2171 115 ------
NM_017747chr5196 ------
NM_017753chr931018 951 679 ------
NM_017754chr6164930 4665 4349 4296 4278 4084 4065 3843 1249 1162 1152 945 886 724 644 296 34547 4516 3176 21344 276 --
NM_017758chr1771398 1227 1165 1002 949 416 58 ------
NM_017770chr662964 2892 2522 1164 541 235 --31866 713 471 12536
NM_017772chr641607 1340 1188 588 1267 ----
NM_017778chr821164 147 11293 1538 --
NM_017779chr162755 2723 2607 2504 2000 893 1915 --22476 1809
NM_017780chr82866 281 ------
NM_017784