TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-885-3p
miRNA Sequence: AGGCAGCGGGGUGUAGUGGAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000034chr16122 ------
NM_000088chr171352 --11109 --
NM_000125chr643744 1708 1269 41 33855 1341 1261 ----
NM_000135chr16--1329 1753 --
NM_000208chr1984602 3658 3608 3134 1777 1583 580 233 ----11202
NM_000212chr171597 ------
NM_000217chr1211850 ------
NM_000259chr1564901 4323 4231 4150 3924 2393 34684 2503 639 ----
NM_000267chr1753156 2692 2516 183 98 21259 142 ----
NM_000278chr101791 --1535 --
NM_000314chr1033005 1088 1039 22893 1169 --1639
NM_000319chr122277 132 1327 ----
NM_000337chr545449 5023 4959 1902 22096 67 ----
NM_000362chr2233440 2807 1120 2535 148 ----
NM_000408chr22413 106 1788 ----
NM_000425chrX2458 107 --2642 185 --
NM_000430chr1773588 3455 2852 2640 2541 2482 2311 ----13047
NM_000480chr1121300 417 ------
NM_000495chrX199 ------
NM_000523chr231075 483 169 ------
NM_000555chrX57797 4980 1711 1585 795 21106 559 ----
NM_000615chr1132830 887 783 ------
NM_000618chr1236098 5152 365 ----16060
NM_000665chr7--1203 ----
NM_000719chr1264264 4239 2407 2222 1700 944 15223 1403 --
NM_000723chr1751586 1461 1400 1164 191 --2672 102 --
NM_000724chr10--2290 269 ----
NM_000725chr123885 282 144 ------
NM_000726chr211326 2575 120 ----
NM_000738chr111851 ------
NM_000756chr8----183 --
NM_000813chr535193 1912 1071 --14721 --
NM_000817chr2--1351 ----
NM_000828chrX31768 1523 57 ------
NM_000831chr144364 1644 1257 179 75435 4797 4372 1911 460 225 109 1568 --
NM_000875chr1576565 6123 4912 1874 731 415 132 35071 4734 1275 1580 --
NM_000920chr11--159 ----
NM_000937chr172378 54 ------
NM_000950chrX22753 1446 11252 ----
NM_000961chr2012820 13553 ----
NM_000966chr1241055 1017 802 25 1965 ----
NM_001001586chr12410 50 ------
NM_001001890chr2164221 3107 3044 1595 1447 154 ------
NM_001001933chr11130 ------
NM_001002296chr831136 1098 489 1111 ----
NM_001002762chr1052353 2335 1039 236 48 22599 1179 ----
NM_001002860chr1433918 2978 1225 13427 ----
NM_001002909chr1732106 2067 832 ------
NM_001003652chr1857356 5597 2347 2324 1578 17689 1395 --
NM_001003682chr111019 11264 ----
NM_001003786chr172651 291 --1761 --
NM_001004065chr953494 2945 2926 2479 313 13772 ----
NM_001004105chr5134 ------
NM_001004304chr1242847 2674 1188 986 12006 --1865
NM_001004317chr633047 1679 1128 33880 1728 529 ----
NM_001005271chr1721071 1052 178 ----
NM_001005335chr191282 ------
NM_001005360chr19--1567 1852 --
NM_001005366chr121241 ------
NM_001005404chr1732929 2795 330 12986 1173 --
NM_001005611chrX2209 103 ------
NM_001006115chr372630 2011 1927 1915 870 854 243 11103 22773 2428 --
NM_001007024chr1753748 3526 2718 1439 1129 2513 399 ----
NM_001007067chr82740 106 1803 ----
NM_001007097chr944064 3346 1512 108 44457 4447 3225 58 ----
NM_001007226chr171209 160 ----
NM_001007246chr2111863 11266 ----
NM_001007271chr102402 78 1432 ----
NM_001008220chr553536 3523 2505 1517 860 23171 778 ----
NM_001008222chrX41099 388 158 96 ------
NM_001008392chr323324 626 1999 --11010
NM_001008407chr721579 322 2627 518 ----
NM_001008660chr112350 86 ------
NM_001008661chr1--166 ----
NM_001008701chr1962884 2410 1911 513 454 430 32007 1916 397 11039 --
NM_001008738chr522453 1101 12457 ----
NM_001009569chr102180 106 ------
NM_001009880chr2244407 3404 1749 1014 156 1209 --
NM_001010924chr1021223 409 1877 1481 --
NM_001010942chr12148 ------
NM_001010986chrX11570 --12193 --
NM_001012329chr142208 709 601 404 1687 ----
NM_001012393chr1174730 3843 3462 1893 1849 1808 1718 ------
NM_001012423chr151650 2702 349 ----
NM_001012426chr642457 2159 1347 572 23366 2366 ----
NM_001012446chr9----160 --
NM_001012643chr193526 219 207 ------
NM_001012644chr202332 55 ------
NM_001012977chrX2465 278 1907 11101 --
NM_001013693chr152918 2600 2216 1149 614 22709 1918 ----
NM_001014283chr1381516 1473 1381 424 381 325 201 162 ------
NM_001014435chr163409 237 187 1529 ----
NM_001015045chr41507 ----1515
NM_001015053chr171634 --21111 137 --
NM_001017523chr1221768 118 11730 ----
NM_001018004chr15--1219 1525 --
NM_001024226chr12321 91 ------
NM_001024455chrX52671 2244 1895 844 226 21983 69 ----
NM_001024460chr62488 74 --1422 --
NM_001024668chr122788 743 ------
NM_001024808chr1241025 911 724 298 22193 518 12392 --
NM_001024948chr152285 2278 2165 2149 1345 ------
NM_001025105chr521520 1167 ------
NM_001025205chr32337 107 ------
NM_001025233chr1232554 1030 239 1257 1936 --
NM_001025579chr174989 958 757 72 ------
NM_001025580chrX33461 1586 290 ----1121
NM_001029875chr522582 177 ------
NM_001029989chr15--1308 ----
NM_001030005chr1511185 ------
NM_001032363chr151756 1718 565 537 433 186 ----
NM_001033049chr2111650 ----12342
NM_001033057chr311579 --11367 --
NM_001033059chr6--1434 ----
NM_001033112chr5--2823 179 ----
NM_001033557chr2--1580 ----
NM_001033578chr8--22323 543 ----
NM_001034915chr821473 1159 21278 1088 ----
NM_001035003chr411334 11189 ----
NM_001035260chr101320 ------
NM_001037334chr183499 320 200 ------
NM_001038640chr151786 1417 ----
NM_001039550chr24807 713 337 28 --1680 --
NM_001039577chr154172 3117 3096 695 22 ------
NM_001039580chr455092 5033 3556 1642 1456 13212 ----
NM_001039690chr1631634 1564 1511 ----159
NM_001039772chr111504 125 ----
NM_001039840chrX56018 4578 1767 767 317 1257 ----
NM_001039960chr1211064 ------
NM_001040056chr162493 33 1677 1697 --
NM_001040101chr44409 364 157 136 1476 ----
NM_001040110chr72571 430 11791 ----
NM_001040284chr1664267 2069 1078 889 731 230 ------
NM_001040439chr1681294 1255 1001 995 594 512 418 391 --11300 --
NM_001040450chr15--22397 2332 ----
NM_001042368chr9----2198 140 --
NM_001042479chrX31775 1536 1402 1197 ----
NM_001042506chrX31128 465 278 1907 ----
NM_001042537chrX42214 963 887 462 ------
NM_001042595chr19179 ------
NM_001042599chr257156 5961 5552 5135 287 22131 308 ----
NM_001042632chr204850 698 472 258 1111 ----
NM_001042683chr611223 ------
NM_001043318chr1493932 3478 1189 1103 1031 1001 778 770 691 11312 1395 --
NM_001044385chr243200 2817 1423 1189 21427 1213 ----
NM_001092chr1781808 1681 945 662 597 569 401 181 22376 414 1611 --
NM_001094chr172536 142 ------
NM_001095chr125676 312 271 252 69 1346 ----
NM_001096chr17--1827 ----
NM_001099678chr31386 ----11683
NM_001148chr41178 11781 ----
NM_001149chr1021265 1159 --1114 --
NM_001153chr21123 ------
NM_001191chr2031271 983 538 11077 ----
NM_001194chr19----2423 80 --
NM_001206chr953071 2163 2080 594 469 --12134 --
NM_001222chr1041773 1432 693 649 ------
NM_001241chr24860 634 381 229 1204 ----
NM_001253chr61290 ------
NM_001256chr1712665 1187 1489 --
NM_001259chr786379 6354 5469 4153 1821 375 271 118 2317 288 26251 6243 --
NM_001292chr152849 38 11081 ----
NM_001292chr152849 38 11081 ----
NM_001345chr12--186 ----
NM_001364chr111982 1866 23538 3019 --
NM_001365chr171753 ------
NM_001386chr82711 394 ------
NM_001396chr212704 81 12331 11749 --
NM_001404chr11126 ------
NM_001417chr1221526 162 2512 276 ----
NM_001419chr1944849 3252 3183 1950 11804 --1507
NM_001420chr1933086 2564 1928 --12154 --
NM_001426chr2----1468 --
NM_001429chr22--1737 ----
NM_001433chr172678 127 ------
NM_001543chr5114403 4348 4204 3633 3099 2984 2936 1422 1381 1225 247 ----1381
NM_001614chr172710 31 ------
NM_001635chr73831 821 349 ------
NM_001642chr1121026 375 ----192
NM_001654chrX195 ------
NM_001665chr11126 --1394 --
NM_001677chr12423 314 ------
NM_001679chr32195 187 ------
NM_001709chr1142085 816 305 250 ----1257
NM_001722chr82216 43 ------
NM_001753chr721379 1146 ------
NM_001759chr1245201 3948 3243 612 21771 626 --11699
NM_001783chr19124 --2297 247 --
NM_001903chr5----1590 --
NM_001939chrX53679 3636 3400 2349 320 13600 ----
NM_001949chr622755 2123 32600 2498 828 ----
NM_001964chr51221 ------
NM_001970chr172406 230 ------
NM_002010chr132203 82 2429 109 ----
NM_002023chr141589 1321 472 369 ------
NM_002028chr1421265 1118 11032 ----
NM_002047chr71130 ------
NM_002063chrX----11122 --
NM_002070chr3--1180 1875 --
NM_002126chr1743145 2912 2794 756 ------
NM_002137chr742402 1915 725 583 ------
NM_002147chr171643 ------
NM_002157chr2138 ------
NM_002205chr121915 ------
NM_002221chr13596 368 283 1401 ----
NM_002254chr24893 858 330 21 12311 ----
NM_002264chr354327 3230 1965 1640 1108 ------
NM_002267chr1332308 365 333 22465 160 ----
NM_002268chr331899 411 133 ------
NM_002270chr535555 1867 172 11212 ----
NM_002280chr17179 ------
NM_002293chr142572 2156 228 108 ------
NM_002305chr22138 ------
NM_002319chr71993 1343 1825 --
NM_002332chr121219 ------
NM_002360chr772621 2505 2006 1006 550 543 340 --11781 12209
NM_002373chr1531341 1294 973 ------
NM_002375chr382324 1995 1803 1682 1561 715 687 234 1753 ----
NM_002390chr1771973 1906 1710 1380 772 687 62 --11716 --
NM_002397chr512112 ------
NM_002401chr1781815 975 591 517 78 55 39 23 1678 ----
NM_002479chr13614 205 93 2778 583 ----
NM_002489chr71299 --126 --
NM_002499chr1572378 2298 1960 1877 1728 947 833 ------
NM_002537chr153914 264 129 --191 --
NM_002569chr151996 ------
NM_002607chr7--11126 ----
NM_002616chr173487 443 165 ------
NM_002628chr31929 1806 ----
NM_002660chr2051165 974 912 738 328 1964 ----
NM_002687chr14189 ------
NM_002698chr192517 96 ------
NM_002721chr92111 100 ------
NM_002747chr1821839 97 ------
NM_002760chrY25783 5057 35753 5701 4586 15979 --
NM_002821chr6----1809 --
NM_002824chr121452 1120 ----
NM_002835chr7----1242 --
NM_002840chr11591 2539 107 --1156
NM_002855chr1153447 3381 2664 449 114 43544 3395 3386 2386 ----
NM_002865chr8124 ------
NM_002868chr1232229 826 125 1189 ----
NM_002869chr111133 12228 ----
NM_002874chr931788 936 501 ------
NM_002880chr33690 157 110 2114 29 ----
NM_002886chr314355 ------
NM_002892chr1421163 389 137 ----
NM_003010chr17--21952 807 ----
NM_003028chr943571 2587 785 371 32795 1219 155 13395 --
NM_003047chr141437 1424 201 62 11428 ----
NM_003068chr8--1347 ----
NM_003069chrX--1735 ----
NM_003076chr122518 58 1600 ----
NM_003099chr1551213 1159 784 521 476 --139 --
NM_003108chr286046 5750 2798 2739 2290 2145 1324 447 11955 ----
NM_003110chr1721116 87 ------
NM_003113chr2149 1772 ----
NM_003128chr221140 500 12449 --1851
NM_003131chr651716 685 518 245 58 ------
NM_003149chr351478 550 283 88 42 1197 ----
NM_003155chr852483 1922 1860 590 367 ------
NM_003161chr1723512 1134 ------
NM_003164chr113532 505 480 171 ----
NM_003173chrX51189 1086 397 379 67 ------
NM_003185chr201297 ------
NM_003189chr142391 527 465 47 ------
NM_003200chr1972012 2004 1811 1498 679 582 305 ------
NM_003202chr541702 1389 463 51 1750 ----
NM_003204chr1721579 1493 11274 ----
NM_003234chr3--1815 ----
NM_003255chr1752473 846 822 802 400 1856 ----
NM_003285chr11173 ------
NM_003292chr1--11795 ----
NM_003298chr385665 5062 4620 2348 2180 1794 1359 1145 15670 ----
NM_003319chr2----1639 --
NM_003340chr431068 236 87 ------
NM_003344chr751451 1423 1103 639 503 ------
NM_003347chr2252338 2322 2211 2147 502 11869 ----
NM_003407chr19------1464
NM_003410chrX12015 ------
NM_003411chrY--11622 21146 163 --
NM_003412chr322367 1057 12531 ----
NM_003458chr333958 275 203 33580 2595 1569 11565 --
NM_003470chr1661778 1665 711 553 350 322 --1113 --
NM_003482chr1272091 2058 1991 1902 625 375 113 ------
NM_003489chr2132974 2635 338 ------
NM_003498chr162199 165 1766 180 --
NM_003502chr162589 23 ------
NM_003508chr7294 29 1103 ----
NM_003557chr121383 138 11397 ----
NM_003562chr17270 30 ------
NM_003586chr162455 94 ------
NM_003629chr122268 204 43134 3042 2386 674 ----
NM_003632chr171776 1314 1592 --
NM_003644chr1786393 4646 4633 4476 1322 1083 940 746 25703 5520 ----
NM_003659chr21288 2292 267 ----
NM_003664chr5165 ------
NM_003670chr3281 22 --11202 --
NM_003704chr43478 224 124 ------
NM_003741chr31343 ------
NM_003758chr1521120 36 1186 ----
NM_003822chr133033 2500 1086 ------
NM_003831chr18--151 ----
NM_003872chr221990 629 32338 2144 593 ----
NM_003893chr10--1471 ----
NM_003895chr2111961 22206 406 ----
NM_003908chr2021110 956 1107 11092 --
NM_003945chr52378 124 ------
NM_003966chr577417 7310 5554 1843 1223 1161 722 27723 145 ----
NM_003988chr101868 --41448 612 62 53 --
NM_004050chr1471938 1886 1797 782 678 506 456 ------
NM_004093chr1353033 913 768 692 286 33024 2324 1132 ----
NM_004117chr621925 165 ------
NM_004157chr32924 592 2348 117 1104 --
NM_004185chr11688 1102 ----
NM_004186chr31901 ------
NM_004202chrY1124 ------
NM_004205chr111128 ----1487
NM_004228chr192147 39 ------
NM_004232chr1831300 753 659 2309 97 ----
NM_004240chr19239 32 ------
NM_004263chr211392 --1648 --
NM_004286chr2262438 2029 848 562 487 404 42723 2036 1088 567 ----
NM_004309chr174390 368 273 222 --1459 --
NM_004311chr1062701 2509 1181 1111 524 69 1467 --1972
NM_004319chr132297 2101 23 32849 2220 27 ----
NM_004327chr2212105 1617 1422 --
NM_004329chr10--2562 134 ----
NM_004349chr821233 890 ------
NM_004393chr321745 915 22167 748 ----
NM_004397chr1143957 2648 1659 1579 11244 ----
NM_004411chr73588 506 260 1813 ----
NM_004416chr122947 734 1987 ----
NM_004420chr1172353 2140 2030 1922 1831 864 332 --2597 590 --
NM_004422chr172459 105 1109 ----
NM_004429chrX41287 1147 1125 1081 31376 1184 400 ----
NM_004430chr831774 756 459 22296 52 ----
NM_004438chr283329 2672 2237 2116 1276 1180 539 142 1319 ----
NM_004451chr112711 220 ------
NM_004456chr7139 ------
NM_004459chr172690 429 1569 ----
NM_004491chr1993881 3151 3027 1590 1517 1307 993 296 196 23886 174 13440 --
NM_004494chr12531 42 --1981 --
NM_004529chr91583 11042 ----
NM_004530chr162478 297 1309 ----
NM_004554chr1441743 1522 1480 188 ------
NM_004571chr2132366 2244 416 ----1316
NM_004576chr51324 ------
NM_004586chrX64990 3439 2140 1393 137 125 15256 ----
NM_004603chr771154 1095 750 446 395 78 59 163 ----
NM_004637chr3--1121 ----
NM_004643chr143318 276 226 ------
NM_004655chr173850 418 262 ------
NM_004690chr61738 1768 ----
NM_004700chr11139 ------
NM_004709chrX11389 11229 ----
NM_004748chr1533767 827 731 ------
NM_004756chr192484 467 ------
NM_004772chr5--1531 ----
NM_004776chr2042036 1011 977 961 22588 771 1266 --
NM_004788chr1142561 1968 1838 387 ------
NM_004798chr2063077 3028 2648 2545 1467 917 12635 --13156
NM_004805chr231348 443 21 --1559 --
NM_004849chr621187 1104 --1116 --
NM_004852chr18714327 10955 3782 3100 2683 1916 1616 ------
NM_004860chr17291 43 ------
NM_004898chr462732 2722 2670 802 607 157 ------
NM_004924chr191969 ------
NM_004953chr32388 165 --1346 --
NM_004973chr641327 1278 485 89 --11663 --
NM_004979chrX1749 ------
NM_004992chrX63186 2992 2810 2176 1184 281 67845 7399 6365 3029 2180 1386 16580 --
NM_005020chr7--133 ----
NM_005026chr12800 123 ------
NM_005032chrX1270 ------
NM_005096chrX1411 ------
NM_005097chr10--123 ----
NM_005099chr121129 78 ------
NM_005105chr121664 725 12116 ----
NM_005121chr1723735 57 ------
NM_005144chr82835 372 ------
NM_005229chrX------1815
NM_005273chr71227 ------
NM_005342chrX188 32437 2220 600 ----
NM_005359chr1876128 6113 5250 4663 4223 2116 135 14002 ----
NM_005374chr1771967 1559 944 646 324 215 112 12180 ----
NM_005400chr2133 1821 ----
NM_005406chr181275 ------
NM_005418chr11184 ------
NM_005424chr1298 52 ------
NM_005458chr9166 1510 12157 --
NM_005461chr202393 386 --11685 --
NM_005465chr1--1242 ----
NM_005491chrX4825 793 603 456 3880 830 800 1808 --
NM_005502chr932093 841 563 --13093 --
NM_005507chr11168 2342 140 ----
NM_005542chr7--1316 ----
NM_005552chr143176 107 100 ------
NM_005575chr5129 ----1100
NM_005578chr323979 3764 33822 1401 350 ----
NM_005596chr956381 5896 4909 1719 1572 ------
NM_005692chr72154 56 1177 ----
NM_005714chr11--1130 1188 --
NM_005716chr191627 ------
NM_005717chr11868 --180 --
NM_005723chr43210 163 21 ------
NM_005737chr23674 414 324 ------
NM_005748chr122445 368 11057 ----
NM_005768chr12--1140 ----
NM_005779chr523139 1101 23132 245 ----
NM_005785chr1211617 ----11725
NM_005796chr162327 28 1137 1133 --
NM_005801chr172708 180 ------
NM_005828chr1754801 2000 1849 362 137 34177 3786 1185 ----
NM_005841chr41841 1127 ----
NM_005866chr91857 ------
NM_005875chr32320 64 ------
NM_005909chr523968 3560 ------
NM_005935chr445102 4749 3508 668 ----1793
NM_005941chr823181 2982 12738 ----
NM_005955chr173616 1883 1529 1032 828 700 352 1784 ----
NM_005957chr183636 2973 1948 1143 852 728 595 64 33862 1385 312 13372 --
NM_006015chr131052 117 69 ----1849
NM_006041chr173424 343 131 ------
NM_006079chr61601 1173 ----
NM_006091chr1511788 1384 ----
NM_006094chr821907 161 ------
NM_006100chr31117 ------
NM_006133chr1162148 1686 696 535 367 343 --1135 --
NM_006136chr7182 2443 103 ----
NM_006158chr8--1222 ----
NM_006190chr2--152 ----
NM_006224chr1762244 2099 1983 986 719 354 1890 ----
NM_006252chr136896 6554 5014 ------
NM_006283chr884817 1959 1828 738 542 267 137 42 1156 ----
NM_006289chr9173 ------
NM_006293chr153397 374 366 ------
NM_006306chrX35892 5845 43 25003 4918 ----
NM_006313chr1241589 1215 432 272 ------
NM_006320chr421008 96 1178 ----
NM_006336chr91354 --1940 --
NM_006361chr173672 563 138 21876 295 ----
NM_006369chr1167 ------
NM_006373chr1741419 1039 287 250 ------
NM_006492chr1131 ------
NM_006526chr2021411 634 --1333 --
NM_006538chr233348 990 468 1629 ----
NM_006540chr831503 543 182 ------
NM_006547chr711909 --11479 --
NM_006555chr721951 1531 ------
NM_006557chr931508 1082 611 ------
NM_006595chr112518 154 ------
NM_006609chr2--11126 ----
NM_006612chr17--1192 171 --
NM_006628chr1523800 610 1137 ----
NM_006640chr1741474 1336 756 609 1134 ----
NM_006646chr132352 206 1227 ----
NM_006690chr2051634 1588 1575 724 624 3814 670 215 ----
NM_006717chr923138 1052 12594 ----
NM_006729chrX45214 4676 4159 1584 45575 4841 1646 1217 ----
NM_006736chr241817 1723 1347 714 --21690 756 --
NM_006738chr15104327 4164 3722 3396 1369 1272 1266 966 63 29 13962 ----
NM_006742chr1652005 1505 1406 1312 273 12024 ----
NM_006763chr161556 1336 760 586 187 42 ------
NM_006772chr621217 218 ------
NM_006789chr61318 136 ----
NM_006791chr15--1208 ----
NM_006815chr121217 1515 ----
NM_006861chr1242143 524 484 362 --1256 --
NM_006885chr1633354 2862 1143 ------
NM_006899chr201293 1286 ----
NM_006939chr14--1230 ----
NM_006943chr2053027 2616 2433 969 815 --21300 692 --
NM_007011chr15116662 6612 5231 4623 4565 4546 2532 1107 966 867 591 35130 4829 2355 ----
NM_007084chr133514 470 66 --1982 --
NM_007106chr1322352 49 1308 ----
NM_007118chr5197 ------
NM_007125chrY1153 ------
NM_007126chr91364 ------
NM_007146chr17----12751 --
NM_007174chr12--22267 193 ----
NM_007184chr32546 200 3523 399 212 ----
NM_007185chr11777 --1121 1745
NM_007198chr81435 11512 ----
NM_007219chr203789 749 82 1106 ----
NM_007249chr1347499 7245 6299 932 1311 ----
NM_007271chr61667 11285 ----
NM_007345chr1822150 687 ------
NM_007367chr20----149 --
NM_012064chr121875 1402 ----
NM_012081chr533727 636 177 21377 814 ----
NM_012090chr131059 1035 129 ------
NM_012104chr1132587 1349 272 ------
NM_012166chr961563 1551 1409 591 486 440 ------
NM_012197chr941459 1310 1061 52 ------
NM_012199chr154151 1722 1602 1030 799 1612 ----
NM_012207chr101268 ------
NM_012234chr332614 343 70 22422 122 ----
NM_012308chr112760 252 ------
NM_012316chr164417 4133 2062 1562 644 115 23427 2192 ----
NM_012410chr16194 1213 ----
NM_012428chr15--1364 ----
NM_012434chr6--3511 452 156 ----
NM_012448chr1752080 1613 901 889 869 ------
NM_012471chrX21490 353 1473 1492 --
NM_013246chr11--1736 ----
NM_013275chr165741 705 207 58 46 ------
NM_013372chr153841 421 117 ------
NM_013385chr2231431 622 304 1372 ----
NM_013411chr122301 867 --12340 --
NM_013446chr731421 116 51 ------
NM_013449chr1261933 1038 999 946 511 83 12939 1546 --
NM_014001chr1771639 1625 1477 1138 270 158 46 31200 480 236 11371 --
NM_014043chr3--1462 ----
NM_014112chr844436 3918 625 432 ------
NM_014159chr31539 ------
NM_014190chr461649 1580 1391 1140 229 217 21675 44 ----
NM_014191chr1241003 928 328 306 ------
NM_014275chr52925 177 ------
NM_014286chr973247 2663 2264 947 702 286 126 ------
NM_014289chrX--1968 1964 --
NM_014299chr1981693 1615 1507 1439 697 511 250 201 11878 11784 --
NM_014342chr1121466 926 --11251 --
NM_014368chr9146 ------
NM_014417chr19----1880 --
NM_014423chr534716 4345 1632 --121 --
NM_014437chr12752 345 1819 ----
NM_014449chr12180 1211 ----
NM_014454chr62840 780 2409 219 ----
NM_014515chr122184 52 ------
NM_014516chr191188 ------
NM_014571chr132096 1999 959 --12815 --
NM_014577chr222240 178 ------
NM_014613chr54970 751 180 150 12112 12285 --
NM_014630chr15103722 3026 2879 2622 1398 821 718 632 364 283 32636 309 143 1236 --
NM_014636chr984132 3808 3590 3354 2653 917 819 441 1772 ----
NM_014655chr131507 891 468 2725 408 ----
NM_014665chr8133425 3408 3279 3060 3010 2886 2545 2536 2341 1439 1430 1364 278 1605 11389 --
NM_014670chr221197 1130 11225 ----
NM_014671chr72975 502 11229 1436 --
NM_014686chr1942396 1898 806 774 12032 ----
NM_014699chr162392 298 ------
NM_014723chr2072509 2473 1092 1085 580 366 336 12145 ----
NM_014727chr19141 ----152
NM_014730chr1285201 4980 4886 4334 4264 3728 2103 1822 11003 ----
NM_014732chr1674528 3659 1520 913 538 156 125 21705 1603 24866 1279 1422
NM_014747chr1135467 5078 4914 4042 3854 3826 3791 3663 2142 1250 525 379 108 ------
NM_014748chr22406 268 ------
NM_014755chr233509 1647 536 ----12672
NM_014757chr541967 1917 1822 867 ------
NM_014761chr162829 171 11186 ----
NM_014782chrX1253 1122 ----
NM_014830chr12--1346 --11159
NM_014840chr1252984 2918 2101 1031 261 33025 2151 511 ----
NM_014847chr1----1105 --
NM_014871chr121527 1479 ----
NM_014891chr73415 378 91 1200 --146
NM_014900chr22405 221 ------
NM_014901chr52543 237 ------
NM_014906chr17------1765
NM_014912chr104887 804 679 421 1696 ----
NM_014934chr1333679 2876 400 --1228 --
NM_014947chr151970 1115 949 328 216 13111 ----
NM_014952chr1511823 11753 ----
NM_014956chr115966 890 668 312 68 ------
NM_014969chr11203 ----1233
NM_014982chr1454921 3848 2132 700 225 ------
NM_014990chr1411156 2922 390 ----
NM_014991chr432737 648 272 ------
NM_015025chr252330 2157 539 252 58 22729 2075 ----
NM_015042chr1583630 3621 3596 3405 2777 820 694 359 ------
NM_015045chr1021420 339 ------
NM_015063chr19--31401 1052 471 11371 --
NM_015069chr16------1141
NM_015071chr574807 4531 2277 1895 1568 1158 1035 26383 693 ----
NM_015075chrX2869 257 --11982 --
NM_015080chr113729 106 32 ------
NM_015082chr562150 2140 495 339 235 74 ----1167
NM_015091chr142740 308 ------
NM_015093chr62454 231 ------
NM_015103chr33816 144 27 1321 ----
NM_015139chr11146 ------
NM_015149chr122138 1581 12228 ----
NM_015155chr1063020 2545 2475 1058 753 35 12989 ----
NM_015157chr1131134 1059 147 3752 311 221 ----
NM_015215chr123108 953 11957 ----
NM_015229chr173955 774 444 2974 457 1931 --
NM_015238chr51568 ------
NM_015246chr1671989 1451 1428 674 506 298 61 11730 1512 --
NM_015265chr232114 2084 1927 ------
NM_015282chr242496 2320 2227 84 --12449 --
NM_015284chr131653 1366 158 --1729 --
NM_015288chr583765 3742 2772 2664 2520 2435 1532 649 2753 112 13771 --
NM_015299chr1473646 3603 3345 2873 382 82 24 23856 266 12916 --
NM_015308chr111219 ------
NM_015315chr542979 1395 1199 917 22327 1168 1691 --
NM_015328chr772802 2768 2509 2146 709 106 88 12136 ----
NM_015338chr2041917 1284 1192 214 11292 ----
NM_015345chr632716 909 244 ------
NM_015349chr612275 22172 588 --12840
NM_015367chr2241213 642 311 79 ------
NM_015483chr71789 1900 11012 --
NM_015497chr152981 232 ------
NM_015508chr3--11415 ----
NM_015509chr12--11023 ----
NM_015530chr22636 337 1254 ----
NM_015542chr1031257 1213 1028 ------
NM_015568chr2084316 3354 3179 2996 606 252 197 152 44293 3075 2894 1145 ----
NM_015576chr322691 524 ------
NM_015577chr521658 1429 ----177
NM_015686chrX22239 343 1427 1899 --
NM_015687chr62208 43 ------
NM_015719chr191671 ------
NM_015831chr7--1947 1733 --
NM_015872chr121491 275 ------
NM_015879chr1827885 6908 38387 5668 246 13288 --
NM_015902chr81324 196 ----
NM_015906chr134735 3698 1092 ------
NM_015981chr552154 1985 295 68 22 22097 1157 ----
NM_015982chr17--135 ----
NM_016076chr13907 295 201 13065 ----
NM_016098chr62170 50 ------
NM_016147chr1121113 954 --1279 --
NM_016201chr352112 1778 828 805 404 --192 --
NM_016202chr19123 ------
NM_016217chr633416 2323 149 ------
NM_016256chr161225 1564 ----
NM_016272chr2252091 1929 998 847 342 ------
NM_016306chr31244 ------
NM_016319chr122586 44 ----1240
NM_016338chr53388 271 22 ------
NM_016339chr1761709 1309 694 662 444 330 11660 11763 --
NM_016396chr151944 ------
NM_016463chr5123 ------
NM_016505chr11181 ------
NM_016592chr2021087 1006 --1507 --
NM_016598chr34349 314 273 222 11457 1305 --
NM_016604chr5----1154 --
NM_016605chr522574 1842 12595 ----
NM_016607chrX--193 1225 --
NM_016626chr1831416 1337 425 1158 ----
NM_016831chr132011 1502 757 ------
NM_016946chr11856 --1678 13145
NM_016952chr1153485 2841 1480 1451 342 33121 472 382 13540 --
NM_017410chr1241050 274 157 75 --1474 --
NM_017413chrX21962 1692 11697 11705 --
NM_017423chr452023 1991 732 508 78 21995 664 ----
NM_017450chr172478 179 --127 --
NM_017542chr111363 21720 1162 ----
NM_017575chr172635 201 1221 ----
NM_017582chr141789 1589 1548 1282 1585 182 --
NM_017602chrX3763 652 222 1839 --1182
NM_017607chr193466 222 40 1554 ----
NM_017628chr464498 4206 2018 1994 1020 813 24267 4128 ----
NM_017633chr643717 3676 3135 830 13429 ----
NM_017634chr81241 ------
NM_017637chr9108753 8486 6437 6358 2945 2890 2624 1700 1374 405 37723 7468 6981 15977 --
NM_017670chr116862 664 209 198 185 31 --121 --
NM_017686chr121020 888 ------
NM_017693chr13--21291 445 ----
NM_017709chr122830 1181 ------
NM_017728chr1782656 2580 1969 908 757 643 450 243 12479 1767 --
NM_017739chr11388 ------
NM_017753chr91377 ------
NM_017780chr81348 1920 ----
NM_017799chr1411252 21436 741 ----
NM_017847chr11163 1115 ----
NM_017849chr242181 1213 578 333 ------
NM_017851chr153910 428 301 1329 ----
NM_017873chr923028 2535 23057 2275 12457 --
NM_017925chr9--11435 ----
NM_017944chr111665 12797 1915 --
NM_018027chr1021051 936 1696 ----
NM_018030chr1811062 31040 383 288 ----
NM_018036chr1424012 319 1243 ----
NM_018061chr1--2476 303 ----
NM_018064chr6128 ------
NM_018103chr11288 ------
NM_018133chr31425 ------
NM_018144chr101231 ------
NM_018211chr11738 --163 1863
NM_018364chr124035 1377 2880 226 ----
NM_018412chr7------140
NM_018416chr1222572 155 ------
NM_018425chr1042220 2075 1896 460 --11053 --
NM_018482chr8288 50 ------
NM_018489chr13778 596 369 22231 2118 ----
NM_018490chr11--11495 ----
NM_018509chr1721467 22 1345 ----
NM_018584chr111056 ------
NM_018650chr11843 ------
NM_018652chr151786 1417 ----
NM_018657chr32265 141 ------
NM_018667chr1642320 1843 431 217 1369 2409 154 --
NM_018689chr1572574 2123 2081 1785 1082 655 105 1169 1983 --
NM_018698chrX11764 1151 1402 --
NM_018704chr111583 11749 ----
NM_018713chr121078 215 ------
NM_018898chr51884 11895 ----
NM_018945chr632728 2629 998 11251 1204 --
NM_018994chr11471 ------
NM_019046chr10--1851 ----
NM_019063chr231581 623 547 12034 ----
NM_019096chr64438 120 67 32 1949 ----
NM_019106chr2252777 2351 2264 2107 679 22101 706 12231 --
NM_019116chr1673749 3066 1347 1282 1123 697 658 23129 1442 --13110
NM_019555chr311612 1682 ----
NM_019593chr2062739 2037 861 661 555 42 1559 13043 --
NM_019594chr921014 447 21042 311 21231 40 --
NM_019606chr7135 --2152 44 --
NM_020155chr11--126 ----
NM_020180chr1811262 --1371 --
NM_020185chr6--156 ----
NM_020198chr1711281 ------
NM_020205chr123442 972 1157 ----
NM_020214chr15186 ------
NM_020235chr32303 118 ------
NM_020336chr2023143 2891 23647 518 --11147
NM_020337chr451090 1001 629 480 168 22507 2042 ----
NM_020338chr1031203 971 142 11311 ----
NM_020382chr1231394 1028 622 11135 21131 428 --
NM_020405chr1764536 4312 3023 2864 920 138 33862 3347 781 ----
NM_020432chr722170 60 ------
NM_020438chr941190 437 238 208 1248 ----
NM_020443chr166842 2742 2504 2115 1907 653 32202 702 638 ----
NM_020645chr111647 ------
NM_020647chr82582 413 ------
NM_020699chr155323 3753 3472 1232 202 21581 532 ----
NM_020703chr1188 1172 ----
NM_020708chr201277 --3408 235 130 179
NM_020717chrX51696 1514 1418 451 275 31842 1426 257 ----
NM_020747chr5--2625 297 ----
NM_020755chr62390 366 ------
NM_020791chr1751314 1275 1241 190 37 11198 ----
NM_020899chr172686 149 ------
NM_020925chr111108 11112 ----
NM_020956chr19194647 4588 4518 4206 4131 3948 3819 3480 3164 2931 1851 1773 1695 1458 1098 976 777 751 411 33577 931 731 11426 --
NM_020971chr191183 ------
NM_020988chr162939 484 ------
NM_021033chr1333030 3020 2358 12963 ----
NM_021064chr641516 528 495 480 ------
NM_021072chr522530 1820 ------
NM_021079chr1773111 2827 2449 2316 2310 2084 1294 32569 1253 822 ----
NM_021109chrX1124 ------
NM_021117chr1161946 1653 1593 531 315 202 1787 ----
NM_021132chr101973 ----1205
NM_021165chr11636 ------
NM_021168chr165497 481 259 209 109 11482 11575 --
NM_021198chr221164 262 2308 292 ----
NM_021202chr201616 1535 ----
NM_021249chr1431593 1462 34 1322 ----
NM_021255chr1432833 2816 1573 ------
NM_021267chr1961383 1344 1280 1225 865 330 --41189 1177 976 343 --
NM_021627chr33401 181 29 31075 472 122 ----
NM_021638chr481906 1690 1094 925 906 753 578 412 21286 649 --13454
NM_021648chr62711 550 11025 ----
NM_021724chr17----128 --
NM_021813chr684143 4070 4021 3700 3620 2332 1712 83 24821 4733 ----
NM_021914chr1421861 831 --1864 --
NM_021945chr663299 2756 2244 944 423 98 22748 2625 23586 1235 --
NM_021961chr1166948 6162 4940 4551 2222 2197 35169 5040 4636 ----
NM_021964chr324736 2597 11908 ----
NM_021998chrX21443 1118 11032 ----
NM_022037chr2--1274 ----
NM_022048chr1566397 5445 4239 1946 256 226 21988 1184 ----
NM_022060chr1411368 ------
NM_022143chr72459 354 1266 ----
NM_022166chr1685392 4355 2375 2098 1670 1510 1465 402 35241 3905 827 ----
NM_022450chr16--1272 ----
NM_022455chr5134 ------
NM_022465chr1231128 1118 1078 11982 ----
NM_022469chr132300 762 507 --2520 99 --
NM_022552chr2----1911 --
NM_022574chr722010 1715 2818 707 22046 655 --
NM_022648chr254612 3593 3056 1342 1160 13047 22929 1426 14528
NM_022719chr2283118 2900 2444 1100 1039 732 418 273 22606 1550 12824 --
NM_022733chr111176 125 ----
NM_022737chr192216 196 ------
NM_022763chr331220 777 635 12336 ----
NM_022781chr92548 292 1732 ----
NM_022823chr21435 1508 ----
NM_022893chr22484 411 32586 2542 2382 ----
NM_022894chr2--2227 86 11120 --
NM_022896chr2041663 1233 309 194 ------
NM_022898chr1474256 3972 3966 3436 3245 928 437 1920 11880 147
NM_022912chr23996 936 389 22418 557 ----
NM_023009chr1288 49 ------
NM_023012chr12----1315 --
NM_023037chr132728 292 21009 46 ----
NM_024015chr1711128 ------
NM_024336chr161366 1370 ----
NM_024602chr1--1278 ----
NM_024612chr17--1202 --1304
NM_024665chr334546 1785 1317 22978 1382 ----
NM_024674chr131303 563 500 ------
NM_024676chr14504 355 198 148 --11085 --
NM_024692chr221518 756 --11444 --
NM_024700chr121048 313 ------
NM_024742chr1651526 1397 1328 723 101 11217 ----
NM_024745chr162400 49 169 ----
NM_024877chr1951086 1039 245 182 104 --1167 --
NM_024922chr1662009 1603 1408 1377 725 520 ------
NM_024944chr21----1856 --
NM_024954chr102544 60 178 ----
NM_024963chr795505 3991 3703 3685 3637 2150 1790 1452 440 25437 4486 14482 --
NM_025010chr332346 2287 1784 ------
NM_025054chr831284 659 180 24074 2663 ----
NM_025057chr142942 31 ------
NM_025133chr21364 ------
NM_025146chr312028 ------
NM_025154chr731508 605 128 21513 978 ----
NM_025160chr153750 3589 3458 642 539 ------
NM_025182chr9----1302 --
NM_025191chr122168 467 ------
NM_025248chr171596 --12818 --
NM_025251chr82976 335 --1316 --
NM_030648chr444572 3710 1681 1634 11433 ----
NM_030661chr731176 1145 1130 ------
NM_030761chr162645 2393 2115 2074 803 250 42631 739 265 214 12091 --
NM_030766chr123692 213 119 ------
NM_030780chr8--1222 ----
NM_030792chr11--1861 ----
NM_030806chr169091 7944 5943 2787 2249 1874 37612 6282 227 ----
NM_030913chr11283 ------
NM_030981chr1171104 1046 990 366 335 244 158 ------
NM_031291chr4--165 ----
NM_031365chr21375 11872 --137
NM_031372chr411461 1154 ----
NM_031407chrX2338 139 ------
NM_031417chr194901 826 643 172 --278 72 1833
NM_031418chr1142753 2714 2522 572 1480 ----
NM_031434chr7172 ------
NM_031445chr243383 2801 2158 622 ----21253 133
NM_032017chr161843 1632 1499 742 411 286 267 33 1373 --
NM_032042chr51324 --1377 1236
NM_032102chr113718 655 98 ----1390
NM_032109chr5----11148 --
NM_032174chr1--1162 ----
NM_032193chr1151992 1282 571 493 353 11270 ----
NM_032199chr1021548 1071 ------
NM_032211chr10127 ------
NM_032239chr42588 118 ------
NM_032268chr1693163 3094 2617 2548 2515 2468 2329 2092 383 23038 1118 --1435
NM_032289chr511697 ------
NM_032320chr111497 ------
NM_032382chr162555 119 ------
NM_032445chr1522288 1956 ------
NM_032452chr1451335 509 479 372 294 ------
NM_032457chr443353 3255 2890 1230 12490 ----
NM_032499chr1521384 118 ------
NM_032512chrX41171 1074 446 111 --1421 --
NM_032524chr175192 162 147 130 70 3179 74 44 ----
NM_032552chr931280 553 198 11403 ----
NM_032569chr162342 329 ------
NM_032603chr2--2175 59 ----
NM_032689chr1911415 1647 ----
NM_032982chr72966 536 22506 970 ----
NM_033025chr191400 3279 199 116 ----
NM_033030chr22158 96 ------
NM_033058chr82802 131 ------
NM_033089chr2041072 523 371 230 ------
NM_033133chr17103628 3273 3236 2937 2803 2593 2440 866 841 341 ------
NM_033224chr777879 4899 2212 2056 1729 1444 893 ------
NM_033225chr822692 1948 12429 12878 --
NM_033259chr32160 75 ------
NM_033309chr161871 ------
NM_033315chr1731987 1744 1406 ------
NM_033389chr1784354 4062 3728 3175 1627 1536 1024 752 1303 ----
NM_033397chr1042232 2190 732 298 1550 ----
NM_033420chr193275 66 28 --1109 1312
NM_033449chr561942 1628 1453 1349 750 34 2579 56 ----
NM_033506chr71149 ------
NM_033515chr621180 160 1165 ----
NM_033631chr173846 3524 3424 3033 2976 769 557 22505 2449 ----
NM_052840chr151469 ------
NM_052854chr112568 513 ------
NM_052879chr12--1299 ----
NM_052885chr1223823 555 24007 3827 ----
NM_052897chr122781 770 ------
NM_052900chr8----11472 --
NM_052906chr2254455 4229 1186 607 271 43699 3130 1666 1057 ----
NM_052910chr1341666 1520 1505 517 ------
NM_052934chr152006 763 616 508 24 31629 635 456 ----
NM_053023chr1142808 2544 721 416 ------
NM_053046chr192176 72 1481 192 --
NM_053056chr1132766 2739 1050 12040 --11967
NM_058197chr93741 215 111 --1181 --
NM_078469chr10--1533 ----
NM_078487chr951005 272 184 149 80 1388 ----
NM_080616chr20145 1660 ----
NM_080738chr11617 ----11930
NM_080836chr2064139 3275 1840 1433 1363 1071 13798 14319 --
NM_133369chr54681 634 131 101 ------
NM_138333chr921981 433 ----1251
NM_138334chr19----1147 --
NM_138350chr131395 580 437 1498 ----
NM_138440chr16--170 ----
NM_138444chr1373225 1652 1525 852 758 194 96 --1831 --
NM_138447chr163288 152 113 ------
NM_138468chr235209 4707 359 15165 15333 --
NM_138473chr1264875 4742 3698 1154 948 722 ------
NM_138689chr11----148 --
NM_138729chr1--1103 ----
NM_138775chr112541 36 ------
NM_138782chr512239 ------
NM_138967chr1532447 2229 228 --12398 --
NM_139161chr192339 159 172 ----
NM_139245chr361625 1373 570 482 404 23 --11499 --
NM_139278chr841195 1184 921 427 1803 ----
NM_144571chr446657 5550 2743 99 32720 1396 1116 ----
NM_144578chr1454763 4157 1979 1811 466 24545 1597 ----
NM_144580chr12317 241 ------
NM_144974chr131753 ------
NM_145008chr112699 673 1819 ----
NM_145012chr101132 ------
NM_145239chr1621205 48 ------
NM_145285chr101515 ----1762
NM_145307chr1033120 1815 1267 ------
NM_145349chr1741638 1614 233 198 1855 1346 --
NM_145808chr732810 412 58 --1513 --
NM_145891chr1631617 1598 1504 11524 ----
NM_147161chr11258 41211 747 401 247 ----
NM_147190chr12--1603 ----
NM_147202chr952306 2297 1815 876 560 22614 999 ----
NM_148170chr1123387 195 --11650 --
NM_148571chr1721810 568 ------
NM_152253chr2294299 4101 3977 3363 2864 2651 1039 522 230 13547 172 --
NM_152264chr111402 1690 ----
NM_152271chr831052 1029 68 ------
NM_152275chr221903 468 31645 903 315 ----
NM_152335chr151124 173 ----
NM_152346chr172758 215 1358 ----
NM_152384chr261820 1488 1313 744 576 336 1447 ----
NM_152493chr111357 1373 ----
NM_152527chr211776 ------
NM_152570chr92227 103 ------
NM_152588chr12----1475 --
NM_152589chr12--1216 ----
NM_152624chr557462 5969 2453 1706 883 12919 12086 --
NM_152716chr1121390 1057 255 40 ----
NM_152749chr7--1249 ----
NM_152753chr631914 1285 727 ------
NM_152754chr723262 2350 22791 970 ----
NM_152756chr511684 ----14081
NM_152860chr1241445 610 378 33 21101 1075 ----
NM_152888chr8----1184 --
NM_153029chr1684059 4031 3782 3656 2670 1279 1262 1153 24036 196 23636 3394 --
NM_153033chr731312 545 85 1630 ----
NM_153035chr11209 1234 1397 --
NM_153207chr1232743 322 311 21223 540 ----
NM_153215chr32327 155 192 ----
NM_153261chr1611096 11441 ----
NM_153262chr133038 2596 915 12370 ----
NM_170606chr72720 380 ------
NM_170739chr112103 79 1119 ----
NM_170768chr1131778 1353 459 --1326 --
NM_172020chr751657 1512 772 606 518 11290 2763 292 --
NM_172071chr147212 2231 1297 1213 25974 4554 ----
NM_173156chr122216 1500 ----1116
NM_173172chr22418 34 ------
NM_173354chr2151654 1603 1589 1346 770 --1789 --
NM_173460chr20176 1214 ----
NM_173475chr1631431 1178 42 11619 ----
NM_173476chr1672052 1916 1760 1559 580 520 90 1117 ----
NM_173500chr152336 281 21421 468 ----
NM_173511chr253942 3905 1438 1193 393 ------
NM_173595chr1254799 4739 4042 4036 144 21547 317 24536 4320 --
NM_173618chr16--1105 ----
NM_173681chr72835 469 ------
NM_173849chr14----187 --
NM_175069chr93207 134 104 ------
NM_175736chr1246340 6203 5249 1645 ------
NM_175854chr1331845 448 124 1194 ----
NM_175895chr12----188 --
NM_175907chr18----1851 --
NM_176871chr882608 1039 683 642 573 437 329 218 33308 2676 1106 ----
NM_178011chr101717 1923 ----
NM_178423chr731144 208 89 ------
NM_178450chr51202 1229 ----
NM_178502chr12132 ----1602
NM_178831chr732585 1135 731 1138 1127 --
NM_178835chr4------179
NM_181504chr523730 1124 23743 3357 ----
NM_181532chrX1247 ------
NM_181671chr171105 ------
NM_181712chr122106 1342 ------
NM_182485chr412721 33698 604 322 ----
NM_182509chr1481170 1086 539 403 277 217 63 45 21438 256 ----
NM_182543chr10146 1129 ----
NM_182557chr1132219 1747 591 ------
NM_182580chr152534 2115 1962 845 833 22570 143 ----
NM_182717chr1011327 1268 11452 --
NM_182920chr321104 577 ------
NM_182970chr2054271 3082 1698 1557 1161 23207 2881 1354 --
NM_183425chr2031203 685 642 31542 358 180 176 --
NM_194247chr233635 3315 3084 1869 ----
NM_194314chr124021 279 25299 82 ----
NM_194449chr181360 1881 ----
NM_198270chrX43315 3137 2849 325 ------
NM_198904chr522147 2072 11800 ----
NM_198993chr1731427 1260 341 11629 ----
NM_199133chr5--1849 ----
NM_199141chr192679 158 ----1210
NM_199262chr1752251 2243 1984 938 391 1673 ----
NM_201521chr64367 331 287 133 ------
NM_201550chr12--1929 ----
NM_201634chr551801 1488 562 150 105 --166 --
NM_203301chr1411383 11147 ----
NM_203403chr91380 ----164
NM_203434chr91317 11160 ----
NM_203458chr123659 149 11544 ----
NM_207009chr103394 383 345 1212 ----
NM_207043chr132080 258 132 31892 1751 456 ----
NM_207313chr171358 ------
NM_207371chr102977 158 ------
NM_207397chr1186 1262 ----
NM_212467chr1552619 2459 2030 1035 486 --12528 --