TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-885-5p
miRNA Sequence: UCCAUUACACUACCCUGCCUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001003652chr18108321 8268 8252 7335 7243 5862 3080 1408 1186 315 28280 7843 12477 38347 3371 2602
NM_001007024chr1723379 3372 ----34225 3417 136
NM_001010888chrX34379 4047 1314 ----34605 1545 312
NM_002025chrX138819 8500 6750 6720 6695 2985 2610 1851 1691 1311 1056 1033 62 12751 26924 6903 --
NM_004482chr22681 282 ----2905 886
NM_005339chr474100 4002 3147 1572 912 783 653 12696 --11367
NM_007007chr1264233 3555 1075 849 429 408 14409 11115 13908
NM_007249chr1379239 9005 8864 8159 1998 1278 359 47598 7328 7126 6170 27081 2350 --
NM_014112chr8105106 4869 3561 1752 1650 1523 825 786 67 47 ------
NM_015886chr895487 4542 4371 4054 4043 3897 1618 406 240 11096 1490 --
NM_016009chr154855 4761 4348 3981 565 --11239 23191 1902
NM_016018chr872723 2428 2117 2016 1929 124 99 --169 11007
NM_017637chr977732 7011 5966 3514 2993 1945 573 15852 26906 6501 18838
NM_020337chr452618 2524 1048 446 147 ----21164 39
NM_020918chr1083297 3015 2863 2560 1305 1191 509 426 13489 22307 1095 1336
NM_022893chr242904 2634 2499 1044 ----22361 2079
NM_024989chr296336 6235 5834 5770 5281 3276 2279 624 151 37397 993 859 ----
NM_032873chr1194078 3558 3292 3251 3120 3087 2832 1344 1331 24207 1034 13847 --
NM_080867chr1464189 4055 4045 3256 1747 1145 14313 --14566
NM_152275chr232195 1890 582 ----21667 1561
NM_175907chr1832509 2138 2040 12179 1617 21923 93
NM_182485chr443503 2937 1504 330 ----23684 986