TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-888-3p
miRNA Sequence: GACUGACACCUCUUUGGGUGAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1575123 4709 3919 2324 1744 1359 384 15631 1462 --
NM_000267chr1733150 3013 1248 --1414 13197
NM_000314chr1031253 1170 99 ----1962
NM_000618chr1256217 5019 4950 2117 1723 --21499 479 --
NM_000618chr1256217 5019 4950 2117 1723 --21499 479 --
NM_000875chr1577019 6289 6134 5615 5442 4907 1171 --15449 --
NM_001003674chr1896452 6192 5783 5539 5492 4816 2319 2098 1871 --47015 5405 4832 1568 --
NM_001003675chr1896452 6192 5783 5539 5492 4816 2319 2098 1871 --47015 5405 4832 1568 --
NM_001003800chr943518 3239 1014 415 --12896 12702
NM_001007278chr1341420 582 44 34 ----13474
NM_001009899chr385144 4974 2206 1531 797 439 174 153 ----11018
NM_001042492chr1733150 3013 1248 --1414 13197
NM_002009chr1532135 447 318 ----1272
NM_002025chrX68964 8249 7865 6199 3086 633 ----16747
NM_002092chr435026 4832 800 --23862 774 13966
NM_002264chr344978 4453 654 32 --13080 15061
NM_003262chr334085 3913 331 --23726 1328 11878
NM_003298chr385888 5824 5445 1858 728 681 303 105 --14573 11865
NM_003411chrY41815 1721 1623 618 ----1467
NM_003566chr1212468 --22351 816 12414
NM_003822chr133074 2857 658 --13127 1901
NM_004124chr1492714 2330 1167 1116 1022 821 808 621 216 --12336 --
NM_004338chr1896452 6192 5783 5539 5492 4816 2319 2098 1871 --47015 5405 4832 1568 --
NM_004999chr643293 1094 685 93 --24290 2965 11078
NM_005065chr1465370 4739 4686 4645 1678 1339 ----11420
NM_005188chr1168293 6777 6604 1650 1550 955 11592 25467 2405 13195
NM_005339chr434061 2693 364 --24096 3785 13629
NM_005504chr1276168 4783 4331 4082 1105 908 647 ------
NM_005795chr212375 11904 12336 1211
NM_005798chr1341420 582 44 34 ----13474
NM_006095chr432958 987 752 1295 1335 11259
NM_006141chr163560 360 190 ----2520 381
NM_006298chr642826 2122 568 112 ----22342 719
NM_007249chr1386223 5888 3520 2655 2272 1284 946 312 --27217 1507 --
NM_012262chr133447 1653 1637 --1173 15106
NM_014331chr476545 1829 787 682 577 313 118 ----21212 972
NM_015144chr1653092 2654 833 566 203 ----13024
NM_015208chr1843436 2477 1430 309 13590 --1107
NM_015886chr835352 5015 1655 --35667 4818 4035 13992
NM_016260chr267148 4774 4612 1729 1459 1149 12511 12289 --
NM_016531chr463380 2915 1388 1354 795 351 1160 2774 322 --
NM_016603chr531956 95 36 ----2850 588
NM_017563chr365626 4536 3995 1723 1238 260 ----16146
NM_017637chr9117031 6542 6223 3056 2892 1588 1358 728 669 620 69 26424 945 ----
NM_017650chr736068 5526 4881 11030 36029 1727 1087 --
NM_017658chr1423393 3157 --34480 1460 1060 21697 1499
NM_017754chr644323 4167 3430 807 --14590 14981
NM_017919chr975721 4672 4256 1742 915 695 225 --35457 4942 402 --
NM_018254chr11467 --21926 917 21892 742
NM_019022chr1832230 333 28 --32857 2315 545 --
NM_020122chr255353 4769 4561 4469 4135 --34298 1862 642 11015
NM_020159chr421559 527 --11176 1314
NM_020727chr2143623 3308 1138 724 12820 --1298
NM_020772chr1737261 1151 713 --37052 6675 282 38218 2742 1381
NM_022753chr132571 862 432 --42835 2731 1010 966 1511
NM_022898chr1453466 3130 2929 1157 387 ----23079 1499
NM_024345chr934477 2099 2022 ----24738 4047
NM_024884chr1444303 2800 342 42 ----13715
NM_025160chr122927 981 12750 13431 13188
NM_031372chr411509 ----21582 623
NM_032521chr2011066 ----23132 2501
NM_032859chr1321422 703 ----23730 252
NM_052811chr1341420 582 44 34 ----13474
NM_052879chr1223194 1098 ----21545 576
NM_052885chr1254353 870 806 669 348 --14947 13972
NM_053279chr852846 2184 1145 425 59 ----11010
NM_138576chr1453466 3130 2929 1157 387 ----23079 1499
NM_138731chr1433602 413 105 ----2707 530
NM_144578chr1484319 4281 3630 1806 1770 544 473 338 --11902 1533
NM_152261chr1222505 2221 --1745 1565
NM_152588chr124730 610 556 96 ----11254
NM_153207chr1214057 ----23560 1042
NM_178498chr1141291 1238 830 565 ----186
NM_181481chr1896452 6192 5783 5539 5492 4816 2319 2098 1871 --47015 5405 4832 1568 --
NM_181482chr1896452 6192 5783 5539 5492 4816 2319 2098 1871 --47015 5405 4832 1568 --
NM_181483chr1896452 6192 5783 5539 5492 4816 2319 2098 1871 --47015 5405 4832 1568 --
NM_181521chr1695228 4507 2101 1781 1277 546 433 385 76 16147 ----
NM_181836chr53969 557 379 --1503 1906
NM_194314chr134552 3842 979 --34092 1855 1847 --
NM_198859chr334559 933 668 --1604 2822 129
NM_199188chr1223194 1098 ----21545 576
NM_199190chr1223194 1098 ----21545 576
NM_205860chr133074 2857 658 --13127 1901
NM_213590chr1341420 582 44 34 ----13474