TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-888-5p
miRNA Sequence: UACUCAAAAAGCUGUCAGUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr576013 5821 5496 5323 5225 1770 141 --26261 1475 15185
NM_001001890chr2163946 3395 3274 3227 3114 703 --33293 723 536 1669
NM_001002860chr1453284 2928 1841 1697 1599 --11572 14605
NM_001010891chr5106584 6162 6025 5498 4971 4945 2513 2386 1331 578 --26188 4230 --
NM_001018065chr955448 5225 1790 1459 539 11949 35606 5380 4309 11189
NM_001018066chr955448 5225 1790 1459 539 11949 35606 5380 4309 11189
NM_001024948chr172767 2178 1351 1199 759 671 653 --12446 1194
NM_001025076chr1096186 5989 4212 4096 1794 1678 1504 648 475 --25581 1494 --
NM_001025077chr10107544 7347 5570 5454 4959 4749 3036 2862 2006 1833 2931 214 26939 2852 14699
NM_001025595chr461358 1175 1122 1063 1034 228 --21504 1090 11157
NM_001030055chr1464709 3970 3462 2894 1222 419 --12877 24308 1062
NM_001037165chr7148779 8382 8327 7866 7831 6995 6005 5689 5593 3199 1859 1610 1209 652 --17418 --
NM_001039618chr11115755 5652 5104 4662 4172 3936 1633 1157 939 726 422 24225 3908 ----
NM_001042604chr321941 428 11586 --24445 693
NM_001106chr398477 7762 6632 6362 3120 2943 1844 815 319 --19031 16460
NM_001173chr1464709 3970 3462 2894 1222 419 --12877 24308 1062
NM_001241chr222263 1571 11563 11554 --
NM_001241chr222263 1571 11563 11554 --
NM_001754chr2163946 3395 3274 3227 3114 703 --33293 723 536 1669
NM_001918chr1179047 8755 7167 6913 6142 3658 3471 3293 2944 2397 1652 1559 1070 775 373 333 31 13117 ----
NM_002214chr764320 4212 3747 2073 1177 215 15149 13681 --
NM_002481chr1127927 7524 6600 6488 6310 6151 5147 4909 4816 1852 1622 951 16779 17844 17906
NM_002886chr3115123 4967 4055 3867 3511 3495 3424 3224 2001 1911 85 --13641 --
NM_003722chr362690 2295 1103 847 422 261 1385 1370 1604
NM_003966chr597514 7104 5011 4914 4897 1720 1331 539 285 --26585 2045 --
NM_004124chr1453347 3089 1399 447 432 ----11008
NM_004171chr1196681 6215 5823 3447 3313 3196 2824 2415 1494 --18668 29498 7501
NM_004866chr5124856 4135 4056 3460 3136 1801 1611 1259 1104 919 726 246 ----14065
NM_005063chr1093749 3689 3517 3484 3266 2909 2515 1458 879 --13204 1923
NM_005065chr1435356 3736 2055 12044 11812 25221 5034
NM_005935chr431178 970 484 --53963 3583 3483 1430 478 --
NM_006007chr9103647 3433 3227 3057 1725 1701 1514 1067 1044 340 --23808 155 --
NM_006166chr1252113 2099 2072 2028 1885 --2717 450 12331
NM_006252chr196305 5521 5382 4899 2785 2122 1893 1729 1705 14591 33023 2226 1864 --
NM_006298chr6103422 2635 2553 2447 2256 1284 663 328 158 24 --1309 --
NM_006561chr1096186 5989 4212 4096 1794 1678 1504 648 475 --25581 1494 --
NM_006599chr1647055 6082 5714 5203 27774 2176 21361 244 1115
NM_006731chr975824 5047 2312 2285 1884 1683 282 13668 45012 4086 3561 503 --
NM_007231chrX42480 2156 2012 689 11744 --1697
NM_012164chr966098 5481 2221 2168 2081 288 --46242 273 56 34 15783
NM_012316chr1125549 5367 5251 4964 4867 4689 4651 4057 1649 736 551 234 1441 21670 206 --
NM_014382chr331491 226 89 11295 11468 11249
NM_014447chr461357 1174 1121 1062 1033 228 --21503 1089 11156
NM_014877chr1767358 6507 5191 5095 1627 1049 12724 1946 26552 2713
NM_015092chr1644453 3069 1551 506 ----23890 1831
NM_015906chr141122 851 560 250 --23690 1746 13885
NM_016206chr398117 3554 3309 2802 2682 1791 1371 484 447 --12697 --
NM_017447chr2153522 2674 1428 903 202 --33852 3154 473 1968
NM_017709chr163469 3341 1533 1295 1284 339 23092 2680 24292 3182 --
NM_018373chr14125432 5315 5213 4677 4166 4012 2537 2161 1317 984 789 293 --12045 --
NM_018440chr877207 6460 6215 6175 3275 2524 2193 37839 7710 3462 12812 17324
NM_018566chr113364 31725 397 290 23873 1033 2454 347
NM_018638chr1275701 4924 4076 4014 2268 620 348 25116 4120 15010 14262
NM_019001chr321941 428 11586 --24445 693
NM_020772chr17108040 5823 2798 2749 2597 1987 1632 1539 1371 1243 27746 2401 11588 --
NM_020774chr1855987 5097 4143 3831 1342 13784 35948 3881 2244 26173 4902
NM_021629chr394068 3643 3546 3227 3080 1753 616 229 220 --24353 383 1771
NM_022898chr14114763 4730 3807 3046 1869 1492 969 767 612 420 239 1320 11627 --
NM_024884chr1453925 3738 970 406 369 --14285 23755 1522
NM_024947chr388393 8098 8068 7894 7318 6653 1508 1385 16994 --26316 3026
NM_024989chr2108087 7654 6761 3009 2718 2645 2194 1749 1650 157 15752 ----
NM_025146chr392530 2083 1835 1719 1068 876 737 452 416 --2641 436 --
NM_032373chr1053929 3654 1416 536 482 14742 11662 14614
NM_032440chr1082414 2259 2218 1884 745 576 543 245 --22847 1992 12611
NM_033020chr141122 851 560 250 --23690 1746 13885
NM_033224chr797864 7612 7413 7126 6604 6499 5072 3167 1724 --36039 2195 879 --
NM_058241chr222163 1471 11463 11454 --
NM_058241chr222163 1471 11463 11454 --
NM_080927chr333198 3031 1057 --12084 21197 715
NM_138444chr1344820 4376 3051 3031 --11211 23118 1099
NM_138576chr14114763 4730 3807 3046 1869 1492 969 767 612 420 239 1320 11627 --
NM_138713chr1647055 6082 5714 5203 27774 2176 21361 244 1115
NM_138714chr1647055 6082 5714 5203 27774 2176 21361 244 1115
NM_144571chr4125897 4961 4925 4486 2714 2472 2274 1093 1071 1053 661 294 --46230 4363 2590 2155 16160
NM_144578chr14114739 4693 4355 2150 2102 2070 1652 1227 777 630 461 ----12046
NM_152624chr5166659 6593 5673 5557 5278 5175 2515 2393 2373 2176 1716 1404 668 640 308 243 17140 55459 5430 5186 759 54 11272
NM_172071chr167222 6322 5880 2759 1045 660 34630 1812 1408 26640 6454 22412 1604
NM_173214chr1647055 6082 5714 5203 27774 2176 21361 244 1115
NM_177538chr2228314 7828 7811 7342 7072 6834 6588 6548 6113 5425 5383 2727 2548 1926 1887 1540 1280 830 694 557 461 421 --18185 28869 5914
NM_181521chr16146857 6328 5971 4920 4680 2814 2585 1831 1792 1068 736 440 203 130 16673 47038 6280 4995 2697 --
NM_182493chr16125303 5164 5139 4131 4061 4043 3974 3368 1736 1550 1153 519 ------
NM_182762chr7106048 5732 5435 4918 4852 3849 2499 2017 1844 903 25157 1023 16108 --
NM_198581chr296825 6441 5482 5156 4853 2715 2461 2084 384 12895 36785 5892 1655 --
NM_207406chr4135719 5335 5186 5123 4663 4449 2060 1703 1636 1411 1135 972 163 ------
NM_213589chr264611 4480 3835 2234 2053 1087 --32131 943 287 21982 1971