TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-890
miRNA Sequence: UACUUGGAAAGGCAUCAGUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96939 6447 5697 4959 4632 2325 1175 982 854 26045 4229 1751 --
NM_000112chr5115307 3995 2067 1994 1866 1812 1606 1162 1024 341 109 --33633 970 50 --
NM_000125chr653789 3574 1700 401 208 ----13736
NM_000208chr1993524 1613 1489 1341 1280 896 523 486 454 14689 22927 466 --
NM_000332chr696569 6122 6085 5615 4650 1737 1420 1230 242 36301 4816 1370 ----
NM_000333chr351089 1071 1017 873 215 ----1340
NM_000411chr2153214 2474 2456 758 532 ----13200
NM_000448chr1163106 2411 1107 827 151 110 1796 12672 --
NM_000461chr364033 3373 3034 1737 490 308 11562 2904 620 13801
NM_000480chr1111244 41655 1130 371 329 146 1263
NM_000489chrX43395 3288 894 430 --13359 12542
NM_000555chrX137703 7534 5903 5005 3152 2665 2625 2538 1128 417 248 73 40 27064 5038 1102 --
NM_000618chr1266309 5964 5693 5677 5501 1068 --1396 --
NM_000859chr551463 1127 587 483 468 --21402 490 --
NM_000875chr15146623 5415 5037 4751 4321 2742 2522 2023 1883 1355 1111 1102 1012 557 --24865 2174 --
NM_001001481chr853354 1366 1006 626 184 12847 23263 295 2873 653
NM_001001664chr254150 3994 512 345 204 13462 44002 660 478 50 --
NM_001003652chr1897873 7110 6283 5702 2992 2001 1954 729 102 --28464 2851 --
NM_001003760chr663167 2830 2776 2729 2528 1288 --13188 --
NM_001005404chr1753469 1345 699 582 397 1844 13099 11572
NM_001006657chr253225 3006 2488 2039 741 ----12478
NM_001007102chr661518 1359 1341 1290 450 85 2521 191 11640 --
NM_001007214chr131825 1335 231 ----1122
NM_001009894chr1231489 1185 1170 ----3644 580 143
NM_001009899chr365951 5831 4582 2071 1995 424 12100 31970 1426 247 1230
NM_001010888chrX124022 3785 3569 3327 2992 2947 1332 1326 645 502 260 242 23657 537 31257 510 275 13715
NM_001010891chr5116811 6466 5974 5173 5025 2733 2595 2347 1452 1269 60 24937 2623 22001 913 --
NM_001010984chr142601 1982 733 495 11778 2416 91 1355
NM_001012393chr1164835 4789 3316 1645 1610 1361 1694 23829 435 --
NM_001014380chr1344318 2338 857 644 1885 25790 752 13623
NM_001015877chrX42714 2676 819 525 22231 452 1710 --
NM_001024647chr12137467 6655 6243 5837 5453 5138 4885 2800 2627 1674 423 130 86 --22300 210 --
NM_001024808chr1252756 2440 766 138 127 --1118 --
NM_001025076chr10116157 5356 4752 4667 4601 4551 4425 4165 1980 1411 427 --11548 12053
NM_001025233chr1292710 2693 2687 983 903 729 411 378 275 12494 22210 2129 --
NM_001025580chrX23158 1566 13118 23907 3544 12621
NM_001030007chr1693588 3568 3502 3464 3136 2722 2625 1375 752 12550 13839 22789 1486
NM_001030055chr1474778 3801 3667 3431 1620 1425 170 --13253 23924 583
NM_001033566chr172848 783 --1322 1965
NM_001037165chr7128118 7796 7596 7071 6695 3304 1844 1674 1592 1058 694 571 38089 7105 5798 58727 7728 7558 6965 6354 1757
NM_001039590chrX73953 3766 3119 2618 1619 721 671 --12846 13075
NM_001039762chr104936 769 596 371 --21592 519 12269
NM_001040152chr774602 4406 4084 3486 766 193 120 13413 23445 775 --
NM_001040152chr774602 4406 4084 3486 766 193 120 13413 23445 775 --
NM_001040429chr1353597 2925 2837 2519 512 22631 1272 --13064
NM_001040665chr723455 824 --21094 155 21101 946
NM_001048183chr163708 3575 1244 864 804 492 23509 2716 23549 292 13057
NM_001099678chr362562 2446 2116 1928 723 255 14583 ----
NM_001100108chr168345 7080 7043 6302 2894 2035 57400 7091 6448 3310 1354 16761 11128
NM_001106chr3149641 9620 8975 8634 8153 8075 6484 6064 3405 3348 2298 1682 1392 1148 --49769 9132 8313 6500 17341
NM_001259chr786361 4781 4194 3948 2155 338 237 147 25638 4701 ----
NM_001390chr1862398 1389 1310 1063 760 263 12291 32708 1219 673 --
NM_001438chr143393 3011 3005 2221 --1847 1857
NM_001482chr151830 --1696 1231
NM_001609chr1044047 3878 3506 2921 1391 22730 754 1993
NM_001627chr322353 2002 1171 --1116
NM_001699chr19221695 1597 1553 1529 1482 1335 1310 1264 1242 1219 1207 1192 1177 1154 645 504 388 338 275 260 246 38 1537 31546 1359 510 --
NM_001759chr12115033 4489 4272 4199 4097 3883 3763 3540 1637 569 401 --11820 --
NM_001858chr644619 4528 1725 1418 --11709 --
NM_001949chr681085 963 688 415 255 240 233 101 12465 ----
NM_002009chr1531862 1083 654 ----1810
NM_002015chr1383152 2920 2421 2108 2099 2073 1172 401 1586 1327 --
NM_002158chr2123467 3295 3195 2865 2547 2353 2339 1390 1004 647 608 239 11219 12474 --
NM_002581chr9144751 4485 4422 4228 3749 3457 1834 1744 1734 1106 880 699 495 177 --25387 3502 --
NM_002655chr8115006 4944 4058 3949 3345 3259 1546 998 866 853 474 --13709 --
NM_002719chr1451534 870 670 662 570 --32318 647 254 --
NM_002734chr1722114 91 32288 1606 1542 --12066
NM_002886chr354574 4392 4236 1895 552 --44806 4213 3327 469 --
NM_003030chr321963 1709 ----11572
NM_003042chr352242 1806 1797 805 237 12043 11846 --
NM_003161chr1783472 3151 2914 2592 2545 2469 1038 936 12617 ----
NM_003320chr1184414 4204 3898 3625 3044 2787 1446 1034 11767 42759 1238 889 685 --
NM_003410chrX63064 2673 2192 2102 992 332 1932 ----
NM_003590chr254006 3289 2470 1447 347 1611 13905 1855
NM_003743chr262047 1605 1584 618 545 353 ----1857
NM_003822chr112028 --1928 31987 998 105
NM_003861chr1431933 698 232 ----1607
NM_003966chr5107501 3146 3079 2119 1286 1168 1119 766 372 120 --1110 12400
NM_004094chr1462990 2744 2103 1188 389 350 ----1122
NM_004100chr622295 2006 21996 995 --142
NM_004171chr11129637 9534 7398 6036 5946 3287 3206 2873 2038 1545 1252 366 37731 3158 2066 13639 17982
NM_004274chr1463205 2557 2471 2392 2323 619 1868 ----
NM_004437chr1113590 3322 3125 2667 2563 2401 1397 784 376 104 45 23039 1425 --12525
NM_004458chrX12462 11730 12233 12106
NM_004464chr453854 3021 2736 1097 846 --54293 3892 3169 978 871 --
NM_004586chrX105367 4896 4316 4259 4059 4031 3575 3500 2000 1181 ----14690
NM_004598chr563058 2354 1336 1079 81 73 12632 22977 414 --
NM_004612chr924346 968 --13938 1949
NM_004745chr8146323 6280 5853 5797 5436 5211 5064 4910 4847 4390 2808 2597 1957 441 --15607 15894
NM_004748chr1563738 3135 1169 1096 242 64 1783 13980 13397
NM_004798chr2083159 2812 2555 2448 1152 756 542 534 --33585 2912 253 --
NM_004852chr182014294 13279 13253 11887 9103 5513 5343 5016 4677 4607 4401 4200 4188 3887 3093 878 830 611 448 170 12727 913584 13048 12429 8754 4835 4733 2257 537 207 113904
NM_004857chr1464389 3668 3035 1133 977 156 33407 1604 1154 24772 3908 --
NM_004992chrX217755 7694 7673 7425 7369 6663 6136 6122 5756 5744 5729 5711 5678 5301 5139 2937 2713 2625 2193 1312 567 27152 6083 37409 5992 1175 --
NM_004999chr633748 1440 1180 24344 3018 1880 --
NM_005140chrX4241 222 184 158 --3954 758 173 --
NM_005230chr12------2606 183
NM_005339chr453527 3386 3370 2823 854 13248 21213 1011 12846
NM_005941chr851307 1114 864 506 59 24019 3992 ----
NM_006055chr261961 526 512 191 84 65 13031 11259 --
NM_006166chr1221906 912 22413 2036 11646 32000 829 356
NM_006252chr197313 7000 5970 4926 2613 1534 527 511 121 16826 34624 1069 696 --
NM_006283chr894629 4062 3846 3728 3230 1709 1079 851 77 34908 4729 571 ----
NM_006375chrX31516 527 437 --189 11451
NM_006544chr1475669 5573 5442 5379 5154 5047 1158 --35284 4530 1410 --
NM_006599chr1687968 7074 6881 2945 2787 2305 316 38 1412 46329 2981 2826 1914 17870
NM_006699chr152486 2450 1671 686 363 1896 22174 572 --
NM_006717chr953243 2449 855 792 556 ----22658 1237
NM_006775chr621951 1187 --11004 1794
NM_006851chr1232511 2358 2314 11024 --12898
NM_007011chr15145459 4373 2487 1581 1401 1313 1236 1120 1090 1035 638 549 440 176 21012 290 45764 2661 1736 1702 11427
NM_007137chrX75457 5017 4327 1955 1043 590 83 31191 1004 766 11943 --
NM_012300chr521022 449 12462 1494 2224 155
NM_013261chr443465 3280 2711 1386 ----12442
NM_014048chr1684213 3956 3442 1914 1720 1315 846 154 24660 4609 --1706
NM_014106chr1562828 2579 2079 2030 768 185 --33012 1094 1035 --
NM_014112chr874542 4164 4119 3632 1056 851 488 34937 4513 805 --23442 1830
NM_014331chr465470 5256 2033 1815 640 162 --15433 15975
NM_014372chr122095 820 21869 1761 127 --
NM_014423chr575631 4238 4084 3670 3632 1363 471 24477 3933 45344 4437 4421 1770 --
NM_014615chr1621315 139 13098 13544 13296
NM_014630chr15133102 3049 2944 2716 2709 2535 1561 1480 1312 1162 1153 1143 1029 13945 1934 --
NM_014701chr1542233 468 330 190 --2704 179 --
NM_014705chr72683 486 ----11446
NM_014730chr12115017 4787 4712 4548 4130 4101 1777 1240 1135 834 663 14997 23778 1425 11338
NM_014755chr263903 3206 3192 2904 1052 836 --22834 294 1175
NM_014840chr1272913 2864 2855 2547 2209 265 136 12883 --11274
NM_014848chr1562256 913 701 372 252 43 1555 2313 238 --
NM_014900chr2------2941 893
NM_014912chr1032758 2629 1127 ----12236
NM_014982chr1454718 3742 3406 970 47 11053 11083 23346 1562
NM_014990chr141384 --31105 1065 864 2838 455
NM_015000chr1232076 594 150 ----12550
NM_015026chr1233568 3561 867 23748 3355 14387 1403
NM_015056chr2182665 2313 2176 1921 842 794 423 227 12301 ----
NM_015144chr1663319 2692 1311 766 667 335 23914 2605 2775 384 12550
NM_015155chr1052634 1159 1022 260 127 --22913 683 --
NM_015156chr14104038 3726 3696 3452 3417 3402 3395 800 645 485 12631 1919 13445
NM_015278chr623078 1348 22981 1381 33140 2342 1354 --
NM_015310chr8127495 7286 6644 6444 5892 5713 5420 2691 2310 1868 887 54 16039 27242 1650 18168
NM_015336chr1232483 855 429 12580 --21689 988
NM_015361chr23955 678 232 ----1712
NM_015635chr932215 1370 763 1229 11601 2278 268
NM_015879chr18197742 7703 7505 7007 6378 6126 6112 5814 5455 5354 3022 2672 2615 2053 1803 1450 1303 1112 1104 ------
NM_015906chr143592 3077 1672 1244 1479 14277 --
NM_016018chr851124 775 716 453 75 --1279 --
NM_016021chr662620 2267 2008 1210 882 70 2944 456 ----
NM_016076chr162430 1260 1167 867 744 626 --12248 1883
NM_016083chr693619 3041 2944 2640 2533 2458 1365 292 190 21297 1155 1973 --
NM_016132chr153466 459 177 1637 1602 --
NM_016206chr3158427 8154 8147 7160 6805 6678 5466 3603 3529 3131 2558 1958 548 280 42 18087 26842 2952 --
NM_016255chr642451 683 290 270 12804 12885 21051 198
NM_016322chr913114 12252 --1402
NM_016395chr152535 505 11549 --11540
NM_016418chr22123848 3756 3690 2926 2618 1433 1378 1352 816 351 38 31 33175 2954 1461 13587 --
NM_017582chr131705 1401 1389 ----1195
NM_017637chr958433 8363 3133 1771 1311 17183 38686 7688 1110 --
NM_017658chr1454241 3913 3788 3304 3227 --24290 1333 --
NM_017709chr174077 3777 3695 3600 1254 525 257 12614 33837 1716 1101 11006
NM_017742chr18135 --11747 21650 1230
NM_017769chr1432800 2576 996 13178 13113 23010 2981
NM_018036chr1484339 4020 3972 3413 3396 2933 1363 246 --1638 12863
NM_018084chr272241 2086 1235 411 344 309 34 ------
NM_018293chr342956 2393 1180 798 ----1960
NM_018362chr1143891 3265 966 452 43556 3534 3293 2823 12508 13852
NM_018370chr1231700 728 120 11429 1614 1228
NM_018373chr1496331 6140 5822 5513 5117 1355 1154 1064 794 12271 25852 3988 --
NM_018374chr7104791 4483 4299 3468 3271 1424 1323 1294 1052 120 13949 14735 --
NM_018403chr374138 3569 2826 797 534 443 336 --43650 2709 2700 148 --
NM_019063chr241773 769 533 268 --32236 815 634 --
NM_019117chrX53305 3230 2366 346 45 ----11205
NM_020390chr384388 4125 4115 3837 1820 1676 1010 251 11043 166 11237
NM_020698chr1273110 2336 2240 2059 897 500 339 --42033 1143 34 24 --
NM_020734chr1212561 ----21022 372
NM_020760chr271382 558 463 361 273 130 85 ------
NM_020772chr1738098 7837 224 28024 5244 37760 6893 1835 27169 6745
NM_020782chr1234151 1719 69 23153 3069 34741 3224 39 --
NM_020830chr231060 909 392 --12974 12400
NM_020956chr19174551 4433 4406 4212 4083 3801 3774 3437 3281 3266 3251 3011 1089 957 692 517 178 14077 32996 2898 1080 --
NM_021813chr6105421 5238 4955 4291 4222 4088 3751 1260 1159 44 1921 25620 740 --
NM_021961chr1162990 2559 2509 2029 2003 305 --37170 5941 2778 25565 1487
NM_021964chr385241 4787 4318 4197 2366 1919 614 264 --24393 372 --
NM_022048chr1596300 5968 4926 4483 2406 1610 1532 721 503 14794 15945 1696
NM_022085chr641558 1216 1019 153 ----1199
NM_022166chr16115491 4495 4240 2512 2244 2201 1921 1121 797 397 255 --15799 --
NM_022351chr853611 3019 2506 1500 125 --2751 33 --
NM_022495chr141196 1520 --1395
NM_022728chr72294 99 ----1589
NM_022771chr121390 1236 --155
NM_022781chr941291 1145 1049 758 13265 1284 12802
NM_022818chr1631649 1043 158 --3298 274 179 --
NM_022898chr1494810 4327 4009 3959 3123 3109 1925 1290 709 24375 3661 34827 3316 653 --
NM_024665chr321245 212 33576 1753 1445 --21732 1577
NM_024947chr3118926 8824 8284 8142 7560 7533 7020 6118 2819 2580 1338 28175 3469 28515 2521 28452 7425
NM_025146chr332685 1751 164 ----1634
NM_025191chr123443 496 1692 22705 487 1444
NM_030625chr10152 --1110 32129 1707 812
NM_030647chr775851 5342 5080 4467 2386 1498 665 --24862 685 24926 992
NM_030648chr494018 3662 3575 2192 2062 2045 1833 1488 863 --1269 --
NM_030806chr1238472 8313 8278 8141 7497 7212 6872 6632 6582 6099 6064 5935 5869 5813 3700 3365 2472 2368 2194 1900 929 742 404 26499 1854 --1270
NM_032199chr1073362 3033 2914 2886 2748 436 293 13217 ----
NM_032373chr10105642 5348 5092 4696 4028 2314 2126 609 312 184 15890 ----
NM_032445chr1572097 1990 1915 833 749 630 171 11774 2948 149 --
NM_032458chrX43044 3006 1149 855 22561 782 11040 --
NM_032826chr785004 4937 4541 4445 4326 1854 1189 823 1498 12103 --
NM_032859chr1323114 1364 --13753 13774
NM_032968chrX42900 2650 1321 1159 13043 23885 393 --
NM_032973chrY34133 1321 1159 13038 23877 393 --
NM_033224chr7167512 7467 7150 6827 6630 2895 1532 1473 1451 1306 716 618 606 340 201 195 16718 1359 25727 5456
NM_033285chr851624 1272 966 872 863 24087 322 11101 --
NM_033505chr234962 1815 176 --11509 15932
NM_033631chr173753 3454 3317 1503 1480 810 78 2454 260 --12797
NM_033656chr2165692 4914 4872 2281 791 598 24321 2391 14624 --
NM_080867chr1454812 4067 581 308 210 34908 3686 1003 23654 1500 --
NM_133334chr4105686 5387 4712 4603 4586 2307 1842 1273 759 629 13996 56360 5995 5426 2449 255 --
NM_133646chr295583 5160 4191 1202 1098 1090 1005 776 739 --15527 --
NM_138473chr1294827 4768 4380 4213 4163 4019 3704 1161 74 25035 4392 11173 --
NM_138782chr532346 1758 617 12076 2526 451 --
NM_144571chr4106480 6420 5697 5427 5175 4833 4752 734 720 433 12015 ----
NM_144578chr1494417 3380 1794 1705 1629 1301 1009 687 321 24095 1338 34449 4207 3938 1372
NM_144582chr2122453 2186 1798 1034 1020 966 956 902 568 276 185 67 --1442 --
NM_144599chr1575061 4479 3668 3581 3356 1757 1364 --1765 1477
NM_144973chr1284924 4780 4735 4330 4241 2016 991 954 --24584 3450 1412
NM_147156chr10----11204 2619 452
NM_152409chr552301 1101 1060 974 25 --22846 215 13148
NM_152424chrX114745 4533 3737 3130 3102 1758 1355 1270 524 313 193 23718 695 23422 3395 --
NM_152475chr1951868 711 448 369 225 11901 51874 594 552 477 231 --
NM_152624chr566906 2576 2403 2018 1024 327 26756 320 ----
NM_152758chr8----52772 2449 2178 1039 484 --
NM_152793chr764723 4110 3999 3567 1802 1438 --24639 851 21660 1639
NM_153042chr641668 1591 367 124 ----1616
NM_153607chr522187 2067 33160 317 137 --1954
NM_153836chr221364 1320 --1420 11469
NM_172127chr431951 1367 334 ----1318
NM_173470chrX22760 2383 12503 11044 12443
NM_173519chr831874 1331 436 ----1396
NM_173562chr642191 878 847 682 12129 12564 12976
NM_173582chr1154688 4479 3850 2523 829 26100 111 25933 5899 --
NM_173808chr154199 3094 1092 986 711 13262 --21763 735
NM_175607chr311527 180 --197
NM_175607chr311527 180 --197
NM_175921chr534099 3270 414 --1660 14286
NM_177538chr2158321 7888 7797 7391 7112 6189 5881 5391 3557 3492 3426 3135 2767 2397 1831 48422 7419 3072 2301 17821 18396
NM_178140chr552721 2337 885 870 123 1986 21989 997 --
NM_181504chr521511 1299 --24129 3494 13105
NM_182830chr1442147 1589 818 683 ----22271 1834
NM_194286chr1295563 5493 5004 4527 2413 2339 1257 497 283 24903 4075 24867 1441 --
NM_198581chr2137024 7016 7008 6862 6503 5699 5562 5371 5228 5071 4931 2011 359 36533 4964 476 67488 7193 7134 4937 1562 672 11212
NM_198715chr145956 4345 1941 1669 --35275 2418 2396 --
NM_199355chr1631388 651 339 ----11709
NM_203349chr1551649 1531 140 123 34 ----1403
NM_206854chr654835 3851 1489 1270 1191 --11049 1283
NM_207015chr341653 730 619 302 ----1463
NM_207337chr1221164 150 --2792 363 1399
NM_212558chr964006 3658 3465 3292 2859 784 --21532 866 12919
NM_213589chr245007 3756 3396 1896 15214 35478 3444 1329 --