TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-892a
miRNA Sequence: CACUGUGUCCUUUCUGCGUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531531 1296 608 2478 239 11565 --
NM_000115chr1341907 260 244 106 11710 12395 --
NM_000125chr643943 1104 922 610 13426 21092 23 13497
NM_000165chr61282 ----11314
NM_000208chr1984587 4090 3958 3507 3266 1648 661 227 --23361 1790 --
NM_000210chr242145 787 367 319 1215 11632 1307
NM_000217chr1275296 4768 3873 1746 1703 1674 759 14243 ----
NM_000222chr43851 521 363 1387 --12029
NM_000248chr362796 2732 2102 1923 1123 705 ----1502
NM_000264chr932751 1169 274 12339 --12656
NM_000332chr696362 4977 4828 2523 1950 399 300 277 220 16259 --183
NM_000337chr576523 5037 4729 2118 728 353 88 12545 35382 4955 4074 --
NM_000361chr2051726 1551 1531 434 247 --11694 --
NM_000411chr2172760 2751 2712 2697 2512 2053 1104 13121 --13175
NM_000448chr1132792 2719 742 12991 31312 1157 866 11130
NM_000461chr384575 4421 4217 4081 3707 3577 3501 421 21440 775 --1762
NM_000555chrX127023 3098 3068 2650 2484 2172 1566 1406 1317 689 368 196 15587 1335 --
NM_000599chr244145 1341 1288 835 34255 1206 845 ----
NM_000615chr1182431 2052 2031 1999 852 458 398 45 ----12099
NM_000618chr1286176 4971 4521 4141 2584 859 734 460 --14432 --
NM_000719chr12126510 6482 6395 5759 5228 5160 4797 4710 4258 4071 2452 2154 --25864 1269 --
NM_000724chr1061867 1608 1339 1256 406 354 ------
NM_000756chr81123 ----163
NM_000813chr585280 3649 3629 3588 1325 1023 821 740 --35428 4267 4257 --
NM_000814chr1573412 1574 1553 659 310 209 89 12832 41347 812 748 481 --
NM_000868chrX31926 1895 645 --21711 630 21643 492
NM_000875chr15166502 6351 6296 6241 6171 6139 5229 5089 4790 2327 2094 2084 1617 1161 993 751 --16206 --
NM_000885chr251818 1786 1567 881 202 ------
NM_000891chr1762794 2415 1308 742 213 74 --32289 2243 42 --
NM_000901chr462438 2135 998 933 559 487 12098 12079 --
NM_000950chrX22675 1142 12883 1539 1311
NM_001001395chr123557 501 84 --1331 --
NM_001001481chr842651 2364 2272 1222 1675 --1215
NM_001001549chr792775 2657 2109 1125 1086 761 694 565 475 --12876 --
NM_001001890chr2164263 4136 4109 1294 1257 1008 14144 14150 --
NM_001001971chr103442 309 255 --11398 --
NM_001002296chr82986 121 11014 1300 1974
NM_001002838chrX31871 208 158 ----11233
NM_001003652chr1897766 7657 6872 6485 5891 2617 2152 2105 1820 37959 2642 338 --27044 843
NM_001003712chr1222694 831 23923 3675 13199 --
NM_001004065chr993088 3006 2864 2745 2651 2434 2422 777 414 --23973 307 --
NM_001004419chr12124079 3887 3839 3125 3006 2992 2984 2941 2880 432 336 32 1229 --23054 1670
NM_001005386chr22817 211 1663 12398 --
NM_001005404chr1754294 3627 3494 2960 1091 --14448 11466
NM_001005473chr5136559 5918 5582 5244 4781 4160 4054 2605 2086 2074 1457 509 285 1632 24302 1679 12100
NM_001006657chr23999 874 313 ----13137
NM_001008215chr21275 11006 1359 11033
NM_001008407chr731742 74 49 --132 11816
NM_001008408chr7135895 5377 5213 5206 2257 2211 1810 1435 1410 710 328 185 93 11167 12347 --
NM_001010000chr1842386 2321 1391 696 --11134 12794
NM_001010888chrX124645 4290 4170 4146 4036 3897 3728 3135 2970 1558 1124 452 11339 11061 13844
NM_001010935chr11935 ----1915
NM_001011666chr776108 5273 4865 2300 1708 1093 483 --14000 --
NM_001011713chr1421292 36 --1294 11610
NM_001012393chr1144598 1884 826 417 --33328 1699 411 --
NM_001014797chr1076655 5343 2882 2307 2196 1455 738 --16030 --
NM_001017371chr21950 1169 21240 476 144
NM_001017523chr1231850 1710 72 31575 1289 1198 ----
NM_001017926chr8--1445 --1258
NM_001024660chr3130 ----1478
NM_001024948chr163357 2951 824 804 454 35 12216 32330 817 353 --
NM_001024956chr1165812 4805 4461 4047 1760 600 --21062 91 22261 105
NM_001025076chr10116193 5720 5574 4679 4374 4254 4189 4114 691 434 377 --45763 5394 4301 4065 --
NM_001025108chr283932 3733 3403 3165 1327 1186 436 208 --13690 --
NM_001025201chr22623 281 ----1537
NM_001029863chr6--22950 186 1138 1949
NM_001030007chr1673548 3375 3244 2903 2841 873 608 --11170 11579
NM_001030055chr1443422 1659 1296 95 11678 --12999
NM_001031695chr2274243 2148 1595 1446 1253 671 651 24643 3617 13836 15248
NM_001031732chr443468 1417 1202 969 13551 1400 11373
NM_001032999chr20104331 3968 3498 3268 1940 1897 1875 1104 994 892 ------
NM_001033087chr2072615 2546 2459 2425 1115 826 295 --32857 2330 372 --
NM_001033117chr354321 3751 3090 1526 1312 2949 604 1981 --
NM_001034954chr1073168 2960 2554 2306 2250 1274 304 --196 --
NM_001037132chr72817 669 21796 546 2834 294 --
NM_001037165chr798455 3157 2929 2544 2443 1964 1469 519 401 13188 27449 1173 18738
NM_001037637chr5----1263 1303
NM_001039538chr253208 3195 3110 2545 1436 23104 853 --1765
NM_001039618chr1125218 1362 35966 4788 4393 14260 1164
NM_001039840chrX85970 5896 4226 4167 1586 1413 926 649 12191 --22174 2154
NM_001040152chr774395 4152 3540 3468 1548 621 523 21140 1081 14258 1645
NM_001040284chr1645519 5170 4051 3843 21974 1821 ----
NM_001040446chr51278 --11833 12168
NM_001040633chr72372 353 1338 1935 1923
NM_001040665chr773808 3560 3281 1577 1305 1123 298 --14022 13792
NM_001040712chr933127 181 72 1742 1967 --
NM_001042404chr14740 703 559 65 1508 11866 --
NM_001042413chr9103683 3510 2804 1602 1336 1276 734 486 403 184 13126 13525 11400
NM_001042473chr1031612 1576 244 --12055 --
NM_001042537chrX52428 2123 603 240 155 22415 620 --11723
NM_001042555chr1233057 1371 233 33656 3481 428 13572 --
NM_001042604chr384611 4335 4297 3481 1946 1487 977 892 1281 11904 13843
NM_001042681chr142328 887 851 646 --12574 1158
NM_001044385chr223488 2556 --13732 23246 2652
NM_001106chr3129556 9515 9335 9049 8778 7752 3559 3550 3064 2220 2119 1059 --36344 5973 3603 28693 2773
NM_001156chr103602 583 513 ----1228
NM_001167chrX46021 5628 5144 4378 1283 24818 4640 --
NM_001177chr1242191 2085 1703 592 --3838 446 279 12470
NM_001186chr2133190 2850 2206 13199 32747 2511 808 --
NM_001201chr483817 3656 3628 2613 2530 1089 735 640 --22779 776 13971
NM_001204chr2117702 6462 6423 5838 5627 5132 4817 2052 867 704 650 --11922 --
NM_001241chr232192 1969 655 --11955 --
NM_001244chr93244 154 108 ----149
NM_001257chr1631460 1033 1011 ----1390
NM_001396chr2152803 2433 2206 931 270 1611 22460 1764 12701
NM_001449chrX--1144 1167 11168
NM_001453chr641487 1288 1108 265 --11665 1507
NM_001455chr653837 1655 1598 1580 714 21542 1445 13536 14580
NM_001498chr6--147 2877 175 1191
NM_001609chr1084023 3122 2752 1704 1600 1447 592 192 --11041 1714
NM_001616chr273378 2726 2409 605 484 183 75 1546 ----
NM_001649chrX62159 2118 1616 1602 987 739 --1688 12018
NM_001650chr1873986 3760 3368 3154 2617 2581 440 --12759 1431
NM_001656chr5----11712 21896 57
NM_001663chr1452285 932 625 312 133 12714 12787 --
NM_001709chr1112495 12205 --1135
NM_001730chr1321084 653 --11054 21065 455
NM_001742chr731798 1576 310 1257 11743 --
NM_001759chr1285053 3807 2103 2068 1587 1230 935 664 34756 1608 619 11119 --
NM_001938chr1----1319 11251
NM_002006chr454880 569 530 452 349 --13592 --
NM_002126chr1743619 3345 1426 694 23425 1458 ----
NM_002193chr271903 1248 437 269 243 102 22 --21549 88 --
NM_002210chr283547 3440 2601 1401 1328 1053 458 196 1857 ----
NM_002211chr1041128 750 60 54 ------
NM_002264chr364723 4533 3953 3638 490 72 13827 14787 25006 4387
NM_002270chr594637 4280 2278 2022 1528 1066 942 891 259 ----1130
NM_002359chr1763880 3574 2972 2850 990 544 14199 14272 --
NM_002397chr522081 1995 ----1168
NM_002408chr14----1651 1141
NM_002500chr2151 11113 11007 1239
NM_002501chr1963370 3358 3310 1636 805 479 ----13823
NM_002522chr1722676 136 --23575 3524 23963 2947
NM_002581chr994431 4334 3982 3695 2122 2023 1715 1618 70 --25502 241 --
NM_002595chr1241711 198 178 126 --1292 --
NM_002655chr895263 4327 4134 4111 3831 3801 961 902 719 ----11330
NM_002657chr2063842 2942 1479 1310 347 135 --23759 588 12920
NM_002709chr242838 2559 1378 693 1976 1644 12475
NM_002731chr112634 ----2604 215
NM_002736chr71415 ----32054 454 45
NM_002874chr932020 400 149 --2209 167 12173
NM_002886chr354364 4319 3999 3855 661 23951 296 1722 21535 990
NM_002906chr1141841 671 518 482 11705 11648 12092
NM_002959chr184074 1427 1353 949 599 553 484 404 145 22702 920 1686
NM_003010chr175554 548 445 412 78 11827 2386 195 --
NM_003108chr277155 6517 6007 5371 5223 2195 982 14825 11405 --
NM_003161chr1742551 2332 133 117 11267 12356 13341
NM_003262chr374141 3958 1284 411 392 279 186 33296 1618 230 ----
NM_003298chr3116003 5705 5084 4546 4127 4108 4081 3931 2171 864 676 25783 5149 ----
NM_003337chr521478 682 11264 --11096
NM_003410chrX53098 2502 1233 1131 462 --12617 --
NM_003423chr1932467 2183 161 1774 --11920
NM_003442chr111894 ----1236
NM_003474chr1021837 223 12171 --11672
NM_003583chr1283855 3627 2653 1533 1363 979 883 426 --12411 --
NM_003620chr17----2871 112 2280 257
NM_003644chr1765918 5240 4092 2325 1094 917 --26584 4715 --
NM_003870chr1541900 767 292 187 --22090 1940 --
NM_003872chr292883 2517 2361 2246 2113 1924 814 282 179 12192 ----
NM_003884chr311151 --11541 1325
NM_003887chr242095 1664 813 667 ----1832
NM_003939chr1043725 3472 3110 1461 --23436 164 13484
NM_003958chr643425 3332 800 164 1953 --12698
NM_003980chr641458 997 990 535 --21490 1398 --
NM_004093chr1372880 1158 1072 825 444 422 105 22802 2342 22047 882 13106
NM_004136chr1552841 2795 2056 1291 862 ----1148
NM_004171chr11179372 8951 8851 8798 8742 8498 7889 6626 6085 3461 3415 3384 1989 1366 783 393 172 27090 1469 39391 3023 1145 --
NM_004225chr831097 1080 335 31416 1238 342 1494 --
NM_004232chr1873663 3161 3019 2660 2645 1398 467 --33895 2539 59 --
NM_004272chr51253 --1362 1810
NM_004331chr81949 32181 1932 59 22652 2110 --
NM_004342chr752373 393 208 170 35 11460 11522 --
NM_004392chr1352272 1826 1734 282 245 2975 810 ----
NM_004437chr153112 2241 1299 946 85 12614 ----
NM_004454chr352196 2089 1859 1630 385 --11849 1339
NM_004458chrX72373 2349 2162 2093 895 604 185 ------
NM_004538chrX161 --1275 1673
NM_004569chr14--1592 2543 99 1253
NM_004571chr2142713 1078 1007 41 22383 118 32608 2512 58 --
NM_004586chrX31797 1490 888 14746 --1480
NM_004687chr17----52103 1378 1338 1302 751 --
NM_004736chr131385 648 301 --1616 1268
NM_004774chr1732776 2630 1203 --1628 22768 1918
NM_004775chr1842137 907 129 94 11541 22037 155 1545
NM_004801chr22993 233 ----11299
NM_004822chr1793175 2944 2767 2675 1579 1453 1267 1207 504 --11411 13146
NM_004840chrX72286 2125 1988 1912 1846 1780 358 ------
NM_004849chr61534 21233 494 1632 1671
NM_004852chr181413463 13186 13026 10914 10044 9723 9392 5666 5623 5613 5579 4230 2000 1269 --310376 9583 3995 11941
NM_004859chr1752889 2616 2392 1980 922 23082 2148 --12768
NM_004898chr442230 973 776 417 ----1712
NM_004921chr13806 788 508 ----12343
NM_004956chr744312 1821 385 58 --11402 --
NM_004992chrX158211 8135 7627 5857 5350 5286 3413 2928 2650 2423 2321 1625 1146 842 204 ------
NM_005116chr2073934 3383 3265 3002 1254 599 31 --24616 1670 --
NM_005121chr1752970 2603 2359 1418 663 3751 299 273 ----
NM_005126chr321944 884 ----21870 804
NM_005171chr12----11257 11299
NM_005188chr1178047 6122 5376 3151 1723 1260 100 11432 18289 --
NM_005207chr2241416 1102 185 156 ----13362
NM_005259chr21111 1133 --2542 386
NM_005339chr443776 3312 1089 638 --11176 --
NM_005436chr1013503 23171 1495 --13316
NM_005504chr1276614 5521 4167 2481 1787 1008 904 25578 4656 --12110
NM_005517chr13920 137 46 --21255 969 --
NM_005578chr331124 836 242 14467 23187 356 --
NM_005596chr9106068 5700 4541 2409 2354 2182 1912 1379 1238 1075 14654 --15360
NM_005668chr564469 4321 3662 1154 710 79 14243 1234 --
NM_005725chr142293 2157 690 571 ----1562
NM_005748chr1252844 2566 1051 956 54 11033 1358 11224
NM_005822chr631512 955 257 ----11577
NM_005906chr621644 198 ----11294
NM_005924chr73412 192 77 ----1723
NM_005941chr874032 3865 3538 1482 961 722 412 22576 200 12776 --
NM_005955chr144471 1069 802 591 --21401 1080 14737
NM_005966chr221924 1684 11608 22120 379 1866
NM_005977chr131206 ----1854
NM_005986chr1352583 2512 2480 2425 1130 22744 261 1713 --
NM_006037chr294540 4459 4205 4030 3709 444 361 250 220 ------
NM_006060chr774201 3637 1334 1294 1207 509 440 11593 24178 3539 --
NM_006106chr1152958 2573 2195 197 99 ------
NM_006251chr552511 1308 886 290 131 --22792 233 --
NM_006283chr854560 914 688 565 196 24884 1843 ----
NM_006330chr831457 1308 135 11033 --1284
NM_006393chr1094383 4262 3434 3215 3104 3088 1142 800 136 14191 ----
NM_006517chrX52271 1436 889 849 110 12230 ----
NM_006546chr1765881 5274 4767 4485 1013 823 34942 4497 544 ----
NM_006547chr742126 1902 1612 1523 1295 1777 --
NM_006599chr16108107 7463 7354 6789 2798 1663 1202 979 480 305 1780 56514 5600 5420 1898 1354 --
NM_006628chr1524446 2867 --13332 23185 730
NM_006717chr952892 610 442 350 270 --1871 --
NM_006750chr16128023 7130 6840 5289 5031 3113 1758 1593 1426 1224 172 101 ----26510 1297
NM_006939chr141753 ----180
NM_006948chr2142450 2405 465 129 11509 1145 --
NM_007006chr1642906 844 597 51 23402 2829 162 --
NM_007007chr1274476 3363 1144 1001 987 868 767 13974 --23162 608
NM_007011chr15156685 6163 6129 6052 5390 4945 4853 4587 2572 2036 1941 883 834 458 413 16221 --16205
NM_007017chr55913 600 562 284 110 --147 --
NM_007038chr2194981 4447 4175 3921 3804 3764 965 699 88 25016 1575 --1368
NM_007050chr20107990 7808 7367 6840 5949 5163 4959 3194 2187 2177 17469 11365 --
NM_007073chr654114 3185 2908 358 257 --11363 --
NM_007107chr362346 2243 1835 1527 889 740 1306 12022 --
NM_007125chrY41093 941 565 253 --1148 --
NM_007137chrX63923 1709 1505 1370 1228 204 --22055 475 25344 705
NM_007249chr13139437 8674 7364 3546 3072 2929 2567 2534 2302 2286 2129 756 82 ----11561
NM_007347chr1532879 937 48 1201 --1749
NM_012096chr333770 535 449 --21468 1378 --
NM_012104chr1143456 465 373 79 11539 21306 1269 13846
NM_012156chr2062952 1234 546 509 431 185 21361 1115 ----
NM_012164chr976667 2787 2774 2702 708 454 198 --27242 119 11104
NM_012193chr1154530 3881 1990 1853 1004 ----11069
NM_012309chr1154694 4582 4407 1070 587 --24983 1479 --
NM_012334chr573857 3033 3021 1835 1529 210 96 24728 3576 1685 --
NM_012338chr731130 813 405 1348 1266 --
NM_012347chr632338 1855 1145 --12075 --
NM_012395chr762965 2632 2239 672 322 28 ----23315 2553
NM_012425chr1062194 1791 1719 952 636 268 --12285 --
NM_012479chr742685 2549 1730 1012 1594 --12261
NM_013231chr1443758 3021 104 79 ----14385
NM_013313chr2243110 1082 990 570 --1193 13158
NM_013354chr821384 1015 ----1521
NM_013396chr2121255 143 ----11219
NM_013448chr141181 ----1226
NM_013450chr2--1834 1824 11025
NM_014048chr1693964 3463 1965 1952 1794 489 322 204 195 13318 15245 --
NM_014112chr875406 5096 3753 2081 2035 1556 1121 ------
NM_014155chr1177125 6846 6466 5425 2305 2272 696 16548 35015 1994 65 --
NM_014319chr1241663 1422 738 408 --1396 --
NM_014423chr565617 4946 1100 1092 1053 577 --1730 --
NM_014445chr342065 1981 515 189 12250 --1247
NM_014586chr2194833 3922 3650 3047 2974 1358 1131 422 397 14374 24579 937 --
NM_014606chr441482 1187 367 62 --11503 --
NM_014615chr1673468 3057 1434 739 720 691 231 ----22568 2488
NM_014630chr1543935 3891 2497 776 --43587 3097 2903 468 --
NM_014682chr832071 1863 655 ----11894
NM_014683chr1741818 1747 687 301 --11469 --
NM_014701chr1541162 1019 1006 754 --22889 2524 --
NM_014729chr832195 2011 71 ----12274
NM_014730chr1295118 4574 4003 3635 3300 1919 1908 1203 861 ------
NM_014746chr264405 4007 3497 3474 1390 123 --11082 --
NM_014787chr131941 1023 608 11834 12756 --
NM_014803chr1062020 1072 893 804 554 221 ----11867
NM_014877chr17167700 7691 7429 7256 6746 6697 6454 5956 5407 5139 5127 4837 4708 2086 1781 90 35626 4859 2617 16771 15157
NM_014897chr1732935 2306 58 22786 488 --13026
NM_014903chr1241983 1559 1506 677 --32133 1940 444 1930
NM_014906chr1753812 3497 1547 211 160 --1356 --
NM_014920chr643189 2823 2788 1069 --2841 294 --
NM_014953chr1364154 3610 3572 3285 3230 1663 11676 44221 1626 243 90 --
NM_014978chr1031624 510 402 ----11754
NM_014982chr1441743 681 508 484 22008 1703 --15400
NM_014988chr442211 1096 998 155 1215 22635 437 --
NM_015032chr13--22441 1150 11176 12871
NM_015033chr942867 2656 2064 2021 --32800 2337 363 --
NM_015035chr20136655 5862 5274 4104 2691 2617 2405 2358 2298 1524 487 302 285 --24669 2328 12026
NM_015039chr184305 3442 3040 1084 997 928 174 131 ------
NM_015045chr101600 ----22159 1551
NM_015049chr232092 1304 317 1834 --12977
NM_015059chr1563556 3355 3183 2454 1285 767 --22889 724 1189
NM_015074chr194855 4207 4182 3653 3431 3296 1081 964 287 ------
NM_015092chr1664714 1520 875 335 253 89 1599 11609 --
NM_015110chr921712 293 --22262 1860 --
NM_015158chr92263 152 --1744 1603
NM_015170chr81943 --21855 55 1818
NM_015199chr352772 2687 763 424 112 2408 30 ----
NM_015205chr13114980 4847 3653 3622 3443 3360 1455 1324 1057 1050 367 --11750 25063 5030
NM_015206chr1543242 3022 2565 359 13099 ----
NM_015210chr181788 1239 --1473
NM_015271chr444276 3856 3186 363 24220 465 ----
NM_015317chr262572 2396 2353 2133 382 248 2627 357 ----
NM_015335chr1231663 887 116 32557 2541 672 ----
NM_015347chr1262956 2569 2391 641 445 321 --12312 --
NM_015455chr563702 2932 2624 1451 331 60 13466 14152 --
NM_015534chr15966 797 409 72 42 ----11062
NM_015554chr1542841 2575 2230 42 --1270 1440
NM_015564chr553537 3529 3412 2734 1319 --22830 1298 153
NM_015578chr1911541 --11627 1563
NM_015852chr743501 3200 877 709 12295 13158 --
NM_015878chr832190 1862 1465 1508 1337 --
NM_015879chr1836279 5841 5577 --16834 18607
NM_015906chr153941 3933 3651 404 110 --44554 4365 3604 785 1149
NM_016076chr153132 2266 838 551 326 1281 ----
NM_016132chr1543142 3055 864 340 --21338 281 --
NM_016195chr103558 287 42 ----1132
NM_016271chr1832304 1779 1747 180 --1369
NM_016374chr131616 304 69 11421 --21219 296
NM_016396chr1572693 2628 1150 980 847 548 318 11110 ----
NM_016441chr242348 2340 1741 895 --2663 580 --
NM_016531chr463711 2956 1514 1483 1107 1096 13457 13174 23732 375
NM_016605chr532101 863 31 ----12234
NM_016831chr152282 1579 462 167 49 ------
NM_017420chr14103693 3632 3291 3164 2717 1231 676 350 167 156 12607 1784 --
NM_017610chr1532010 1340 155 --2655 168 21728 360
NM_017632chr4176 1398 --1149
NM_017633chr643080 2608 2487 475 --12846 11088
NM_017635chr112292 272 1395 21483 323 --
NM_017637chr988874 7748 6731 6644 2885 768 604 65 39354 2538 2144 1326 11286
NM_017694chr281823 1778 1522 1454 1346 156 102 57 21716 167 ----
NM_017753chr94850 801 371 334 1811 167 --
NM_017770chr652643 774 512 409 304 ----12921
NM_017813chr865541 4827 4227 4171 1379 24 --25483 232 14765
NM_017919chr972330 2318 1964 1857 1425 642 472 ------
NM_018254chr11351 1957 2931 685 22069 1910
NM_018364chr1104093 1347 1285 1124 1044 976 577 436 420 160 23560 204 14018 11213
NM_018371chr831592 1564 1367 11460 11359 --
NM_018383chr24747 481 379 343 11510 --11963
NM_018387chr92382 49 ----141
NM_018440chr8118140 6972 6791 6059 5968 5706 5672 3490 2868 2629 896 28008 2751 16930 --
NM_018482chr852181 2086 1589 614 72 --1489 --
NM_018566chr154745 4083 1742 497 196 13984 13345 --
NM_018948chr131282 1210 34 11399 11155 1433
NM_018963chr2131502 1326 404 ----11161
NM_019004chr782312 2020 1869 929 905 597 540 130 --22193 846 12346
NM_019063chr232101 1977 163 ----1932
NM_019593chr2052370 2352 2136 1181 144 12270 --1978
NM_019885chr272787 2402 1963 1805 725 538 305 ------
NM_020116chr42730 646 ----11598
NM_020156chr7174 --1503 1198
NM_020208chr373435 2698 2639 2323 774 647 27 13501 11176 --
NM_020336chr2053458 1322 1213 635 51 11222 13622 --
NM_020337chr42231 128 ----22615 1961
NM_020416chr441785 1030 282 140 11718 22456 2179 --
NM_020429chr742808 697 353 275 1206 --12829
NM_020546chr563026 2494 1157 1032 831 669 --2820 760 1401
NM_020651chr241108 386 361 82 --1254 --
NM_020718chr1664835 2516 2275 1818 1532 1453 36355 6078 5528 26573 4971 --
NM_020742chrX32631 960 52 22767 2351 --11724
NM_020772chr17148342 8047 7999 5783 5371 3466 3256 2386 1680 1462 1431 1412 323 94 --37300 3058 727 --
NM_020802chr1131232 1221 323 12271 12134 --
NM_020810chr1422986 2908 21120 1018 13651 --
NM_020824chr103654 253 148 --1536 --
NM_020854chr1871454 1271 1185 1149 1118 1097 598 --11335 1554
NM_020859chr483956 3620 3109 3013 2732 1538 554 349 22612 1319 ----
NM_020870chr462032 1557 761 455 244 144 --22159 1485 --
NM_020940chr1052776 2141 1843 1133 668 ----1109
NM_020962chr1552139 1628 346 220 48 --11987 --
NM_021033chr1383367 2958 2378 2176 1335 1298 240 187 12496 ----
NM_021038chr352588 1118 868 505 284 1832 13068 11005
NM_021097chr243016 2969 2901 2193 --11085 --
NM_021111chr931237 1132 496 ----1130
NM_021148chr752373 2031 1767 586 109 --11600 11732
NM_021229chr1231175 1063 927 --31150 1113 173 --
NM_021813chr685538 4565 4416 4182 3863 1517 1116 629 22052 838 25226 4803 --
NM_021964chr375737 5725 2214 1372 919 745 385 --35971 5703 2173 15036
NM_022048chr1554314 2023 1870 1060 286 --14856 --
NM_022118chr13------2469 424
NM_022351chr853431 3421 1385 783 657 --23565 3241 --
NM_022458chr773005 2900 2375 2091 930 712 674 --1765 --
NM_022459chr13135839 5705 5522 5151 5131 1969 1432 1407 1363 1297 1167 1096 330 16018 34971 3942 147 --
NM_022735chr141784 747 381 96 11867 11331 --
NM_022841chr1542348 1704 714 330 32706 2273 1922 12045 --
NM_022912chr242574 2086 454 136 23024 2852 --1771
NM_024524chr352944 2734 2285 920 409 ----12241
NM_024569chr142232 2161 928 23 1560 21971 801 --
NM_024612chr1721108 206 ----11123
NM_024617chr9182 --1295 1879
NM_024646chr143115 1123 725 280 1769 13153 11194
NM_024665chr334242 1505 45 --1142 --
NM_024770chr276599 6483 6315 6277 1922 1119 1110 24295 177 1387 15001
NM_024947chr399205 6663 3009 2209 2113 1780 1585 1189 816 12144 ----
NM_024949chr4124471 4331 3938 3744 3541 3188 3181 1993 1933 1709 1262 743 13609 11771 --
NM_025134chr1632128 913 319 --11877 --
NM_025160chr164093 3383 3261 2705 1160 633 33444 545 173 11439 1778
NM_025222chr373045 2673 2563 1117 1078 794 568 12069 22975 954 --
NM_030621chr1453983 3419 2890 2831 1085 --1638 14158
NM_030625chr101395 --2424 380 12170
NM_030627chr533222 1302 1167 11057 24025 1327 --
NM_030647chr745846 5402 5314 4331 26077 500 25481 4372 11998
NM_030648chr475325 5152 4616 1553 970 948 364 14706 14825 --
NM_030755chr1462804 1897 1080 1056 582 561 1194 --12110
NM_031449chr731897 1792 1622 --1637 12227
NM_031461chr831966 1689 260 --1272 --
NM_032047chr361759 1728 1709 1667 875 731 1362 12279 --
NM_032172chr721005 705 --2923 890 --
NM_032199chr1073846 3152 1451 1114 912 589 225 --22488 1501 --
NM_032221chr2061434 810 449 418 257 216 ----1267
NM_032373chr1064607 4237 4153 3898 1323 68 --24875 4805 15915
NM_032457chr483885 3667 3381 2936 2527 1572 941 540 33057 2468 327 1731 --
NM_032471chr61873 ----11137
NM_032682chr341102 977 890 102 1449 13339 --
NM_032784chr61158 ----1390
NM_032846chr1411101 --21252 1147 11316
NM_032859chr1363408 2936 2509 867 710 308 13888 23493 2693 --
NM_032968chrX54104 2771 1587 1271 714 33824 282 241 --1540
NM_032973chrY54096 2766 1586 1271 714 33816 282 241 --1540
NM_033055chr1189 1859 --1369
NM_033103chr1931257 1244 119 ----11232
NM_033132chr1341855 1577 684 422 ------
NM_033222chr92529 386 --11373 1204
NM_033224chr778056 7718 5804 5032 3032 2863 625 27232 2003 27903 139 --
NM_033285chr884469 4367 4353 4287 1450 1342 252 71 --33638 589 116 --
NM_033389chr1763035 1863 1660 1606 1281 787 1589 --11176
NM_052851chr1311631 12280 22202 463 12173
NM_052879chr1253848 2849 2780 1608 1207 32503 1118 1081 23346 1258 --
NM_052885chr1274634 3290 1712 1693 1242 955 550 --23499 3478 13111
NM_052900chr83648 230 133 ----11278
NM_052907chr1253276 3227 1022 943 380 --1788 --
NM_053025chr321792 1542 11532 --11393
NM_078469chr1061348 1195 1187 1073 981 935 1917 1425 --
NM_080836chr2084596 4175 4158 1859 1090 987 892 60 --13258 --
NM_080867chr1411197 --14936 14241
NM_080872chr853951 3092 2589 1156 833 12646 13278 --
NM_101395chr2173471 3101 2874 938 555 329 104 11279 23128 2432 23369 2152
NM_130446chr374370 3360 2734 1604 1591 889 157 --11651 --
NM_133265chrX52660 2578 1295 921 865 1358 13225 --
NM_133646chr295509 5017 4419 3794 1883 1692 1271 1184 806 ------
NM_138286chr1943813 3304 174 136 23618 614 24110 3465 11744
NM_138423chr1522195 2059 2854 359 1219 --
NM_138782chr542062 1883 1688 866 ----11724
NM_139318chr141185 ----164
NM_144571chr476679 5866 5816 2634 1006 982 51 42057 1692 1337 589 16777 1402
NM_144664chr1141939 1643 503 149 22170 619 ----
NM_144778chr1312682 1711 21770 298 11983
NM_144963chr842624 2356 1762 576 ------
NM_145176chr663053 2977 955 901 410 71 --1472 12616
NM_145251chr1421617 473 ----11594
NM_145735chr1362837 2448 764 570 360 320 32762 1025 787 12056 12614
NM_145808chr752604 2263 2231 2111 500 --23058 1211 --
NM_147128chr75621 283 239 143 97 11459 ----
NM_152261chr1252217 1969 844 452 331 1173 ----
NM_152265chr121409 431 --1327 11230
NM_152309chr102563 47 --1848 11514
NM_152470chr1843539 1558 1153 746 --11245 11571
NM_152622chr573498 3050 908 781 725 377 71 ----11296
NM_152641chr1232712 1820 1096 12626 122 --
NM_152678chr342688 2352 1822 492 --32258 2023 1039 --
NM_152756chr584159 3536 3175 715 399 287 231 128 --11412 --
NM_152787chrX93169 2432 1118 1014 872 691 374 269 111 1360 ----
NM_152835chr162684 2554 2015 1999 891 625 --12394 11176
NM_153184chr331949 629 261 --1247 12002
NM_153207chr1233654 2786 1510 23184 727 ----
NM_153262chr132615 1224 621 --22897 406 1904
NM_153332chr842751 2552 1284 457 --22987 2331 2957 226
NM_153371chr1331793 491 115 11648 11864 11882
NM_170665chr1244586 4289 442 268 14198 1723 --
NM_172070chr211774 ----22164 683
NM_172071chr124823 1788 --21553 173 12673
NM_172127chr421537 1491 ----11750
NM_172375chr1421119 145 ----1998
NM_173468chr485997 5851 4763 4517 2180 1944 512 417 ----25629 2066
NM_173511chr243354 2786 2594 2583 --33753 1297 1234 --
NM_173531chr1933196 779 223 22969 837 13074 --
NM_173602chr1253090 2843 1034 223 155 23674 628 32754 371 288 --
NM_173632chr1993292 2836 2086 1120 894 790 554 310 190 13066 ----
NM_173808chr164013 3869 3418 961 932 71 13530 ----
NM_175607chr31458 2600 563 --1155
NM_175907chr1892457 1905 1825 1133 862 829 776 709 588 --11978 --
NM_178011chr1023035 648 21001 357 1905 --
NM_180989chr1342039 855 678 531 --166 12011
NM_181354chr851744 1716 1523 440 137 --185 --
NM_181358chr143278 2850 1665 1556 13603 24164 2777 --
NM_181489chr346095 6054 4936 4403 14666 15188 1802
NM_181504chr564052 3508 2799 2687 1018 468 13088 11467 --
NM_181714chr62723 169 --1365 156
NM_182524chr42170 42 --1247 1129
NM_182765chr1042051 652 316 187 12189 12372 32209 462 387
NM_183376chr1531725 973 581 12485 1861 --
NM_194247chr263145 1488 1253 205 143 23 13982 13234 --
NM_194282chr412356 --11953 1831
NM_194314chr175373 5022 4291 2215 1062 841 707 --13769 --
NM_194318chr132396 274 --11967 11001
NM_197941chr5113060 3044 2828 2810 2626 2415 2286 1889 879 680 250 ----1209
NM_198270chrX33199 2822 234 12354 --1142
NM_198281chr443222 2714 2116 1119 ----22138 361
NM_198503chr13517 468 364 --12187 1848
NM_198513chr831702 1574 155 ----1675
NM_198859chr323337 172 --14554 1221
NM_199461chr1053212 2822 2605 1118 679 13130 --1823
NM_201613chr12--1850 --1302
NM_203459chr152603 2497 2424 2367 1738 2550 156 12198 --
NM_206853chr644080 3946 3416 128 --1930 23276 182
NM_207406chr4116309 5385 5013 4327 2621 2591 2438 912 748 483 105 24290 130 14517 15896
NM_213609chr34374 178 166 133 --1941 --