TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-892b
miRNA Sequence: CACUGGCUCCUUUCUGGGUAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96222 6145 6053 4622 4310 2639 1565 1120 473 12782 12379 26075 2764
NM_000110chr121133 268 ------
NM_000115chr1321735 1020 12005 --11671
NM_000125chr644011 3876 1108 461 --23467 3000 --
NM_000176chr5----1620 --
NM_000214chr20----21243 208 --
NM_000264chr942808 2353 813 721 ------
NM_000321chr1311380 ----11124
NM_000332chr695833 5779 4664 2881 2285 1735 330 310 196 26776 6584 16628 --
NM_000430chr1733049 1465 619 ------
NM_000448chr1142820 2591 353 154 --1345 --
NM_000474chr7----1504 --
NM_000489chrX2841 186 12139 13376 --
NM_000599chr2114094 3807 3370 3278 1818 1774 1562 1269 1258 576 59 ------
NM_000617chr1222243 278 11860 21815 43 --
NM_000663chr1642570 2323 2051 387 --22155 333 13114
NM_000721chr152060 1094 918 548 463 --22370 71 --
NM_000793chr1454753 4127 3943 813 704 ------
NM_000813chr545605 1066 586 336 --15571 11811
NM_000814chr1533739 827 493 --44003 3818 2847 217 --
NM_000845chr7----1121 --
NM_000859chr541234 1170 1097 381 --21581 1184 --
NM_000875chr1595811 5449 5442 4759 4660 4592 2760 2305 2164 --26628 5615 --
NM_000891chr1721013 837 1554 31365 892 460 12583
NM_000961chr2062990 2649 1383 1013 772 375 --1470 --
NM_000965chr311129 ------
NM_001001323chr1212984 ----1375
NM_001001419chr513919 14438 45036 2076 1680 754 --
NM_001001481chr833055 2992 1285 ------
NM_001002294chr1------1137
NM_001002295chr102777 435 ------
NM_001002762chr1082789 2604 2471 2127 1139 537 365 41 11982 32273 2269 1149 --
NM_001003674chr1896300 5787 5419 4832 4370 2245 1471 1438 360 --1435 --
NM_001003800chr942802 1001 789 621 12715 33715 2900 2784 --
NM_001004127chr132710 415 --1807 --
NM_001004304chr1252832 2806 2713 2125 713 --22301 240 --
NM_001005609chrX123404 3076 2931 2533 2407 1522 1332 1231 1212 478 347 52 --11349 --
NM_001007097chr9114634 4236 3353 3216 3134 2040 1985 1815 1561 1382 696 --14543 --
NM_001007102chr611534 ----1460
NM_001007237chr111794 --2875 147 12360
NM_001009566chr121282 537 1102 ----
NM_001009993chr2144351 4184 4172 3566 3388 3346 3173 2982 2976 2970 1367 1279 739 528 --34440 2938 686 --
NM_001010891chr555464 5379 1754 1568 881 14392 15513 15852
NM_001011537chr3----21642 444 --
NM_001011666chr725670 5078 ----25971 4933
NM_001011713chr143574 235 121 ----11316
NM_001012393chr1144328 3701 1691 1484 --14431 --
NM_001012614chr41796 ----1230
NM_001012755chrX44533 4488 1070 239 ------
NM_001017371chr2----11045 --
NM_001018115chr3----1599 --
NM_001024218chr14----180 --
NM_001024948chr112144 --11085 12984
NM_001025580chrX53557 3223 3115 1680 298 --12827 --
NM_001031679chr1243015 2193 1037 810 --12843 --
NM_001031695chr2264803 4406 4030 3981 3959 1948 11132 44829 4237 3587 936 --
NM_001032221chr91656 --11707 --
NM_001033925chr1041550 743 567 471 12088 ----
NM_001034915chr821090 1032 --1200 11152
NM_001034915chr821090 1032 --1200 11152
NM_001034954chr1062310 1168 732 473 444 324 ----180
NM_001039479chr1462405 2392 2269 2225 484 103 --22140 702 --
NM_001039538chr252993 2709 711 700 565 --12346 --
NM_001039585chr11137 --11220 --
NM_001039693chr253600 3183 1618 629 476 1428 1590 --
NM_001040429chr1312828 ------
NM_001040876chr41394 --2426 146 --
NM_001042406chr621138 1043 1375 1466 --
NM_001042414chr13----142 --
NM_001042481chr141859 12476 11043 11690
NM_001042555chr1224443 547 --13021 14495
NM_001042599chr287241 5389 5273 5086 4980 3085 1279 256 25899 98 ----
NM_001042601chr3----12479 --
NM_001042604chr344013 3724 3185 595 ------
NM_001044305chr611560 ----1382
NM_001046chr521169 639 --12566 --
NM_001092chr1782378 2322 2255 2248 2200 905 176 124 --11555 --
NM_001106chr388394 8051 6895 6665 6618 2935 2056 1897 --28079 1266 --
NM_001149chr10--143 --11142
NM_001204chr244958 2304 1358 626 --24694 439 --
NM_001206chr922917 21 --12237 --
NM_001241chr2131 22355 1740 22458 2334 --
NM_001259chr756322 6178 6059 1568 319 22115 529 ----
NM_001270chr511069 --1320 --
NM_001356chrX41782 985 790 65 ------
NM_001401chr92351 334 --11403 1647
NM_001417chr1261714 1263 768 550 278 211 11612 ----
NM_001438chr131168 617 578 ----23412 1439
NM_001440chr892620 2222 2132 2108 2038 780 751 661 170 --11052 --
NM_001526chr6----1157 --
NM_001616chr212448 --12413 --
NM_001650chr1813043 --1998 --
NM_001698chr9------1211
NM_001729chr4------194
NM_001755chr16--1673 --1258
NM_001759chr1265196 3916 3881 655 572 370 --14261 --
NM_001839chr1161 --1278 --
NM_001859chr952709 2544 647 429 403 --12853 --
NM_001882chr5------1106
NM_001949chr623100 258 --11038 --
NM_001981chr13938 295 208 --1382 --
NM_001982chr1231161 823 184 --145 --
NM_001987chr12104282 3889 3294 3206 1722 1147 1095 863 763 30 --13958 --
NM_002025chrX68249 6979 6452 3090 1745 1657 16747 ----
NM_002040chr212878 262 1282 --2943 314
NM_002069chr721340 419 --11300 --
NM_002128chr13----1516 --
NM_002154chr5----1107 --
NM_002156chr2----188 --
NM_002158chr223413 2887 13666 12343 --
NM_002247chr1032175 1824 327 --1658 --
NM_002270chr531214 979 562 --13478 --
NM_002293chr122235 1914 1446 12318 --
NM_002356chr611808 --1703 --
NM_002401chr17102486 2317 1662 998 933 549 480 164 123 26 ------
NM_002526chr611409 11636 ----
NM_002577chr333405 3273 401 --1656 --
NM_002581chr954635 4497 1571 1432 73 --34826 1111 514 --
NM_002588chr531189 1146 160 ----11513
NM_002655chr853475 1749 1553 1068 874 ----1135
NM_002657chr2023377 2623 11403 32628 558 432 --
NM_002717chr81589 --1578 --
NM_002719chr143275 257 36 --1922 --
NM_002731chr123118 611 ----1859
NM_002734chr17----1796 --
NM_002745chr2264432 4093 2855 1722 1197 1179 --22794 459 --
NM_002753chr42630 558 1733 ----
NM_002869chr11----1183 --
NM_002886chr344796 3173 1165 111 --24006 1073 --
NM_002924chr11464 ------
NM_002959chr174314 4298 3756 3587 3402 1682 1558 1831 11506 --
NM_003010chr1722447 1513 ----1267
NM_003013chr4----1298 --
NM_003017chr6----21117 942 --
NM_003030chr331449 166 104 11913 11679 --
NM_003069chrX2218 100 1738 ----
NM_003081chr2011163 --11193 --
NM_003106chr3----1428 --
NM_003108chr256001 5302 4722 4627 1773 ------
NM_003155chr822406 2180 --1516 --
NM_003185chr20--1871 1425 --
NM_003205chr151807 --21913 1635 --
NM_003243chr12399 304 1186 ----
NM_003257chr15------1319
NM_003270chrX------1317
NM_003320chr1163704 3221 3029 914 403 143 --14326 --
NM_003342chr1732450 2122 155 12972 ----
NM_003344chr73633 481 271 --11658 --
NM_003390chr11149 1104 1706 --
NM_003411chrY--1467 165 --
NM_003462chr151417 1287 530 275 210 --1105 --
NM_003468chr2103998 3687 3654 3286 3054 2734 1696 1642 1273 490 ----24149 3890
NM_003559chr1773522 2702 2685 1427 1151 27 21 13619 13264 --
NM_003583chr1243914 3828 3241 622 ----12888
NM_003590chr233719 3316 2588 --1480 --
NM_003624chr1951368 1123 974 421 348 --11373 --
NM_003705chr23740 614 80 ------
NM_003745chr16----1390 --
NM_003762chr131246 1025 274 --11137 --
NM_003860chr11----1366 --
NM_003895chr211298 --12163 --
NM_003939chr1073944 3918 1321 1144 759 750 512 --24086 1641 --
NM_003953chr132817 2415 1120 --1197 --
NM_004114chrX21038 99 ------
NM_004124chr1413521 1844 12330 --
NM_004134chr5124 --1159 --
NM_004230chr19101782 879 552 278 254 219 206 153 94 29 --12319 --
NM_004232chr1833232 3184 2808 --13411 13123
NM_004267chr3----1163 --
NM_004272chr5----1191 --
NM_004280chr6------1477
NM_004281chr10----186 --
NM_004392chr1321690 50 11791 11057 --
NM_004432chr9--1163 197 --
NM_004501chr11956 1238 24032 1440 --
NM_004503chr122663 153 ----1750
NM_004529chr921044 1018 --1175 --
NM_004571chr2162817 2198 1279 1133 434 142 --1950 --
NM_004614chr1692289 2094 2039 1880 1545 900 643 145 109 11914 --12381
NM_004660chrY42196 2169 1714 66 --11615 --
NM_004663chr15----11440 --
NM_004690chr6----1246 --
NM_004725chr10----1572 --
NM_004774chr1762932 2273 1942 756 86 31 12799 12755 --
NM_004779chr51983 --11092 --
NM_004801chr2----1430 --
NM_004808chr1073215 3133 3042 2906 849 650 171 ------
NM_004815chr154603 3781 3492 622 576 11019 1642 --
NM_004852chr18914271 13489 12879 8682 4551 3072 2556 386 168 28914 4826 413588 9587 9514 747 19036
NM_004863chr1485042 4992 4793 4726 4061 3806 3504 1131 --168 --
NM_004898chr442681 2665 1166 191 --21935 220 --
NM_004929chr831188 224 27 --11169 1230
NM_004956chr713726 1710 ----
NM_004992chrX158044 7671 7535 7373 7328 6489 6117 5959 3031 2744 2298 1874 1647 231 208 38129 5982 1389 13117 16856
NM_005023chr5------1155
NM_005056chr1233411 509 164 13866 --13906
NM_005057chr131480 1297 66 --21756 720 --
NM_005065chr1434895 1161 813 25193 1420 14686 --
NM_005121chr1722814 1382 12962 12711 --
NM_005156chr934905 3603 181 --13980 --
NM_005188chr1198222 6676 6381 5528 5507 5467 2405 1052 678 --47727 2819 1550 955 35822 2043 181
NM_005256chr11----165 --
NM_005261chr81122 ----1184
NM_005385chr311746 ----12634
NM_005386chr204821 340 135 60 1147 173 --
NM_005475chr12103084 2935 2631 2570 2211 715 673 446 314 132 ------
NM_005491chrX82207 1823 1486 738 661 556 280 79 --22174 836 --
NM_005596chr926214 565 --45990 5423 5408 451 --
NM_005639chr12----11232 152
NM_005668chr544301 1682 864 477 --13703 --
NM_005715chr63823 758 488 --12583 --
NM_005717chr141326 1193 404 384 ------
NM_005749chr17----1688 --
NM_005759chr294596 3835 3428 1480 1420 1158 804 743 39 24689 1061 13909 11352
NM_005766chr1311054 1240 1233 --
NM_005828chr1784578 4217 4093 4077 3446 3091 1774 155 196 11282 --
NM_005902chr1534448 3069 2830 --34130 2974 949 --
NM_005941chr853850 3460 2667 1659 89 ------
NM_005966chr21968 11621 ----
NM_006047chr2033311 3157 3082 1345 21324 799 --
NM_006100chr3----1240 --
NM_006141chr162806 663 1520 ----
NM_006164chr2--1168 132 --
NM_006210chr191204 191 11138 11166
NM_006212chr144895 852 684 668 ----11002
NM_006265chr8----124 --
NM_006306chrX125831 5747 5549 5272 5096 5048 4759 4560 4169 3779 1343 758 14216 --15719
NM_006310chr173931 876 285 --21002 488 --
NM_006328chr11----1511 --
NM_006329chr141131 ------
NM_006375chrX1113 11364 ----
NM_006504chr1012866 141 21882 387 --
NM_006544chr1445433 4377 1586 31 14956 14571 --
NM_006546chr1785970 5928 5286 4994 2177 1937 1609 1452 24267 572 --11860
NM_006575chr14----1174 11101
NM_006621chr111646 ----11256
NM_006644chr13----1524 --
NM_006696chr51219 --1234 --
NM_006711chr162603 148 --1254 1726
NM_006713chr5----1575 --
NM_006717chr921316 1292 --1560 2925 263
NM_006749chr8----1963 --
NM_006763chr141532 755 653 439 --21617 250 --
NM_006791chr151210 --1596 --
NM_006807chr1711346 ----1120
NM_006873chr211053 --23354 3049 1293
NM_006888chr1462346 958 852 757 344 306 --11349 --
NM_006943chr2083238 2913 2560 2164 2156 2121 1219 258 ------
NM_006951chr102760 681 ------
NM_007007chr1211618 --1991 --
NM_007011chr1565132 5054 4979 4939 4860 498 12726 35169 4641 2395 --
NM_007034chr11756 --1278 --
NM_007050chr20147878 7538 7339 5498 5225 3185 3101 2209 2161 1760 1626 1567 714 659 --36066 1790 1694 11717
NM_007125chrY11291 11379 11155 --
NM_007146chr1712247 --1440 --
NM_007159chr321574 1306 --11283 --
NM_007185chr1----1958 --
NM_007249chr1363562 2255 1348 1284 1256 454 --32415 2272 946 --
NM_007275chr32468 287 1888 ----
NM_007373chr102487 246 ------
NM_012081chr553475 3074 2711 1379 653 --13332 --
NM_012104chr1143559 2846 637 96 13012 13092 1450
NM_012214chr264965 2474 1930 1920 1525 1394 15961 21579 784 --
NM_012231chr111861 --11346 --
NM_012294chr763481 3292 3122 565 230 137 1715 1972 13969
NM_012297chr4--12546 --11594
NM_012300chr51815 --1631 --
NM_012306chr12133463 3079 2883 2567 2194 1402 1375 1253 1221 1215 1070 944 117 ------
NM_012329chr17----1341 --
NM_012330chr10----11170 --
NM_012399chr2241961 1371 1319 699 --2512 80 --
NM_012416chr911075 --1769 --
NM_012433chr21122 ------
NM_013261chr413357 ------
NM_013333chr19----1302 --
NM_013336chr331489 803 756 --12008 --
NM_013392chr2------184
NM_013444chrX----1730 --
NM_013449chr1242656 2286 912 105 1455 ----
NM_014021chr1--1574 182 --
NM_014112chr834987 4974 802 --11599 14138
NM_014141chr784129 4038 4019 3703 3677 1721 884 552 ------
NM_014231chr121415 ----11662
NM_014289chrX2477 471 --21161 926 --
NM_014423chr575333 4925 4887 1686 1282 341 166 --23424 2202 15349
NM_014554chr1232258 886 63 ------
NM_014607chr21809 --21870 732 --
NM_014613chr562737 2261 2106 1897 1049 75 22353 2145 22613 2426 --
NM_014615chr1642852 2846 2285 434 1495 ----
NM_014647chr1631988 1432 785 --11468 --
NM_014665chr8133599 3579 3435 3170 3085 3040 2875 2662 1465 1073 749 743 691 --13078 --
NM_014667chr332130 921 305 ----164
NM_014674chr353132 2461 1540 1321 1230 --12674 --
NM_014730chr12134471 4362 3663 1890 1855 1781 1626 1549 1383 1346 950 943 641 --11212 --
NM_014747chr194712 4290 4077 3894 1858 1816 845 766 643 14638 35827 5252 4776 --
NM_014755chr273936 3431 3196 2909 1459 911 834 1892 ----
NM_014772chr18103563 3482 3210 2948 1284 1246 774 147 136 59 1860 ----
NM_014830chr1283565 3386 3217 3074 2529 667 601 44 12413 ----
NM_014872chr972351 2123 2091 904 802 245 33 --21899 505 --
NM_014877chr17107104 6974 6110 5363 2155 2104 1841 1594 426 274 --12467 15236
NM_014906chr1753279 1109 607 346 25 --12909 --
NM_014920chr623634 2791 --11195 --
NM_014932chr311908 2571 514 ----
NM_014947chr142562 1994 434 273 --12980 --
NM_014949chr1----1923 --
NM_014951chr1052568 1606 934 927 578 --12573 --
NM_015000chr1211937 --22986 2785 --
NM_015020chr1663874 3737 3177 2727 2465 313 --23660 3254 13325
NM_015035chr20126380 6087 5900 5833 5792 5402 4119 2459 1171 490 411 32 --12682 --
NM_015042chr15130 --13150 --
NM_015045chr1031607 1558 389 ------
NM_015059chr1532819 2809 464 13529 33050 2571 808 1296
NM_015069chr161537 --1226 --
NM_015074chr184247 4223 3977 3285 3268 3252 3108 1874 11814 25007 3237 --
NM_015076chr631673 1509 24 ----11638
NM_015090chr1156073 5325 4658 4583 4573 4360 4269 4242 1991 1769 1755 1670 1040 859 631 --35700 5104 2221 --
NM_015094chr22154278 3799 3212 3109 3086 2849 1741 1658 1475 1414 1264 528 495 356 196 13686 ----
NM_015097chr31309 --1622 12114
NM_015111chr584028 3317 3019 1083 503 495 182 104 ------
NM_015144chr1653440 3082 3000 2891 602 --3833 829 566 --
NM_015155chr1072511 2378 2294 2247 2116 2063 443 --12453 --
NM_015185chrX62915 2676 2648 1995 1876 651 ------
NM_015275chr1232076 1341 61 ----1404
NM_015278chr642949 2883 424 410 ----12895
NM_015288chr5133732 3426 3336 1309 1034 870 784 755 747 664 563 491 384 ------
NM_015291chr13950 742 393 --11294 1906
NM_015299chr1473649 3624 2863 397 321 188 176 --32857 1471 502 --
NM_015313chr1144337 4057 3336 3320 23232 1118 ----
NM_015317chr2------11812
NM_015336chr1212265 --11889 --
NM_015338chr2071213 723 543 456 444 385 223 ------
NM_015344chr822098 1949 --1460 --
NM_015349chr642842 2174 1997 1186 ----23021 619
NM_015353chr1772639 2480 1834 1795 764 695 42 ----1244
NM_015455chr553684 3252 1234 575 155 1363 ----
NM_015458chr885297 5177 4851 4040 2087 1181 235 221 ----13277
NM_015460chr321353 23 ----1356
NM_015493chr1952007 1592 845 710 26 --12012 12206
NM_015508chr321077 212 ------
NM_015523chr11----1288 --
NM_015713chr812585 --21056 310 1949
NM_015831chr71649 ----1216
NM_015850chr872075 1672 1634 571 496 445 114 ------
NM_015879chr18118422 7824 7745 7097 5851 5551 5202 2082 1498 1232 1097 --15889 15822
NM_015902chr81206 --1717 --
NM_015967chr13292 167 71 ------
NM_016022chr12947 280 --2201 197 --
NM_016073chr15----1953 --
NM_016147chr111475 ------
NM_016205chr4--1353 1273 --
NM_016271chr1822221 2131 --1418 1764
NM_016284chr16131 ------
NM_016289chr221499 722 11590 ----
NM_016396chr1523054 2313 1441 --12944
NM_016424chr1711241 1488 --1571
NM_016448chr111327 11603 --11802
NM_016472chr14------11066
NM_016605chr541996 1761 388 370 12482 12149 --
NM_016607chrX31155 528 95 ------
NM_016628chr10----1888 --
NM_017413chrX41621 921 707 430 --12522 --
NM_017415chr524000 2947 --34370 2869 1737 --
NM_017544chrX1853 ------
NM_017548chr321786 472 --1278 --
NM_017549chr7--1330 11175 --
NM_017551chr1042025 1890 1693 944 ----1208
NM_017594chr933341 2297 942 ----12960
NM_017610chr151812 --11815 11407
NM_017637chr988974 8517 7907 7176 5882 3562 2237 1520 38524 6424 945 58811 6542 6223 2971 69 --
NM_017658chr1433409 1766 1728 --11393 --
NM_017672chr151172 ------
NM_017848chrX43325 2889 1737 73 --24314 3200 23600 3274
NM_017919chr945457 5345 4021 1967 13714 22229 675 --
NM_018013chr6----1964 --
NM_018092chr162293 257 --1542 --
NM_018098chr3------1999
NM_018121chr1012049 12819 23081 321 12121
NM_018133chr3----1361 --
NM_018247chr652859 2576 2408 698 45 ------
NM_018364chr113473 11139 ----
NM_018367chr1182161 2139 1922 747 581 536 446 399 ------
NM_018373chr1455622 4032 1750 349 98 11588 16251 16457
NM_018374chr723446 504 --24612 1969 --
NM_018439chr181106 1729 1111 --
NM_018440chr8108468 7486 6745 6276 5701 3122 1652 1199 572 283 18542 38724 6541 724 --
NM_018490chr1131565 1349 487 11498 ----
NM_018566chr134637 3876 3133 --13950 --
NM_018650chr1------1168
NM_018682chr71748 ----1187
NM_019046chr101664 --2906 196 --
NM_019098chr8----134 --
NM_019116chr1672860 2681 1162 949 601 215 148 --11506 --
NM_019558chr2----1276 --
NM_019605chr11470 ------
NM_020150chr1031952 669 490 1220 1779 --
NM_020177chr543275 2778 1077 1055 11145 ----
NM_020235chr3171 ------
NM_020315chr224971 905 722 241 ----1743
NM_020342chr2--12135 22448 96 --
NM_020443chr186902 6836 5940 5509 2753 1740 1271 960 16206 26427 2513 --
NM_020474chr18------1427
NM_020630chr10----1626 --
NM_020699chr134624 1977 806 11986 11938 --
NM_020713chr2072928 1996 1109 649 241 136 65 --12772 --
NM_020718chr1665433 5313 2405 1250 1131 790 11446 2799 588 11715
NM_020768chr532986 502 282 12570 ----
NM_020772chr1767075 6421 3267 2278 2012 1857 28218 2742 11084 --
NM_020866chr13----1798 --
NM_020871chrX12445 --1244 1695
NM_020925chr131114 342 321 ------
NM_020944chr91237 ------
NM_021144chr9----1387 --
NM_021204chr4----1342 --
NM_021633chr11487 --129 --
NM_021643chr2------11228
NM_021814chr6----1643 --
NM_021943chr681735 861 780 739 464 261 133 71 --1112 --
NM_022048chr15106277 5238 4402 3858 2404 1344 1106 1097 164 151 13954 ----
NM_022130chr511061 ------
NM_022166chr1684475 4178 3982 2357 1500 990 521 52 --11426 --
NM_022458chr742933 2303 2176 772 --11928 --
NM_022459chr1334926 4892 482 --34750 2542 1224 --
NM_022719chr22113435 3038 2852 1368 1298 1272 1242 1017 954 155 102 11531 --12650
NM_022826chr21372 11058 ----
NM_022894chr211396 11407 ----
NM_024122chrX------1100
NM_024574chr41422 ------
NM_024612chr173948 66 42 ------
NM_024896chr922455 213 22029 808 11010 --
NM_025160chr143431 3013 2649 1701 13188 1981 --
NM_025191chr123244 266 --33218 2749 641 --
NM_030627chr554062 3860 1578 849 719 --11331 --
NM_030640chr12----1683 --
NM_030647chr745676 5317 4219 1403 12268 ----
NM_030648chr4105276 4483 2060 1944 1824 1740 1583 711 383 191 1906 21460 350 11043
NM_030806chr1129130 8400 7641 6955 6877 6857 6721 6287 2797 2629 2236 229 --15874 --
NM_030877chr20----198 --
NM_030963chr6------1522
NM_031216chr181634 --1190 --
NM_031445chr222937 2543 22727 2518 ----
NM_032042chr562676 2563 2479 2311 2159 238 ------
NM_032124chr18----199 1172
NM_032153chr312593 ------
NM_032199chr1023114 1235 ----191
NM_032283chr141672 632 407 371 --11218 11834
NM_032316chr322174 339 --1254 --
NM_032329chr294150 3875 3768 3701 3156 1632 1010 960 119 --23487 1427 --
NM_032440chr101838 --12941 --
NM_032564chr111675 ----1165
NM_032603chr23657 570 169 1178 1496 --
NM_032622chr4178 --1147 --
NM_032827chr23848 798 51 11044 1423 --
NM_032900chr1053588 2981 1428 1245 510 1358 --12432
NM_032961chr411348 --21315 331 --
NM_033224chr7117906 7065 6800 5210 5148 3094 2259 1431 968 850 724 17291 32437 989 88 26955 6916
NM_033285chr844342 1392 1362 295 14485 11431 --
NM_033393chr452560 2118 393 348 124 11033 ----
NM_033626chrX81581 1309 1273 1193 1157 228 57 45 ------
NM_052879chr1223590 93 --13944 --
NM_052885chr1264947 4188 1535 1500 870 732 14111 1348 --
NM_052906chr22124805 4166 3746 3196 1548 1496 1472 1360 1211 934 74 34 --24387 1850 --
NM_053025chr341761 1464 557 224 11479 ----
NM_080832chrX11424 ----1404
NM_080867chr1444966 3767 3192 1436 --14126 1840
NM_133265chrX31307 1185 405 12555 13611 --
NM_133329chr221513 526 11729 ----
NM_133334chr4136130 5770 5363 5084 4754 4669 4080 3907 2035 1533 1495 974 454 ------
NM_133443chr162675 631 --11890 11692
NM_133494chr1----1105 --
NM_133496chr153328 3107 881 715 138 11050 --1367
NM_138426chr7----11838 --
NM_138473chr1221328 1112 --23940 1276 13817
NM_144571chr456536 6033 4422 1247 264 ------
NM_144574chr14----1225 --
NM_144578chr1465197 3878 2186 1902 1599 564 1533 23630 569 --
NM_144590chr1052429 1174 350 264 245 --12642 --
NM_144778chr13----2360 160 --
NM_144967chrX----1773 --
NM_144973chr1264871 1767 1633 1303 568 349 --13896 1362
NM_144982chr122648 542 ------
NM_145175chr251395 352 165 126 79 ----11007
NM_145203chr13----197 --
NM_145313chr1021659 1222 --1390 11390
NM_148957chr1322034 168 12549 1154 --
NM_152253chr2283699 3644 3038 2944 2639 1051 984 909 --21317 687 --
NM_152261chr1231947 745 43 ------
NM_152389chr211370 1500 ----
NM_152424chrX73317 3134 3077 3068 1794 1126 672 ------
NM_152437chr121866 --22312 2150 --
NM_152556chr711981 --11621 --
NM_152622chr51645 1122 12197 --
NM_152643chr1051156 1019 994 434 200 --11161 --
NM_152660chr1----1657 --
NM_152787chrX22882 621 1866 12590 --
NM_152835chr142532 2311 2213 92 1331 1532 --
NM_152994chr2----1133 --
NM_153267chr9------1600
NM_153343chr421542 60 11978 ----
NM_153607chr52947 85 12904 ----
NM_153686chr4--142 21970 1847 1334
NM_170606chr7----1614 --
NM_170665chr12104236 3595 3415 3408 3265 3228 1612 1586 1575 314 --13627 1504
NM_171998chrX62073 1758 1640 1586 1020 209 --11578 --
NM_172071chr116643 ------
NM_172127chr411663 ------
NM_173156chr131423 859 678 --2612 532 --
NM_173470chrX52381 2215 2117 1152 522 --22577 838 --
NM_173505chr181307 --11134 --
NM_173511chr233472 2745 2419 21337 1087 1858 --
NM_173519chr822049 792 --11885 --
NM_173797chr511127 --1447 --
NM_173808chr124107 3318 ------
NM_173822chr211344 11338 ----
NM_175607chr3--11520 153 --
NM_175630chr22647 238 1170 ----
NM_175733chr1141979 1806 731 603 ----12119
NM_175876chr11527 --12725 --
NM_177951chr14----184 --
NM_178011chr1022893 925 --11058 --
NM_178140chr542449 1944 880 325 --31884 915 911 --
NM_181504chr564056 2878 2840 2733 1419 574 1971 13623 --
NM_181723chr822119 2070 ------
NM_181784chr232290 1899 154 --31759 556 531 --
NM_182515chr1986677 6633 5674 5235 4546 2449 1920 190 --1930 --
NM_182691chr7131 --11267 --
NM_182756chr22610 407 --1239 --
NM_182765chr1022116 868 --22376 2264 --
NM_182830chr141641 --22091 1478 --
NM_194247chr244281 3139 1614 146 --22952 1479 --
NM_198581chr267105 6616 6140 5763 2028 295 2964 123 ----
NM_198904chr521999 1802 11738 11337 11681
NM_203494chr151161 --127 --
NM_206853chr624021 3022 --1102 --
NM_206855chr636247 5248 940 --12328 --
NM_207303chr1034098 3506 1153 --1208 --
NM_213589chr225491 4614 25501 1662 25541 1385 --