TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-9-3p
miRNA Sequence: AUAAAGCUAGAUAACCGAAAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521236 110 ------
NM_000038chr531291 517 246 11654 ----
NM_000051chr1143225 1151 1062 1024 22622 138 12379 12537
NM_000052chrX1543 33273 3109 2486 32178 486 188 12637
NM_000053chr1352011 1727 1715 1561 236 --31363 1321 101 --
NM_000081chr141577 1545 1163 603 21409 1173 170 1241
NM_000084chrX146952 6589 5895 5880 5609 5555 5278 4681 4627 2351 943 718 621 444 --26532 1434 --
NM_000088chr1721284 172 ------
NM_000090chr21207 1669 ----
NM_000092chr263933 3702 3448 1689 1561 258 ------
NM_000093chr932507 837 626 ----22431 578
NM_000096chr33952 843 274 --1907 --
NM_000108chr781792 1604 1481 1294 749 505 312 46 1561 11300 11932
NM_000109chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_000110chr11937 1799 ----
NM_000112chr5125498 5334 4743 4415 4204 4081 957 819 540 502 308 217 --21440 1128 24978 4102
NM_000125chr644084 695 540 122 --14183 --
NM_000129chr61200 189 --1242
NM_000139chr1132154 218 110 --1545 --
NM_000141chr1021342 1205 ------
NM_000142chr421306 502 --21363 118 --
NM_000161chr1421819 1491 11376 ----
NM_000163chr52785 361 ----11924
NM_000165chr651581 1203 517 374 293 ----11716
NM_000168chr762849 2780 716 681 431 212 --12232 --
NM_000173chr172416 382 ------
NM_000176chr573721 3637 3318 2644 630 95 49 2523 129 ----
NM_000189chr252238 1904 743 731 100 153 ----
NM_000194chrX2457 103 ------
NM_000214chr2041664 1568 394 121 --1350 --
NM_000216chrX62651 2625 1588 1071 818 312 22916 976 1465 --
NM_000217chr1285299 4737 4682 4298 798 342 185 93 14746 ----
NM_000218chr111964 1921 ----
NM_000222chr442091 1942 1845 588 ------
NM_000237chr841919 1698 684 495 21868 597 ----
NM_000248chr3112466 2209 1186 1005 908 880 814 735 708 266 123 --52308 1989 1981 1101 516 --
NM_000251chr2168 --158 --
NM_000252chrX61196 1085 567 515 402 248 ------
NM_000259chr1585994 4989 2254 2175 1688 1594 1447 1438 14344 --1732
NM_000264chr953209 2755 2508 2413 1242 12270 23122 2234 --
NM_000267chr1742892 2877 2390 111 ------
NM_000268chr2233635 2793 2444 23775 237 ----
NM_000271chr18--1667 1441 1132
NM_000276chrX----11899 --
NM_000280chr1141011 759 661 80 --2405 385 1907
NM_000289chr12181 --1298 --
NM_000291chrX2912 765 --1333 --
NM_000304chr1721073 351 ------
NM_000314chr1052253 1223 1002 287 147 12982 2384 298 12812
NM_000321chr1351711 1581 1384 604 282 ------
NM_000325chr42671 639 --1547 --
NM_000327chr111268 ------
NM_000328chrX4373 302 150 122 ------
NM_000329chr12294 138 1106 ----
NM_000330chrX51836 1796 1427 369 159 22133 415 ----
NM_000332chr696941 6859 6405 5987 2846 1953 1882 1793 1574 47142 6680 5136 2022 25748 2034 --
NM_000333chr33914 790 286 1153 ----
NM_000337chr575097 4524 4132 1732 1700 507 52 26454 6271 1513 --
NM_000340chr341491 1103 488 107 11413 ----
NM_000345chr42892 103 ------
NM_000346chr1761277 1221 807 712 680 571 --21882 1738 --
NM_000362chr2283653 3541 3380 3373 2382 880 859 719 --12400 --
NM_000368chr973966 3033 1826 1645 1403 1096 77 23826 1896 44551 2970 1774 277 --
NM_000369chr1431855 581 347 11572 --1565
NM_000386chr172788 160 1323 ----
NM_000389chr6--1110 ----
NM_000390chrX43418 1159 1039 926 ----22683 2633
NM_000393chr222007 1349 ----1197
NM_000397chrX52543 2453 2294 721 416 ------
NM_000408chr243098 2712 252 206 --1165 --
NM_000430chr1753702 2644 1248 712 416 --13011 11032
NM_000437chr122097 40 ------
NM_000448chr1142690 2521 510 189 --22369 2356 --
NM_000449chr11196 1310 ----
NM_000459chr9--1204 1848 --
NM_000461chr364579 4070 3504 3142 446 227 14526 ----
NM_000462chr1531869 1526 585 21463 653 ----
NM_000480chr1131573 654 533 --11167 --
NM_000484chr211103 1382 ----
NM_000489chrX72878 2711 2274 2238 2173 953 528 22183 488 32370 1234 135 33461 2670 2106
NM_000492chr721091 128 --11076 --
NM_000495chrX1451 2827 29 ----
NM_000503chr831709 1203 238 --1520 21598 666
NM_000509chr4----1148 --
NM_000522chr7159 1183 ----
NM_000555chrX107682 7247 6650 5484 4859 2937 1388 1185 1174 105 37310 6937 6223 26889 6158 --
NM_000589chr5121 --132 --
NM_000598chr741534 1484 1399 418 ------
NM_000609chr1031906 721 119 13048 ----
NM_000615chr1162542 2456 2215 1102 915 846 --12761 --
NM_000617chr1232272 2079 761 --1403 --
NM_000618chr1275697 5486 4697 2325 2073 1625 456 1728 1646 15028
NM_000618chr1275697 5486 4697 2325 2073 1625 456 1728 1646 15028
NM_000620chr1252034 2019 1710 188 33 --12057 11302
NM_000633chr1895011 4918 4880 4820 4083 3578 3441 1511 450 34968 1807 1390 12009 14312
NM_000668chr431131 426 131 --11203 --
NM_000675chr22--1854 ----
NM_000681chr1011279 ------
NM_000684chr1011260 ------
NM_000718chr9----162 --
NM_000719chr1276241 2579 2133 1797 1537 778 24 --21743 956 15451
NM_000724chr1021320 677 1313 ----
NM_000726chr231415 1375 1139 --1499 --
NM_000739chr7------178
NM_000758chr51282 ------
NM_000780chr851038 934 889 864 514 31127 951 816 1989 --
NM_000783chr10152 ------
NM_000788chr43993 346 103 1121 2506 50 1402
NM_000793chr1485056 4767 4757 4057 3883 3828 1958 1385 2320 32 11573 --
NM_000800chr521341 1261 11512 ----
NM_000806chr541588 1450 724 83 21520 695 --1525
NM_000812chr41122 --1142 --
NM_000813chr584498 4122 3632 3512 1946 1230 1174 896 --14955 --
NM_000814chr1554116 2666 430 313 70 13478 ----
NM_000817chr211210 ------
NM_000826chr462587 1961 856 665 587 518 ----11896
NM_000827chr552433 1789 1653 471 334 12491 11781 --
NM_000828chrX41871 837 754 229 1718 --12173
NM_000831chr126128 1692 16293 ----
NM_000833chr1631110 541 21 ------
NM_000840chr71370 ------
NM_000845chr71190 ------
NM_000859chr561598 1351 1297 1174 319 208 ------
NM_000868chrX32607 2138 708 12391 21044 130 --
NM_000875chr1586755 6285 4611 4541 2447 2349 1372 202 26399 5554 25816 1116 176
NM_000876chr62327 128 ------
NM_000880chr8174 ------
NM_000891chr1753220 3128 2612 1066 435 12718 --12734
NM_000895chr122107 101 ------
NM_000899chr1293427 3364 2966 2934 2781 1541 1496 1431 182 23693 1747 31172 566 378 22813 81
NM_000901chr482270 2207 2189 2022 1697 1603 1553 672 31576 385 356 11588 1317
NM_000944chr412060 ----1732
NM_000945chr252024 1577 674 352 267 21418 378 21368 469 --
NM_000950chrX93050 3009 2846 2270 2251 880 486 148 134 --12654 13503
NM_000958chr521163 137 11300 31062 992 322 --
NM_000961chr204703 240 221 72 12565 ----
NM_000962chr942821 2793 2702 2297 12599 137 --
NM_000963chr14347 246 223 211 12151 ----
NM_000965chr33863 135 91 ------
NM_000975chr1137 ------
NM_000989chr8--177 ----
NM_001001132chr213537 360 273 21444 584 1954 1331
NM_001001323chr1272987 2571 2535 2515 2447 962 455 --1588 --
NM_001001330chr1071248 1186 912 896 526 504 462 1812 ----
NM_001001331chr332302 923 474 11727 ----
NM_001001344chrX22476 441 --1377 --
NM_001001395chr121800 11751 21763 335 22635 659
NM_001001396chr174447 3287 3272 2926 2844 1188 1168 ----14415
NM_001001419chr5125162 4116 4042 3994 3961 2087 1785 1760 1016 870 579 383 146 31887 1090 516 --
NM_001001420chr5125162 4116 4042 3994 3961 2087 1785 1760 1016 870 579 383 146 31887 1090 516 --
NM_001001433chr2053011 2374 1291 1283 564 12074 --1673
NM_001001436chr161817 ------
NM_001001481chr872892 2203 1234 1048 780 382 279 11145 ----
NM_001001484chr1052169 2154 1665 1552 623 ------
NM_001001549chr752758 2453 2112 622 485 ------
NM_001001550chr752758 2453 2112 622 485 ------
NM_001001555chr752758 2453 2112 622 485 ------
NM_001001557chr832082 1822 332 1362 11650 1632
NM_001001664chr233576 3085 2669 13207 --33899 1350 179
NM_001001715chr132458 407 ------
NM_001001872chr142623 207 --1602 --
NM_001001928chr2298335 6619 6040 5388 2652 1514 1489 1266 300 38351 1275 167 25609 1405 --
NM_001001937chr18137 ------
NM_001001971chr10182 ------
NM_001001974chr1031900 763 703 11525 ----
NM_001001994chrX--1415 1117 --
NM_001001995chrX31696 678 545 --1758 --
NM_001001996chrX--1415 1117 --
NM_001002243chr2--1827 ----
NM_001002255chr61118 1364 ----
NM_001002257chr243528 1426 788 270 --21385 1105 13500
NM_001002295chr101438 ------
NM_001002759chr10----1525 1495
NM_001002762chr1042489 2418 2173 1852 --175 --
NM_001002800chr321046 125 ------
NM_001002838chrX21493 1266 1281 11503 --
NM_001002843chr1541284 1207 482 207 31247 1150 836 ----
NM_001002860chr1483898 3756 3289 3077 1665 1575 536 128 13283 13220 --
NM_001002909chr171131 ------
NM_001002919chr22452 145 ------
NM_001002926chr772429 2046 1971 705 475 138 25 ------
NM_001003396chr6129 1443 ----
NM_001003397chr6129 1443 ----
NM_001003652chr18178690 8444 8375 7563 7429 7120 6633 6545 6465 6305 6149 5899 3264 2312 2287 2100 1326 46939 6442 6143 3143 16073 --
NM_001003674chr18146656 6151 5924 5446 5340 5127 4835 2451 1653 1442 1270 817 623 374 3575 477 281 --11573
NM_001003675chr18146656 6151 5924 5446 5340 5127 4835 2451 1653 1442 1270 817 623 374 3575 477 281 --11573
NM_001003679chr172176 2123 1738 890 781 606 275 ----1422
NM_001003681chr2222046 2031 1103 --11655
NM_001003688chr431112 959 408 1991 ----
NM_001003712chr1263845 3670 3506 2673 628 233 --2913 434 13093
NM_001003760chr611291 22551 152 11232 --
NM_001003792chr32980 164 1459 2992 971 --
NM_001003793chr32980 164 1459 2992 971 --
NM_001003800chr952967 2532 1476 773 479 1896 3990 433 170 --
NM_001003810chr44715 633 245 206 1573 ----
NM_001004051chrX2241 62 ------
NM_001004065chr9104009 3938 3932 3443 3384 3081 3047 2714 2606 1523 --1717 --
NM_001004106chr52240 66 ------
NM_001004304chr1253269 3169 3047 2889 2164 ------
NM_001004317chr684447 4239 3830 2815 678 434 311 184 1751 13535 1414
NM_001004329chr1221174 132 11435 ----
NM_001004342chr145599 5270 5157 3983 14523 26070 2127 14417
NM_001004346chr4----1156 1188
NM_001004360chr281966 1924 1888 1828 1739 1687 773 250 11510 ----
NM_001004419chr1211604 34114 1638 859 ----
NM_001004441chr521473 363 --1641 --
NM_001004720chr211062 --1204 --
NM_001004722chr211231 --1373 --
NM_001005266chr153618 608 64 --138 --
NM_001005267chr153618 608 64 --138 --
NM_001005268chr153618 608 64 --138 --
NM_001005269chr153618 608 64 --138 --
NM_001005375chrY61597 1536 1369 418 150 57 --3612 522 232 --
NM_001005386chr231651 387 244 12190 2154 130 21608 496
NM_001005404chr17114529 3974 3888 3776 3763 3652 3300 1684 1087 238 192 23347 830 ----
NM_001005463chr1042560 2459 2289 2106 11658 1992 --
NM_001005473chr596220 4958 4674 4632 4041 1726 1182 1103 472 --24058 2317 24447 4307
NM_001005474chr331391 1279 278 21632 1375 11304 --
NM_001005732chr211556 ------
NM_001005733chr211513 ------
NM_001005743chr1451367 1152 1128 1100 862 21338 900 11161 --
NM_001005744chr1451367 1152 1128 1100 862 21338 900 11161 --
NM_001005745chr1451367 1152 1128 1100 862 21338 900 11161 --
NM_001005746chr231415 1375 1139 --1499 --
NM_001005747chr231415 1375 1139 --1499 --
NM_001005752chr11787 ------
NM_001005753chr232269 519 352 ------
NM_001005782chr21400 1717 ----
NM_001005849chr172558 115 ------
NM_001005861chr341015 304 139 74 ------
NM_001005862chr172481 454 ------
NM_001006600chr572387 2137 1589 885 762 478 388 ----21791 961
NM_001006610chr162850 285 ------
NM_001006612chrX1116 --1453 --
NM_001006613chrX1116 --1453 --
NM_001006614chrX1116 --1453 --
NM_001006617chr9--1220 --1564
NM_001006618chr91198 ------
NM_001006619chr9--1220 --1564
NM_001006620chr9--1220 --1564
NM_001006621chr9--1220 --1564
NM_001006626chr7------178
NM_001006627chr7------178
NM_001006628chr7------178
NM_001006629chr7------178
NM_001006630chr7------178
NM_001006631chr7------178
NM_001006632chr7------178
NM_001006636chr2--2810 642 ----
NM_001006656chr1951707 1356 537 521 333 ------
NM_001006684chrX2112 39 ------
NM_001007023chr1485056 4767 4757 4057 3883 3828 1958 1385 2320 32 11573 --
NM_001007024chr1774300 3730 3038 2917 2896 1618 290 --14400 --
NM_001007025chr1774300 3730 3038 2917 2896 1618 290 --14400 --
NM_001007067chr81205 --1319 --
NM_001007068chr81205 --1319 --
NM_001007069chr81205 --1319 --
NM_001007070chr81205 --1319 --
NM_001007075chr421025 811 ------
NM_001007097chr944558 1826 1152 973 25050 1474 14651 11525
NM_001007098chr13652 379 153 ----1680
NM_001007099chr14807 703 318 195 1866 ----
NM_001007100chr14807 703 318 195 1866 ----
NM_001007102chr631588 181 52 139 ----
NM_001007156chr1541746 1579 1488 333 21778 1388 1782 --
NM_001007214chr15774 713 620 404 205 --1733 --
NM_001007226chr1731376 1185 97 11400 --1392
NM_001007227chr1731376 1185 97 11400 --1392
NM_001007228chr1731376 1185 97 11400 --1392
NM_001007229chr1731376 1185 97 11400 --1392
NM_001007230chr1731376 1185 97 11400 --1392
NM_001007237chr142708 2435 2123 984 --12558 --
NM_001007245chr72454 79 ------
NM_001007246chr2131926 1668 251 --1784 --
NM_001007257chr11376 ------
NM_001007267chr21842 ----1657
NM_001007278chr1374331 4312 2076 2016 946 911 24 13640 23336 1993 --
NM_001007466chr684961 4518 3496 1872 1767 993 513 278 15003 ----
NM_001007468chr221299 ------
NM_001007471chr93127 96 67 ------
NM_001007553chr131197 1107 1057 1461 21235 258 1136
NM_001007559chr185795 703 667 176 105 1748 1321 --
NM_001007794chr1----1696 1724
NM_001008222chrX2358 165 ------
NM_001008239chr1833667 1449 345 --22692 1098 13192
NM_001008405chr741798 1585 283 127 --11302 31269 119 83
NM_001008408chr786041 5605 4947 4882 1445 1018 377 248 15335 15272 --
NM_001008495chr891915 1868 1535 847 745 477 427 264 121 --11390 1395
NM_001008539chr865360 5128 4678 1251 1055 312 25282 4136 1449 --
NM_001008540chr23444 136 96 ------
NM_001008541chr1011794 --31584 1525 397 --
NM_001008541chr1011794 --31584 1525 397 --
NM_001008564chr1341876 1847 874 109 12282 ----
NM_001008660chr1131501 1367 1171 ------
NM_001008701chr1952826 2152 1116 1016 358 ----13077
NM_001008726chr1451644 1580 1194 355 33 1264 21349 89 --
NM_001008738chr562669 2498 2371 448 391 169 --12268 --
NM_001008777chr173527 473 240 ------
NM_001008783chr62688 87 167 --1626
NM_001008801chr194799 631 548 194 ------
NM_001008860chr152739 306 ----1288
NM_001008892chr152739 306 ----1288
NM_001008894chr152739 306 ----1288
NM_001008925chr483222 901 741 729 718 633 427 235 1499 21338 493 --
NM_001008938chr112365 330 --134 --
NM_001009552chr82527 48 ------
NM_001009554chr443125 1571 1258 681 14755 --22876 441
NM_001009554chr443125 1571 1258 681 14755 --22876 441
NM_001009555chr421728 1312 1325 ----
NM_001009881chr11237 1451 ----
NM_001009882chr11237 1451 ----
NM_001009899chr364591 3973 1861 1823 813 119 --24772 4399 --
NM_001009993chr254565 3821 3775 945 552 13445 ----
NM_001010000chr1873497 3445 3263 2903 1282 924 189 11329 13338 12961
NM_001010853chr643240 2950 2882 2235 1523 12320 1982
NM_001010854chr142505 277 ------
NM_001010861chr132584 1072 869 ----12197
NM_001010867chr196565 5022 2465 2298 2173 1743 1592 924 440 11552 12388 --
NM_001010888chrX104532 4500 4345 3885 3476 3400 2899 719 377 99 ----11129
NM_001010891chr5116669 6470 5960 5924 2171 1064 989 916 437 423 389 --66498 4474 4296 2104 1305 729 11446
NM_001010895chr931760 279 43 21899 353 12080 --
NM_001010923chr641640 1352 1197 618 --11340 --
NM_001010927chr62391 384 ------
NM_001010942chr1221072 1049 21311 521 ----
NM_001010971chr15995 873 744 653 314 1279 ----
NM_001010986chrX52428 1977 1702 1638 224 ------
NM_001010989chr163509 452 100 133 1576 1226
NM_001010990chr163509 452 100 133 1576 1226
NM_001011513chr462765 2528 2508 1107 504 96 --33907 2791 238 1138
NM_001011537chr342294 2119 593 353 --1581 1711
NM_001011553chr7----197 --
NM_001011663chr101314 ----1917
NM_001011666chr7166440 5861 5413 4689 4407 4304 2552 1924 1171 1022 670 605 353 240 222 122 32558 1893 1752 22051 948 35812 4536 2383
NM_001011708chr252581 2503 1849 374 250 1142 1207 --
NM_001011713chr1451111 614 451 412 79 1196 21153 444 --
NM_001011724chr131131 1251 ----
NM_001011725chr131131 1251 ----
NM_001011885chr1521812 448 1561 ----
NM_001012393chr1153430 3361 1732 1393 1286 24961 3378 ----
NM_001012398chr161781 --1839 --
NM_001012410chr31344 --185 --
NM_001012419chr91867 1328 --11100
NM_001012420chr1542817 2372 622 185 22004 932 12804 --
NM_001012423chr1542817 2372 622 185 22004 932 12804 --
NM_001012456chr7122 ------
NM_001012614chr41269 ------
NM_001012732chr431205 1150 198 ------
NM_001012751chr1031931 634 121 2728 88 ----
NM_001012754chr1361957 1942 1860 1845 1488 757 --1179 --
NM_001012755chrX94903 4703 4697 4665 4310 4129 4097 3726 1817 --34925 3915 28 --
NM_001012761chr571987 1927 1065 816 741 443 234 3934 804 552 ----
NM_001012968chrX52768 2661 2492 2444 2150 --22625 1720 12469
NM_001012977chrX21365 1113 ------
NM_001012979chrX1242 189 ----
NM_001012989chrX1669 ------
NM_001013031chr1053177 3027 976 858 694 --1496 1146
NM_001013398chr741534 1484 1399 418 ------
NM_001013399chr63312 265 149 ------
NM_001013406chr731291 1183 50 --3645 576 481 --
NM_001013415chr441452 1289 1217 541 --21249 257 --
NM_001013438chr31755 1634 1807 --
NM_001013620chr12107375 7237 7099 6431 6396 6208 2526 1618 1527 129 28144 7384 17935 12370
NM_001013629chr1022120 220 --21653 204 --
NM_001013699chr122565 411 ------
NM_001013703chr151451 --1443 --
NM_001013746chr751992 580 496 416 164 ------
NM_001013843chr151194 126 ----
NM_001014380chr13115465 4939 4633 4540 4028 2167 1453 1371 1320 341 203 11359 35170 1796 596 14811
NM_001014434chr12269 24 1861 ----
NM_001014446chr4128 ------
NM_001014797chr1087317 7309 6828 5601 5136 1156 1073 768 --11109 15408
NM_001014809chr43874 862 270 --189 --
NM_001014812chr15--1136 ----
NM_001014831chr191166 --1801 --
NM_001014832chr191166 --1801 --
NM_001014834chr191166 --1801 --
NM_001014835chr191166 --1801 --
NM_001015053chr1721536 1400 ------
NM_001015508chr83575 560 207 ------
NM_001015877chrX83041 2933 1090 1047 1006 985 542 157 --12728 12340
NM_001015881chrX144 21122 433 ----
NM_001017368chr1752824 2746 2561 1063 450 22519 461 --1950
NM_001017369chr44956 733 300 222 --1995 1238
NM_001017371chr231243 1001 485 ------
NM_001017395chr3103479 3008 2544 2342 2292 2220 1101 528 194 86 --23288 1394 --
NM_001017440chr7138272 7640 7581 6873 6038 2781 2328 1677 1624 1545 1082 678 487 25182 218 1743 15385
NM_001017922chr11485 --1364 11732
NM_001017923chr142154 62 ------
NM_001017926chr851780 1603 1503 1439 1427 --21370 1183 --
NM_001017930chrX31322 1210 279 21456 1336 21474 977 --
NM_001017969chr93580 177 24 1145 ----
NM_001017977chr11113 1397 180 --
NM_001017995chr584558 1791 1750 907 744 713 464 46 1921 ----
NM_001017999chr122166 734 ------
NM_001017999chr122166 734 ------
NM_001018000chr122166 734 ------
NM_001018000chr122166 734 ------
NM_001018001chr122166 734 ------
NM_001018004chr15----1455 1682
NM_001018006chr15----1455 1682
NM_001018007chr15----1455 1682
NM_001018008chr153535 482 210 ------
NM_001018020chr15----1455 1682
NM_001018053chr141742 1628 1326 602 --11242 --
NM_001018054chr181448 1210 906 897 429 380 221 203 1998 ----
NM_001018057chr113397 266 68 1310 --11302
NM_001018064chr911927 21984 1367 ----
NM_001018065chr965349 4789 4696 1457 1365 566 11775 25223 3893 --
NM_001018066chr965349 4789 4696 1457 1365 566 11775 25223 3893 --
NM_001018067chr1135388 5252 5056 4673 4380 3324 1998 1875 1346 444 349 201 55 44809 433 411 151 33246 1115 846 21475 542
NM_001018068chr1135388 5252 5056 4673 4380 3324 1998 1875 1346 444 349 201 55 44809 433 411 151 33246 1115 846 21475 542
NM_001018069chr1135388 5252 5056 4673 4380 3324 1998 1875 1346 444 349 201 55 44809 433 411 151 33246 1115 846 21475 542
NM_001018074chr573721 3637 3318 2644 630 95 49 2523 129 ----
NM_001018075chr573721 3637 3318 2644 630 95 49 2523 129 ----
NM_001018076chr573721 3637 3318 2644 630 95 49 2523 129 ----
NM_001018077chr573721 3637 3318 2644 630 95 49 2523 129 ----
NM_001018111chr783764 3672 3661 3108 3062 1173 1122 550 13011 12892 --
NM_001018113chrX1128 ------
NM_001018115chr31602 ------
NM_001020658chr141362 1212 425 237 ----1369
NM_001020658chr141362 1212 425 237 ----1369
NM_001020825chr531196 1112 119 ------
NM_001023560chr63683 401 311 --1167 --
NM_001023567chr1532209 1735 625 1940 12196 --
NM_001024024chr141873 1104 ----
NM_001024070chr141869 1100 ----
NM_001024071chr141841 2398 72 ----
NM_001024094chr573721 3637 3318 2644 630 95 49 2523 129 ----
NM_001024218chr143280 246 83 ----126
NM_001024226chr171139 932 351 234 183 162 42 ------
NM_001024227chr171139 932 351 234 183 162 42 ------
NM_001024228chr171139 932 351 234 183 162 42 ------
NM_001024372chr862075 1987 1822 1780 900 594 --12008 --
NM_001024455chrX32688 2528 2519 --1383 --
NM_001024463chr1511091 --1309 --
NM_001024647chr12136838 6813 6712 5755 5456 2757 2643 2630 1018 967 911 665 446 17485 --15500
NM_001024649chr552706 2103 909 702 408 --1994 11937
NM_001024660chr351427 630 508 365 194 ------
NM_001024688chr851542 753 664 193 113 11675 --11825
NM_001024847chr351623 1609 985 416 312 --22338 1580 11769
NM_001024934chr62508 182 ------
NM_001024935chr62508 182 ------
NM_001024936chr62508 182 ------
NM_001024947chr5----11057 1209
NM_001024948chr142401 2232 1235 231 32842 2261 1148 12413 13076
NM_001024956chr1195768 5654 5122 4783 4733 3848 1668 1559 1221 14772 14716 --
NM_001025076chr10116226 5577 5461 4235 3910 3817 1424 966 548 521 38 ----24562 1723
NM_001025077chr10207584 6935 6819 5593 5268 5175 4773 4711 4634 2782 2324 1906 1879 1321 1045 1006 667 657 569 38 ----15920
NM_001025079chr3104154 3814 3738 3486 3435 2816 2690 2638 238 164 --23306 454 44187 4174 3885 3452
NM_001025201chr23708 51 32 ------
NM_001025233chr1242358 2263 278 233 --11793 1837
NM_001025252chr853152 2924 1280 601 312 --1114 --
NM_001025253chr853152 2924 1280 601 312 --1114 --
NM_001025266chr394374 4306 4273 4013 3700 3354 1772 199 44 14713 11017 24817 4299
NM_001025366chr631815 1220 658 --1315 --
NM_001025366chr631815 1220 658 --1315 --
NM_001025367chr631815 1220 658 --1315 --
NM_001025367chr631815 1220 658 --1315 --
NM_001025368chr631815 1220 658 --1315 --
NM_001025368chr631815 1220 658 --1315 --
NM_001025369chr631831 1236 674 --1331 --
NM_001025369chr631831 1236 674 --1331 --
NM_001025370chr631815 1220 658 --1315 --
NM_001025370chr631815 1220 658 --1315 --
NM_001025389chr1131573 654 533 --11167 --
NM_001025390chr1131573 654 533 --11167 --
NM_001025579chr1741077 1069 1012 448 ------
NM_001025580chrX104280 4190 3922 3053 2995 2626 460 428 285 199 --11227 --
NM_001025595chr441480 1330 1228 644 21257 180 --1130
NM_001025596chr111463 ----1487
NM_001025603chr11196 1310 ----
NM_001025616chr431325 640 233 --1569 --
NM_001025777chr251203 1091 301 64 45 ------
NM_001025780chr911589 1156 --11507
NM_001029835chr71327 ------
NM_001029858chr653411 2771 2391 2203 771 ------
NM_001029860chr82340 269 ------
NM_001029863chr662528 2366 2210 836 385 141 --11975 --
NM_001029875chr532417 1083 933 12963 11103 --
NM_001029882chr13557 451 47 --1278 --
NM_001029882chr13557 451 47 --1278 --
NM_001030001chr141441 ------
NM_001030002chr172355 132 ------
NM_001030006chr173525 410 285 --1171 --
NM_001030007chr1673656 3556 3315 2847 2465 1352 697 --23412 2890 --
NM_001030055chr1444376 4046 2989 1149 14465 11821 34702 4577 1758
NM_001030272chr112314 99 --160 --
NM_001030273chr112314 99 --160 --
NM_001031623chr631567 1113 428 21671 588 ----
NM_001031679chr1242846 2582 296 109 23391 469 43465 487 223 204 --
NM_001031684chr221195 1182 ----11471
NM_001031695chr22105382 5320 5234 5177 4878 3947 3336 2142 1147 674 34578 3731 3700 --13555
NM_001031700chr462405 2379 2286 2047 1621 296 22064 1563 21694 704 --
NM_001031710chr74932 695 83 57 ------
NM_001031712chr61165 1101 ----
NM_001031716chr22335 28 --21032 301 1997
NM_001031748chr122556 233 1613 1216 --
NM_001031801chr221162 ------
NM_001031803chr172307 231 1270 ----
NM_001031804chr1684163 1490 1431 1406 1089 822 625 494 33086 1182 241 ----
NM_001031812chr532369 232 212 11830 11972 1206
NM_001032280chr621372 598 --11725 --
NM_001032282chr82947 233 ----11259
NM_001032283chr123933 819 253 ------
NM_001032284chr123933 819 253 ------
NM_001032288chr2021123 1068 ----11113
NM_001032289chrX186 ------
NM_001032296chr1352357 2048 1995 1907 618 2786 376 12739 1818
NM_001032363chr11390 21988 120 ----
NM_001032363chr11390 21988 120 ----
NM_001032380chr1051801 1487 1281 1243 317 ------
NM_001032393chrX3700 570 202 ------
NM_001032394chr662147 2077 1839 1129 1067 269 12671 12662 1133
NM_001032395chr662014 1944 1706 996 934 136 12538 12529 --
NM_001032999chr2065246 5089 4449 4207 1214 242 ------
NM_001033030chr31258 2213 104 ----
NM_001033031chr31258 2213 104 ----
NM_001033032chr31258 2213 104 ----
NM_001033057chr322121 452 11723 51965 1759 797 620 486 --
NM_001033059chr651986 1687 1403 543 372 ------
NM_001033081chr111693 11210 1384 --
NM_001033082chr111693 11210 1384 --
NM_001033087chr2052916 2689 2297 997 914 22923 2342 12334 --
NM_001033112chr53784 731 121 ------
NM_001033503chr53463 378 199 ------
NM_001033507chr131415 115 71 ----1633
NM_001033557chr21248 152 41356 1251 1119 113 --
NM_001033561chr171879 ------
NM_001033578chr822233 404 --11598 --
NM_001033602chr1371882 1028 824 768 450 310 215 --12189 1699
NM_001033659chr1711474 --1356 1365
NM_001033723chr881910 1122 1115 1020 561 362 237 79 ------
NM_001033756chr641749 1154 733 592 --1249 --
NM_001033756chr641749 1154 733 592 --1249 --
NM_001033910chr142105 1717 589 264 ------
NM_001033925chr104578 523 185 144 --21847 1682 11695
NM_001034194chr41124 1144 ----
NM_001034841chr16135538 4982 4835 4409 4397 3779 1961 1858 981 975 957 417 299 11044 23648 135 12113
NM_001034850chr541420 1141 345 125 ----1103
NM_001034852chr1442081 1382 459 251 11282 ----
NM_001034915chr811532 ----1347
NM_001034954chr1072963 2821 2253 2109 1985 852 791 ------
NM_001034955chr1072963 2821 2253 2109 1985 852 791 ------
NM_001034956chr1072963 2821 2253 2109 1985 852 791 ------
NM_001034957chr1072963 2821 2253 2109 1985 852 791 ------
NM_001035chr121060 1021 ------
NM_001035003chr42307 164 1133 3564 274 127 --
NM_001035004chr42307 164 1133 3564 274 127 --
NM_001035260chr1011387 11150 ----
NM_001035267chr121291 ------
NM_001035511chr14816 299 205 77 31387 1348 184 1500 --
NM_001035512chr14923 406 312 184 31494 1455 291 1607 --
NM_001035513chr14923 406 312 184 31494 1455 291 1607 --
NM_001037132chr711513 12129 11780 --
NM_001037133chr711513 12129 11780 --
NM_001037164chr762014 1678 1475 1427 655 388 --1118 --
NM_001037165chr7178918 8330 8127 7646 7524 7335 7308 6822 6578 6224 6051 3333 3218 3196 2742 1401 574 38822 8506 8347 ----
NM_001037172chr321250 70 --1996 1885
NM_001037174chr261755 1726 1670 1663 1473 193 11911 1315 --
NM_001037317chr132584 1072 869 ----12197
NM_001037331chr182719 179 ------
NM_001037332chr511010 12333 --32343 1707 820
NM_001037333chr511010 12333 --32343 1707 820
NM_001037334chr183769 669 558 11592 175 --
NM_001037339chr161418 1346 1298 1250 1181 484 ------
NM_001037340chr161418 1346 1298 1250 1181 484 ------
NM_001037341chr161418 1346 1298 1250 1181 484 ------
NM_001037341chr161418 1346 1298 1250 1181 484 ------
NM_001037535chrX51552 1545 1176 970 548 ----1613
NM_001037536chrX51552 1545 1176 970 548 ----1613
NM_001037540chrX51552 1545 1176 970 548 ----1613
NM_001037553chr2144473 3288 1493 1375 15049 24490 3807 --
NM_001037637chr5----1267 --
NM_001037954chr1153404 2139 1406 715 455 13072 --13472
NM_001038493chr221523 1398 11183 31496 1204 485 --
NM_001038640chr151692 11007 ----
NM_001038707chr141827 1602 807 418 11650 11805 --
NM_001038707chr141827 1602 807 418 11650 11805 --
NM_001039199chr2063809 3388 3315 3041 1127 678 14908 13969 --
NM_001039348chr231055 421 410 ----1851
NM_001039349chr231055 421 410 ----1851
NM_001039350chr731507 465 150 21582 621 ----
NM_001039459chr741108 1018 999 988 ------
NM_001039538chr2103357 3211 2723 2624 2468 2300 1453 1011 475 214 ----12259
NM_001039547chr387776 6595 5998 5019 2994 2806 1734 1697 --17039 14992
NM_001039570chr2244489 4059 1144 1110 --3735 569 375 1727
NM_001039571chr2244489 4059 1144 1110 --3735 569 375 1727
NM_001039577chr1114193 4009 3892 1682 1591 1549 1464 1330 987 186 33 21051 1042 1396 --
NM_001039580chr464798 4280 3325 3083 856 558 54034 3294 1593 1392 587 24194 1679 --
NM_001039590chrX73718 3631 3566 3421 3055 1415 749 12593 ----
NM_001039591chrX73718 3631 3566 3421 3055 1415 749 12593 ----
NM_001039616chr19153 ------
NM_001039618chr11175766 5108 4917 4659 4238 4118 4034 3973 3898 2358 2291 1926 1553 1413 901 801 332 25592 4056 ----
NM_001039693chr273683 3448 2774 1621 942 697 516 ------
NM_001039709chr2065246 5089 4449 4207 1214 242 ------
NM_001039762chr1032010 1583 772 21963 1711 ----
NM_001039840chrX115349 5337 4958 4291 3774 2431 714 511 438 424 414 35617 4811 4682 25826 1352 --
NM_001039937chr1353313 2635 1371 1040 715 13906 11576 --
NM_001040001chr631918 1427 255 ------
NM_001040057chr72972 484 11177 ----
NM_001040100chr331267 1046 201 2996 911 ----
NM_001040101chr421224 140 ------
NM_001040102chr1052220 1925 1717 635 202 12370 ----
NM_001040103chr1052220 1925 1717 635 202 12370 ----
NM_001040110chr731585 496 110 ------
NM_001040135chr73735 706 538 ------
NM_001040142chr232005 1532 750 1368 ----
NM_001040143chr232005 1532 750 1368 ----
NM_001040147chr182701 619 ------
NM_001040152chr764534 4005 3887 3776 3339 1464 11932 ----
NM_001040153chr134836 320 307 245 1112 ----
NM_001040158chr53374 136 111 ------
NM_001040159chr42273 250 2435 186 ----
NM_001040202chr472376 1591 835 584 175 124 91 32421 2346 1577 12323 1602
NM_001040214chr642259 2064 1533 753 12048 ----
NM_001040260chr431084 1023 789 ------
NM_001040261chr431084 1023 789 ------
NM_001040284chr1675960 4309 2310 2127 1929 1621 313 11875 --21402 1157
NM_001040402chr453187 1042 947 194 44 1565 12058 12848
NM_001040409chr22744 687 ------
NM_001040429chr1362921 2841 1384 1185 897 121 43018 2221 816 115 ----
NM_001040441chr114835 15466 13631 --
NM_001040446chr552593 2221 2183 1000 917 --2895 440 12618
NM_001040450chr1522611 830 12558 1552 1609
NM_001040453chr1522611 830 12558 1552 1609
NM_001040458chr541790 1184 526 159 11738 ----
NM_001040619chr121398 1051 11447 ----
NM_001040633chr71269 1758 ----
NM_001040665chr754736 4092 3063 355 147 11128 14282 --
NM_001040708chr831015 967 203 ------
NM_001040709chr132308 1833 1698 ----1124
NM_001040712chr963491 3334 2775 1001 781 505 23202 416 --12732
NM_001040876chr41267 ------
NM_001042355chr1685226 5034 4535 1461 1344 752 546 442 14865 33638 3520 1376 23454 263
NM_001042388chr182361 86 ------
NM_001042404chr12746 248 41677 1645 1415 731 ----
NM_001042412chr1685226 5034 4535 1461 1344 752 546 442 14865 33638 3520 1376 23454 263
NM_001042413chr984134 3991 3892 3668 3087 774 683 589 --24109 168 13974
NM_001042414chr132117 88 ------
NM_001042424chr483286 2870 2381 2144 1295 826 644 366 22224 337 12483 --
NM_001042425chr621372 598 --11725 --
NM_001042453chrX51749 1342 1218 402 374 ------
NM_001042473chr1022107 631 21583 823 ----
NM_001042481chr1442165 1964 820 259 --12538 --
NM_001042486chr2041180 510 158 74 --1179 --
NM_001042492chr1742892 2877 2390 111 ------
NM_001042498chrX1223 ------
NM_001042510chr861753 1728 1703 1639 1369 336 11653 ----
NM_001042511chr861753 1728 1703 1639 1369 336 11653 ----
NM_001042517chr132904 282 1207 --1107
NM_001042537chrX51697 942 927 222 189 --1265 11617
NM_001042543chr431330 1025 618 --31378 281 143 11070
NM_001042555chr12124730 4340 4243 3732 1762 931 851 775 601 483 335 41 23170 396 11643 --
NM_001042599chr297769 7685 7126 6184 5918 4984 2969 2888 103 27273 706 15394 16025
NM_001042601chr373174 2892 2798 1270 852 804 102 ------
NM_001042604chr3104234 3739 3485 3118 1838 1195 854 604 598 534 44715 4401 3199 523 33964 3719 1041 14306
NM_001042632chr2052234 2208 2049 1939 192 --1838 --
NM_001042633chr2052234 2208 2049 1939 192 --1838 --
NM_001042669chr431325 640 233 --1569 --
NM_001042683chr651745 1456 1273 749 398 11529 1359 21176 77
NM_001042749chrX71789 1643 1469 1462 259 215 158 1526 11764 --
NM_001042750chrX71789 1643 1469 1462 259 215 158 1526 11764 --
NM_001042751chrX71789 1643 1469 1462 259 215 158 1526 11764 --
NM_001043318chr1463795 3241 1245 1136 301 156 14172 ----
NM_001043351chr132244 907 596 11943 11731 21967 605
NM_001044305chr621606 279 --1212 --
NM_001044722chr532369 232 212 11830 11972 1206
NM_001044723chr532369 232 212 11830 11972 1206
NM_001046chr553003 2462 2315 250 182 12977 12588 --
NM_001049chr1462294 2031 1596 812 743 228 --1207 --
NM_001071775chr1341442 1303 598 236 --2780 147 1290
NM_001076chr4--172 ----
NM_001076chr4--172 ----
NM_001077628chr11602 1456 ----
NM_001078chr11506 ------
NM_001079874chr121583 372 1636 ----
NM_001083620chr462585 1959 855 664 586 517 ----11894
NM_001083621chr174748 4732 4536 1764 1477 1382 1050 ------
NM_001099678chr366180 6118 4567 2392 258 246 14051 16158 --
NM_001100108chr187339 7138 3080 3054 2908 2261 1977 1666 18360 27923 1550 --
NM_001106chr3199703 9157 8807 8746 8637 8427 8145 7254 6731 6258 5988 2710 2655 2516 2265 1716 1547 534 197 27462 3148 49773 8865 6990 6055 28295 2475
NM_001109977chr43856 234 46 ------
NM_001113490chrX42904 2605 631 535 11005 --11392
NM_001117chr1812186 --12059 --
NM_001121chr1021824 142 41593 603 455 198 --31178 521 222
NM_001122631chr11------1230
NM_001122679chr521236 110 ------
NM_001126chr13394 323 190 --1358 --
NM_001128chr1673656 3556 3315 2847 2465 1352 697 --23412 2890 --
NM_001144chr1621258 896 --21172 1108 --
NM_001146chr842180 2029 1614 704 1249 ----
NM_001148chr41312 --1704 --
NM_001149chr1041068 1010 484 32 11274 ----
NM_001159chr22716 512 ----1534
NM_001160chr1241724 1045 606 163 22361 485 ----
NM_001166chr112130 96 1418 --1316
NM_001167chrX146489 4600 4579 2455 2323 2213 1388 1336 1086 1055 813 495 365 141 26513 2444 1971 12180
NM_001173chr1444376 4046 2989 1149 14465 11821 34702 4577 1758
NM_001174chrX12143 --42048 1834 1556 203 --
NM_001177chr1222142 513 ------
NM_001178chr112314 99 --160 --
NM_001186chr2162979 2436 2374 1272 552 47 42076 2055 581 251 ----
NM_001191chr2031205 366 159 ------
NM_001197chr221151 ------
NM_001198chr662446 2340 2294 2063 976 789 1938 ----
NM_001201chr473820 3621 3358 2573 1100 825 623 --33919 2621 2454 --
NM_001204chr2157635 7183 7069 6292 6245 5193 4725 2450 1984 1361 539 442 420 205 87 37664 2363 136 25685 2648 16225
NM_001206chr952716 2283 1115 1097 761 42840 2473 2326 840 23032 2764 12042
NM_001207chr5----1267 --
NM_001219chr7----12251 --
NM_001237chr44946 913 824 63 2155 78 --1785
NM_001237chr44946 913 824 63 2155 78 --1785
NM_001253chr61253 ------
NM_001254chr172964 74 ------
NM_001256chr1722178 312 22900 640 11873 --
NM_001257chr1611264 11342 1335 11043
NM_001263chr43402 111 65 1320 ----
NM_001265chr133969 861 219 ------
NM_001268chr13121 ------
NM_001269chr13902 770 311 --1975 --
NM_001270chr511034 ----1887
NM_001278chr1031200 388 177 1248 ----
NM_001280chr194697 687 445 274 ------
NM_001282chr173525 410 285 --1171 --
NM_001290chr411062 1293 ----
NM_001293chr111399 ------
NM_001304chr17143761 3600 3584 3220 3129 2780 2715 2628 2459 1183 577 490 341 161 33091 1398 361 22972 110 1425
NM_001310chr1262772 2649 2095 1949 386 327 2624 176 12619 12929
NM_001313chr43874 862 270 --189 --
NM_001319chr1931104 1036 1029 ------
NM_001326chr112306 81 --1318 --
NM_001328chr41269 ------
NM_001330chr16----1957 --
NM_001331chr1162194 2128 2110 1934 1061 296 ------
NM_001338chr2141235 970 496 253 1292 --11216
NM_001343chr521487 1295 1211 --1113
NM_001351chr341857 1571 1510 1343 --3514 424 144 --
NM_001356chrX21954 516 --32399 2301 1786 --
NM_001358chr41115 ----142
NM_001363chrX3714 624 518 1187 ----
NM_001364chr11134763 4458 4194 3772 1241 1222 1079 1039 763 541 265 218 79 1354 1640 --
NM_001379chr192277 215 ------
NM_001380chr10--2790 718 ----
NM_001386chr842134 1708 790 429 ------
NM_001387chr552920 2716 1085 1070 182 --1168 --
NM_001389chr21----1238 --
NM_001396chr2132451 2441 2366 11074 ----
NM_001401chr9----11052 --
NM_001402chr62357 210 1486 1775 22060 198
NM_001406chr1721596 543 --21731 1530 --
NM_001408chr151467 1314 1151 258 80 ------
NM_001412chrX42901 2301 1200 876 1618 22858 1176 --
NM_001415chrX51817 1790 802 671 301 ----11625
NM_001418chr112590 499 ------
NM_001418chr112590 499 ------
NM_001419chr19114619 4579 4458 4391 4345 4189 4094 2987 1532 1379 467 24172 309 24674 386 24522 1066
NM_001420chr1912242 12503 --12117
NM_001422chr111378 11328 ----
NM_001427chr721959 206 --11792 --
NM_001429chr221329 ------
NM_001430chr241676 709 639 209 --21861 377 --
NM_001431chr64917 494 440 218 --1993 --
NM_001432chr453443 3368 1166 888 150 --12791 23809 1025
NM_001438chr163065 3039 2957 2862 2264 150 22368 965 31066 908 409 --
NM_001448chrX51552 1116 442 168 114 21124 702 ----
NM_001451chr1631129 263 135 ------
NM_001453chr621235 260 1486 ----
NM_001454chr171993 ------
NM_001458chr71668 ----1458
NM_001463chr22797 227 ------
NM_001465chr592006 1966 1794 1780 1342 865 821 567 249 11520 11806 --
NM_001482chr151785 2103 77 ----
NM_001483chr72758 380 1103 ----
NM_001491chr662527 2278 1094 881 458 331 1611 1914 --
NM_001494chr102292 229 1581 ----
NM_001495chr82891 168 ------
NM_001498chr661405 1023 896 880 301 144 --11083 --
NM_001514chr12430 394 ------
NM_001530chr142436 217 ------
NM_001539chr9--2126 105 ----
NM_001541chr111166 ------
NM_001542chr142708 2435 2123 984 --12558 --
NM_001543chr564597 4507 4432 3596 3185 865 ------
NM_001546chr631080 949 933 1581 1396 --
NM_001550chr72454 79 ------
NM_001554chr12548 529 1515 ----
NM_001560chrX42546 2457 328 186 1879 ----
NM_001567chr111273 --1746 --
NM_001584chr111282 2362 323 11127 --
NM_001587chrX----11899 --
NM_001604chr1141011 759 661 80 --2405 385 1907
NM_001609chr1043682 2872 987 459 24443 815 11287 13714
NM_001616chr273350 2758 2702 2656 1086 1009 753 21272 842 ----
NM_001619chr11184 ------
NM_001627chr32957 212 --21721 347 --
NM_001634chr651986 1687 1403 543 372 ------
NM_001635chr74746 675 294 237 ------
NM_001642chr113475 430 262 ----11064
NM_001650chr1873608 2811 2803 2545 1334 1012 869 14160 1856 --
NM_001655chr1142015 1645 724 74 ------
NM_001656chr552010 1883 603 270 29 2161 65 11379 --
NM_001658chr171139 932 351 234 183 162 42 ------
NM_001660chr31767 2326 189 ----
NM_001663chr1432639 1789 220 ------
NM_001668chr161960 1800 1733 1399 453 209 --11863 --
NM_001677chr14802 382 133 123 1878 ----
NM_001682chr1272701 2285 2249 2229 2161 676 169 --1302 --
NM_001683chr332302 923 474 11727 ----
NM_001684chr174164 3004 2989 2643 2561 905 885 ----14132
NM_001690chr321874 482 11953 --1110
NM_001693chr821025 373 1163 11018 --
NM_001704chr63551 527 414 1460 ----
NM_001706chr32852 795 ------
NM_001709chr112515 451 32881 896 310 ----
NM_001713chr531094 905 176 ------
NM_001717chr1541376 992 133 35 21387 343 ----
NM_001718chr611099 --1313 --
NM_001719chr203176 165 37 ------
NM_001726chr11139 ------
NM_001730chr1351371 1331 591 421 224 --1572 --
NM_001730chr1351371 1331 591 421 224 --1572 --
NM_001731chr122689 57 1608 ----
NM_001746chr552706 2103 909 702 408 --1994 11937
NM_001753chr751699 1398 715 264 146 --21595 1228 --
NM_001755chr1641962 1858 867 273 12122 --1829
NM_001759chr1254524 3354 3272 645 84 15009 --14330
NM_001777chr3104154 3814 3738 3486 3435 2816 2690 2638 238 164 --23306 454 44187 4174 3885 3452
NM_001788chr7----197 --
NM_001789chr32564 539 11235 ----
NM_001792chr1851077 963 719 276 121 2292 83 11108 --
NM_001796chr16192 ------
NM_001797chr16--1769 1120 --
NM_001801chr52235 26 ------
NM_001806chr1982905 2713 2437 2259 2147 1172 747 567 41097 529 372 194 ----
NM_001822chr23708 51 32 ------
NM_001830chrX53408 3175 2502 446 118 23735 3220 --1198
NM_001845chr1321311 202 1942 11391 --
NM_001854chr121337 80 11193 --1178
NM_001855chr93574 99 29 ------
NM_001858chr674468 3322 1924 749 614 586 220 45109 4248 4039 1815 35078 4060 250 13137
NM_001859chr953921 3087 2606 817 318 23969 1325 11191 --
NM_001880chr2--1311 127 --
NM_001881chr102402 343 ------
NM_001884chr5------128
NM_001893chr172373 66 ------
NM_001894chr2231131 843 445 --11235 --
NM_001895chr2031259 987 847 ------
NM_001896chr16--1458 ----
NM_001904chr31245 1285 --126
NM_001918chr1119324 8832 8195 7508 7335 6887 6753 6637 1734 1395 965 36125 2343 1419 37165 946 901 28817 2949
NM_001920chr123306 214 110 ------
NM_001921chr431205 1150 198 ------
NM_001923chr11143 --1658 --
NM_001924chr1145 --1458 --
NM_001931chr11--11314 1461 --
NM_001935chr22293 227 ------
NM_001936chr731507 465 150 21582 621 ----
NM_001938chr121949 1715 11586 31505 1465 664 11229
NM_001942chr18------12075
NM_001949chr663151 2878 2758 2654 2085 226 --43086 2139 2016 990 --
NM_001951chr82507 189 ------
NM_001954chr61854 ------
NM_001977chr411703 --2536 338 11346
NM_001981chr122308 262 ----12149
NM_001987chr1263864 3571 2630 1706 1455 756 1335 11240 --
NM_001992chr522090 749 ------
NM_001995chr411463 21440 307 ----
NM_001999chr531392 1188 313 11068 ----
NM_002006chr4124788 3711 3643 3617 3558 1431 1262 1031 955 696 285 269 11797 1456 34363 4349 3666
NM_002009chr1552690 1996 1945 854 801 1167 12736 --
NM_002011chr51428 ------
NM_002014chr122134 69 ------
NM_002015chr1362979 2542 2475 2088 330 103 12733 21308 658 --
NM_002017chr1131178 506 48 --1937 --
NM_002024chrX1345 11617 1256 --
NM_002025chrX189147 9104 9071 8847 8347 8169 7906 7746 6964 6433 5944 5794 5749 2954 2575 1045 264 193 21332 295 48451 3144 1908 709 --
NM_002026chr2--2908 672 1893 --
NM_002037chr6162 1447 ----
NM_002040chr2172569 2418 2357 2326 1951 421 409 33117 2895 2545 --1991
NM_002051chr101438 ------
NM_002052chr8--11392 ----
NM_002054chr22441 112 --1178 --
NM_002061chr121577 702 ----2681 148
NM_002063chrX1849 31170 1062 378 ----
NM_002069chr73601 362 306 1328 1433 21354 424
NM_002076chr1211124 21038 121 33125 2961 2049 --
NM_002077chr931913 497 470 ----11945
NM_002082chr52203 29 ------
NM_002086chr1752164 2119 1587 395 216 ------
NM_002089chr41179 ----1549
NM_002090chr41101 --1663 --
NM_002092chr494700 4459 4032 3926 3173 1819 738 613 273 23323 1032 24962 1712 1519
NM_002104chr51182 ------
NM_002107chr11175 ------
NM_002126chr1741078 563 437 25 21665 1545 1350 --
NM_002128chr1362381 2030 1626 649 595 311 --11740 --
NM_002130chr521195 1077 --11723 --
NM_002136chr121131 1251 ----
NM_002137chr731754 388 265 12157 ----
NM_002138chr44715 633 245 206 1573 ----
NM_002140chr94469 350 198 52 --1886 --
NM_002145chr171310 ------
NM_002154chr51110 2409 384 --145
NM_002158chr263844 3745 3210 2749 1259 750 11212 31009 766 81 33283 2678 682
NM_002165chr202363 321 ------
NM_002166chr22659 507 1681 ----
NM_002182chr31407 22697 2488 12807 12110
NM_002193chr21523 ----11602
NM_002196chr202890 328 ----1931
NM_002196chr202890 328 ----1931
NM_002199chr43962 780 42 1654 ----
NM_002202chr5--1147 ----
NM_002210chr263364 953 839 599 248 98 1383 11347 12351
NM_002211chr102147 94 21094 456 3924 385 72 11110
NM_002214chr775590 5237 3519 1989 1562 1152 863 25736 5473 1583 1785
NM_002222chr331296 1134 1059 --1126 --
NM_002223chr1241442 1086 606 346 --1456 --
NM_002232chr131388 1261 76 ------
NM_002239chr21392 --1261 --
NM_002240chr21190 --1424 --
NM_002247chr1051761 1521 1501 560 398 --11616 --
NM_002264chr394876 4207 3865 3436 1969 1702 962 516 253 14738 ----
NM_002267chr1362321 2257 1763 1654 962 216 32165 1727 987 11549 --
NM_002268chr321526 1390 ------
NM_002270chr5125574 4928 4910 4599 3813 3742 3490 2189 1594 489 475 450 25539 208 65323 5274 5201 4583 4285 3778 15390
NM_002271chr1352160 2149 1641 824 572 --11503 1335
NM_002293chr162212 2145 1818 1089 875 197 12752 11970 --
NM_002296chr161618 1547 1520 625 413 368 11360 11201 11769
NM_002310chr566016 5658 5625 4552 2392 733 --21672 849 --
NM_002332chr121480 1725 ----
NM_002334chr1112107 12012 1563 --
NM_002335chr11------149
NM_002336chr1274897 4090 3587 3350 1905 538 360 44986 3208 1712 952 23608 253 14831
NM_002351chrX31710 701 325 11353 11760 1185
NM_002355chr122354 253 11390 ----
NM_002356chr632697 2654 735 --12880 32722 1833 1104
NM_002358chr43632 504 83 ----1648
NM_002359chr1753783 3282 2987 2962 979 --22741 1629 13695
NM_002374chr2103357 3211 2723 2624 2468 2300 1453 1011 475 214 ----12259
NM_002375chr331825 375 302 ----12303
NM_002397chr552249 1605 881 744 23 ------
NM_002398chr2--11093 ----
NM_002401chr173806 722 698 ------
NM_002403chr11411 ------
NM_002408chr142788 742 2207 99 ----
NM_002430chr2251706 1615 474 208 125 ----22227 2184
NM_002436chrX197 169 ----
NM_002442chr1231757 1651 353 ----11770
NM_002449chr511285 ------
NM_002473chr221348 ------
NM_002480chr1271358 1339 1096 1046 544 469 445 ------
NM_002481chr1167901 7879 7812 7548 6730 6369 5779 5670 5362 5194 2879 2852 1500 1416 1377 382 28004 5308 45846 2541 1833 207 34815 617 219
NM_002482chr12659 173 1120 ----
NM_002485chr851542 753 664 193 113 11675 --11825
NM_002489chr72302 29 ------
NM_002499chr1522444 647 1977 ----
NM_002501chr1922577 1194 12823 ----
NM_002505chr631300 464 129 ------
NM_002515chr1451977 1807 329 164 88 130 --1489
NM_002518chr231192 852 101 1491 --137
NM_002519chr111544 --1958 1256
NM_002520chr5--1209 ----
NM_002523chr71779 1905 ----
NM_002527chr121293 ------
NM_002538chr52492 121 2215 132 ----
NM_002539chr2185 ------
NM_002542chr31204 ------
NM_002543chr1231533 1318 1201 --31340 1139 43 --
NM_002544chr17--1257 ----
NM_002545chr1153430 3361 1732 1393 1286 24961 3378 ----
NM_002546chr83803 773 83 ------
NM_002547chrX93441 3162 3077 1641 1366 1337 1283 1169 329 --23818 3306 --
NM_002556chr1152115 1975 1930 1742 746 ------
NM_002568chr8--2425 365 ----
NM_002569chr15--11548 ----
NM_002577chr383930 3885 3553 1344 1062 864 422 375 --1660 --
NM_002581chr954369 4039 3991 3950 3467 11257 --15507
NM_002583chr121567 1174 ----
NM_002586chr6----1993 11623
NM_002588chr521761 568 --11738 --
NM_002591chr202532 511 --1644 --
NM_002594chr2032210 883 306 11655 1980 --
NM_002595chr1251942 1699 1545 426 384 1207 1489 --
NM_002600chr161418 1346 1298 1250 1181 484 ------
NM_002607chr751177 903 879 442 103 ------
NM_002609chr551860 1467 746 264 128 ------
NM_002610chr2102684 2453 2392 2203 2181 812 793 311 240 37 22470 2340 --12170
NM_002612chr741791 1683 838 278 11485 12009 --
NM_002613chr16125350 5259 3993 3904 3688 1876 1303 1257 1193 613 339 221 12066 1497 --
NM_002624chr12--177 ----
NM_002628chr31895 ------
NM_002645chr1122040 694 1225 122 --
NM_002648chr621248 966 ------
NM_002655chr8135333 4907 4717 4675 4157 3861 3754 3489 3380 3267 2030 1486 154 --21974 168 11308
NM_002656chr641077 972 949 193 144 --11021
NM_002657chr2073879 3788 3679 1394 921 92 28 --12725 --
NM_002667chr61201 ----1315
NM_002687chr1451261 1122 1005 521 449 1949 11175 --
NM_002698chr1912509 11059 --12138
NM_002703chr451683 1676 780 633 129 21848 301 ----
NM_002706chr2----3639 534 111 --
NM_002707chr2165 ------
NM_002709chr293612 3562 3227 3198 2843 1428 833 688 354 22599 598 21223 480 13333
NM_002713chr131035 1024 774 --1980 --
NM_002715chr51456 11017 1355 --
NM_002717chr81626 ------
NM_002719chr1452384 2337 2058 1665 103 1394 --1768
NM_002721chr92384 184 ----1400
NM_002729chr101752 1349 --1340
NM_002731chr122092 822 12686 12023 --
NM_002734chr1751990 1635 626 580 67 12121 22047 1933 --
NM_002736chr771971 1652 804 682 635 484 340 2478 172 --1555
NM_002737chr1776647 6114 6046 5672 5477 2238 2044 --11402 --
NM_002738chr163794 766 432 2925 880 ----
NM_002740chr342624 456 238 163 32401 1954 1744 ----
NM_002742chr141528 ----1517
NM_002745chr2283583 3572 3200 1527 1393 658 277 158 13343 --12994
NM_002748chr153406 296 173 ------
NM_002755chr152699 214 ------
NM_002756chr172878 673 1981 ----
NM_002764chrX4835 656 109 21 ----1242
NM_002786chr111118 1279 ----
NM_002815chr171166 ------
NM_002821chr64654 608 598 233 1220 ----
NM_002822chr1241730 524 49 33 ------
NM_002828chr185968 749 707 700 387 ------
NM_002833chr1511612 ------
NM_002835chr71311 --2784 515 --
NM_002836chr202193 104 ----1528
NM_002837chr1243834 3641 3395 2901 --23746 239 --
NM_002839chr963491 3334 2775 1001 781 505 23202 416 --12732
NM_002840chr131436 1014 659 ------
NM_002841chr33709 665 124 ------
NM_002843chr1143262 1133 1003 755 ----13206
NM_002844chr641431 1056 920 187 --11187 --
NM_002849chr121975 1393 --1810
NM_002851chr73733 634 569 ------
NM_002855chr1152594 640 236 183 175 ------
NM_002858chr121010 95 ------
NM_002868chr1252341 2297 2102 2060 1768 11703 ----
NM_002869chr1131960 757 44 1868 ----
NM_002874chr972230 2156 1857 1830 433 342 241 ----1786
NM_002886chr374700 4467 3619 3331 3297 1857 977 2919 84 --1474
NM_002890chr52694 346 --2959 627 --
NM_002892chr1461384 1341 1269 1187 690 310 11739 ----
NM_002893chrX1360 1268 --1378
NM_002894chr182205 37 ------
NM_002897chr25765 726 549 105 86 1677 ----
NM_002902chr151537 --157 --
NM_002906chr1152322 823 729 704 611 ------
NM_002912chr62634 230 1934 ----
NM_002924chr11622 ------
NM_002938chr451986 1765 1498 1381 343 ------
NM_002940chr41267 ------
NM_002941chr31504 1268 ----
NM_002942chr31904 ------
NM_002945chr171864 1870 ----
NM_002946chr11164 ------
NM_002956chr1221030 206 ----1414
NM_002958chr341015 304 139 74 ------
NM_002959chr1134232 3469 2924 2884 1718 1509 1394 1249 1208 1108 817 497 277 11786 --23546 1348
NM_002971chr32838 186 ----1819
NM_002973chr12------1591
NM_002977chr263068 2959 1380 1093 427 254 --23078 2333 --
NM_002979chr14807 703 318 195 1866 ----
NM_002994chr461828 1637 274 197 137 55 --11212 --
NM_002998chr872251 2014 1626 1449 856 593 57 11747 1615 --
NM_003001chr14923 406 312 184 31494 1455 291 1607 --
NM_003011chr941561 1474 1178 373 ------
NM_003014chr731405 391 167 1434 ----
NM_003017chr641211 574 118 76 1258 ----
NM_003022chrX2889 864 11292 175 --
NM_003026chr92404 62 --1841 --
NM_003031chr162850 285 ------
NM_003032chr332362 834 326 1414 ----
NM_003035chr14939 922 828 330 ------
NM_003036chr11154 ------
NM_003043chr364189 4172 1455 1288 259 31 --183 --
NM_003046chr865360 5128 4678 1251 1055 312 25282 4136 1449 --
NM_003048chr292629 2597 2322 2177 1075 886 804 489 429 --12609 --
NM_003051chr121650 251 1241 1292 --
NM_003060chr51842 ----11316
NM_003068chr831030 1011 381 ------
NM_003069chrX----1319 1168
NM_003070chr94644 571 329 250 --1129 --
NM_003071chr351664 821 472 308 257 --3595 72 47 --
NM_003073chr221299 ------
NM_003074chr362127 2099 1861 1461 357 349 1424 11554 1821
NM_003076chr122648 388 ----11625
NM_003079chr172860 125 163 --1362
NM_003082chr144485 473 36 22 ------
NM_003093chr63173 85 33 ------
NM_003096chr23226 180 54 ------
NM_003099chr1585044 4784 1746 1498 1443 915 514 493 44755 4426 1188 215 --25313 628
NM_003100chr51124 1383 ----
NM_003106chr321067 816 --2734 384 --
NM_003107chr652246 1986 653 478 423 12036 --32077 2006 1641
NM_003108chr2107281 6752 6742 6478 5818 5665 5563 4554 807 238 26645 6022 15762 --
NM_003110chr1721020 963 ------
NM_003111chr231243 1001 485 ------
NM_003112chr743230 3041 2849 2078 32350 2179 960 12529 12017
NM_003113chr22804 303 ------
NM_003115chr14424 403 114 41 ------
NM_003128chr242839 2378 1889 583 1654 ----
NM_003135chr52231 86 ------
NM_003137chr642017 1722 903 791 ----11966
NM_003142chr2164 141 ----
NM_003144chr622133 1548 --11772 1412
NM_003155chr842841 2409 832 67 --1846 2948 678
NM_003156chr111332 ------
NM_003161chr1733480 2359 488 13204 11110 11169
NM_003174chr101116 ------
NM_003184chr81725 11003 160 --
NM_003185chr2031319 1302 1103 --1112 --
NM_003188chr62755 95 1538 1631 --
NM_003189chr162264 2126 1202 1023 750 169 --13421 --
NM_003194chr61387 ------
NM_003198chr11100 ----1298
NM_003199chr1864194 3903 3673 1999 1780 687 25677 1982 13919 11584
NM_003201chr103714 290 166 1811 ----
NM_003206chr61416 ------
NM_003211chr1291750 1545 1508 707 538 472 232 202 89 21427 604 11530 141
NM_003214chr621281 950 1180 ----
NM_003216chr2233084 2646 2458 1914 12521 --
NM_003217chr1261780 1249 591 541 439 114 ------
NM_003220chr621372 598 --11725 --
NM_003221chr653510 3491 3457 1465 93 2396 34 33042 1391 1004 31558 1192 76
NM_003222chr2021004 254 --1306 --
NM_003234chr33852 255 153 --22131 1568 11807
NM_003242chr351623 1609 985 416 312 --22338 1580 11769
NM_003246chr1551740 1408 1324 242 174 11370 ----
NM_003248chr51105 ------
NM_003250chr171362 ------
NM_003253chr2131280 617 242 --31631 1584 1418 --
NM_003257chr151248 1937 ----
NM_003259chr191152 ------
NM_003262chr384172 1338 1301 1152 898 450 321 208 23230 1143 45009 4231 967 314 --
NM_003269chr6--1472 ----
NM_003275chr92193 137 ------
NM_003285chr11450 ------
NM_003286chr201962 --11056 --
NM_003288chr201197 --1631 1560
NM_003290chr1931144 213 100 ----1161
NM_003291chr13----141 --
NM_003292chr161894 1472 1407 859 468 50 ------
NM_003298chr3116007 5797 5604 5305 4161 2260 2129 1567 1520 1054 294 35126 2502 199 36166 5998 5753 --
NM_003300chr141175 ------
NM_003304chr34591 424 202 179 2410 275 ----
NM_003305chr42157 149 125 ----
NM_003315chr171239 ------
NM_003317chr141657 --1289 --
NM_003319chr23278 240 107 ------
NM_003320chr11104430 4329 3439 3059 3007 2767 1741 1650 1424 1163 --1114 --
NM_003336chrX5741 302 267 242 140 1919 --1839
NM_003337chr52374 267 21726 94 ----
NM_003338chr1011974 11431 1370 11423
NM_003340chr421124 479 --1185 11060
NM_003341chr32511 434 ------
NM_003342chr17103316 3167 3049 2865 2700 2653 1325 1142 909 682 1232 --12074
NM_003347chr2242310 2046 477 144 21492 225 ----
NM_003348chr1231679 1345 659 ------
NM_003349chr2021123 1068 ----11113
NM_003350chr82822 363 ------
NM_003352chr21400 1717 ----
NM_003360chr41218 ----1287
NM_003367chr19--1477 ----
NM_003369chr1152634 2502 2406 2067 819 ------
NM_003370chr192800 638 ------
NM_003372chrX2779 30 193 ----
NM_003373chr1031701 1569 469 --1540 --
NM_003376chr631815 1220 658 --1315 --
NM_003376chr631815 1220 658 --1315 --
NM_003379chr63950 887 732 --11158 1718
NM_003380chr10298 77 ------
NM_003384chr14177 ------
NM_003387chr272727 2275 1958 1899 294 257 177 ------
NM_003390chr1141111 974 344 177 --2836 110 --
NM_003392chr353309 2990 2807 1578 1211 11222 13586 13522
NM_003400chr23795 658 182 1845 ----
NM_003404chr2031860 807 218 11321 ----
NM_003406chr851489 1371 671 627 83 ------
NM_003409chr1811289 --1962 21229 425
NM_003410chrX53101 2198 1929 628 567 12825 1269 22762 2185
NM_003411chrY31751 687 420 --31589 649 273 11262
NM_003413chrX31649 729 712 ----189
NM_003418chr32788 223 --1116 --
NM_003420chr32258 125 1214 ----
NM_003432chr52492 214 ------
NM_003442chr112787 94 1853 ----
NM_003452chr9--1981 21011 58 --
NM_003453chr134693 518 187 107 ------
NM_003454chr1671398 1375 1212 1202 233 216 51 ------
NM_003458chr333790 3391 466 1492 ----
NM_003463chr621102 874 --1127 13074
NM_003467chr23444 136 96 ------
NM_003468chr264120 1468 1390 316 308 65 --32739 842 649 13393
NM_003469chr22458 339 --1428 --
NM_003471chr352231 2122 905 647 599 ------
NM_003472chr621151 616 1174 ----
NM_003478chr1153119 2851 2153 2062 688 --12998 12193
NM_003482chr1242742 2470 2463 2297 ------
NM_003487chr17160 ------
NM_003489chr2142111 858 843 22 23120 980 13102 --
NM_003505chr731886 380 345 11683 ----
NM_003506chr821110 494 1896 --11057
NM_003507chr231691 790 442 12011 ----
NM_003557chr131474 519 352 11638 ----
NM_003558chr92698 143 ------
NM_003563chr1731376 1185 97 11400 --1392
NM_003566chr1263250 2855 2790 2733 1024 233 22386 623 --11224
NM_003567chr11115 ----1316
NM_003574chr18105802 5359 4424 4388 4044 1888 1668 1647 542 133 45672 4166 969 294 24809 4574 --
NM_003576chr1352357 2048 1995 1907 618 2786 376 12739 1818
NM_003580chr8--1132 1107 --
NM_003581chr211062 --1204 --
NM_003583chr1232589 2387 634 33494 2471 191 ----
NM_003590chr243589 3252 1188 188 --43895 3674 3616 3491 43939 2888 2796 1057
NM_003592chr7--1476 1482 --
NM_003597chr252246 2170 887 467 207 11933 ----
NM_003603chr432114 845 642 --21881 1385 1239
NM_003607chr194212 4177 4101 3149 2971 2769 2737 1642 1224 ----23319 848
NM_003608chr141179 ------
NM_003615chr3123827 3669 3659 3645 3603 3041 2685 1297 1281 848 581 413 43283 3202 2848 1615 ----
NM_003617chr144242 3798 423 163 44403 4314 3292 716 196 --
NM_003618chr221165 1108 21289 157 ----
NM_003620chr1751059 1048 874 801 51 --1139 --
NM_003629chr163153 2737 1323 1264 423 50 12913 1769 22924 872
NM_003630chr62613 198 ----1697
NM_003644chr17116610 5592 2348 1895 1313 1097 808 572 542 383 303 14748 15055 --
NM_003659chr221053 48 ------
NM_003663chr3133417 3185 2724 2616 2432 2375 2344 2255 989 844 738 532 117 12885 --11261
NM_003670chr371122 903 540 436 296 69 26 31450 1160 408 11065 --
NM_003671chr953577 3292 2608 2516 571 --22823 677 13355
NM_003672chr141361 1266 719 533 1738 31988 1670 467 1241
NM_003676chr13651 645 153 ------
NM_003677chr121902 22075 1593 --11523
NM_003685chr193927 818 713 ------
NM_003692chr92179 154 1729 ----
NM_003705chr23823 786 263 --1200 --
NM_003713chr131603 482 141 1496 ----
NM_003714chr552649 2449 2290 2158 774 ----13115
NM_003716chr31713 ------
NM_003718chr7----3565 394 110 --
NM_003722chr372686 2601 2457 2415 2004 1942 773 1190 32592 2060 1054 --
NM_003735chr521761 568 --11738 --
NM_003736chr521761 568 --11738 --
NM_003740chr621331 745 11801 ----
NM_003741chr31378 ------
NM_003743chr252073 2053 1768 422 323 ------
NM_003744chr1451367 1152 1128 1100 862 21338 900 11161 --
NM_003749chr1371838 1805 1794 1683 1529 782 98 1249 ----
NM_003750chr1031003 696 658 ------
NM_003758chr151452 11350 --11057
NM_003758chr151452 11350 --11057
NM_003759chr484228 3689 3377 2638 1396 974 937 239 --24219 514 --
NM_003760chr1--1257 ----
NM_003762chr111440 --11291 --
NM_003763chr2053011 2374 1291 1283 564 12074 --1673
NM_003766chr172216 37 168 1449 --
NM_003768chr131527 1351 1284 ------
NM_003772chr1121057 904 --11020 --
NM_003774chr1272649 2551 1184 1085 546 233 221 13242 12894 --
NM_003777chr7------1559
NM_003778chr33697 686 192 ------
NM_003783chr131221 1089 375 --190 --
NM_003784chr182701 619 ------
NM_003787chr1831409 1352 233 --11281 --
NM_003794chr31124 11065 1975 1684
NM_003795chr62174 135 1230 ----
NM_003800chr672303 2249 1896 1577 1528 821 579 ----11509
NM_003816chr851498 1474 1448 1224 335 ------
NM_003818chr20--1968 --1212
NM_003819chr11266 ------
NM_003825chr1561024 611 573 539 485 82 11284 21300 1290 --
NM_003831chr1871692 1588 1374 1312 699 672 386 ------
NM_003850chr131491 1563 ----
NM_003860chr114372 347 239 141 ------
NM_003861chr1432422 1922 909 --1920 12676
NM_003873chr1052225 1985 590 204 123 11604 11775 --
NM_003877chr122835 286 ------
NM_003884chr341581 591 156 67 31794 1570 550 --21856 1293
NM_003885chr1752369 778 764 612 68 ------
NM_003887chr241550 1481 1414 770 1133 ----
NM_003893chr101492 ------
NM_003895chr212428 202 21738 445 11626 --
NM_003899chr1332337 2111 954 11856 11767 --
NM_003901chr1052447 1096 1040 457 287 1258 12641 --
NM_003902chr14826 788 340 279 ------
NM_003909chr863082 2381 2332 2295 742 627 12191 ----
NM_003913chr6123752 3722 3680 3355 2655 1497 1389 1315 1128 972 857 653 33578 565 212 22850 612 --
NM_003916chrX1387 --11171 --
NM_003921chr111799 21681 46 11845 21788 1548
NM_003922chr15--1404 1373 --
NM_003924chr421671 115 11302 ----
NM_003927chr184768 265 122 81 ----1333
NM_003929chr131279 611 311 11492 11103 --
NM_003930chr7112411 2283 2238 1919 1888 1871 1678 447 253 101 46 ------
NM_003931chr62508 182 ------
NM_003934chr93499 464 348 ------
NM_003939chr1054000 3892 3761 378 308 24051 144 ----
NM_003941chr732368 2215 812 ------
NM_003946chr16--1565 ----
NM_003947chr321027 411 ----1875
NM_003948chr452582 1725 1713 1009 539 12066 --12182
NM_003953chr152795 1157 805 571 560 --1761 --
NM_003955chr1711276 ------
NM_003958chr653830 3549 2836 863 494 11400 ----
NM_003966chr577801 7043 5671 5364 2906 1103 234 25223 5176 27065 3093 27513 2791
NM_003971chr172594 415 ------
NM_003980chr651493 1236 1040 235 169 --11127 --
NM_003982chr141255 ------
NM_003983chr1663792 3248 1167 664 397 386 --1248 --
NM_003993chr11294 ------
NM_003994chr1293427 3364 2966 2934 2781 1541 1496 1431 182 23693 1747 31172 566 378 22813 81
NM_004006chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004007chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004009chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004010chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004011chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004012chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004013chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004014chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004015chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004016chrX72571 1778 1743 580 472 332 177 22455 2201 32503 2278 1627 --
NM_004017chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004018chrX72571 1778 1743 580 472 332 177 22455 2201 32503 2278 1627 --
NM_004020chrX82657 1864 1829 666 558 418 263 94 22541 2287 32589 2364 1713 --
NM_004021chrX72571 1778 1743 580 472 332 177 22455 2201 32503 2278 1627 --
NM_004022chrX72571 1778 1743 580 472 332 177 22455 2201 32503 2278 1627 --
NM_004023chrX72571 1778 1743 580 472 332 177 22455 2201 32503 2278 1627 --
NM_004024chr121307 960 11356 ----
NM_004028chr1873608 2811 2803 2545 1334 1012 869 14160 1856 --
NM_004035chr1774469 3841 3310 1684 1072 1046 411 1179 1744 --
NM_004040chr231346 1085 1020 ------
NM_004046chr18137 ------
NM_004060chr531304 1213 1194 ------
NM_004061chr52244 195 ------
NM_004063chr821069 981 ------
NM_004067chr741507 1296 1011 629 ------
NM_004075chr121450 1513 ----
NM_004080chr741422 545 181 127 ------
NM_004081chrY61597 1536 1369 418 150 57 --3612 522 232 --
NM_004087chr311411 1375 1329 --
NM_004089chrX144 21122 433 ----
NM_004093chr1343183 3147 2857 1103 13173 12667 --
NM_004094chr1432864 1059 77 12789 1569 --
NM_004098chr1011119 ------
NM_004100chr632281 1975 1057 --21012 289 --
NM_004105chr231055 421 410 ----1851
NM_004109chr1132145 1921 1642 --1114 --
NM_004112chr1741762 1455 1424 648 ------
NM_004117chr691872 1659 1546 1527 754 656 452 349 56 ------
NM_004124chr1462499 2339 2220 1025 711 625 ----1814
NM_004125chr93851 708 381 ------
NM_004126chr72288 48 ------
NM_004130chr32572 134 ------
NM_004133chr861817 975 544 422 334 299 ------
NM_004136chr1553009 2728 2668 2344 349 22276 1067 --13191
NM_004145chr191377 ------
NM_004156chr82527 48 ------
NM_004161chr2--1209 ----
NM_004170chr92399 239 ----1558
NM_004171chr11129538 9529 9267 6139 5997 5843 3432 2600 2340 892 199 75 19644 12413 21336 595
NM_004172chr5----22059 403 --
NM_004187chrX51489 1251 1130 578 516 ------
NM_004225chr81213 11149 ----
NM_004232chr1873379 3273 2999 2521 898 496 214 11043 1114 23237 1010
NM_004234chr191148 ------
NM_004235chr9------1874
NM_004236chr15------1189
NM_004237chr54918 910 329 148 1183 ----
NM_004238chr22276 264 ------
NM_004240chr192261 219 ------
NM_004242chr62360 319 ------
NM_004244chr121438 ------
NM_004261chr14937 907 246 79 --2678 303 --
NM_004263chr261697 1621 1144 1137 514 303 ------
NM_004268chr1121150 820 21179 179 ----
NM_004272chr511663 ----11912
NM_004274chr1443186 2296 1160 729 --1488 --
NM_004279chr731864 1849 345 --1268 --
NM_004280chr62176 154 2457 43 ----
NM_004286chr2272766 2593 2547 2378 1754 857 271 ------
NM_004290chr521296 1140 --1310 --
NM_004291chr51100 --1276 --
NM_004293chr963588 1110 852 676 618 563 12389 --13048
NM_004301chr3----155 1145
NM_004302chr123918 662 536 12911 12960 --
NM_004316chr1241151 1115 771 220 ------
NM_004319chr142839 1070 606 261 12269 ----
NM_004329chr1011010 --1215 --
NM_004331chr852553 2243 1674 962 917 --32345 586 435 --
NM_004337chr821740 237 --11495 --
NM_004338chr18146656 6151 5924 5446 5340 5127 4835 2451 1653 1442 1270 817 623 374 3575 477 281 --11573
NM_004342chr731933 799 376 --22055 1739 --
NM_004346chr431219 384 262 ------
NM_004349chr82873 346 ------
NM_004354chr42728 651 ------
NM_004360chr1621909 212 --21785 144 --
NM_004365chr51217 ----1232
NM_004370chr621964 290 ------
NM_004380chr162663 640 11950 12026 12040
NM_004384chr532369 232 212 11830 11972 1206
NM_004385chr52526 249 ------
NM_004392chr1362482 2263 2111 1954 673 166 1936 1316 12078
NM_004393chr33559 491 231 12075 ----
NM_004397chr1174165 3723 3653 3239 2655 1731 1005 11594 21512 1131 --
NM_004412chr1096019 6012 5702 4466 4434 4049 432 380 212 --21893 309 15678
NM_004415chr62609 169 1711 ----
NM_004426chr1221515 494 --21507 727 1186
NM_004428chr11742 ------
NM_004430chr822230 267 22407 2242 22802 1035 --
NM_004432chr942266 1999 764 354 11900 21906 423 --
NM_004433chr141671 1585 1160 676 ------
NM_004437chr172586 2231 1302 1229 925 260 199 1253 13004 --
NM_004438chr231137 469 300 13180 ----
NM_004440chr61455 11808 21273 475 --
NM_004442chr131748 1445 664 ------
NM_004447chr12155 161 ----
NM_004448chr172481 454 ------
NM_004449chr2141105 1016 583 391 --1109 --
NM_004451chr11--1736 ----
NM_004454chr321832 814 11598 --11408
NM_004457chr22405 297 1565 ----
NM_004458chrX31747 1651 178 32258 1065 459 12633 --
NM_004463chrX2591 178 ------
NM_004464chr473631 3236 3213 2759 1724 1452 244 11623 22914 633 --
NM_004475chr171784 161 ----
NM_004481chr142353 2242 581 266 12085 ----
NM_004482chr22363 75 ------
NM_004500chr1451857 1421 1409 730 205 ----1419
NM_004501chr173960 3277 2649 2521 1643 760 315 33819 2944 1191 1133 13699
NM_004504chr272873 2809 2522 2134 2049 1051 478 21869 1170 23030 2558 22471 98
NM_004505chr1711695 --1436 --
NM_004506chr62171 96 ----1669
NM_004514chr1722347 553 --12710 13054
NM_004520chr5----1270 --
NM_004523chr101527 ------
NM_004524chr172279 203 1242 ----
NM_004526chr33257 177 68 ----1635
NM_004529chr921461 1030 --1157 --
NM_004535chr202498 321 ------
NM_004537chr1231293 1204 248 11240 1281 11467
NM_004561chr1121832 681 ------
NM_004571chr2132942 1022 78 33098 2902 1047 22927 62 11056
NM_004575chr451661 1606 1254 1215 1204 --11133 --
NM_004576chr53373 284 56 ------
NM_004577chr71532 1587 ----
NM_004586chrX105338 5312 5085 4943 4771 4381 4222 3701 2165 1265 23647 167 14869 11866
NM_004588chr1173864 3363 3162 2731 974 915 402 13343 ----
NM_004598chr531072 529 28 --12746 --
NM_004600chr151514 615 576 281 275 --2551 530 1399
NM_004612chr9124840 4732 4546 4457 4210 4081 3183 1601 1592 1339 923 477 33854 2969 56 13949 --
NM_004619chr142105 1717 589 264 ------
NM_004622chr262165 1708 1665 910 622 111 1689 12365 11786
NM_004630chr1111138 1975 ----
NM_004631chr181448 1210 906 897 429 380 221 203 1998 ----
NM_004635chr321209 315 1123 ----
NM_004637chr331149 854 529 ------
NM_004654chrY31381 1114 201 21226 378 ----
NM_004655chr1741204 902 562 527 1423 --1452
NM_004660chrY72188 2090 1883 850 576 528 245 --12294 1823
NM_004663chr1551236 1162 974 186 96 --1150 --
NM_004671chr181310 ------
NM_004681chrY3745 606 589 1138 ----
NM_004685chr1342769 2648 2208 858 --42874 2752 522 407 12555
NM_004686chr821675 523 21771 1190 ----
NM_004687chr1731808 1620 1381 ------
NM_004694chr171354 2347 181 ----
NM_004701chr151120 ------
NM_004707chr521387 70 ------
NM_004709chrX31644 700 77 ------
NM_004715chr18----1177 --
NM_004719chr1292670 2611 2420 2218 2196 2182 2040 1874 297 12444 11833 11775
NM_004725chr103575 269 256 --11258 --
NM_004726chrX84713 4311 3710 3598 2169 1468 1411 166 35244 4123 769 11520 --
NM_004730chr541937 1739 1730 264 11368 11498 --
NM_004731chr1241838 1745 160 90 1618 ----
NM_004733chr3------149
NM_004736chr12844 619 21555 252 ----
NM_004740chr17136 ------
NM_004742chr321593 420 ------
NM_004744chr462796 1455 859 670 539 177 ----13907
NM_004745chr8107040 6655 5801 5187 4862 4815 4361 1528 1288 504 --26896 1748 16362
NM_004747chr1061619 1420 1406 1086 480 419 1222 --1517
NM_004748chr1593971 3329 2718 2681 1669 1350 896 884 76 23036 988 13520 --
NM_004760chr751902 1735 1709 1625 545 ----32352 2283 1881
NM_004762chr1751893 1852 1612 1521 138 ------
NM_004768chr121165 168 1874 1235 --
NM_004772chr531517 172 130 ------
NM_004774chr1742896 2142 1975 309 2368 129 --12970
NM_004775chr1872241 2040 1946 649 607 563 397 1619 21769 571 --
NM_004776chr2062408 2329 2027 443 232 25 33247 3200 2272 ----
NM_004779chr51142 ------
NM_004781chr121120 538 21204 613 ----
NM_004781chr121120 538 21204 613 ----
NM_004788chr1152339 2232 2219 1904 1752 ------
NM_004789chr91326 188 ----
NM_004792chr2------1199
NM_004794chrX143 ------
NM_004796chr1462328 1525 915 777 603 30 11641 ----
NM_004798chr2013378 --23589 1255 --
NM_004800chr13----185 --
NM_004801chr21549 --11095 --
NM_004804chr242761 1990 1750 326 --11799 --
NM_004805chr2--1341 1411 --
NM_004808chr1022248 674 ------
NM_004817chr93566 540 217 --2795 500 --
NM_004821chr53672 653 527 ------
NM_004824chr641429 1261 481 338 ----1165
NM_004831chr192861 693 ------
NM_004834chr273026 2724 2715 2527 2248 1176 390 --1898 --
NM_004836chr24877 669 639 187 --1257 --
NM_004839chr15--2630 475 ----
NM_004840chrX52473 911 846 467 93 1618 ----
NM_004842chr621399 600 --1716 --
NM_004845chrX93933 3644 2988 1171 873 797 649 590 315 ------
NM_004846chr2--1129 ----
NM_004849chr621254 635 --11713 --
NM_004850chr221407 1368 ------
NM_004855chr151211 ------
NM_004856chr152422 157 --1105 --
NM_004857chr1464161 3980 3053 410 329 281 ------
NM_004859chr1771937 971 860 802 420 243 229 11913 1981 1936
NM_004863chr1453517 3484 1957 1826 522 13419 22044 1319 13958
NM_004865chr62344 299 ------
NM_004866chr564035 4013 3539 1795 1532 1016 13736 34700 3765 1507 --
NM_004869chr1831312 541 143 --31322 602 491 --
NM_004871chr1774300 3730 3038 2917 2896 1618 290 --14400 --
NM_004874chr82189 117 ------
NM_004893chr53374 136 111 ------
NM_004896chr1011302 11065 ----
NM_004898chr472922 2736 1963 945 924 745 235 ------
NM_004904chr7166440 5861 5413 4689 4407 4304 2552 1924 1171 1022 670 605 353 240 222 122 32558 1893 1752 22051 948 35812 4536 2383
NM_004906chr64606 533 469 202 ------
NM_004912chr731291 1183 50 --3645 576 481 --
NM_004921chr131757 484 270 11707 12356 --
NM_004926chr1411685 ----11334
NM_004927chr1131423 1165 243 ------
NM_004946chr51416 ------
NM_004956chr793047 1512 1493 1269 588 578 300 133 81 ------
NM_004960chr162236 33 ------
NM_004961chrX1111 ------
NM_004965chr213708 301 94 ------
NM_004966chr102996 210 ------
NM_004967chr4137 --1498 --
NM_004972chr95820 420 374 303 166 --152 --
NM_004973chr661766 1713 473 342 146 127 21141 234 ----
NM_004976chr1155167 5099 1584 1407 694 --11026 --
NM_004985chr12154140 3998 3398 2960 1789 1619 1026 706 368 343 267 201 167 128 84 22834 1406 23004 1313 1923
NM_004992chrX98279 5717 5424 5412 5393 5373 3371 3271 1967 28324 1128 1242 --
NM_004992chrX98279 5717 5424 5412 5393 5373 3371 3271 1967 28324 1128 1242 --
NM_004993chr1461501 1331 1230 410 342 231 --21008 977 --
NM_004996chr1641702 1113 508 320 ------
NM_004999chr6134186 4146 3743 3666 1745 1656 1251 1187 1034 792 763 751 136 --22789 995 23213 1103
NM_005003chr162140 21 ------
NM_005006chr231018 837 24 ------
NM_005010chr711513 12129 11780 --
NM_005011chr731585 496 110 ------
NM_005016chr121358 196 ----
NM_005023chr51614 31277 1114 435 --11487
NM_005025chr3182 ------
NM_005028chr1042203 1935 466 164 ------
NM_005032chrX11005 1797 ----
NM_005033chr41124 1144 ----
NM_005036chr2298335 6619 6040 5388 2652 1514 1489 1266 300 38351 1275 167 25609 1405 --
NM_005053chr19----157 1587
NM_005054chr221521 587 21186 408 1673 --
NM_005056chr1283755 3697 3639 3581 1977 1350 1205 586 21561 986 ----
NM_005063chr1063481 3429 3188 2907 2368 480 153 --1405
NM_005065chr1475161 5103 5021 1756 1576 671 243 22054 1512 21142 683 13844
NM_005067chr33991 812 75 1620 1918 --
NM_005079chr853152 2924 1280 601 312 --1114 --
NM_005080chr222651 614 --1774 --
NM_005088chrX2795 165 --1690 1253
NM_005093chr2065246 5089 4449 4207 1214 242 ------
NM_005095chr122191 577 --1360 --
NM_005104chr62745 597 ------
NM_005109chr332394 1826 1699 --1122 --
NM_005112chr41698 2999 757 1183 --
NM_005114chr4----1552 --
NM_005116chr20104447 4323 3866 3386 3278 1506 1072 899 371 339 23195 2781 11596 --
NM_005117chr112407 147 --1109 --
NM_005119chr141244 340 242 215 ------
NM_005121chr1743517 3150 2531 457 33644 3381 538 1967 23502 1047
NM_005125chr11----1151 --
NM_005126chr341973 1947 1877 1638 ------
NM_005134chr182361 86 ------
NM_005151chr183769 669 558 11592 175 --
NM_005156chr9115138 5086 4968 4932 4645 4326 4034 3407 3318 1217 318 24699 771 --14165
NM_005159chr1531885 875 152 21967 240 --12065
NM_005160chr2285905 5502 4971 4267 2704 2209 936 756 --45455 5203 1284 732 --
NM_005168chr241581 1369 471 208 31560 571 395 11109 --
NM_005171chr1241071 889 108 95 1817 2206 67 --
NM_005180chr1041575 1490 1343 72 --1588 --
NM_005188chr11208308 8248 7876 7830 7606 6091 5968 5892 2704 2656 2544 2533 2079 1832 1748 1639 1340 1136 1068 188 --17819 18184
NM_005190chr63312 265 149 ------
NM_005192chr14----1131 --
NM_005197chr1495762 5751 5143 5047 4336 4009 3965 256 246 1154 ----
NM_005201chr31339 ------
NM_005203chr10166 ------
NM_005204chr101831 ------
NM_005206chr171148 11166 ----
NM_005207chr22103708 3675 3163 2658 2508 1232 1220 486 115 29 33579 3355 1125 ----
NM_005219chr541393 1176 715 362 11653 ----
NM_005222chr71696 1839 ----
NM_005229chrX31224 850 488 ------
NM_005230chr121541 ------
NM_005231chr1131321 1293 251 ------
NM_005233chr31353 1556 ----
NM_005235chr297769 7685 7126 6184 5918 4984 2969 2888 103 27273 706 15394 16025
NM_005238chr1173523 3469 2990 2839 1394 1251 515 --22632 1320 --
NM_005239chr2131910 812 584 ------
NM_005241chr331326 1020 943 --1468 --
NM_005242chr521316 1128 ------
NM_005243chr22--165 ----
NM_005245chr43808 696 92 ------
NM_005249chr142257 34 ------
NM_005252chr143632 616 536 ------
NM_005254chr1541257 1249 1234 215 ----2477 347
NM_005256chr113917 621 359 ------
NM_005257chr1821377 1188 11259 --11128
NM_005259chr22353 222 1332 1206 --
NM_005273chr73339 311 295 ------
NM_005277chr441836 1795 397 380 ------
NM_005278chrX--1415 1117 --
NM_005281chr1----1267 --
NM_005295chr7------145
NM_005296chrX1145 --1409 --
NM_005302chr7160 1165 ----
NM_005308chr101335 ------
NM_005310chr172355 132 ------
NM_005311chr752758 2453 2112 622 485 ------
NM_005313chr1521044 390 ------
NM_005318chr221414 --11051 --
NM_005324chr1752020 1371 832 566 411 ------
NM_005329chr1632345 569 102 --12183 --
NM_005334chrX31641 1415 409 ------
NM_005336chr221955 1417 ------
NM_005339chr4114009 3989 3152 3118 1612 1239 1118 1064 996 962 880 13205 ----
NM_005342chrX31877 668 381 --12172 12426
NM_005349chr42505 246 --1404 --
NM_005359chr18126469 6423 5699 5677 5618 5596 5377 5335 4269 2407 1109 101 14092 76078 2255 2009 1934 1922 1435 617 --
NM_005369chrX2424 173 1441 ----
NM_005376chr141028 968 341 221 ------
NM_005378chr21666 ------
NM_005381chr22411 386 ------
NM_005385chr352497 2185 1834 1068 749 --1360 --
NM_005387chr11165 ------
NM_005392chr931812 1460 557 --11489 11879
NM_005397chr783764 3672 3661 3108 3062 1173 1122 550 13011 12892 --
NM_005398chr103470 288 118 1201 ----
NM_005399chr1104047 3763 2997 1767 1700 1051 864 817 656 469 53795 3296 2815 749 100 23810 173 --
NM_005400chr252952 2637 1210 602 596 12836 ----
NM_005406chr1871330 1024 617 468 442 326 147 ------
NM_005415chr21793 1304 ----
NM_005433chr1872691 2501 2232 1736 1102 483 447 22355 1895 11041 --
NM_005436chr103488 330 216 33184 2975 1592 --12909
NM_005440chr1733117 792 561 ------
NM_005443chr41141 1194 ----
NM_005445chr102325 100 ------
NM_005450chr17------1229
NM_005455chr121507 1293 --21186 669 --
NM_005458chr921831 1786 22372 1717 ----
NM_005461chr202389 353 --31946 1811 591 11772
NM_005465chr131551 352 190 ------
NM_005471chr511251 11282 --1265
NM_005474chr1721536 1400 ------
NM_005475chr1273310 3228 2856 2107 2047 1067 201 --2912 516 --
NM_005487chr2222046 2031 1103 --11655
NM_005493chr62591 124 1598 ----
NM_005494chr71535 1616 ----
NM_005496chr321046 125 ------
NM_005497chr17116170 4122 3917 3766 2319 1341 1105 559 470 462 292 35846 1784 742 11308 --
NM_005499chr191526 ----1199
NM_005502chr952725 2016 978 510 242 1635 ----
NM_005504chr12126479 6331 6113 5896 5769 5559 5400 5361 5186 1912 1373 734 11801 --25016 4087
NM_005506chr442642 2620 2474 2278 12404 1190 --
NM_005513chr321593 85 ------
NM_005517chr12237 97 1903 174 --
NM_005530chr1531328 1149 209 ------
NM_005539chr1041177 918 320 313 ------
NM_005542chr751910 1504 1449 1227 362 11301 ----
NM_005544chr2--1635 ----
NM_005563chr13635 190 158 ------
NM_005565chr51126 --1432 --
NM_005570chr1811117 ----1988
NM_005573chr52587 162 ------
NM_005578chr3135108 4042 3890 3790 3590 2022 1907 1669 1657 1070 494 359 327 --14473 --
NM_005585chr15----1142 --
NM_005587chr152384 308 --2972 948 --
NM_005595chr13643 632 204 ------
NM_005596chr986233 5553 5201 4378 3995 2330 1859 1003 11961 1455 16310
NM_005599chr131534 1475 1141 1312 ----
NM_005602chr331225 1142 1094 ------
NM_005604chr641864 1850 854 631 ----12411
NM_005607chr83733 693 275 ------
NM_005610chr11308 1778 ----
NM_005611chr1641127 835 273 76 1822 ----
NM_005613chr141703 1536 168 94 --1320 --
NM_005618chr61600 ------
NM_005625chr81205 --1319 --
NM_005627chr63391 158 53 123 ----
NM_005634chrX2693 141 --190 --
NM_005637chr185795 703 667 176 105 1748 1321 --
NM_005638chrX21695 235 --1434 --
NM_005639chr1221365 528 1141 --11267
NM_005647chrX93265 3243 3126 2521 1141 951 924 761 177 11093 11076 --
NM_005650chr22--1417 11324 11213
NM_005655chr82947 233 ----11259
NM_005657chr15124 265 54 1117 --
NM_005660chrX1227 ------
NM_005664chr1541059 1015 410 232 --1370 1353
NM_005665chr194946 4754 3374 1829 1779 1713 1484 1441 63 21186 958 24634 1194 24680 946
NM_005668chr584603 4324 3846 3492 3198 2809 1686 1424 34189 3880 511 1972 --
NM_005685chr7199 ------
NM_005688chr321123 213 --1287 --
NM_005711chr52433 373 --1778 --
NM_005715chr642636 263 164 26 11019 ----
NM_005717chr121196 1005 --1111 --
NM_005721chr21246 194 ----
NM_005722chr231651 387 244 12190 2154 130 21608 496
NM_005724chr153609 136 23 1644 --1579
NM_005725chr152063 798 335 240 36 --21815 575 --
NM_005730chr1233423 3026 1354 21325 783 22802 140 --
NM_005734chr111252 ----1141
NM_005738chr762014 1678 1475 1427 655 388 --1118 --
NM_005739chr1542406 2385 2166 1918 --21629 1573 199
NM_005742chr22793 681 ------
NM_005746chr762692 2014 1011 345 212 76 11708 12653 --
NM_005748chr1273241 3073 2894 2255 2154 605 570 --41186 875 710 121 1859
NM_005751chr71453 ------
NM_005752chr1621091 800 --11216 --
NM_005754chr51862 ------
NM_005759chr244517 3887 1822 526 11743 11492 --
NM_005776chr141340 1620 ----
NM_005779chr522717 1047 1820 ----
NM_005780chr131368 ------
NM_005791chr2163 ------
NM_005798chr1374331 4312 2076 2016 946 911 24 13640 23336 1993 --
NM_005801chr17------1765
NM_005802chr9------1746
NM_005806chr2151260 1190 1077 967 267 1238 ----
NM_005813chr272222 2102 1701 1014 878 579 212 11036 ----
NM_005826chr11447 ----1419
NM_005828chr1754545 1728 1662 113 35 ----24512 224
NM_005832chr321315 1044 ------
NM_005840chrX107482 5009 2825 2782 2170 1623 1035 910 393 28 14728 25866 4663 --
NM_005842chr131274 1162 1636 --
NM_005845chr1361732 1381 1349 1212 1085 49 21676 686 ----
NM_005857chr141112 974 946 285 1473 1222 --
NM_005859chr521232 519 11239 ----
NM_005862chr31339 1416 ----
NM_005863chr104996 542 307 60 --1921 --
NM_005875chr3139 ------
NM_005880chr1651570 1072 542 473 304 --2380 183 --
NM_005884chr191166 --1801 --
NM_005885chr531543 1112 1080 ------
NM_005896chr21750 ------
NM_005898chr1162895 2678 1053 969 478 160 1677 12636 1568
NM_005899chr1721083 226 11432 11513 --
NM_005900chr431112 959 408 1991 ----
NM_005901chr18178690 8444 8375 7563 7429 7120 6633 6545 6465 6305 6149 5899 3264 2312 2287 2100 1326 46939 6442 6143 3143 16073 --
NM_005902chr1564500 4161 1584 1099 583 330 ------
NM_005903chr5125162 4116 4042 3994 3961 2087 1785 1760 1016 870 579 383 146 31887 1090 516 --
NM_005904chr1811306 21379 1202 ----
NM_005907chr631602 434 217 21616 378 21588 1066 --
NM_005909chr553721 3462 1310 563 167 23428 2641 13052 --
NM_005910chr1754060 3618 3545 932 157 14099 12802 13895
NM_005911chr241159 993 966 154 2956 283 ----
NM_005920chr173844 3447 3164 2865 2833 842 200 --1676 --
NM_005927chr52920 352 --1210 --
NM_005930chr14--1284 2807 252 --
NM_005933chr1122279 220 1628 --1945
NM_005935chr4115152 5082 4918 4512 3629 3571 3495 3335 2055 946 481 24859 4696 --11950
NM_005941chr853963 2570 1036 717 565 21348 455 22680 533 --
NM_005955chr154962 4745 1871 1024 395 --45268 4402 3666 3433 --
NM_005962chr1011794 --31584 1525 397 --
NM_005962chr1011794 --31584 1525 397 --
NM_005964chr1721202 544 ----11341
NM_005966chr232123 1815 1649 11672 --1818
NM_005975chr201803 ------
NM_005977chr131404 ----1881
NM_005986chr1362474 844 716 481 221 91 ----11889
NM_005994chr171719 ----1625
NM_005999chr151518 1495 1253 1139 96 1130 ----
NM_006007chr973328 2838 1789 1349 1321 1027 912 24430 4170 1109 --
NM_006009chr121150 153 ----
NM_006011chr1534259 3989 847 11553 ----
NM_006016chr651785 1617 1515 1407 774 ------
NM_006024chr71565 1217 ----
NM_006036chr222507 448 ------
NM_006037chr284426 4006 3589 3390 1729 1578 1500 897 --13737 --
NM_006043chr162709 188 1290 ----
NM_006047chr20103397 2944 2584 2466 2368 2322 1102 577 433 310 --32989 2612 451 --
NM_006051chr5161 ------
NM_006054chr1141051 386 350 117 11333 ----
NM_006060chr753542 3228 3154 1233 715 11120 23601 942 --
NM_006067chr1641070 829 414 342 1113 --1301
NM_006079chr61771 1158 ----
NM_006080chr742323 881 739 181 1747 --22447 618
NM_006089chrX71898 1891 1540 1250 662 639 83 --1186 --
NM_006090chr1----1696 1724
NM_006094chr832398 1750 355 ----21527 773
NM_006095chr494396 4355 4238 1425 1374 1251 1004 909 272 34473 3320 1267 --13235
NM_006100chr32243 212 --141 --
NM_006106chr1193367 3290 2675 1367 1352 1235 1031 537 86 12581 42313 2141 1344 1318 --
NM_006107chr172337 156 --1508 --
NM_006108chr1161613 917 689 665 564 101 11680 ----
NM_006113chr121583 372 1636 ----
NM_006136chr71282 11362 ----
NM_006139chr222488 1782 ------
NM_006141chr1662554 2264 2203 940 860 98 ------
NM_006143chr121109 ----147
NM_006147chr1181 --1385 --
NM_006153chr32267 219 ------
NM_006154chr1552386 2040 653 358 263 --2671 43 --
NM_006159chr121571 --1111 --
NM_006164chr2135 ------
NM_006166chr1221856 692 --2861 678 --
NM_006180chr911927 21984 1367 ----
NM_006186chr221012 476 ------
NM_006187chr1222959 160 1524 ----
NM_006190chr21945 ------
NM_006194chr14------1483
NM_006196chr2--187 ----
NM_006197chr81361 --1736 21993 286
NM_006203chr5105607 4232 4117 3553 1483 1436 1285 802 695 172 34360 1598 1541 25357 1864 24934 4827
NM_006206chr442267 2014 1099 773 12919 31840 1134 825 --
NM_006211chr82232 78 ------
NM_006223chrX1433 --128 --
NM_006224chr1722445 1011 ------
NM_006226chr22921 81 2382 195 ----
NM_006237chr1362110 1891 1622 852 502 63 1302 12249 --
NM_006242chr2051590 1524 875 632 339 ------
NM_006246chr142829 74 ------
NM_006251chr522985 2458 1298 22996 869 12797
NM_006252chr1187578 7379 7021 6590 6463 6436 6066 5200 2345 2039 1860 1621 1322 1245 1223 530 402 352 12911 --45526 5388 1144 1051
NM_006255chr141705 1995 ----
NM_006256chr142646 646 386 99 32695 2369 1854 22150 335 1984
NM_006259chr42830 293 ------
NM_006264chr4------1402
NM_006265chr811385 31297 1269 534 21349 953 --
NM_006267chr2187 ----11648
NM_006268chr1141143 1035 460 387 ------
NM_006275chr2061997 1937 441 406 352 230 22514 1896 --1392
NM_006282chr2041690 1491 327 41 24753 3360 1296 44521 662 441 248
NM_006283chr854129 3082 1992 425 150 34320 1410 304 --21795 766
NM_006300chr1941976 618 306 195 --22358 2182 --
NM_006306chrX45848 4608 4103 406 25937 1576 14005 --
NM_006310chr171508 11304 --11135
NM_006311chr172258 49 ------
NM_006315chr454546 3892 3853 2764 1444 ------
NM_006321chr341374 895 426 410 ------
NM_006324chr16274 51 ------
NM_006325chr12--1761 138 --
NM_006330chr831172 1106 607 ------
NM_006345chr411091 1952 ----
NM_006350chr52318 51 174 ----
NM_006352chr142039 1999 1800 350 11450 1396 11981
NM_006353chr64529 448 392 98 --175 --
NM_006357chr21430 ------
NM_006359chrX51697 942 927 222 189 --1265 11617
NM_006366chr631274 1251 101 --1107 --
NM_006367chr12901 214 ----1292
NM_006369chr12435 334 ------
NM_006371chr355316 4993 4850 4750 916 24413 3524 25138 3782 11278
NM_006375chrX31418 769 563 11677 ----
NM_006378chr931384 1249 60 1496 ----
NM_006379chr762110 538 417 360 353 85 --21937 132 --
NM_006380chr17114050 3737 3706 3688 3381 3370 3360 2996 1672 1513 764 ------
NM_006386chr2252289 2155 890 697 606 1451 ----
NM_006390chr1251579 1462 639 575 286 ------
NM_006393chr1084540 4465 3897 2929 2883 1783 1387 945 --127 11022
NM_006411chr63998 892 843 ------
NM_006416chr61216 ------
NM_006420chr2083412 3239 3165 3044 2543 959 696 655 53461 3099 2993 2569 2506 23060 2616 --
NM_006421chr821249 1163 ------
NM_006425chr521349 246 1114 21467 563 --
NM_006434chr1072963 2821 2253 2109 1985 852 791 ------
NM_006439chr4----1465 --
NM_006451chr571030 992 810 799 721 708 406 --126 --
NM_006457chr462765 2528 2508 1107 504 96 --33907 2791 238 1138
NM_006460chr1731790 234 131 ------
NM_006464chr2124541 4528 3856 3786 3301 3176 3033 1870 946 933 222 216 ----21412 71
NM_006469chr131189 562 119 ------
NM_006471chr18188 --181 --
NM_006482chr1232589 2387 634 33494 2471 191 ----
NM_006489chr1451977 1807 329 164 88 130 --1489
NM_006496chr131698 1357 1270 ------
NM_006509chr191396 ------
NM_006524chr75827 407 239 155 82 1746 ----
NM_006526chr2052145 2003 1877 1648 1561 ------
NM_006529chr431653 1321 609 --31369 272 134 11061
NM_006534chr2063410 3105 2468 1168 639 557 ----1115
NM_006536chr13666 289 114 1759 1783 --
NM_006537chr153216 123 54 ------
NM_006540chr831210 1056 397 21279 490 ----
NM_006544chr1475909 5212 4125 3707 1332 439 168 14227 42397 1708 1551 1012 --
NM_006546chr17136614 6545 6396 6033 5875 5786 5566 4759 4422 2230 2181 1908 535 35773 366 343 15179 --
NM_006547chr772048 1847 1805 1503 1350 768 107 --1476 21709 208
NM_006549chr12--1154 --1545
NM_006558chr81380 ------
NM_006559chr13834 405 81 ------
NM_006560chr111463 ----1487
NM_006561chr10116226 5577 5461 4235 3910 3817 1424 966 548 521 38 ----24562 1723
NM_006565chr163874 373 92 --1514 1413
NM_006572chr1722182 1166 41192 294 215 24 11301 --
NM_006593chr21574 ------
NM_006595chr115627 576 449 413 264 1500 ----
NM_006599chr16178101 6943 6792 6752 6395 6020 5112 2969 2433 2292 1917 1901 1357 1247 1198 420 404 17931 1517 --
NM_006603chrX71789 1643 1469 1462 259 215 158 1526 11764 --
NM_006609chr282591 2350 1841 900 889 693 416 219 --12848 --
NM_006614chr373460 3119 2547 2236 1393 942 752 ------
NM_006618chr141108 632 487 471 ------
NM_006621chr121545 635 --11373 11389
NM_006622chr52399 215 1235 ----
NM_006624chr1041967 1827 281 179 --11942 21704 638
NM_006626chr9--1782 12292 --
NM_006628chr1584333 2841 1107 931 847 735 315 164 --43161 1668 342 112 2537 295
NM_006633chr52789 508 1278 ----
NM_006636chr22744 687 ------
NM_006644chr132447 234 1490 --1661
NM_006646chr1372922 2777 2584 2563 2241 484 433 12497 12830 --
NM_006653chr61102 1396 ----
NM_006654chr12124730 4340 4243 3732 1762 931 851 775 601 483 335 41 23170 396 11643 --
NM_006660chr152247 33 1267 ----
NM_006667chrX61205 1182 1142 440 121 101 ------
NM_006682chr721765 1056 22740 1014 ----
NM_006690chr2021747 733 ------
NM_006698chr2031435 1036 142 --21485 969 --
NM_006706chr5--1549 1527 --
NM_006711chr16154 --1752 --
NM_006713chr53339 310 68 146 ----
NM_006716chr741316 995 267 208 --199 --
NM_006717chr962929 2780 2771 1158 1036 549 --11086 --
NM_006718chr641077 972 949 193 144 --11021
NM_006722chr3112466 2209 1186 1005 908 880 814 735 708 266 123 --52308 1989 1981 1101 516 --
NM_006726chr41881 ----1214
NM_006727chr53555 511 355 ------
NM_006729chrX74537 2242 2236 1877 1031 598 310 15490 13477 --
NM_006731chr955736 4081 3799 1263 1187 ----13910
NM_006738chr1563261 2821 1609 1470 1328 1280 23954 3937 --14527
NM_006745chr44956 733 300 222 --1995 1238
NM_006746chrX51552 1545 1176 970 548 ----1613
NM_006750chr1668124 7066 3229 1903 945 740 16391 57959 6551 5506 882 623 --
NM_006751chr21837 ----1780
NM_006756chr851531 1434 1282 1102 83 --11076 161
NM_006761chr173262 222 167 ------
NM_006772chr621627 1117 ------
NM_006774chr731279 293 154 ------
NM_006775chr682989 2946 2799 2574 2196 2172 643 187 --12151 --
NM_006777chrX82799 2267 2186 626 351 222 172 26 --21099 457 --
NM_006788chr1842124 1683 221 204 12134 11357 --
NM_006790chr51368 1105 ----
NM_006791chr152599 255 2565 85 ----
NM_006803chr861603 1580 1545 1521 1363 713 1321 21846 1556 --
NM_006805chr531721 1175 503 21740 309 ----
NM_006807chr1721349 408 1156 --11003
NM_006808chr91156 ------
NM_006811chr205890 846 666 636 106 --1714 --
NM_006813chr61226 ------
NM_006815chr1221306 280 1556 11173 --
NM_006822chr172605 533 ------
NM_006823chr811321 11294 ----
NM_006827chr1443114 1154 990 112 --13004 23175 574
NM_006832chr141757 1411 --1851
NM_006838chr1231656 1398 188 2343 93 2631 44 --
NM_006845chr11523 ------
NM_006851chr1242794 1913 823 53 ------
NM_006852chr1762855 2490 2122 1106 687 549 ----12908
NM_006868chr1883225 2839 2253 2046 1949 1079 466 120 12964 1478 --
NM_006874chr441185 1013 952 334 ------
NM_006885chr16104056 3847 1467 1337 1036 944 686 657 566 543 11542 43617 3322 2732 1302 33839 808 426
NM_006888chr1483497 2799 2772 2706 2650 2410 911 310 --1220 --
NM_006892chr2041379 1253 1243 291 ------
NM_006892chr2041379 1253 1243 291 ------
NM_006896chr721155 69 ------
NM_006897chr121204 ------
NM_006898chr21615 ------
NM_006908chr751291 1154 1109 605 53 --11147 --
NM_006910chr161402 --1159 --
NM_006915chrX62527 2386 1648 779 688 242 1978 --1197
NM_006918chr1195768 5654 5122 4783 4733 3848 1668 1559 1221 14772 14716 --
NM_006922chr232288 856 819 2593 109 12201 --
NM_006924chr1744060 627 397 46 1714 34053 3280 1079 --
NM_006930chr551802 1363 454 231 187 ----11289
NM_006931chr1242012 1325 285 177 12159 1470 --
NM_006937chr172558 115 ------
NM_006938chr183878 702 75 1214 3949 817 127 --
NM_006939chr1471162 1034 756 454 441 138 49 --1999 --
NM_006940chr1221833 437 ------
NM_006951chr106829 790 763 725 581 242 ------
NM_006963chr103477 93 23 21166 1083 2979 388 --
NM_006965chr1841207 1131 872 92 ------
NM_006981chr952900 2577 2198 375 211 1340 ----
NM_006982chr121227 ------
NM_006988chr212810 430 ----125
NM_006990chr121628 125 12135 --1743
NM_006996chr141830 1564 735 332 ------
NM_006999chr552064 1337 838 685 429 ----11573
NM_007006chr1693482 3016 2869 2806 1305 863 673 99 89 1387 ----
NM_007007chr1284395 4040 3992 3180 2991 1807 246 207 23110 811 11622 --
NM_007011chr15105339 4729 4692 1844 1225 794 587 552 353 338 --15962 --
NM_007013chr81360 --1299 --
NM_007017chr51365 1791 ----
NM_007027chr31146 ------
NM_007033chr151761 1599 844 748 42 1463 ----
NM_007034chr1--11039 ----
NM_007035chr12--2849 706 1255 --
NM_007038chr2175564 4526 4050 2326 1806 973 921 25725 565 45888 5256 5006 4235 14135
NM_007040chr192957 435 11008 ----
NM_007042chr342016 492 459 377 1638 ----
NM_007050chr2097378 7253 6021 5999 5808 2998 2497 842 678 --46303 2281 1909 1125 --
NM_007064chr351427 630 508 365 194 ------
NM_007073chr663738 918 205 189 97 80 32827 2593 283 14109 14081
NM_007076chr121124 ------
NM_007078chr1082943 2905 2338 829 793 490 323 300 ----1859
NM_007084chr1341426 1409 364 289 11449 11330 --
NM_007106chr1352600 2092 1904 1734 795 1225 12748 --
NM_007107chr342254 1798 676 27 ------
NM_007111chr131299 1919 ----
NM_007112chr12240 179 ------
NM_007114chr343102 1049 637 141 23113 1114 13027 --
NM_007118chr51834 1865 ----
NM_007123chr141271 1075 245 119 ------
NM_007124chr641674 1643 1571 327 ------
NM_007125chrY41003 463 452 419 --1980 --
NM_007129chr134833 756 396 158 21010 389 ----
NM_007137chrX75460 4082 3763 1909 1259 1158 622 25447 5310 34403 4024 1922 11144
NM_007146chr1722319 1025 1889 ----
NM_007147chr191167 --11245 --
NM_007150chrX61361 777 551 313 232 67 --11987 --
NM_007158chr131197 1107 1057 1461 21235 258 1136
NM_007159chr3--21669 143 ----
NM_007166chr1131501 1367 1171 ------
NM_007167chr1150 1115 1825 --
NM_007172chr22103292 2964 2855 2722 2636 2164 658 513 374 73 12370 --1917
NM_007173chr1152161 1802 1578 931 168 ------
NM_007174chr1252318 1890 1808 1546 1479 --1839 --
NM_007175chr853416 2994 2738 2542 190 --13519 --
NM_007191chr123714 218 167 124 ----
NM_007195chr1833551 1486 455 12304 ----
NM_007200chr1563261 2821 1609 1470 1328 1280 23954 3937 --14527
NM_007203chr9104009 3938 3932 3443 3384 3081 3047 2714 2606 1523 --1717 --
NM_007207chr1--1691 ----
NM_007212chr132098 1416 443 11445 11810 12158
NM_007214chr64942 885 849 114 1403 2379 373 --
NM_007216chr1121122 379 ------
NM_007218chr83740 362 275 1756 1903 --
NM_007222chr851780 1603 1503 1439 1427 --21370 1183 --
NM_007235chr121493 ------
NM_007236chr1542138 958 638 584 12423 ----
NM_007246chr421003 189 ------
NM_007249chr1389477 9099 8763 7962 6154 2805 2177 1648 37177 3678 3190 ----
NM_007250chrX--1577 ----
NM_007274chr11126 ------
NM_007276chr731020 280 203 1735 11133 --
NM_007282chr31329 ------
NM_007285chr161194 --1183 --
NM_007292chr1774469 3841 3310 1684 1072 1046 411 1179 1744 --
NM_007308chr42512 103 ------
NM_007315chr241461 1358 475 37 21365 458 ----
NM_007325chrX41871 837 754 229 1718 --12173
NM_007331chr442555 742 488 121 --1781 1790
NM_007345chr1842355 1587 479 114 22255 81 --11747
NM_007347chr1542637 2231 430 368 --12629 --
NM_007350chr1294528 4472 4104 3923 1729 1460 1017 328 167 24378 3605 23764 971 --
NM_007353chr772675 2498 2477 1956 1018 410 281 --32973 1935 456 --
NM_007357chr12449 223 ------
NM_007358chr172001 1942 1482 1255 736 324 78 --21596 663 --
NM_007359chr1711108 11704 ----
NM_007361chr14--1672 ----
NM_007363chrX21032 878 ------
NM_007372chr172910 713 ------
NM_007373chr1061796 1619 1525 534 396 195 ------
NM_007374chr141383 1377 ----
NM_007375chr162634 2032 1838 1022 921 192 22388 385 --11984
NM_012064chr121284 1990 ----
NM_012081chr593693 3495 3152 2939 2807 2740 1274 1017 281 --43230 3142 3043 963 --
NM_012082chr81329 --1788 --
NM_012090chr13818 496 336 11109 ----
NM_012095chr1063327 2968 2920 885 755 505 --12636 1172
NM_012096chr353500 2649 1509 1471 866 12367 1106 --
NM_012097chr261755 1726 1670 1663 1473 193 11911 1315 --
NM_012104chr1173222 3119 3095 2521 2414 1312 481 --21044 676 --
NM_012104chr1173222 3119 3095 2521 2414 1312 481 --21044 676 --
NM_012115chr62621 528 171 ----
NM_012120chr661993 1924 1832 1056 995 294 ------
NM_012129chr762248 2103 2044 943 701 155 ------
NM_012141chr1353313 2635 1371 1040 715 13906 11576 --
NM_012153chr1152473 2197 1734 923 224 ------
NM_012155chr192224 183 ------
NM_012157chr31165 --1942 --
NM_012158chr1321141 164 --2663 58 11263
NM_012160chr62524 37 188 ----
NM_012161chr431080 931 47 1267 2836 377 1324
NM_012164chr9147245 7000 6671 6477 6239 6065 5847 2939 2687 2508 969 658 379 182 37361 6309 304 12636 --
NM_012175chr112667 178 1280 ----
NM_012183chr11237 --1455 --
NM_012193chr11105455 4964 4919 4786 4536 1965 1714 1661 1465 228 --31213 492 79 --
NM_012197chr911613 1524 ----
NM_012199chr164663 3874 3784 3321 953 40 24550 546 --1728
NM_012207chr1021024 825 --1954 --
NM_012210chr921304 278 1364 --1202
NM_012215chr1061783 1773 1671 1661 1408 1343 11440 ----
NM_012218chr1962340 823 398 380 256 248 --2412 62 --
NM_012219chr352370 870 564 183 163 ------
NM_012223chr241285 1060 105 65 --1969 1168
NM_012224chr421045 865 ------
NM_012229chr103596 564 500 11317 ----
NM_012234chr383754 3259 2516 2457 1253 1206 463 214 33717 2897 818 23344 1002 --
NM_012238chr1041537 1362 687 353 21756 1596 ----
NM_012242chr101547 --1157 --
NM_012245chr141181 1420 ----
NM_012247chr102680 295 ------
NM_012249chr263181 2897 2502 2489 2477 551 23595 331 ----
NM_012250chr1121197 298 ------
NM_012252chr795142 4825 4622 4472 4410 3642 1219 938 86 1297 11835 --
NM_012255chr20186 --146 --
NM_012257chr72941 330 ------
NM_012259chr631247 565 422 ------
NM_012262chr1125014 4688 4419 4128 4119 3918 1995 1979 1648 1543 1123 912 44942 4506 925 567 24000 721 --
NM_012281chr742227 2196 1593 863 ------
NM_012286chrX--1143 ----
NM_012287chr394291 3787 3636 3543 1707 1481 924 505 451 53800 2948 1639 808 84 24447 1098 --
NM_012288chr655712 4876 3905 637 270 25696 3681 --11335
NM_012290chr251646 1154 571 524 383 ------
NM_012291chr121109 ------
NM_012294chr793814 3520 3485 3351 3249 2903 709 389 293 --32656 406 103 --
NM_012297chr462479 2465 2411 2063 2021 79 --11968 12336
NM_012300chr561789 1775 563 454 370 316 22271 1007 12398 11937
NM_012301chr731977 890 227 2730 74 1292 --
NM_012302chr11883 2825 401 ----
NM_012307chr184895 818 696 280 ------
NM_012308chr1132044 1695 869 ------
NM_012309chr11104595 4456 3982 3737 1540 1374 1164 696 296 239 --1687 --
NM_012317chrX2669 563 ------
NM_012327chr1861566 1500 1367 1090 996 444 --11074 --
NM_012328chr731464 1066 582 ------
NM_012329chr1741581 1241 662 491 21406 1270 1620 --
NM_012330chr104728 651 534 367 2571 349 ----
NM_012333chr121266 1227 --1623 --
NM_012334chr5103450 3209 3144 1795 1759 1463 929 817 744 111 34511 2974 1140 24775 224 11269
NM_012338chr721095 38 1143 ----
NM_012341chr102470 131 ------
NM_012382chr5104529 4126 3114 1708 1662 1390 772 694 360 55 1179 --1856
NM_012388chr1583081 2701 2523 2036 1019 815 523 199 ------
NM_012399chr2231359 1339 703 ------
NM_012405chr183473 3379 3078 2534 749 701 542 102 33164 1147 470 13023 11167
NM_012412chr71233 --1790 --
NM_012416chr931114 496 177 ------
NM_012417chr17291 28 ------
NM_012425chr1052156 1006 668 407 281 ------
NM_012426chr162477 360 ------
NM_012431chr763265 3197 2909 1427 1081 623 22627 383 ----
NM_012434chr6------11643
NM_012446chr52565 473 ------
NM_012448chr172644 626 167 ----
NM_012454chr62391 384 ------
NM_012464chr442933 1129 267 92 --11793 --
NM_012471chrX61930 1604 1361 628 296 171 ------
NM_012482chr12624 49 1284 --1718
NM_013229chr1241724 1045 606 163 22361 485 ----
NM_013230chrY31696 598 374 11756 1540 --
NM_013231chr1473988 3935 3678 3568 1527 663 209 12748 ----
NM_013233chr21203 --11031 1528
NM_013238chr1331849 1691 1414 21653 441 ----
NM_013242chr161352 ------
NM_013253chr113397 266 68 1310 --11302
NM_013254chr12--1665 ----
NM_013255chr7128583 8566 6456 6322 5642 2572 2482 1981 1898 1570 1501 142 33153 2284 2107 58758 6607 6252 1366 972 --
NM_013257chr822233 404 --11598 --
NM_013261chr453708 3190 2960 2918 674 --21483 260 --
NM_013262chr621007 926 1494 ----
NM_013264chr11189 ----1144
NM_013269chr1211531 34041 1565 786 ----
NM_013277chr1261095 966 724 225 144 113 ------
NM_013281chr2011347 11080 ----
NM_013283chr52799 82 1868 ----
NM_013286chr332979 1425 979 --23415 3000 --
NM_013293chr72486 258 ------
NM_013309chr1522274 544 ------
NM_013316chr73922 823 693 1721 ----
NM_013322chr741614 1604 1194 303 1285 ----
NM_013323chr1741210 904 422 326 ------
NM_013330chr1--197 ----
NM_013336chr332011 1300 597 1287 ----
NM_013341chr252581 2503 1849 374 250 1142 1207 --
NM_013354chr841458 463 425 59 --1396 --
NM_013357chr83832 804 82 ----1672
NM_013372chr1531186 942 414 32152 1219 251 ----
NM_013373chr222997 720 ------
NM_013374chr352980 2206 789 624 379 --12264 --
NM_013380chr19----2808 662 --
NM_013390chr931754 1657 1550 ----1511
NM_013396chr2131547 316 95 --1422 --
NM_013400chr721091 664 ------
NM_013423chrX11105 --31010 796 518 --
NM_013427chrX11105 --31010 796 518 --
NM_013436chr2296 50 1757 ----
NM_013437chr831232 1014 968 11384 184 --
NM_013438chr951815 1698 1280 468 73 11253 ----
NM_013446chr741104 983 366 226 11342 ----
NM_013448chr141184 1614 1707 --
NM_013449chr1252508 2482 2104 577 277 ------
NM_013450chr221105 916 1498 11186 --
NM_013943chr173085 2741 2522 2414 1192 600 563 12349 ----
NM_013986chr22--165 ----
NM_013989chr1485056 4767 4757 4057 3883 3828 1958 1385 2320 32 11573 --
NM_013993chr61854 ------
NM_013994chr61854 ------
NM_013995chrX52493 2312 2101 775 643 --12426 12191
NM_014000chr1031701 1569 469 --1540 --
NM_014010chr92434 407 ------
NM_014011chr232225 396 93 22368 698 22305 449 --
NM_014016chr321611 1241 ------
NM_014023chr1092880 2865 2731 2451 2075 763 622 117 62 --12832 --
NM_014028chr653366 3207 1255 704 352 --11184 --
NM_014034chr631366 1267 1038 ------
NM_014038chr72422 405 ------
NM_014043chr321613 1230 --11090 --
NM_014048chr1684878 4855 3454 3239 1968 1220 971 67 14636 24448 4345 14474
NM_014055chr123192 130 27 --1443 --
NM_014059chr132342 270 ------
NM_014089chr1341876 1847 874 109 12282 ----
NM_014106chr1531958 391 172 11881 11069 --
NM_014110chr131035 1024 774 --1980 --
NM_014112chr865386 4679 3586 2042 1913 1192 --15513 --
NM_014117chr1632490 537 188 --1634 1731
NM_014141chr794283 3445 2062 1990 1006 827 555 343 206 33546 1884 991 15095 15371
NM_014154chr321230 1116 --1372 --
NM_014155chr11147576 7500 7274 7043 6960 6671 5324 3025 2168 1650 1070 754 295 276 36693 5637 4653 36927 2830 812 --
NM_014170chr32324 315 193 147 1136
NM_014171chr2125 195 ----
NM_014178chr14160 ------
NM_014181chr242504 2293 1984 520 1674 11821 --
NM_014203chr19164 ------
NM_014211chr541441 1127 541 461 ------
NM_014231chr122732 470 --1801 --
NM_014232chr1711592 --1200 --
NM_014232chr1711592 --1200 --
NM_014233chr1722166 1662 11901 ----
NM_014236chr1--1226 ----
NM_014241chr102304 281 ----163
NM_014243chr442066 1616 1412 329 ------
NM_014245chr311026 11099 1172 --
NM_014250chr2222046 2031 1103 --11655
NM_014253chrX52336 1704 949 788 260 22476 2305 ----
NM_014263chr102127 33 ------
NM_014264chr41449 ------
NM_014271chrX2224 186 --1318 --
NM_014278chr43492 144 131 ------
NM_014282chr92883 432 11256 ----
NM_014283chr131349 1331 1008 1478 2333 185 --
NM_014290chr91158 1165 ----
NM_014299chr19--12118 1534 --
NM_014300chr15140 ------
NM_014302chr7122 ------
NM_014309chr22105372 5310 5224 5167 4868 3937 3326 2132 1137 664 34568 3721 3690 --13545
NM_014313chr151510 1473 1289 519 430 ------
NM_014315chr14--1117 ----
NM_014319chr1292001 1386 1278 653 617 571 240 206 60 ------
NM_014325chr122231 216 21954 244 1438 --
NM_014331chr466783 6117 2280 1205 985 383 26292 541 46793 5294 5135 713 --
NM_014332chrX1361 ------
NM_014333chr111458 ------
NM_014335chr1541363 1215 572 83 2951 255 ----
NM_014337chr2232344 2325 603 --12072 --
NM_014342chr112942 322 11448 ----
NM_014344chr111132 --1769 --
NM_014350chr51162 ------
NM_014361chr11134 ----1106
NM_014363chr131919 ------
NM_014372chr141502 1322 775 432 ----1481
NM_014374chr721091 664 ------
NM_014376chr511010 12333 --32343 1707 820
NM_014382chr381767 1706 1396 1209 665 544 388 215 --11357 --
NM_014392chr421224 140 ------
NM_014393chr842306 806 584 548 22117 115 --12031
NM_014394chr103967 909 87 --1413 --
NM_014397chr91546 ------
NM_014415chr351263 577 519 402 390 21479 1409 ----
NM_014423chr595598 5209 4653 4613 4055 2177 2015 1596 111 24988 1637 34026 1474 437 --
NM_014431chr1021691 567 11454 ----
NM_014445chr341621 524 285 172 22432 1721 --1555
NM_014447chr441479 1329 1227 644 21256 180 --1130
NM_014452chr61278 1922 1916 --
NM_014456chr1051742 1256 439 293 74 --1373 --
NM_014458chr111172 1209 165 152
NM_014462chr81103 ------
NM_014469chr111190 ------
NM_014470chr122737 104 ------
NM_014488chr111664 1595 ----
NM_014494chr1652372 1547 709 596 386 12317 --12254
NM_014503chr121400 ------
NM_014507chr222903 878 ----195
NM_014515chr12--1110 ----
NM_014516chr19----1269 --
NM_014517chr361810 1711 1612 1508 694 391 11704 --11494
NM_014548chr151191 ----1408
NM_014554chr1262162 1750 1729 1511 1477 616 12317 ----
NM_014570chr225913 828 253 182 92 ------
NM_014574chr1471418 1401 1391 1268 587 431 309 1504 11187 --
NM_014575chr31456 --1546 1356
NM_014577chr225759 593 269 149 137 1775 ----
NM_014583chr32512 326 ------
NM_014585chr23954 900 369 11075 ----
NM_014586chr2174647 4501 4484 4215 4114 3731 1803 --14773 --
NM_014591chr1021307 884 ------
NM_014606chr411463 21572 245 ----
NM_014607chr24824 538 482 87 1545 11535 --
NM_014612chr941434 1102 492 437 1451 --1178
NM_014613chr573110 2528 2243 1213 990 883 511 11104 ----
NM_014614chr221059 603 ----188
NM_014615chr1672625 1356 1265 816 646 585 234 --11375 --
NM_014616chr383248 3154 3001 2318 2308 2268 1370 467 22598 840 ----
NM_014620chr121824 ------
NM_014634chr2221069 746 --23553 3433 1959
NM_014635chr231493 1301 551 21149 372 1637 --
NM_014636chr954039 3189 1413 1135 399 2593 580 13227 --
NM_014637chr851353 1055 1016 360 261 11484 1191 --
NM_014644chr111024 ------
NM_014646chr1852678 2527 2004 1253 1000 ----13149
NM_014647chr1621631 682 ----1169
NM_014649chr19121 ------
NM_014655chr142351 2170 772 383 1675 --12034
NM_014659chr1511091 --1309 --
NM_014660chr71821 1811 --21006 992
NM_014666chr531193 474 143 ------
NM_014667chr341565 1558 1524 363 2823 805 21726 646 154
NM_014670chr221543 118 1192 --1345
NM_014671chr721427 272 --1317 --
NM_014674chr3103864 3717 3461 3008 2998 2586 2574 2496 1103 693 --22691 306 13724
NM_014676chr141362 1212 425 237 ----1369
NM_014677chr821191 1096 ------
NM_014679chr1151253 1014 487 288 147 11176 --1206
NM_014682chr82894 334 2775 454 --11798
NM_014683chr1742186 1991 1756 828 ------
NM_014685chr163509 452 100 133 1576 1226
NM_014686chr1952587 2093 1994 1826 469 12166 1701 --
NM_014689chr2196 ------
NM_014701chr1582796 2557 2418 2389 2151 1262 163 135 12808 11102 --
NM_014702chr693348 2775 2405 1350 927 905 728 432 213 33433 944 759 ----
NM_014705chr721763 1735 11847 11720 --
NM_014707chr742306 1688 1512 377 2583 245 ----
NM_014709chr25567 509 254 225 67 ------
NM_014711chr1662093 1926 1847 1799 1724 1365 --11870 --
NM_014713chr23208 148 39 ------
NM_014721chr687260 7066 6308 6136 5502 2899 1440 1279 11835 27146 5906 1273
NM_014729chr852216 1856 1654 644 65 ----12163
NM_014730chr1295287 5187 4628 3944 3938 3876 1667 1215 765 45295 5142 3406 3287 44135 3357 2022 611 --
NM_014730chr1295287 5187 4628 3944 3938 3876 1667 1215 765 45295 5142 3406 3287 44135 3357 2022 611 --
NM_014731chr2011375 --11710 --
NM_014733chr551973 736 632 459 387 --31686 212 124 --
NM_014735chrX72088 1445 1300 860 278 169 145 ------
NM_014739chr6103916 3667 2642 1266 1130 1116 1055 627 353 281 24001 138 23566 579 22988 840
NM_014742chr201217 1330 ----
NM_014743chr452170 2162 2135 1053 414 --22568 399 --
NM_014749chr142257 165 144 ----
NM_014751chr862103 2059 1895 1879 1658 405 21622 1513 ----
NM_014752chr1151397 713 512 443 258 11916 2593 319 --
NM_014754chr8--1955 ----
NM_014755chr2114096 4000 3474 3350 3040 1679 1588 1487 1296 710 139 33297 823 147 24278 366 13024
NM_014756chr112365 330 --134 --
NM_014757chr562370 2103 1976 1756 847 583 --12239 --
NM_014764chr122915 72 ------
NM_014765chr152330 2070 1918 1043 328 12011 22671 2122 --
NM_014767chr1032594 2424 893 1335 --13222
NM_014774chr133152 1245 1173 12515 23235 987 --
NM_014776chr1252950 2934 966 586 38 ------
NM_014779chr35438 421 294 151 101 ------
NM_014793chr15147 ----1537
NM_014800chr741108 1018 999 988 ------
NM_014803chr1082802 2747 2669 2574 2560 917 583 198 12967 22631 2414 22392 1172
NM_014810chr143386 3055 2479 1197 11139 ----
NM_014811chr92276 192 ------
NM_014812chr12746 248 41677 1645 1415 731 ----
NM_014819chr532407 2046 313 ----1590
NM_014820chr331851 818 196 --21357 559 --
NM_014822chr4189 --1152 --
NM_014826chr194212 4177 4101 3149 2971 2769 2737 1642 1224 ----23319 848
NM_014827chr141220 1054 341 335 21703 665 --1529
NM_014829chr51509 --22202 1532 1909
NM_014830chr1263817 3289 2398 1283 624 338 --31111 646 320 --
NM_014835chr201659 --21621 459 --
NM_014836chr1051801 1487 1281 1243 317 ------
NM_014838chr22112721 2403 2311 650 493 428 350 305 286 276 195 1410 ----
NM_014839chr192336 2092 2029 1899 1864 1676 738 573 226 ------
NM_014840chr1283274 2968 2839 2727 2651 2435 1318 235 21293 1063 ----
NM_014841chr611333 ----11077
NM_014848chr1542712 2581 1943 606 ----11782
NM_014849chr121295 205 ------
NM_014870chr174748 4732 4536 1764 1477 1382 1050 ------
NM_014871chr122636 596 ------
NM_014873chr144418 4179 3856 915 1218 ----
NM_014874chr151850 1190 758 281 271 ------
NM_014876chr2242179 1598 243 111 --1872 --
NM_014877chr17177673 7633 7220 6888 6758 6582 6206 5902 5650 2973 2237 2161 1947 1739 520 214 135 65183 2593 1236 937 105 35 56751 4866 2328 571 512 --
NM_014884chr192174 67 ------
NM_014885chr4142 ------
NM_014887chr134864 711 587 331 ------
NM_014893chrY61470 933 864 767 669 455 1245 12341 --
NM_014897chr1762629 2053 1170 871 582 447 ----12181
NM_014898chr191248 --1124 --
NM_014899chr552682 2430 635 270 210 --13146 1999
NM_014900chr22225 137 1885 11084 --
NM_014901chr531937 1556 789 ------
NM_014902chr2041180 510 158 74 --1179 --
NM_014903chr1252308 1905 765 754 656 21748 1682 1720 --
NM_014904chr1063714 3311 3292 2960 1132 743 12626 1137 12799
NM_014905chr251960 1910 1843 755 129 11798 ----
NM_014906chr1743913 3500 3396 325 33426 834 776 ----
NM_014909chr1421427 220 ------
NM_014912chr1033437 992 688 --23455 2355 --
NM_014916chr72724 597 ------
NM_014918chr1571615 1330 1249 1128 509 144 74 1434 ----
NM_014920chr64628 280 197 163 ------
NM_014921chr1952826 2152 1116 1016 358 ----13077
NM_014923chr13--21497 361 22379 1552 --
NM_014924chr1442986 2806 706 469 12198 21016 394 --
NM_014926chr341165 1149 449 403 --11006 --
NM_014932chr34694 421 404 70 ------
NM_014937chr104885 488 435 31 1126 11220 --
NM_014939chr1861271 598 586 476 57 41 1576 1404 --
NM_014946chr242697 2567 1094 500 --12457 --
NM_014947chr163002 2934 2753 437 395 255 32987 2279 1958 12038 --
NM_014949chr13996 237 21 --1359 --
NM_014951chr1032617 1972 38 ------
NM_014953chr1344183 3736 3641 750 --14132 14215
NM_014961chr442202 2171 1933 1744 ------
NM_014962chr2082451 2419 1003 886 514 455 301 225 11781 ----
NM_014964chr172709 110 1792 --1551
NM_014969chr1----2987 347 --
NM_014974chr1031799 1159 556 1425 ----
NM_014977chr141581 ------
NM_014978chr1051781 1373 1356 557 251 --1147 --
NM_014982chr1454287 4092 3738 3462 285 1309 14856 --
NM_014988chr452819 1893 1783 356 269 ------
NM_014989chr651619 673 512 473 127 11791 ----
NM_014992chr141647 ----1554
NM_014996chr36853 784 700 665 81 58 ------
NM_014997chr722313 811 31141 842 606 11996 --
NM_015000chr1222953 416 2540 324 22517 2159 12685
NM_015001chr12979 208 ------
NM_015008chr3103479 3008 2544 2342 2292 2220 1101 528 194 86 --23288 1394 --
NM_015009chr34771 620 225 82 ------
NM_015011chr132457 401 ------
NM_015017chr131250 254 97 --11018 1198
NM_015018chr6180 ------
NM_015020chr1633521 3107 778 12593 1273 --
NM_015023chr121324 172 11396 --11337
NM_015024chr811319 --1492 --
NM_015025chr272270 1962 603 551 354 338 179 1155 --1415
NM_015026chr1263991 3684 3564 3323 1545 871 1211 --1787
NM_015027chr1651821 1601 706 364 154 ------
NM_015032chr1372675 2350 1179 859 813 310 170 21991 325 22024 37 --
NM_015035chr20115959 5195 4963 4362 4287 1838 1612 1586 712 628 313 16469 26061 1237 1947
NM_015039chr144249 4194 1624 1544 --34358 3228 1554 --
NM_015040chr283182 2864 2632 2600 924 537 116 79 22204 329 12816 13164
NM_015042chr1574363 4311 4024 3885 3212 1465 499 33187 3065 1317 33826 1415 1373 --
NM_015045chr1031871 518 304 ----12054
NM_015051chr973369 3277 2989 2296 1117 488 467 --1263 12504
NM_015055chr1162927 2780 2665 2537 2450 411 --283 57 --
NM_015061chr93836 256 87 1825 ----
NM_015062chr101107 ------
NM_015064chr1252929 2486 937 550 375 13373 21426 1280 --
NM_015068chr763386 2857 2739 2628 1513 316 1784 11449 --
NM_015071chr5116474 6395 5720 5513 5158 4696 2207 2184 2074 2003 1962 22404 1772 45371 2391 1727 31 --
NM_015074chr1104814 3783 1892 1869 1820 1655 1548 1427 721 666 14276 ----
NM_015076chr6114435 4349 3959 3312 3273 3103 1807 1139 926 651 381 21492 1372 33384 811 411 --
NM_015080chr111925 --1298 --
NM_015091chr143786 748 706 --1614 --
NM_015092chr1684501 4292 3729 3699 3316 3028 2934 1306 --24084 1089 --
NM_015093chr671777 1766 1618 1197 629 390 377 21563 662 ----
NM_015097chr341657 1471 762 440 11958 21691 117 1367
NM_015100chr141726 1491 1335 409 1683 11667 --
NM_015107chrX21906 765 --11681 --
NM_015110chr932514 1885 1783 1645 1563 1345
NM_015115chr453187 1042 947 194 44 1565 12058 12848
NM_015124chr2262528 2254 2019 1582 158 106 ------
NM_015129chrX41606 1482 1438 73 11752 --11816
NM_015130chr42386 73 11039 ----
NM_015132chr731343 1235 576 31800 1354 684 21585 794 21492 1305
NM_015137chr852619 492 476 157 64 41040 768 291 219 12407 --
NM_015138chr1532524 1034 244 32155 1884 1836 11934 --
NM_015139chr1139 ------
NM_015143chr411398 11303 ----
NM_015144chr1693941 3863 3699 3272 3188 2791 951 645 116 1841 --1806
NM_015149chr111464 ------
NM_015153chr63801 502 262 1545 3589 298 233 --
NM_015155chr1022731 346 11131 ----
NM_015156chr1433133 2742 896 11503 12562 --
NM_015158chr92614 146 1342 ----
NM_015161chr1621271 355 ----11518
NM_015163chr1431627 748 409 --31489 569 539 --
NM_015170chr832239 1707 1440 ------
NM_015173chr411180 --1248 --
NM_015176chr151615 1324 1163 1142 108 11275 --11195
NM_015180chr143786 690 166 2799 565 ----
NM_015184chr33678 638 73 ------
NM_015185chrX42841 2670 718 291 ------
NM_015186chr92442 312 1384 ----
NM_015191chr1132566 507 194 11064 1952 --
NM_015192chr2042463 615 585 509 ------
NM_015197chr1453387 3352 2225 2204 529 ------
NM_015199chr343021 2795 1032 573 1561 1170 1158
NM_015200chr462467 2264 955 932 858 359 ------
NM_015203chr11162 ------
NM_015206chr1532574 1101 813 11004 --1193
NM_015208chr1883758 3542 3260 2912 1321 636 477 360 23655 1104 --1494
NM_015209chr122166 734 ------
NM_015213chr111683 1644 ----
NM_015215chr153171 2775 2016 1133 148 32504 2472 587 13045 12186
NM_015229chr1721195 450 ----1763
NM_015231chr113925 806 250 ------
NM_015233chr1371882 1028 824 768 450 310 215 --12189 1699
NM_015236chr4--1321 ----
NM_015238chr5----1710 --
NM_015239chr91185 ------
NM_015245chr622585 1113 --22725 859 --
NM_015247chr1685226 5034 4535 1461 1344 752 546 442 14865 33638 3520 1376 23454 263
NM_015250chr921269 834 1534 1512 1189
NM_015251chr1662329 2071 1999 1597 1560 604 ----2595 539
NM_015265chr252542 1946 557 115 70 11653 --12092
NM_015267chr1221993 1756 ------
NM_015269chr11237 1451 ----
NM_015271chr4104234 4060 4005 3881 3277 2756 1353 831 356 90 13559 2888 234 --
NM_015272chr1652047 1815 1805 645 151 11499 22165 451 --
NM_015275chr121521 52013 668 639 494 145 ----
NM_015277chr1811298 11502 ----
NM_015278chr652415 1231 715 608 586 23350 905 --22728 2347
NM_015285chr1852329 1615 660 244 31 ------
NM_015288chr552658 2371 1528 150 128 ------
NM_015293chr63705 630 543 1532 1120 --
NM_015296chr133952 340 158 ----11025
NM_015305chr1411613 11933 --11843
NM_015308chr112891 147 2828 210 171 --
NM_015310chr8138303 8112 7914 7786 7694 7231 6560 5871 5249 5199 2977 1018 314 36346 5148 189 57584 7513 6764 1415 403 --
NM_015313chr1184711 4563 4341 3367 3339 3182 2935 2927 24373 404 44182 3225 423 285 --
NM_015314chr762304 2168 1967 561 486 449 12367 1949 42192 2099 2092 699
NM_015315chr543429 3249 2421 723 ----1302
NM_015317chr252689 2337 1970 1793 338 1640 1877 --
NM_015326chr172923 2116 1965 833 824 724 383 11118 31079 965 923 --
NM_015328chr772877 2760 2635 951 680 547 374 --1772 --
NM_015330chr2252385 791 766 676 266 --12510 --
NM_015335chr1262189 2037 2011 1907 542 298 --1941 --
NM_015336chr1232454 1892 662 31966 1764 442 --1356
NM_015339chr20----1914 --
NM_015344chr881971 1685 1653 1601 873 813 609 452 ------
NM_015346chr1461878 1560 1493 555 480 454 ------
NM_015347chr1252838 1837 1083 1051 701 --1399 --
NM_015349chr672908 2856 2289 2064 920 494 463 --12590 --
NM_015350chr11510 ------
NM_015354chr91368 ------
NM_015355chr1721501 1322 11605 ----
NM_015358chr216996 957 889 314 79 55 --21074 335 --
NM_015359chr822941 1911 32693 1984 1172 22345 1818 --
NM_015361chr23815 279 128 ------
NM_015365chrX104280 4190 3922 3053 2995 2626 460 428 285 199 --11227 --
NM_015367chr2221235 437 11619 ----
NM_015375chr154980 4139 3995 3907 1394 14733 13187 --
NM_015381chr2222022 739 1791 ----
NM_015382chr141151 1131 1698 --
NM_015385chr1072963 2821 2253 2109 1985 852 791 ------
NM_015387chr24758 501 439 395 21528 483 ----
NM_015394chr123793 768 479 --1672 --
NM_015397chr931481 238 102 --1572 --
NM_015409chr123792 346 62 22658 1839 ----
NM_015419chrX31092 875 419 ------
NM_015423chr1131396 1340 104 11144 ----
NM_015428chr1951707 1356 537 521 333 ------
NM_015429chr331153 729 176 ------
NM_015435chr841005 976 591 368 1196 ----
NM_015436chr483041 720 560 548 537 452 246 54 1318 21157 312 --
NM_015439chr6--1511 ----
NM_015443chr1721390 106 1160 ----
NM_015446chr111133 --1319 --
NM_015455chr543636 2546 1074 194 32845 2756 1279 23158 2815 11479
NM_015458chr8164972 4279 3683 3553 3258 1901 1855 1808 1718 1381 1281 1026 931 533 308 107 33711 3234 1114 --13638
NM_015461chr18159 ----1632
NM_015464chr75896 685 187 172 45 1120 --1251
NM_015475chr251079 975 804 352 330 1854 ----
NM_015483chr72420 41 ----1725
NM_015503chr16--1695 ----
NM_015508chr331533 990 471 --11578 1173
NM_015509chr121253 11098 11070 --
NM_015520chr312819 12421 22663 2457 --
NM_015530chr2------1700
NM_015534chr13401 387 242 ----1437
NM_015535chr293507 3302 2592 1124 910 468 184 35 24 12835 ----
NM_015542chr101918 ----1391
NM_015550chr743048 1178 1093 994 23539 2433 --32311 1117 293
NM_015553chr635061 1600 742 21973 893 44989 4398 1699 1359 14886
NM_015554chr1582949 2927 2387 2373 1979 1818 1007 829 22399 2302 12834 1913
NM_015555chr631567 1113 428 21671 588 ----
NM_015564chr532861 2841 130 1790 ----
NM_015565chr2131603 376 184 --11865 --
NM_015567chr1341031 1023 447 26 1256 ----
NM_015568chr2054326 3604 1246 950 502 --14097 --
NM_015569chr174628 3956 1269 1012 312 302 212 24431 3190 2889 124 13357
NM_015571chr642479 1886 879 236 12522 12270 12605
NM_015575chr263569 3480 2578 2450 2397 133 13289 ----
NM_015576chr332488 166 29 11810 ----
NM_015577chr531785 427 320 11517 ----
NM_015578chr1921865 779 ------
NM_015599chr6----1275 --
NM_015601chr102826 799 11018 2869 258 --
NM_015602chr131640 1481 1359 ------
NM_015609chr132363 2120 541 12997 ----
NM_015622chr71282 ------
NM_015626chr1721234 150 --164 --
NM_015630chr221043 965 2813 343 ----
NM_015640chr1135388 5252 5056 4673 4380 3324 1998 1875 1346 444 349 201 55 44809 433 411 151 33246 1115 846 21475 542
NM_015641chr731124 1021 238 ------
NM_015642chr31213 ------
NM_015646chr1221072 1049 21311 521 ----
NM_015652chr101253 1233 ----
NM_015660chr7----1248 --
NM_015678chr1311668 --11441 1357
NM_015691chrX62783 2697 2038 280 268 42 12817 ----
NM_015695chr631398 157 128 11378 ----
NM_015702chr2179 ----1298
NM_015723chr72573 200 --1228 --
NM_015836chr171329 1222 149 129 93 68 29 ----1158
NM_015850chr841675 831 527 347 22242 2062 ----
NM_015852chr7101085 1001 833 749 581 497 413 329 245 161 ------
NM_015866chr11376 ------
NM_015874chr42505 246 --1404 --
NM_015878chr872217 2076 1705 680 618 340 158 1472 ----
NM_015879chr18108649 7242 6099 5922 5586 2884 2769 2751 1400 573 --56727 5981 5649 5546 160 12103
NM_015881chr113397 266 68 1310 --11302
NM_015885chr11----1644 --
NM_015886chr885728 5430 4047 3968 3943 3500 2055 1602 24175 1866 25606 4644 --
NM_015888chr11494 12207 ----
NM_015891chr611446 1770 --21882 488
NM_015902chr81821 ------
NM_015904chr22830 532 2815 270 ----
NM_015905chr7--1409 1419 --
NM_015906chr1104863 4702 3357 3106 1801 896 832 602 569 140 13688 13473 14799
NM_015955chr23404 366 187 ------
NM_015960chr10--1119 --179
NM_015975chrX21284 88 --11486 --
NM_015976chr1--2351 247 ----
NM_015981chr543174 3054 947 931 --1708 --
NM_015982chr173423 128 54 ------
NM_015990chr421025 811 ------
NM_015995chr1535117 4728 333 15540 --14585
NM_015997chr1------1174
NM_015999chr1------2654 579
NM_016009chr183823 3260 1784 1704 1285 727 318 190 34943 1806 1492 11621 --
NM_016013chr15124 ------
NM_016018chr842595 2439 357 34 --11870 11084
NM_016019chr71736 --2357 229 --
NM_016021chr652952 2594 2555 1214 235 2814 342 1853 --
NM_016022chr12994 140 1848 1171 --
NM_016023chr842168 1633 1489 688 2564 30 31765 515 116 --
NM_016025chr1621974 1592 1408 ----
NM_016032chrX2358 165 ------
NM_016037chr121140 737 ------
NM_016045chr2071579 1508 1190 738 628 313 101 ----21231 458
NM_016048chr52380 329 1704 ----
NM_016061chr231605 1020 332 ------
NM_016072chr1222028 669 12362 --12037
NM_016073chr151963 ------
NM_016075chr1343041 2475 459 319 22740 1007 12187 --
NM_016076chr153005 2712 2311 251 125 12509 12559 --
NM_016078chr1761049 435 163 150 104 23 ----11100
NM_016079chr232269 519 352 ------
NM_016081chr442276 2250 1857 791 21676 1606 ----
NM_016083chr6----12760 --
NM_016087chr7----11154 --
NM_016090chr114755 218 199 167 --199 --
NM_016096chr861753 1728 1703 1639 1369 336 11653 ----
NM_016097chr181365 --11009 --
NM_016100chr20141 ----1386
NM_016103chr53463 378 199 ------
NM_016107chr51128 11373 ----
NM_016120chrX31162 1037 157 ------
NM_016121chr1178 ----1739
NM_016125chr171115 1175 ----
NM_016131chr272248 2094 2001 1920 1521 1453 783 1699 22227 678 --
NM_016132chr1593357 3145 2938 2635 2280 930 367 312 129 1434 22976 450 1801
NM_016133chr231214 661 106 1376 --11382
NM_016142chr1131192 1135 497 --21360 329 1924
NM_016152chr33863 135 91 ------
NM_016156chr1141546 1495 833 378 ------
NM_016166chr15180 --1182 --
NM_016192chr21242 ------
NM_016195chr102183 123 ------
NM_016200chr7176 ------
NM_016201chr332199 2151 1425 --12096 --
NM_016203chr71269 1758 ----
NM_016206chr3148472 8412 6959 6200 5643 5440 3135 3033 2088 1560 1234 735 707 283 1778 11569 28618 8228
NM_016213chr15138 ------
NM_016217chr673641 3395 3040 2868 2372 2338 749 11223 12838 1266
NM_016220chr751992 580 496 416 164 ------
NM_016224chr631609 838 781 ------
NM_016227chr131349 1331 1008 1478 2333 185 --
NM_016231chr173309 234 41 ----21454 114
NM_016239chr171755 ------
NM_016248chr1393896 3041 2617 1607 1066 994 542 144 132 23661 816 ----
NM_016252chr21819 ------
NM_016255chr673016 2928 1341 1264 1232 760 573 ----1318
NM_016260chr2177607 7172 6991 5969 5801 5465 5168 5070 4982 4788 2912 2495 1062 784 708 593 383 26087 290 37298 4991 2781 16641
NM_016264chr19135 ------
NM_016270chr191486 ------
NM_016271chr1852346 2044 1992 1540 125 11986 12308 1206
NM_016272chr2252559 1076 764 280 241 ------
NM_016275chr342422 2215 1091 231 ----12035
NM_016277chr651535 1515 1387 1329 399 ----11040
NM_016281chr1231163 1083 778 1350 --1302
NM_016287chr131837 1735 77 --3545 306 166 --
NM_016289chr241836 871 616 201 11627 1462 --
NM_016290chr51187 --198 --
NM_016299chr101113 ------
NM_016300chr31440 ------
NM_016303chrX1116 --1453 --
NM_016308chr161976 1928 1893 1843 1763 1734 148 2664 558 1387
NM_016315chr221597 669 ------
NM_016322chr973117 2825 2177 1991 1255 1105 336 --22269 603 --
NM_016328chr7199 ------
NM_016338chr521114 1040 ------
NM_016356chr662846 2622 2248 977 871 316 22810 209 22942 2856 --
NM_016374chr131241 629 270 21250 476 ----
NM_016374chr131241 629 270 21250 476 ----
NM_016377chr621399 600 --1716 --
NM_016383chrX----1745 --
NM_016395chr1531369 321 85 1641 21847 59 --
NM_016396chr1572972 2932 2168 611 576 551 453 12818 ----
NM_016400chr15----173 --
NM_016418chr2233695 2853 2504 23835 297 ----
NM_016422chr1132377 1252 204 23110 761 12709 --
NM_016424chr1751842 1661 524 516 68 31385 474 429 12013 --
NM_016436chr2032478 1711 637 12673 --11795
NM_016441chr251710 898 867 775 226 ------
NM_016445chr142114 103 ------
NM_016463chr5--1168 ----
NM_016480chr53784 731 121 ------
NM_016485chr63873 651 177 1767 1313 189
NM_016488chr1221961 1316 --1191 --
NM_016506chr114725 568 449 162 ------
NM_016507chr1772817 2458 2088 1962 500 388 294 12663 ----
NM_016513chr64628 280 197 163 ------
NM_016522chr1121401 232 ----1183
NM_016525chr92813 665 ------
NM_016530chr15103919 3824 3225 2523 1212 1110 1099 866 500 252 --1602 --
NM_016531chr443338 1470 1100 1036 33148 2669 1196 1844 --
NM_016542chrX51749 1342 1218 402 374 ------
NM_016544chr253738 3238 2948 2555 80 --33595 3530 3022 --
NM_016559chr32995 576 11266 1559 --
NM_016586chr142518 173 ------
NM_016587chr731020 280 203 1735 11133 --
NM_016588chr62745 179 --2680 240 --
NM_016603chr521844 335 11895 12131 --
NM_016605chr542661 2227 579 528 1674 12744 --
NM_016607chrX31673 1631 98 ------
NM_016612chr82473 268 ------
NM_016613chr452405 2379 2286 2047 296 12064 21694 704 --
NM_016620chr121273 219 ------
NM_016621chr1164533 4518 3206 2984 2812 454 --11023 --
NM_016623chr82661 67 ----1511
NM_016626chr1831185 446 112 --11749 --
NM_016631chr21--2928 105 ----
NM_016644chr51453 ------
NM_016647chr811450 ------
NM_016651chr1431135 760 245 1225 1318 --
NM_016653chr231194 120 21 ------
NM_016654chr1541257 1249 1234 215 ----2477 347
NM_016819chr31511 ------
NM_016820chr3126 ------
NM_016824chr1021824 142 41593 603 455 198 --31178 521 222
NM_016834chr1754060 3618 3545 932 157 14099 12802 13895
NM_016835chr1754060 3618 3545 932 157 14099 12802 13895
NM_016836chr25765 726 549 105 86 1677 ----
NM_016839chr25765 726 549 105 86 1677 ----
NM_016841chr1754060 3618 3545 932 157 14099 12802 13895
NM_016929chr634387 3340 347 --13240 11797
NM_016936chr1652138 1949 865 858 670 ------
NM_016937chrX31025 627 344 1223 ----
NM_016946chr112822 12813 ----
NM_016950chr42273 250 2435 186 ----
NM_017412chr831428 1035 322 --1458 --
NM_017420chr1483798 3600 3522 3283 3049 2410 319 104 11097 21448 803 --
NM_017423chr432052 2026 284 1247 11634 --
NM_017426chr41450 ------
NM_017437chr1482014 1773 1682 626 451 286 195 71 ------
NM_017440chr12187 ------
NM_017443chr931551 414 74 --1494 11021
NM_017447chr2163589 3117 3102 2836 1685 1188 34174 3137 626 --11697
NM_017449chr131748 1445 664 ------
NM_017450chr17----11506 --
NM_017456chr1751893 1852 1612 1521 138 ------
NM_017459chr11411 ------
NM_017488chr221179 495 11538 11233 --
NM_017491chr41698 2999 757 1183 --
NM_017519chr61443 --1856 --
NM_017520chr132219 98 ------
NM_017522chr181448 1210 906 897 429 380 221 203 1998 ----
NM_017545chr201561 ------
NM_017548chr321452 1366 1834 --12094
NM_017563chr396046 4340 4124 2335 2157 2019 1499 884 403 56411 5675 4467 4282 2246 24137 1844 1541
NM_017577chr341601 1139 1034 340 ------
NM_017583chr1131600 386 343 1287 31251 1168 171 --
NM_017590chr2222210 537 12632 --2472 303
NM_017599chr1221386 234 --21838 1676 --
NM_017610chr1562076 1553 1491 759 320 195 --12114 11295
NM_017623chr251699 1008 945 113 75 ------
NM_017626chr1041327 1256 690 596 ------
NM_017628chr4125140 5114 5073 4880 4429 4316 1395 1157 1040 1027 192 114 --13833 25032 3544
NM_017629chr1----41902 559 550 540 --
NM_017631chr42578 47 ------
NM_017632chr42113 81 1436 ----
NM_017633chr653616 3446 3026 2452 1279 23754 138 1344 --
NM_017634chr831564 1467 276 --1487 --
NM_017635chr113488 451 326 ----11151
NM_017637chr9189242 8625 8339 7568 7556 7503 6796 6178 3557 3537 3450 3395 2705 2514 2466 760 346 221 28331 1536 36890 2735 2255 11471
NM_017640chr65793 742 357 106 40 ------
NM_017641chr121233 ----1189
NM_017643chr1722207 228 11167 ----
NM_017644chr385067 4993 4848 4327 4074 1379 1085 756 24445 53 --1463
NM_017645chr942658 2541 1928 358 13168 ----
NM_017649chr101958 ----1390
NM_017650chr765802 5720 1918 1809 1684 1557 15094 ----
NM_017657chr2--1827 ----
NM_017658chr14134542 3757 3573 3212 1836 1444 883 773 579 397 165 135 71 23265 481 1286 --
NM_017660chr1923185 245 --13419 --
NM_017661chr1541284 1207 482 207 31247 1150 836 ----
NM_017666chrX32193 1656 148 --1699 11993
NM_017670chr111134 ------
NM_017672chr1521099 374 11121 11113 --
NM_017684chr1551415 1259 164 148 71 22006 715 1111 --
NM_017686chr121094 1065 ------
NM_017693chr1321653 457 --1389 --
NM_017694chr211296 2721 710 ----
NM_017697chr8------1347
NM_017700chr42125 99 ------
NM_017703chr19135 ------
NM_017709chr1104144 4046 3909 3653 3330 3151 1427 1164 899 93 21636 975 --14290
NM_017712chr19115955 5369 4303 2345 2225 2090 1458 1067 645 504 401 ------
NM_017714chr204681 97 83 52 1331 ----
NM_017719chr3181 11620 --11015
NM_017724chr32627 102 ------
NM_017736chr1682153 876 850 452 355 335 162 92 --12466 12287
NM_017737chr13636 531 372 21551 364 --11785
NM_017738chr91357 --11261 --
NM_017740chr1641726 1165 1154 484 --1140 --
NM_017742chr1831756 733 410 ----11629
NM_017744chr132111 1951 784 22250 960 ----
NM_017745chrX3584 240 191 ------
NM_017752chrX32142 1509 169 --12020 --
NM_017753chr941025 883 754 705 --1325 1197
NM_017754chr644440 4075 3645 1044 24703 986 23249 471 --
NM_017769chr1453273 3108 2968 2826 325 22123 853 ----
NM_017770chr632883 1026 86 2180 54 --12168
NM_017772chr651730 1717 1422 1231 496 ------
NM_017778chr811088 1172 --11139
NM_017780chr8----191 --
NM_017784chr351009 797 373 343 22 ------
NM_017786chr82711 639 ------
NM_017787chr1032675 2200 1933 1316 12387 --
NM_017798chr201794 ----1818
NM_017799chr1471494 1328 687 556 453 235 64 ----1372
NM_017811chr932553 1252 947 --13004 --
NM_017813chr8125716 5436 5148 4562 4412 3624 1889 1655 1239 968 835 188 13545 24500 4175 14191
NM_017824chr1072208 2150 1864 1777 1708 781 335 12505 ----
NM_017826chr132809 751 --1785 --
NM_017831chr1844250 3219 3064 186 21076 162 --14079
NM_017845chr41586 --1296 --
NM_017848chrX74002 3722 3319 3142 3021 1658 1452 --31553 548 356 --
NM_017851chr1551257 1150 854 269 218 11066 ----
NM_017857chr112677 652 ------
NM_017880chr21465 ------
NM_017896chr2083547 2988 2930 2413 814 689 569 421 ------
NM_017902chr1054067 3501 1076 535 277 --15732 --
NM_017915chr122825 21 --11160 --
NM_017925chr9170 --11320 11874
NM_017933chr231573 1503 304 --1539 --
NM_017938chrX62056 1971 1909 1741 603 39 22074 719 1109 --
NM_017944chr1183119 2461 2096 1988 1190 1183 977 35 21934 43 --11030
NM_017948chr92477 370 --173 --
NM_017958chr262857 2123 2060 1095 652 90 22027 721 --1105
NM_017964chr21848 1204 ----
NM_017987chr1051998 1969 1618 893 96 ------
NM_017988chr121180 ------
NM_017994chr753007 2771 1968 555 204 12227 ----
NM_017998chr951309 1023 520 386 247 1511 2996 304 --
NM_018003chr1562398 2185 1942 1871 916 31 --1971 --
NM_018004chr32299 21 ------
NM_018008chr3------1278
NM_018015chrX21151 159 21024 48 1133 --
NM_018017chr1062565 2336 1848 672 616 294 12687 2809 484 32758 526 192
NM_018026chr1131276 1243 994 ------
NM_018027chr1012599 12113 23034 206 --
NM_018030chr1831118 942 398 --1329 --
NM_018036chr1474252 3904 3265 2956 1429 1019 712 13670 --1818
NM_018046chr54703 694 147 32 ------
NM_018048chr123671 482 278 --22005 679 --
NM_018060chr11333 ------
NM_018061chr131622 1182 708 1283 ----
NM_018078chr441046 709 420 308 --1930 --
NM_018084chr241294 892 374 242 32420 810 316 22497 1153 --
NM_018086chr251744 1670 1414 1398 368 ----1424
NM_018092chr1641245 450 434 316 ------
NM_018095chr114725 568 449 162 ------
NM_018098chr3--11102 2864 291 --
NM_018112chr941010 979 332 210 2828 695 2383 251 --
NM_018117chr101556 1592 --1264
NM_018120chr871218 454 382 204 144 106 49 --1302 --
NM_018121chr1012231 --12536 --
NM_018126chr461563 1024 509 499 252 181 --21361 1260 --
NM_018133chr342221 1814 1540 311 --2727 51 --
NM_018137chr131188 1024 339 ------
NM_018147chr31258 2213 104 ----
NM_018155chr3113251 2425 2204 1388 1191 1074 1042 971 909 699 131 22866 2625 ----
NM_018157chr1253153 2361 2150 98 34 --22259 2089 --
NM_018159chrX1464 11503 --1573
NM_018168chr1421321 49 137 --11429
NM_018169chr121447 ------
NM_018171chr121216 161 ----
NM_018177chr4196 1375 --1263
NM_018178chr131850 1275 69 --11394 --
NM_018181chr1811899 1775 11834 --
NM_018182chr173551 226 196 11898 --11490
NM_018184chr311586 --12007 21475 257
NM_018191chr132779 170 ------
NM_018195chr111600 21700 476 11641 --
NM_018200chr1562537 1978 1925 1899 683 402 ----1226
NM_018202chr13363 330 180 ------
NM_018206chr162135 52 1667 ----
NM_018211chr121658 1542 32209 1619 603 11384 --
NM_018214chr611196 --21022 396 11014
NM_018221chr22446 352 ------
NM_018223chr1241096 1018 301 25 --2965 158 --
NM_018227chr432272 1205 255 1465 13224 --
NM_018228chr142375 268 ------
NM_018237chr101238 ----1262
NM_018241chr42280 156 ------
NM_018243chr453576 3378 1392 801 301 --183 --
NM_018246chr822453 2173 --22040 1980 22649 146
NM_018247chr643078 2123 1975 64 12591 21966 905 1574
NM_018254chr142136 430 291 186 ----11594
NM_018266chr3--1974 1938 --
NM_018270chr202767 682 1745 ----
NM_018279chr1282845 2576 2427 2316 1008 775 553 316 --12820 --
NM_018283chr1321205 1139 11316 ----
NM_018293chr362565 2143 1899 812 665 217 ------
NM_018298chr14962 940 805 262 ------
NM_018299chr872892 2203 1234 1048 780 382 279 11145 ----
NM_018312chr1131794 805 568 --1327 --
NM_018313chr332663 2092 592 --22263 281 --
NM_018315chr441452 1289 1217 541 --21249 257 --
NM_018317chr4135 ------
NM_018318chr122945 908 ------
NM_018323chr431676 1609 156 ------
NM_018325chr931424 1383 362 --1505 --
NM_018327chr2041496 1382 678 293 --1666 --
NM_018330chr1021338 1212 --161 --
NM_018334chr71384 ------
NM_018354chr20129 198 ----
NM_018362chr11113799 2944 2701 2502 1482 655 589 447 353 50 36 12680 ----
NM_018363chr102325 34 ------
NM_018364chr144096 3852 3431 1381 33958 3620 239 285 62 32949 2694 981
NM_018368chr63224 95 24 ------
NM_018371chr841219 347 184 155 ------
NM_018373chr1486396 4958 2418 2040 1672 1662 1622 1603 32486 1836 1804 25249 1986 --
NM_018374chr7134828 3426 3186 1556 1239 1186 1171 1015 751 679 518 497 445 24550 1608 33971 1491 763 --
NM_018375chr1431343 458 169 1256 --1302
NM_018376chr92306 269 2716 171 ----
NM_018383chr221778 366 11947 --11318
NM_018388chrX21078 335 ------
NM_018403chr3113879 3619 3514 2703 1646 1530 1507 1491 488 446 426 14067 34142 3222 1091 21408 936
NM_018416chr1252563 888 849 794 369 1534 12667 --
NM_018423chr121268 ------
NM_018429chr562653 2369 2269 2012 441 148 --22415 1069 --
NM_018440chr8158431 6882 5579 3377 3144 2758 2463 2177 2155 1736 1082 737 526 437 103 17897 28728 728 15421
NM_018442chr11113 1397 180 --
NM_018444chr8----2747 680 --
NM_018448chr1241173 870 227 146 ------
NM_018452chr6_random43674 2667 541 192 22609 1406 12708 12497
NM_018482chr852546 2115 1034 937 310 --11815 --
NM_018486chrX1493 ------
NM_018489chr11695 ------
NM_018490chr1131223 676 286 ----11678
NM_018502chr51271 --1294 --
NM_018534chr22615 587 ------
NM_018553chr1741840 1690 331 244 ----11263
NM_018557chr261470 1345 1335 1184 150 140 1531 ----
NM_018566chr194640 3348 1797 1478 1383 1266 1030 975 925 44967 4090 1582 825 24879 2023 41184 801 424 317
NM_018569chr411558 --11321 --
NM_018590chr1011108 11142 --21668 1439
NM_018602chr153636 308 150 2201 81 ----
NM_018638chr12145615 5595 5216 4467 4342 4196 3702 3656 1796 1205 1023 847 379 117 34306 3612 1541 45409 5137 1393 389 25015 785
NM_018640chr121800 11751 21763 335 22635 659
NM_018649chr103520 455 233 ------
NM_018650chr141595 1557 640 56 31580 488 339 1535 --
NM_018657chr34804 759 202 177 --1247 --
NM_018667chr16------12564
NM_018682chr73751 574 466 ------
NM_018683chr2041704 1436 1164 571 ------
NM_018685chr72749 397 195 ----
NM_018695chr572387 2137 1589 885 762 478 388 ----21791 961
NM_018698chrX41675 1428 446 364 11863 11490 2741 181
NM_018700chr511426 11325 --11650
NM_018703chr161402 --1159 --
NM_018704chr11843 2527 382 2616 538 --
NM_018708chr191594 11573 ----
NM_018712chr111261 ------
NM_018715chr12307 147 --11654 --
NM_018717chr422432 2221 22648 536 1406 --
NM_018718chr772316 2133 1798 1744 1555 1498 302 11898 1881 11661
NM_018719chr711232 --1502 --
NM_018724chr12647 521 ------
NM_018834chr53207 200 117 ------
NM_018840chr201362 ------
NM_018841chr153227 2834 2446 1273 233 11465 23634 991 --
NM_018844chr742040 1827 525 369 --11544 31511 361 325
NM_018846chr74932 695 83 57 ------
NM_018847chr951932 1731 411 310 131 1194 ----
NM_018890chr751291 1154 1109 605 53 --11147 --
NM_018898chr541604 632 372 36 21840 716 21518 182 --
NM_018899chr541604 632 372 36 21840 716 21518 182 --
NM_018900chr541604 632 372 36 21840 716 21518 182 --
NM_018901chr541604 632 372 36 21840 716 21518 182 --
NM_018902chr541604 632 372 36 21840 716 21518 182 --
NM_018903chr541604 632 372 36 21840 716 21518 182 --
NM_018904chr541604 632 372 36 21840 716 21518 182 --
NM_018905chr541604 632 372 36 21840 716 21518 182 --
NM_018906chr541604 632 372 36 21840 716 21518 182 --
NM_018907chr541604 632 372 36 21840 716 21518 182 --
NM_018908chr541604 632 372 36 21840 716 21518 182 --
NM_018909chr541604 632 372 36 21840 716 21518 182 --
NM_018910chr541604 632 372 36 21840 716 21518 182 --
NM_018911chr541604 632 372 36 21840 716 21518 182 --
NM_018912chr521761 568 --11738 --
NM_018913chr521761 568 --11738 --
NM_018914chr521761 568 --11738 --
NM_018915chr521761 568 --11738 --
NM_018916chr521761 568 --11738 --
NM_018917chr521761 568 --11738 --
NM_018918chr521761 568 --11738 --
NM_018919chr521761 568 --11738 --
NM_018920chr521761 568 --11738 --
NM_018921chr521761 568 --11738 --
NM_018922chr521761 568 --11738 --
NM_018923chr521761 568 --11738 --
NM_018924chr521761 568 --11738 --
NM_018925chr521761 568 --11738 --
NM_018926chr521761 568 --11738 --
NM_018927chr521761 568 --11738 --
NM_018928chr521761 568 --11738 --
NM_018929chr521761 568 --11738 --
NM_018932chr51665 ------
NM_018945chr643656 3560 2421 2292 11237 --1894
NM_018947chr774638 3815 1946 1138 486 323 182 23822 1384 23724 3700 --
NM_018951chr731299 930 799 11148 ----
NM_018958chr1512970 ------
NM_018968chr2189 ------
NM_018970chr732414 1958 706 ----21209 111
NM_018976chr1221870 690 12891 ----
NM_018979chr1242589 1742 667 218 22087 573 --2719 596
NM_018983chr42297 257 ------
NM_018999chr10104612 4437 4157 4055 3378 1557 1406 1261 1051 347 14707 41286 1236 784 53 --
NM_019000chr541420 1141 345 125 ----1103
NM_019001chr3104234 3739 3485 3118 1838 1195 854 604 598 534 44715 4401 3199 523 33964 3719 1041 14306
NM_019004chr751958 1793 404 379 209 ----1554
NM_019005chr73265 142 41 ------
NM_019018chr51642 --2694 576 --
NM_019024chr2195 ------
NM_019027chr472613 2553 2538 1821 862 165 155 21766 991 12487 --
NM_019042chr741094 1054 932 135 --1266 --
NM_019048chr2274 36 ----199
NM_019049chr11743 ------
NM_019050chr481974 1833 1815 1804 1755 1574 690 519 11666 12122 --
NM_019063chr23720 681 526 --1179 --
NM_019071chr71803 --1508 --
NM_019072chr524262 388 --11292 1501
NM_019074chr151892 ------
NM_019080chr1331565 1509 1092 ------
NM_019083chr11146 11441 11491 --
NM_019084chr1052621 2463 2389 1781 37 --12321 --
NM_019087chr541580 1508 1156 463 --11209 --
NM_019094chr1273313 2816 2645 2360 1267 470 295 12909 ----
NM_019096chr641115 881 800 779 ------
NM_019114chr952384 962 899 195 65 --12141 1384
NM_019116chr1663391 3070 1384 1226 1013 575 1583 1350 --
NM_019555chr321325 320 ------
NM_019556chrX2950 488 ----11050
NM_019590chr101956 21248 990 1467 --
NM_019593chr2072886 2807 1243 943 760 633 342 1893 ----
NM_019594chr921479 1408 --1651 --
NM_019597chrX3700 570 202 ------
NM_019600chr152540 126 ------
NM_019605chr13645 250 85 1130 ----
NM_019610chr141585 1546 1533 1514 11702 11572 --
NM_019862chr1641702 1113 508 320 ------
NM_019891chr111303 ------
NM_019898chr1641702 1113 508 320 ------
NM_019899chr1641702 1113 508 320 ------
NM_019900chr1641702 1113 508 320 ------
NM_019903chr1021824 142 41593 603 455 198 --31178 521 222
NM_020116chr421682 36 21280 262 ----
NM_020120chr251203 1091 301 64 45 ------
NM_020122chr2124410 4279 2062 1766 1288 1221 1160 950 828 780 511 472 --35227 1631 401 1988
NM_020123chr1031581 1249 1053 1100 ----
NM_020132chr2144473 3288 1493 1375 15049 24490 3807 --
NM_020135chr6------1364
NM_020141chr132011 622 509 11621 --21907 846
NM_020144chr742061 1963 1590 1430 11609 ----
NM_020148chr1853118 2996 1095 259 90 12284 22359 734 --
NM_020150chr1032172 1901 415 --130 --
NM_020156chr71506 ----1158
NM_020159chr43487 302 251 ------
NM_020168chr1511309 11370 ----
NM_020177chr541293 702 521 447 ------
NM_020178chr172935 829 ------
NM_020184chr212255 ------
NM_020186chr71214 ----2496 88
NM_020189chr8131 ------
NM_020193chr1171285 1202 1191 1130 414 293 158 ------
NM_020194chr22605 267 ------
NM_020198chr1751530 1460 1227 997 161 1277 ----
NM_020199chr581264 1163 1099 485 443 254 244 129 ------
NM_020204chr12269 24 1861 ----
NM_020205chr183478 3292 2817 2802 2734 2581 2484 2346 ------
NM_020216chr12413 45 ------
NM_020225chr41106 ------
NM_020226chr42266 21 1768 ----
NM_020228chr1142058 465 455 125 11873 21733 773 11880
NM_020239chr141827 1602 807 418 11650 11805 --
NM_020245chr684867 4424 3402 1778 1673 899 419 184 14909 ----
NM_020246chr71362 ------
NM_020311chr23636 569 199 --1584 --
NM_020336chr2052664 2629 2582 371 300 13256 13027 --
NM_020337chr433028 2047 217 33115 3048 633 12955 --
NM_020341chr2041701 1629 1458 465 1223 1634 --
NM_020342chr21951 22517 411 32050 1711 50 11990
NM_020357chr331320 492 178 ------
NM_020363chrY61597 1536 1369 418 150 57 --3612 522 232 --
NM_020369chr71143 ------
NM_020374chr1211862 11619 ----
NM_020379chr11373 ------
NM_020381chr661852 1751 595 556 497 199 11769 ----
NM_020382chr121309 --11571 --
NM_020390chr384207 3833 3579 830 728 607 311 143 1336 11824 --
NM_020394chr11388 21366 1350 11255 --
NM_020403chr1321763 611 --166 --
NM_020420chrY61597 1536 1369 418 150 57 --3612 522 232 --
NM_020432chr741984 1774 1712 1647 --12314 11675
NM_020438chr911111 11409 ----
NM_020440chr163317 2968 1338 513 325 248 --12156 --
NM_020443chr196638 6560 5926 5766 5064 4335 1755 968 317 25018 4971 11216 --
NM_020445chr73735 706 538 ------
NM_020449chrX2782 139 1649 2671 301 --
NM_020455chr662147 2077 1839 1129 1067 269 12671 12662 1133
NM_020457chr161648 ------
NM_020463chr251457 1403 990 595 83 1431 11100 --
NM_020466chr654279 3919 3738 3275 3076 ------
NM_020474chr1831681 751 157 11942 11328 1734
NM_020529chr14----156 --
NM_020546chr542816 2788 2171 585 --1651 --
NM_020548chr21187 ------
NM_020640chr351960 1626 737 653 429 --21681 298 12154
NM_020644chr112972 622 ----2909 322
NM_020647chr862306 2062 1972 1634 212 205 21786 587 ----
NM_020651chr241715 1695 222 85 11567 11428 --
NM_020653chr17129 ------
NM_020654chr321643 1336 11201 1109 --
NM_020666chr51734 ------
NM_020673chr20187694 7374 7364 7080 6594 6450 5959 5702 5472 2346 2328 2232 1879 1292 1010 300 237 84 --46294 5769 5419 3028 15375
NM_020697chr81155 --1516 --
NM_020699chr174810 4092 3304 1878 570 339 242 12158 ----
NM_020708chr2052479 2472 2227 2062 689 ------
NM_020715chr1442185 1855 662 324 --21716 1441 --
NM_020717chrX54101 3607 1160 1061 310 13392 34193 3084 499 --
NM_020718chr16136539 6477 6294 6229 5730 4995 4113 1902 1665 1374 1330 1321 24 --14703 15802
NM_020727chr2183918 3847 3802 3770 3471 3460 1284 187 12645 11251 13435
NM_020728chr732105 664 302 --2885 129 12412
NM_020732chr61443 --1856 --
NM_020734chr1242938 2892 1198 754 --22448 496 --
NM_020739chr1593971 3329 2718 2681 1669 1350 896 884 76 23036 988 13520 --
NM_020742chrX72668 2605 2419 1694 828 713 684 1264 ----
NM_020747chr54970 873 184 54 --1831 --
NM_020748chr1761808 1524 806 585 307 236 1785 1777 --
NM_020752chr1032622 743 696 --1880 --
NM_020754chr31487 --21001 500 --
NM_020755chr661667 1540 1369 1102 481 337 1637 1208 --
NM_020760chr231748 1434 689 ------
NM_020766chrX63685 2983 1751 1320 634 114 42969 1449 557 68 54485 1779 1612 922 208 --
NM_020770chr121307 1040 --1342 --
NM_020771chr661516 1502 1411 1360 1330 1175 ------
NM_020772chr17167987 7865 7601 7585 7404 7109 5449 5434 5375 2458 2214 1637 1584 510 285 70 78568 7684 6803 6766 5764 5512 2224 77790 7434 7425 7266 7093 5966 5303 12063
NM_020773chr442694 2551 460 399 12612 ----
NM_020774chr18165952 5860 5454 5422 5351 4921 4697 4177 2484 2409 1484 1469 1441 1408 380 61 46266 4847 3792 199 35958 1598 931 13879
NM_020782chr1294868 4459 4297 3961 3922 1940 1103 951 42 1760 1971 --
NM_020794chr121539 237 ----1203
NM_020796chr572768 2386 2329 2218 2175 1063 598 --1890 --
NM_020800chr321481 268 ----1584
NM_020801chr562502 2099 1844 930 211 156 22588 1942 12316 1466
NM_020802chr1123280 1064 ----11001
NM_020803chr43766 497 345 --1691 11604
NM_020804chr631905 499 113 ------
NM_020805chr1821840 1428 1241 1256 --
NM_020806chr143280 246 83 ----126
NM_020808chr121083 392 --1332 1874
NM_020809chr1152130 698 649 254 213 12145 ----
NM_020810chr1443517 3086 2956 754 --12933 1572
NM_020819chr621075 308 1444 ----
NM_020821chr1551415 1259 164 148 71 22006 715 1111 --
NM_020824chr102547 539 --2515 144 --
NM_020825chr1633635 2865 2599 1733 ----
NM_020830chr232831 1143 970 --1295 12551
NM_020841chr1263845 3670 3506 2673 628 233 --2913 434 13093
NM_020844chr867142 6849 5570 1662 524 112 16932 37360 4837 564 17305
NM_020854chr1821265 293 --197 --
NM_020858chr1542319 2227 1884 30 --11958 1733
NM_020859chr463611 3402 3250 1557 1068 292 33319 977 966 21435 574 --
NM_020861chr641365 877 259 163 ------
NM_020868chr281966 1924 1888 1828 1739 1687 773 250 11510 ----
NM_020870chr421863 1560 --1805 --
NM_020872chr341289 1268 1111 677 ------
NM_020873chr32811 54 ------
NM_020890chr31211 --1193 --
NM_020897chr111087 --11338 --
NM_020899chr1772320 1650 1567 519 412 168 152 ------
NM_020918chr1083658 3181 2777 977 907 819 750 536 23665 3233 1480 11125
NM_020919chr21823 --1959 --
NM_020921chr14103412 3397 3350 3176 2793 2416 459 299 288 138 32843 1433 675 13567 --
NM_020922chrX21493 1266 1281 11503 --
NM_020925chr151145 1042 977 446 113 21353 1217 ----
NM_020926chrX130 1286 ----
NM_020927chr1632337 2329 2019 ------
NM_020935chr2144643 4569 4340 4060 3906 3726 2986 1855 1831 1797 1132 714 471 464 33962 3575 3257 ----
NM_020940chr1062538 2185 861 848 575 195 1996 --21958 1032
NM_020948chr143627 3558 2263 808 --22377 1433 12614
NM_020951chr1942103 309 271 226 1476 1182 12133
NM_020952chr93127 96 67 ------
NM_020961chr42456 405 2419 111 --1481
NM_020962chr1522308 132 11957 ----
NM_020975chr1021285 164 1147 ----
NM_020977chr41312 --1704 --
NM_020987chr1041068 1010 484 32 11274 ----
NM_021005chr152737 475 11046 ----
NM_021007chr232005 1532 750 1368 ----
NM_021012chr1763144 768 716 406 132 123 ------
NM_021025chr52353 347 ------
NM_021033chr1373105 2630 2321 717 697 672 190 12899 21358 1062 13195
NM_021038chr363325 3246 2625 2534 1353 1078 23087 635 ----
NM_021064chr6--11550 ----
NM_021069chr432114 845 642 --21881 1385 1239
NM_021072chr51907 --1792 22487 821
NM_021083chrX93580 3388 3347 2767 943 548 481 404 351 13059 22512 384 12484
NM_021090chr2254493 4436 4387 3574 1339 --14991 11255
NM_021097chr232786 1201 337 1277 1977 --
NM_021102chr193372 163 54 ------
NM_021104chr121291 ------
NM_021110chr83753 604 569 1617 ----
NM_021111chr921377 1289 ------
NM_021120chrX52774 926 799 175 143 1649 ----
NM_021129chr10178 ----190
NM_021132chr101980 11000 ----
NM_021136chr141527 ------
NM_021140chrX2893 846 11014 --1864
NM_021144chr91557 ------
NM_021145chr71977 --1190 1227
NM_021151chr731116 1077 962 ------
NM_021155chr1922412 2072 --2978 187 --
NM_021159chr41681 11678 --11272
NM_021163chr783556 3083 2739 1213 760 684 587 451 --32882 2601 238 --
NM_021183chrX41960 1032 262 71 --11953 --
NM_021188chr142430 348 1451 ----
NM_021190chr141318 1012 538 429 ----11092
NM_021191chr1222184 136 ------
NM_021192chr2------1370
NM_021194chr1--137 --1234
NM_021203chr32342 46 ------
NM_021204chr42345 213 --1802 --
NM_021205chr132597 2381 753 --22294 2167 1456
NM_021215chr2042091 1950 459 336 ------
NM_021224chr92450 424 ----1411
NM_021227chr41446 --1432 158
NM_021238chr1261404 1290 802 590 359 102 --21679 252 --
NM_021239chr1451286 1216 1154 575 236 --21381 1015 11278
NM_021252chr1051868 1458 467 203 111 ----1655
NM_021255chr14104028 3844 3359 2867 2667 1054 898 606 549 300 --11630 11620
NM_021619chr911145 ------
NM_021620chr62808 718 ------
NM_021622chr1031900 763 703 11525 ----
NM_021627chr32991 958 --1221 --
NM_021629chr385075 4331 3588 3477 1256 1082 386 133 13971 11579 --
NM_021633chr121112 264 ------
NM_021637chrX21365 1246 11256 11070 --
NM_021638chr444911 4439 1140 714 1779 11669 --
NM_021643chr251871 1599 1393 1340 637 --11354 --
NM_021644chr1021024 825 --1954 --
NM_021645chr1321912 343 --21701 62 1501
NM_021647chr443125 1571 1258 681 14755 --22876 441
NM_021705chr631300 464 129 ------
NM_021728chr141375 --2224 64 --
NM_021738chr101116 ------
NM_021785chrX157 1308 --1246
NM_021813chr6125788 5441 4081 2185 2064 1620 1563 1389 1271 869 695 681 --1410 14784
NM_021814chr61593 21435 609 ----
NM_021815chr252910 819 359 293 234 ------
NM_021818chr1421228 26 ----139
NM_021825chr112291 143 ------
NM_021830chr102594 196 --2872 309 --
NM_021911chr584498 4122 3632 3512 1946 1230 1174 896 --14955 --
NM_021912chr1554116 2666 430 313 70 13478 ----
NM_021914chr141556 12118 1695 12322
NM_021940chr621606 279 --1212 --
NM_021942chr41713 ----182
NM_021943chr62881 400 --12146 12153
NM_021946chrX----11449 --
NM_021949chrX22771 736 --1672 --
NM_021951chr92267 208 ----1351
NM_021956chr621182 1123 ------
NM_021957chr121507 ------
NM_021960chr182242 1881 1808 1035 817 758 502 482 ----11063
NM_021961chr11147455 7288 7260 6345 6144 6129 5678 5358 4620 2862 2724 2552 2453 1659 47181 7158 1772 435 11085 --
NM_021963chrX----1159 --
NM_021964chr3186563 5881 5791 5426 4448 4209 4189 4164 2516 2379 2217 1915 1897 1881 1863 1461 375 231 56503 5627 4540 2199 874 36145 5975 803 --
NM_021970chr4--1656 ----
NM_021984chrX1111 ------
NM_021987chrX1111 ------
NM_021988chr2021123 1068 ----11113
NM_021990chrX1111 ------
NM_021998chrX41290 1104 503 366 --11217 --
NM_021999chr132302 118 ------
NM_022037chr22900 691 2991 170 ----
NM_022041chr1652380 2200 2064 131 105 12602 32028 380 155 --
NM_022045chr8--1250 199 --
NM_022048chr1585530 4809 4707 4570 825 760 671 405 ----15792
NM_022049chr141678 509 351 243 1301 ----
NM_022051chr11721 ------
NM_022062chr1111716 11617 ----
NM_022066chr1731000 991 198 ------
NM_022079chr102826 799 11018 2869 258 --
NM_022080chr2072492 2044 751 615 388 370 45 11951 ----
NM_022114chr124220 1873 31343 563 488 ----
NM_022118chr132563 484 1539 ----
NM_022130chr551340 319 135 116 51 11150 1208 --
NM_022133chr831756 486 144 ------
NM_022136chr21--1126 1499 --
NM_022137chr1442081 1382 459 251 11282 ----
NM_022143chr711073 11022 --11477
NM_022145chr51192 2427 201 ----
NM_022154chr42537 405 ------
NM_022164chr1--1685 ----
NM_022166chr1695848 5782 5438 4843 4762 2458 2430 1600 1475 11841 --15949
NM_022173chr22900 691 2991 170 ----
NM_022343chr9------1471
NM_022346chr4--31239 953 53 ----
NM_022351chr843851 3568 769 228 13832 22768 755 --
NM_022373chr72744 184 ----1723
NM_022442chr2021123 1068 ----11113
NM_022443chr3129 140 1154 --
NM_022456chr12136838 6813 6712 5755 5456 2757 2643 2630 1018 967 911 665 446 17485 --15500
NM_022459chr13116030 5689 4697 3913 2433 1922 934 677 632 607 552 25371 2493 24612 2223 11698
NM_022465chr1283052 2969 2937 2111 840 473 93 87 1437 ----
NM_022467chr192380 273 ------
NM_022469chr152862 2562 1291 811 180 ------
NM_022473chr15123944 3653 3376 3363 3153 2855 2738 1183 1038 550 503 408 2569 197 11624 1454
NM_022474chr1471927 1875 929 893 634 247 206 12105 12512 --
NM_022475chr41629 ------
NM_022476chr161781 --1839 --
NM_022477chr2031646 367 262 ----1549
NM_022482chr2072438 1817 1804 1673 817 176 154 ------
NM_022484chr7--1398 ----
NM_022491chr1263464 2976 774 555 234 47 ----13014
NM_022496chr123498 351 334 ------
NM_022553chr62461 96 ------
NM_022566chr151588 ------
NM_022575chr20--1139 ----
NM_022650chr52694 346 --2959 627 --
NM_022658chr122160 53 11032 ----
NM_022716chr173142 2657 2518 2363 1132 484 265 11203 --1333
NM_022725chr111394 --32082 1701 1695 1311
NM_022733chr121084 186 --1879 --
NM_022735chr131563 1358 549 21830 439 ----
NM_022753chr132469 243 87 22199 1877 12317 --
NM_022756chr131487 436 364 ----11151
NM_022763chr353026 2996 1262 254 112 33212 781 596 12095 --
NM_022771chr121375 21058 100 1146 --
NM_022780chr221478 191 1759 1406 --
NM_022781chr943258 2686 2347 2296 11172 --23158 539
NM_022782chr121379 --1112 --
NM_022783chr81712 --1147 --
NM_022784chr151241 11052 11000 --
NM_022817chr252106 389 233 147 125 --2577 519 --
NM_022818chr1631190 424 360 --1196 --
NM_022824chr54776 755 239 192 21650 90 11547 --
NM_022826chr21361 1282 ----
NM_022832chr4102590 2264 1769 1657 1608 837 696 334 181 74 ----21875 501
NM_022838chrX2268 36 ------
NM_022841chr1532599 955 807 1219 ----
NM_022843chr1331159 1004 264 136 ----
NM_022845chr1641916 1812 821 227 12076 --1783
NM_022893chr243072 2838 2781 2751 21112 716 21008 518 --
NM_022894chr21270 --1255 --
NM_022896chr20----11099 11118
NM_022898chr14104539 3834 3440 3432 3248 3063 1571 1390 741 567 ----13668
NM_022909chr5----1528 --
NM_022912chr252719 1040 529 522 431 1162 ----
NM_022918chr112453 163 21762 755 11530 --
NM_022965chr421306 502 --21363 118 --
NM_022970chr1021342 1205 ------
NM_022977chrX31747 1651 178 32258 1065 459 12633 --
NM_023000chr1461384 1341 1269 1187 690 310 11739 ----
NM_023001chr1461384 1341 1269 1187 690 310 11739 ----
NM_023009chr12720 576 ------
NM_023012chr121519 ------
NM_023016chr262802 2354 1141 1103 790 361 22406 320 --1638
NM_023037chr1321106 130 ------
NM_023039chr5163 1121 ----
NM_023076chr1631830 923 693 21982 1945 1471 --
NM_023079chr1721871 1225 --1631 --
NM_023105chr841675 831 527 347 22242 2062 ----
NM_023106chr841675 831 527 347 22242 2062 ----
NM_023110chr841675 831 527 347 22242 2062 ----
NM_023111chr841675 831 527 347 22242 2062 ----
NM_023927chr521171 842 ------
NM_023929chr872844 2279 2090 2046 972 495 433 --12615 --
NM_024007chr541936 1192 1122 531 22872 372 12831 --
NM_024009chr11787 ------
NM_024028chr51238 1972 ----
NM_024050chr191172 ------
NM_024052chr174983 954 785 418 ------
NM_024076chr1922056 313 ----12081
NM_024082chrX----1139 --
NM_024086chr1763370 3130 3078 2935 1360 45 --21393 730 12593
NM_024087chrX2600 261 ------
NM_024090chr411895 21779 1386 11941 11834
NM_024092chr111779 11224 ----
NM_024094chr83344 278 39 --2850 671 1180
NM_024102chr13338 245 192 1893 11206 --
NM_024117chr9--1220 --1564
NM_024293chr2--1201 1533 --
NM_024295chr861961 1306 1289 834 589 296 ------
NM_024312chr1231107 646 404 --1570 --
NM_024329chr121488 1357 ------
NM_024334chr351864 1728 746 693 415 --31819 1273 216 --
NM_024345chr966081 5831 5675 5500 4085 396 26035 4077 25068 798 --
NM_024411chr2021442 565 ------
NM_024415chr5267 53 ------
NM_024422chr1881969 1883 1648 1572 752 683 573 36 1379 21547 566 1646
NM_024423chr1854165 3650 3069 1527 622 13188 43534 3199 2722 1068 --
NM_024429chr71269 1758 ----
NM_024430chr1871492 1245 1193 548 378 192 21 ------
NM_024511chr412632 53112 3015 2727 891 777 11163 --
NM_024519chr16----1292 --
NM_024524chr3102689 2649 2486 2035 1073 932 859 648 619 339 --32833 2626 138 --
NM_024525chr13652 467 186 ------
NM_024529chr12232 116 --21169 44 --
NM_024539chrX21104 1097 1502 ----
NM_024548chr32190 169 ----1645
NM_024551chr1231700 1003 122 ------
NM_024551chr1231700 1003 122 ------
NM_024556chr113450 421 381 ------
NM_024561chr1331183 334 208 1318 --1377
NM_024563chr52727 266 1711 21488 550 --
NM_024569chr142872 882 648 637 --1838 --
NM_024582chr421017 881 ------
NM_024586chr11500 ------
NM_024594chr521790 376 ----11597
NM_024613chr84718 470 399 206 31679 1427 290 ----
NM_024624chr271548 1533 1444 1226 597 388 244 1229 1503 --
NM_024635chr91249 ------
NM_024639chr662678 2608 1959 1001 888 311 12910 --12183
NM_024646chr1--1620 33952 3917 284 --
NM_024659chr2--2810 642 ----
NM_024665chr3124500 4060 3934 3189 2860 1833 1789 1018 987 324 259 182 34686 3164 473 13565 11765
NM_024674chr163099 1170 984 936 289 43 11002 12984 --
NM_024675chr161204 ----167
NM_024692chr231521 1334 444 --3498 373 229 --
NM_024699chr85378 312 227 161 148 1171 ----
NM_024713chr1521583 420 21006 597 ----
NM_024715chr551895 1886 1510 424 406 2561 172 ----
NM_024721chr852512 2485 2170 1821 799 22425 1771 1606 1411
NM_024725chr114822 725 643 256 ------
NM_024740chr1123983 3122 13531 22759 720 13924
NM_024744chr242075 1651 185 123 ------
NM_024749chr131446 613 561 1307 1269 1163
NM_024751chr432060 420 184 ------
NM_024755chr151194 126 ----
NM_024757chr9------11100
NM_024770chr2105963 5569 5390 5033 4556 4532 4459 2280 1406 982 1197 12648 --
NM_024785chr221318 368 11041 ----
NM_024792chr174963 842 779 124 1239 ----
NM_024806chr112271 264 ------
NM_024811chr1121611 300 --11850 --
NM_024812chr861969 1881 1716 1674 794 488 --11902 --
NM_024813chr1----198 --
NM_024814chr72346 306 1146 --169
NM_024824chr1451661 1582 1089 593 44 1186 1126 --
NM_024828chr941586 1209 1173 430 11186 ----
NM_024835chr171340 ------
NM_024847chr1671266 1081 977 934 272 212 128 ------
NM_024871chr31268 11277 ----
NM_024896chr931026 573 125 --12010 --
NM_024908chr152612 122 ----1599
NM_024911chr13757 729 172 1662 --1611
NM_024913chr721142 494 11618 1183 --
NM_024917chrX1881 1848 ----
NM_024920chr431421 1403 1245 --2976 294 --
NM_024940chr831707 1348 387 --11091 --
NM_024945chr93765 385 166 21174 1045 ----
NM_024947chr3189157 8358 8216 8043 7252 6415 6217 5925 3600 3323 2528 2029 1830 1737 683 639 517 407 68522 6468 3781 3159 2899 1858 57960 6123 2745 1478 35 49210 6134 3023 2669
NM_024948chr102705 233 --1174 --
NM_024949chr464902 4815 4359 3555 1460 1296 11674 14510 --
NM_024953chr1262090 768 622 611 493 402 32002 1006 948 11012 --
NM_024960chr202551 486 ------
NM_024969chr21702 ------
NM_024971chr93127 96 67 ------
NM_024979chr1331441 1125 408 --1419 --
NM_024989chr277348 6192 3023 2843 517 289 145 11612 21432 1327 21649 578
NM_024991chr1072963 2821 2253 2109 1985 852 791 ------
NM_024993chr211283 ----21326 487
NM_024997chr1621034 339 1141 ----
NM_025047chr31510 --1327 --
NM_025054chr863971 3275 3108 1575 1075 166 14209 23931 3342 --
NM_025065chr1----1875 --
NM_025073chr1114692 4587 3499 3286 1837 1722 1292 1022 931 809 745 --24684 4295 --
NM_025074chr442832 2711 422 407 1864 --1108
NM_025076chr23524 258 62 1141 1499 --
NM_025077chr1----1234 --
NM_025106chr111882 11510 ----
NM_025113chr1331181 439 83 ------
NM_025126chr123775 612 225 ----1768
NM_025133chr24993 895 804 205 2833 746 1357 --
NM_025134chr1632403 2131 976 2538 469 1362 1796
NM_025138chr1341250 1229 1189 1179 --11078 --
NM_025146chr352645 2522 2412 253 98 12467 --1154
NM_025152chr1421926 109 ----11343
NM_025154chr741146 1105 561 345 ----11559
NM_025160chr164284 3543 1308 1234 891 618 1869 12955 --
NM_025164chr1122086 834 ------
NM_025179chr154235 3575 1887 859 311 14167 21999 766 --
NM_025181chr22767 69 ------
NM_025187chr1611042 1931 ----
NM_025191chr173225 3053 2882 2752 2394 1384 86 1103 --33572 2820 2710
NM_025208chr1172426 2391 2042 1919 675 513 149 --12171 --
NM_025211chr92240 99 ------
NM_025221chr42307 164 1133 3564 274 127 --
NM_025230chr1431260 1220 690 ----21303 646
NM_025235chr1082044 1798 1514 788 466 448 415 69 ----1165
NM_025238chr1521609 245 1358 --1642
NM_025248chr1733219 1251 1123 13244 12521 --
NM_025250chr722969 2214 13044 ----
NM_025263chr631430 695 618 1414 ----
NM_025268chr141396 ------
NM_030579chr1633119 3028 936 13160 21035 391 --
NM_030594chr1541361 896 257 182 ------
NM_030621chr1494023 3317 2919 2861 2851 1684 724 623 248 23626 271 2344 200 13730
NM_030625chr1031993 1819 1692 21850 293 22056 220 1229
NM_030627chr593896 3788 3719 3681 3609 3193 2629 1369 433 --1231 11393
NM_030629chr1641637 1525 1479 1328 ------
NM_030634chr152438 1663 1604 486 394 11972 1167 --
NM_030636chr762136 2096 903 809 490 437 12124 12155 --
NM_030637chr143566 164 105 2607 595 ----
NM_030647chr796097 5790 5727 5691 4420 1406 984 868 367 --12364 1920
NM_030648chr4105477 4619 3968 3763 3694 1865 1733 1597 1323 511 33700 1978 765 11361 --
NM_030650chr273981 3728 3553 2809 1509 1440 245 21039 383 --12997
NM_030652chr61282 ------
NM_030660chr1461501 1331 1230 410 342 231 --21008 977 --
NM_030664chr1052169 2154 1665 1552 623 ------
NM_030674chr12135878 5703 4845 4725 4512 4156 3941 1855 1072 1032 951 927 456 ----15532
NM_030751chr1041893 1640 362 243 --31703 1603 1356 --
NM_030751chr1041893 1640 362 243 --31703 1603 1356 --
NM_030755chr1452743 737 608 564 292 11101 12227 12169
NM_030756chr10128 ----1320
NM_030759chr101806 ------
NM_030762chr1241978 1915 584 509 ----11861
NM_030773chr2021835 1676 21528 1204 ----
NM_030780chr841583 1202 525 279 1365 ----
NM_030791chr1461821 1392 638 253 176 92 --11696 --
NM_030799chr551870 1807 1724 1551 1386 11691 --1209
NM_030805chr261028 979 473 412 371 137 ------
NM_030806chr1138916 8017 6983 6730 6226 5877 5854 3412 2900 2165 1915 675 316 33591 2455 808 27017 500 23668 1351
NM_030808chr174991 983 926 362 ------
NM_030809chr1272013 1881 1699 1687 1014 809 251 --1970 --
NM_030811chr201370 ------
NM_030816chr143247 2741 1341 176 --1473 1954
NM_030820chr611055 --1301 --
NM_030881chr2252289 2155 890 697 606 1451 ----
NM_030884chr331825 375 302 ----12303
NM_030885chr332138 912 602 21529 821 22031 97 --
NM_030918chr1115235 4724 4389 4317 3834 1669 551 544 499 315 171 --24597 3647 --
NM_030920chr152003 1986 1496 1441 131 11618 11946 --
NM_030922chr152739 306 ----1288
NM_030937chr121157 973 ------
NM_030938chr1751085 1062 784 386 359 ------
NM_030939chr63830 223 49 --11089 --
NM_030940chr91231 --21371 52 --
NM_030949chr621457 355 1188 1473 --
NM_030958chr82394 27 ------
NM_030963chr62574 231 ------
NM_030964chr533028 206 87 1961 ----
NM_030965chr11538 ------
NM_030979chr13--2450 390 ----
NM_031157chr121131 1251 ----
NM_031216chr1862137 1478 1456 702 511 236 ------
NM_031217chr111219 ------
NM_031243chr731754 388 265 12157 ----
NM_031244chr621126 864 ------
NM_031262chr93412 293 141 --1829 --
NM_031263chr94469 350 198 52 --1886 --
NM_031267chr7----3565 394 110 --
NM_031268chr16125350 5259 3993 3904 3688 1876 1303 1257 1193 613 339 221 12066 1497 --
NM_031292chr1221725 1194 ------
NM_031296chr462414 2017 1959 604 584 567 22354 2221 --12319
NM_031305chr431325 640 233 --1569 --
NM_031314chr1451857 1421 1409 730 205 ----1419
NM_031369chr44715 633 245 206 1573 ----
NM_031370chr44715 633 245 206 1573 ----
NM_031371chr131241 629 270 21250 476 ----
NM_031371chr131241 629 270 21250 476 ----
NM_031411chr541604 632 372 36 21840 716 21518 182 --
NM_031418chr1172621 2434 2416 1931 987 838 576 --12401 --
NM_031419chr331391 1279 278 21632 1375 11304 --
NM_031427chr1455889 3847 2162 1856 786 35026 1990 1493 15573 --
NM_031431chr133