TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-9-5p
miRNA Sequence: UCUUUGGUUAUCUAGCUGUAUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX103465 3225 2606 1264 979 782 638 460 321 297 42956 2936 2560 927 --12424
NM_000081chr181652 1356 638 628 567 540 393 28 31672 303 88 1292 --
NM_000084chrX186810 6481 5575 5285 5234 5119 4650 4617 4459 4400 4361 2790 2620 2435 1944 1491 1068 981 36320 4961 2476 86567 6431 6141 2226 2166 1612 1582 1288 1461
NM_000088chr1781270 1056 981 228 207 200 190 99 --2881 463 --
NM_000091chr2112778 2749 2729 2196 2107 1977 1149 274 250 207 93 142 ----
NM_000104chr2113092 3043 2799 2639 1908 1014 888 771 743 527 336 1220 12182 --
NM_000109chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_000112chr5125271 5213 5053 4954 4898 4015 2103 2027 1818 1171 979 108 12223 23521 3370 --
NM_000115chr1372494 2385 2176 2031 1717 769 77 --147 --
NM_000138chr1582657 2585 2111 1038 792 714 483 108 --2530 149 1692
NM_000163chr5102377 2235 2173 1763 917 900 862 648 451 73 1681 ----
NM_000176chr593917 3880 3862 2500 1461 1124 1106 921 323 1292 ----
NM_000202chrX103868 3550 2772 2755 1339 650 529 409 334 166 12834 ----
NM_000210chr262278 2209 1896 779 670 372 22265 885 12215 1111
NM_000216chrX123396 3366 3194 3157 2748 2733 2541 1471 656 421 333 81 12988 1612 1936
NM_000217chr12124926 4567 4373 4359 4275 1627 1540 1092 990 754 500 179 14825 21966 1375 24856 3580
NM_000230chr782646 2577 2461 2037 1791 1758 395 149 31050 777 423 1268 1188
NM_000248chr3112703 2685 2644 2636 2486 856 781 631 402 366 208 --1653 --
NM_000252chrX31311 456 450 --1349 11515
NM_000254chr152795 883 539 528 300 ----12723
NM_000259chr15146283 5971 4493 4354 4331 3945 2316 2241 2220 2042 1161 1090 966 415 1504 15236 1398
NM_000267chr1782511 2403 2261 2165 2147 1397 837 802 --12212 --
NM_000293chr165824 634 608 312 300 ------
NM_000297chr431453 1273 335 2800 175 11671 1692
NM_000325chr42484 173 ----2151 99
NM_000329chr15761 641 287 261 67 1924 1367 --
NM_000330chrX61725 865 596 587 457 404 31961 470 209 1686 --
NM_000332chr6166761 6737 6721 6646 6347 6299 6271 5627 4338 2883 2627 2257 2084 1904 1368 1150 25573 1974 14535 --
NM_000337chr5186333 5914 5587 5400 4986 4890 4563 4540 4430 4113 4092 1535 1174 1132 927 894 613 482 46131 4802 1564 1387 26542 4442 1103
NM_000367chr661769 1680 630 194 128 64 22201 1573 --12082
NM_000368chr9124794 3941 3898 3509 3134 1781 1082 553 380 337 250 73 11004 11578 13548
NM_000390chrX63213 2856 2689 2108 1360 215 13222 1466 11196
NM_000408chr262782 2587 1223 1165 1101 861 22195 646 --165
NM_000411chr2183311 3032 2975 2746 2348 1033 1009 378 13287 --12143
NM_000428chr1451907 1726 734 487 106 42095 1961 751 584 1285 --
NM_000441chr752274 2036 1750 1458 734 21620 1418 ----
NM_000448chr1132771 1268 326 1336 1320 1274
NM_000461chr3114517 4318 4117 3915 3570 1560 1174 947 826 361 276 23375 705 --1346
NM_000489chrX93383 3275 3237 2804 2633 2577 2149 1198 967 ------
NM_000495chrX3747 303 185 ----1214
NM_000555chrX167091 6756 6565 6499 6228 5180 5066 3090 2341 1861 1466 1227 1114 1057 601 28 47791 7270 6413 674 12250 17169
NM_000610chr1162690 2585 1953 915 839 533 42867 2506 2089 1934 13061 1858
NM_000615chr1182925 2262 1194 617 309 270 164 29 --22565 59 12514
NM_000618chr12116365 6156 5737 5228 4171 1321 943 870 607 342 92 34243 1123 991 ----
NM_000618chr12116365 6156 5737 5228 4171 1321 943 870 607 342 92 34243 1123 991 ----
NM_000633chr1894831 4647 4227 4096 2020 932 673 280 211 34209 3466 3275 34927 972 46 --
NM_000681chr1061391 1224 1161 1123 1089 277 11043 --11321
NM_000719chr1265911 4601 4340 4324 324 134 15627 46257 5569 5395 5186 --
NM_000793chr14104786 4345 4304 3937 3570 1843 1487 1277 838 327 14818 34718 1773 1707 --
NM_000806chr551739 783 541 411 319 1280 --11921
NM_000809chr4149042 8956 8666 7948 6807 3687 2685 2599 2544 2405 1748 640 397 91 22342 824 36591 6564 566 12369
NM_000813chr595027 4930 4781 3838 3395 2204 2071 1293 354 34822 3816 914 24732 4475 14652
NM_000826chr4102362 2317 1919 1800 1006 930 691 550 227 100 1948 ----
NM_000831chr1195797 5457 5378 4668 4010 4000 3956 2299 1792 1328 1237 1168 1139 1129 781 302 273 241 219 45425 1545 823 417 56258 6020 2331 1874 103 22413 1278
NM_000849chr1102917 2557 2550 2216 1934 1251 992 898 740 518 12225 ----
NM_000875chr15126702 6655 5828 4581 4507 2780 1980 1969 1884 906 593 558 36333 5075 988 --24956 2228
NM_000877chr2103040 3016 2716 2644 2531 2051 1915 893 643 347 22510 825 1293 --
NM_000891chr1753625 2506 1333 526 497 1146 --1722
NM_000899chr1284056 4038 3988 3646 3566 1601 1427 468 23404 1354 33487 2865 1347 11654
NM_000901chr452481 2453 1785 1760 1646 --1190 --
NM_000902chr373173 3129 2466 2353 844 390 350 42735 2561 488 247 23008 2365 --
NM_000922chr115939 889 342 210 44 11059 1372 1906
NM_000926chr11229053 9006 8857 8601 8081 7724 7461 7379 7156 7052 6520 6457 5761 3231 3147 2928 2754 2641 2504 1104 551 248 48554 8429 6563 3420 47390 6091 3411 916 --
NM_000933chr2071555 1339 1161 621 603 183 25 --11268 1122
NM_000944chr472348 2169 2013 1885 606 448 432 11997 21804 1468 12239
NM_000961chr20153894 3650 3585 3470 3177 3041 2703 1436 1365 1015 998 801 690 600 402 --1504 --
NM_000962chr992865 2731 2627 2114 1230 794 755 403 54 --1684 11179
NM_000963chr192166 1655 1544 935 779 771 723 626 444 21904 176 --1234
NM_001001323chr12122995 2806 2688 2677 2491 2117 2047 1981 1236 1218 942 881 1129 ----
NM_001001331chr342029 1827 1002 122 11922 22200 2146 1580
NM_001001344chrX72589 2130 2010 1991 1855 1037 288 2988 914 ----
NM_001001389chr1162690 2585 1953 915 839 533 42867 2506 2089 1934 13061 1858
NM_001001390chr1162690 2585 1953 915 839 533 42867 2506 2089 1934 13061 1858
NM_001001391chr1162690 2585 1953 915 839 533 42867 2506 2089 1934 13061 1858
NM_001001392chr1162736 2631 1999 961 885 579 42913 2552 2135 1980 13107 1904
NM_001001395chr1252533 2281 2012 871 539 ----11909
NM_001001396chr1154396 3840 3613 3470 1771 1617 1362 1349 1279 1269 1203 840 790 230 38 11426 24200 1304 --
NM_001001433chr20112813 2392 2130 1998 1173 1031 1013 924 833 738 444 11114 ----
NM_001001481chr842751 2573 2263 1198 12149 12126 13274
NM_001001668chr19113999 3976 3849 3100 3087 3035 1655 1091 922 908 350 --14139 --
NM_001001890chr21114091 2912 1578 1350 1302 1262 1217 1143 988 881 398 21054 414 14240 --
NM_001001928chr22177998 7887 7713 7319 6443 6189 5986 5813 5445 3208 3131 3038 2324 1083 910 707 464 47557 6336 532 504 25690 2259 17631
NM_001001995chrX51798 1641 1264 302 90 ----1507
NM_001002257chr2123494 3400 2779 2756 2531 2422 2189 1205 1046 902 590 483 13180 22525 334 --
NM_001002814chr893923 3726 3212 2914 2375 1401 1340 1129 199 1293 --1261
NM_001002860chr14104401 4238 3864 3707 3521 2916 2900 1463 776 703 1494 ----
NM_001003652chr18138507 7597 7362 6849 5485 5439 2964 2049 1122 1054 768 561 276 --12071 15457
NM_001003674chr18176824 6768 6533 6147 6016 5588 4886 2787 2726 1818 1422 794 761 513 491 115 40 1677 16125 --
NM_001003675chr18176824 6768 6533 6147 6016 5588 4886 2787 2726 1818 1422 794 761 513 491 115 40 1677 16125 --
NM_001003760chr6133695 3619 3364 3247 3209 2784 2661 2574 2428 2236 928 604 291 12755 11247 --
NM_001003800chr993604 2976 2630 1117 964 740 667 327 192 33566 883 586 1927 --
NM_001003940chr15143557 3090 3058 2957 2840 1413 1350 1336 1286 1149 684 413 364 266 11460 ----
NM_001003942chr15143557 3090 3058 2957 2840 1413 1350 1336 1286 1149 684 413 364 266 11460 ----
NM_001003943chr15143561 3094 3062 2961 2844 1417 1354 1340 1290 1153 688 417 368 270 11464 ----
NM_001004065chr993593 3355 1387 1348 699 205 130 53 45 11240 12759 13653
NM_001004317chr654137 3859 2940 1216 472 13116 44199 546 504 340 11232
NM_001004328chr1271955 1804 908 720 694 411 226 ----1348
NM_001004342chr1115588 5579 5456 5153 4483 3862 1932 1920 1888 1709 332 33707 2113 2072 14401 14992
NM_001004419chr12134130 4074 3756 3387 3213 1389 1346 1335 1261 1213 1207 1151 220 --1654 24011 2970
NM_001005404chr1794203 4026 3468 2965 2955 842 823 572 51 ------
NM_001005463chr1072517 2348 2056 2039 1627 916 830 1490 139 --
NM_001005473chr5106462 6081 5717 4747 4528 4521 4103 1954 554 414 14541 26160 2226 16475
NM_001005502chr12125077 4645 4603 3698 2075 1400 1329 1196 958 920 529 457 11021 11268 --
NM_001005609chrX93455 3048 2835 2679 1464 1328 982 398 322 53248 2584 532 481 350 ----
NM_001007023chr14104786 4345 4304 3937 3570 1843 1487 1277 838 327 14818 34718 1773 1707 --
NM_001007024chr1763771 3147 2913 743 494 279 23465 378 14037 11739
NM_001007025chr1763771 3147 2913 743 494 279 23465 378 14037 11739
NM_001007094chr1084326 3841 3625 3569 1432 1032 867 198 33487 832 521 33970 1730 1066 --
NM_001007097chr964911 4261 3585 1962 1694 550 44392 4301 3331 3137 24538 1593 --
NM_001007237chr172856 2214 1051 989 870 756 506 1652 22416 2354 --
NM_001007246chr2111477 11445 11457 11524
NM_001007267chr25852 817 292 197 122 ------
NM_001007278chr13115278 4903 4425 4284 4251 1811 1706 1345 1152 841 637 1678 1778 1955
NM_001007466chr6114846 3599 3513 3299 3192 1247 1230 893 530 196 160 23581 1855 24692 3519 13624
NM_001008408chr7166374 5231 4842 4471 2526 2398 2061 1673 1539 1473 1212 447 270 235 163 133 15878 14600 --
NM_001008536chr13705 225 202 ----1159
NM_001008539chr885018 4221 3289 1478 1468 1424 1080 490 13263 14905 21858 911
NM_001008738chr582554 2258 2172 2061 1153 925 486 259 22443 1079 1875 151
NM_001008895chr1331355 1180 505 --11126 1282
NM_001008925chr463295 3237 3213 2561 867 737 1933 --13318
NM_001009554chr4174382 4265 4235 4075 4046 3911 3795 3231 3215 2898 2891 1355 1218 1128 622 271 222 1933 ----
NM_001009554chr4174382 4265 4235 4075 4046 3911 3795 3231 3215 2898 2891 1355 1218 1128 622 271 222 1933 ----
NM_001009555chr441177 670 599 579 1664 21428 495 --
NM_001009899chr3126316 5966 5128 4903 4877 4758 2396 2234 1784 1586 1291 555 12351 --14031
NM_001009909chr11113660 3578 3413 3230 3005 1325 1077 980 724 639 90 1149 ----
NM_001009959chr272593 2373 1983 982 511 334 188 --137 1736
NM_001009960chr741793 921 390 31 1368 --2481 152
NM_001009993chr253861 3690 2972 873 373 14416 --14262
NM_001010853chr6103033 2350 2315 2252 1985 1182 767 631 482 167 --12407 --
NM_001010861chr152708 1837 1124 265 70 --12233 21758 883
NM_001010867chr1186214 5677 5609 4952 4483 4412 4295 2364 2305 2290 1946 1857 1704 1639 1260 1138 986 224 ------
NM_001010888chrX83985 3616 3596 3532 2910 1431 671 357 14063 44469 1189 715 373 --
NM_001010891chr5136680 6343 6072 5967 5807 4342 2759 2192 1579 479 116 59 24 --46854 5835 4380 317 15939
NM_001010980chr1153152 3008 2689 2547 2500 2442 2300 1375 999 923 589 479 213 62 49 42760 2415 834 37 23530 2789 --
NM_001010984chr152441 2334 2196 1769 1590 2449 237 11732 --
NM_001010986chrX82220 2164 723 550 466 166 117 69 11609 ----
NM_001011513chr483624 3098 1255 991 885 643 572 146 12596 ----
NM_001011537chr322262 2068 ----11572
NM_001011666chr7125534 5439 5308 4789 4377 4011 2421 2174 1582 556 464 400 24921 114 25061 4019 --
NM_001011885chr1571603 1516 1447 1387 1359 672 45 11677 ----
NM_001012393chr1173757 3149 1766 1192 1169 700 678 14472 23248 814 --
NM_001012420chr1562896 2799 2477 2299 1957 519 --12580 --
NM_001012423chr1562896 2799 2477 2299 1957 519 --12580 --
NM_001012426chr683297 3031 3009 2803 2354 1026 807 428 12375 11140 1997
NM_001012427chr683297 3031 3009 2803 2354 1026 807 428 12375 11140 1997
NM_001012755chrX64535 4195 3995 1444 1078 378 23267 403 13698 --
NM_001013031chr1043317 2503 2410 65 1306 12692 12357
NM_001013620chr12147130 7067 6634 6454 6357 6340 6010 5774 3083 2977 2610 2029 1279 604 33378 2568 683 21210 838 16877
NM_001013659chr19125070 4354 4110 3640 2094 2088 1598 1590 1249 1237 691 299 --34702 4684 3430 --
NM_001014342chr151665 1286 605 45 37 21638 645 ----
NM_001014380chr1395422 5141 4709 1811 1470 1439 955 407 149 ------
NM_001014797chr10217929 7774 7717 7045 6614 5994 5819 5540 5349 3158 2761 2531 1994 1637 1614 1353 1239 916 348 146 65 --27700 1624 25976 2866
NM_001015045chr462158 2086 1877 1007 891 832 159 1976 12103
NM_001015877chrX92995 2858 2556 1996 1187 634 538 362 83 --22922 1238 --
NM_001017368chr1782403 1854 1797 625 537 520 476 196 --12452 --
NM_001017395chr383316 3305 2568 2460 1389 633 344 334 11439 53485 2419 1423 1334 298 --
NM_001017440chr7208195 8178 8116 7800 7660 7399 6925 6595 6580 6574 6467 5828 2953 2241 1660 1539 1142 536 407 143 47651 7538 3222 1304 1198 26865 1897
NM_001017995chr5154317 4253 3858 3091 1786 1597 1546 1470 888 811 797 561 495 310 100 44310 1939 1693 975 21399 1191 13928
NM_001018065chr9126048 4443 3775 2264 2139 1970 1764 1742 1443 1045 848 209 35711 4629 3745 34155 2192 47 21275 1247
NM_001018066chr9126048 4443 3775 2264 2139 1970 1764 1742 1443 1045 848 209 35711 4629 3745 34155 2192 47 21275 1247
NM_001018067chr195342 5224 4773 4700 3666 1162 987 649 51 21752 131 24342 1047 --
NM_001018068chr195342 5224 4773 4700 3666 1162 987 649 51 21752 131 24342 1047 --
NM_001018069chr195342 5224 4773 4700 3666 1162 987 649 51 21752 131 24342 1047 --
NM_001018074chr593917 3880 3862 2500 1461 1124 1106 921 323 1292 ----
NM_001018075chr593917 3880 3862 2500 1461 1124 1106 921 323 1292 ----
NM_001018076chr593917 3880 3862 2500 1461 1124 1106 921 323 1292 ----
NM_001018077chr593917 3880 3862 2500 1461 1124 1106 921 323 1292 ----
NM_001024094chr593917 3880 3862 2500 1461 1124 1106 921 323 1292 ----
NM_001024380chr872275 2037 2014 1681 1628 650 220 --22308 999 --
NM_001024381chr872275 2037 2014 1681 1628 650 220 --22308 999 --
NM_001024647chr12147319 7019 6740 6699 5856 5593 5554 5253 2769 1708 1627 731 424 241 2625 88 46418 5799 2349 1599 11766
NM_001024649chr532249 1056 663 ----12743
NM_001024847chr342415 1864 437 394 133 1106 22273 54
NM_001024855chr341325 1259 478 262 --11584 11567
NM_001024948chr122357 545 21381 417 22890 1241 12364
NM_001024956chr1195571 5081 5000 4725 3930 2175 916 409 390 34080 1590 1576 15549 13884
NM_001025076chr10156144 5819 5477 5357 4788 4776 4602 4493 4358 4228 2087 1626 1450 1098 1090 25498 4814 13813 --
NM_001025077chr10177502 7177 6835 6715 6146 6134 5960 5851 5716 5586 4754 4659 2984 2808 2456 2448 114 46856 6172 939 600 15171 --
NM_001025079chr373907 3048 2905 1635 1605 423 173 1393 13806 --
NM_001025100chr1873704 3529 3506 3028 1425 1415 680 --2742 561 14024
NM_001025108chr2113967 3941 3603 3370 3257 2983 669 615 445 403 22 13187 11213 --
NM_001025580chrX73428 3123 2634 1630 769 660 515 11141 13869 13435
NM_001025780chr971564 1167 415 304 283 170 164 ------
NM_001029863chr692983 2296 923 769 737 577 399 327 264 32406 2379 2069 32117 447 371 --
NM_001029875chr593032 2987 2896 2522 2476 2339 1124 797 633 12451 12606 --
NM_001030007chr1683536 2768 2626 1406 997 753 635 141 23638 980 142 11342
NM_001030055chr14124603 4198 3582 1887 1530 1263 1255 1194 1134 950 661 460 11846 --1644
NM_001031679chr1283007 2963 2455 791 722 583 548 60 12562 1377 --
NM_001031695chr22114329 4225 4104 3419 2057 1664 1650 1432 1224 1199 943 35161 3443 224 23503 409 --
NM_001031716chr22954 417 --1403 11016
NM_001031804chr1673925 3321 2956 1604 1328 1241 839 21234 941 22744 1750 --
NM_001032221chr951685 1603 1355 1136 569 --21806 1148 --
NM_001032380chr1061941 1864 1602 683 531 64 11446 21837 164 --
NM_001032394chr672309 2243 2103 1933 1091 824 331 21139 678 ----
NM_001032395chr682176 2110 1970 1800 1045 958 691 198 21006 545 ----
NM_001032999chr20105323 4951 4724 4571 4503 4230 3761 3594 2150 1617 34776 3671 1085 11827 23743 3733
NM_001033087chr2093246 2535 1275 1141 945 886 619 564 385 --12625 12412
NM_001033117chr3124818 4729 4531 4343 3702 3037 1653 1124 847 827 754 536 21498 801 24541 219 23421 3367
NM_001033925chr1041824 1774 1500 234 1555 --11603
NM_001034841chr16145402 5117 4782 4731 4658 4276 4004 3761 3485 1005 910 723 39 28 2884 667 2899 413 15358
NM_001034850chr571426 1194 1088 533 488 302 40 11334 --11121
NM_001035chr1130 --11103 1193
NM_001037165chr7218952 8470 8217 8082 7906 7783 7240 6942 6509 5931 5562 3528 3312 2807 2498 1664 1303 1287 952 883 50 --38672 6933 418 --
NM_001037174chr252200 917 897 722 201 ------
NM_001037317chr152708 1837 1124 265 70 --12233 21758 883
NM_001037553chr21105199 4801 4579 4400 4203 4106 1736 1434 746 328 33972 1888 861 13595 15145
NM_001037954chr11133490 2544 2512 2360 2278 1286 1245 989 546 485 112 79 73 13375 33456 3439 275 1511
NM_001039199chr20124992 4801 4336 4113 3582 3256 1750 1375 1306 630 440 423 --24960 343 --
NM_001039459chr761053 826 445 399 379 284 --1385 --
NM_001039538chr283652 2884 2828 2765 2392 1363 1253 995 13320 --1433
NM_001039569chr283318 3007 2661 2622 2412 2037 1250 102 11008 --1600
NM_001039580chr4104254 3576 3214 1873 1857 1256 1214 1006 707 478 11429 23582 806 --
NM_001039585chr184266 4210 4133 4113 1659 1470 1311 69 33068 1205 589 11096 --
NM_001039615chr861803 907 719 693 411 226 ----21473 348
NM_001039618chr1175285 5170 4738 2287 1857 1724 1353 35567 2076 1523 14420 --
NM_001039693chr293922 3350 3240 2913 2582 1499 1281 560 209 --13485 --
NM_001039697chr971559 1291 1168 448 341 124 116 1355 ----
NM_001039709chr20105323 4951 4724 4571 4503 4230 3761 3594 2150 1617 34776 3671 1085 11827 23743 3733
NM_001039762chr10102095 1874 1687 1630 1479 813 807 711 491 137 1261 11920 12405
NM_001039802chr1268 50 ----175
NM_001039840chrX95980 5831 5463 4466 3806 1927 1893 1824 788 32096 1120 551 ----
NM_001040001chr661904 1676 822 741 586 290 31411 1365 1313 ----
NM_001040151chr1194331 3792 3727 2835 1411 1257 618 296 95 --13415 --
NM_001040152chr7114870 4241 3830 1667 1507 1473 1416 1330 1323 933 882 24491 3932 13667 11997
NM_001040181chr36896 869 364 297 171 150 1471 1342 --
NM_001040182chr36896 869 364 297 171 150 1471 1342 --
NM_001040183chr36896 869 364 297 171 150 1471 1342 --
NM_001040199chr36896 869 364 297 171 150 1471 1342 --
NM_001040200chr36896 869 364 297 171 150 1471 1342 --
NM_001040214chr672123 2094 2071 881 538 509 391 142 ----
NM_001040284chr16125715 5400 5026 4895 4245 4021 3737 3603 1729 1719 1281 433 45851 5086 4193 753 --14472
NM_001040409chr22400 377 --1406 1889
NM_001040429chr13102945 2566 2518 2300 1270 1057 1010 916 522 207 13349 13313 --
NM_001040441chr1155126 5054 4828 4809 4731 4421 4217 3405 3374 2024 2003 1750 895 480 368 63888 3644 768 666 337 285 23680 571 --
NM_001040450chr1562764 2530 2441 2013 1151 1080 12321 --11922
NM_001040453chr1562764 2530 2441 2013 1151 1080 12321 --11922
NM_001040665chr794915 4884 4559 4516 4431 4059 3422 1115 1056 14537 24524 1033 --
NM_001040666chr75617 586 261 218 133 1239 1226 --
NM_001040712chr962885 2500 2249 1429 696 171 ----22309 822
NM_001042413chr983999 2904 1636 1531 1496 1013 480 244 41393 951 895 882 ----
NM_001042473chr1062018 1742 1473 622 374 349 ----11853
NM_001042481chr1462601 2193 1861 874 604 511 22285 560 11880 --
NM_001042492chr1782511 2403 2261 2165 2147 1397 837 802 --12212 --
NM_001042493chr672028 1459 1311 721 647 623 135 --11818 --
NM_001042494chr1583152 2893 2774 1476 1405 1125 608 259 13476 --1439
NM_001042495chr1583152 2893 2774 1476 1405 1125 608 259 13476 --1439
NM_001042496chr1583152 2893 2774 1476 1405 1125 608 259 13476 --1439
NM_001042497chr1583152 2893 2774 1476 1405 1125 608 259 13476 --1439
NM_001042555chr1264460 3906 3391 1677 1608 498 --1146 11478
NM_001042599chr2177147 7081 6842 5881 5694 5534 3126 3099 2320 1978 1812 1471 1225 848 298 268 92 35028 3042 1895 26934 736 15427
NM_001042601chr353301 2603 1073 809 733 13008 --12758
NM_001042603chr12105276 4564 4515 4432 3818 1653 1388 1279 809 517 34858 492 103 ----
NM_001042604chr3114250 4213 3827 3046 1912 1883 1372 953 294 250 178 --22948 624 --
NM_001044385chr273908 2938 1521 1374 1009 964 597 33659 3344 1468 --11404
NM_001046chr582766 2620 2361 1925 1002 589 562 351 ------
NM_001048183chr1113507 3190 2849 2519 2359 2303 1284 844 702 423 56 --1266 --
NM_001049chr1482476 2402 2243 2123 2095 2062 692 54 1880 ----
NM_001079874chr152166 1688 394 257 31 1167 --12039
NM_001083620chr4102360 2315 1917 1798 1005 929 690 549 226 100 1947 ----
NM_001083621chr184010 3990 3823 3000 1681 1670 1647 1188 --54164 3686 3204 1743 817 --
NM_001099678chr3166419 6201 5948 5825 5320 5139 4853 4507 4206 4105 3993 2546 1303 1116 737 381 1529 1366 35411 2237 115
NM_001100108chr1158140 6478 6379 6170 6098 5528 3061 2914 2895 2817 2024 1961 1618 998 457 47458 6538 1578 963 18031 --
NM_001106chr3149493 8627 8201 7948 6727 6470 6174 3347 2723 2631 1453 1393 1121 1097 37660 7482 3368 19300 19146
NM_001117chr1822442 2346 11600 --11885
NM_001128chr1683536 2768 2626 1406 997 753 635 141 23638 980 142 11342
NM_001148chr462069 1893 1823 752 194 81 21461 534 --1359
NM_001153chr26678 642 634 614 605 205 ------
NM_001160chr1272658 2197 1920 1882 1131 828 425 21891 1802 ----
NM_001167chrX145997 5960 5728 5098 4842 4757 4137 2659 2113 2072 1239 805 750 110 22422 637 1696 15017
NM_001173chr14124603 4198 3582 1887 1530 1263 1255 1194 1134 950 661 460 11846 --1644
NM_001174chrX82066 2019 1993 1824 1763 1588 1489 252 2720 356 1279 --
NM_001198chr662313 2137 1910 1485 963 155 --22329 2114 --
NM_001201chr493292 3040 1169 1038 914 801 705 269 252 23716 2464 13440 1169
NM_001204chr2167010 6759 5738 5612 4939 3070 2799 2695 2185 1707 1292 1262 876 744 277 230 37026 1782 731 --17630
NM_001206chr943089 2662 2564 2011 1644 1193 --
NM_001219chr732246 1629 1412 21492 919 1779 11470
NM_001256chr1792764 2230 2126 1984 1085 813 681 652 594 22241 515 2871 356 12023
NM_001259chr7106033 5628 5376 4606 4167 4033 2172 1494 626 567 21807 149 24423 1692 15080
NM_001304chr1793143 2540 1503 1441 1428 1406 592 370 38 1104 ----
NM_001310chr1282535 1045 921 762 735 435 163 140 12492 ----
NM_001331chr1172581 2243 2235 2026 2006 1984 634 12000 11000 --
NM_001356chrX72077 1872 795 726 712 419 30 ------
NM_001364chr11114328 3376 1887 1517 1463 1070 828 801 315 231 177 34286 3918 1255 --1693
NM_001390chr1863340 3130 2589 2385 699 291 31335 1312 192 2968 922 33457 1275 143
NM_001399chrX93455 3048 2835 2679 1464 1328 982 398 322 53248 2584 532 481 350 ----
NM_001412chrX83492 3135 2745 2649 2418 2326 1450 1260 12401 ----
NM_001419chr19114723 4634 4015 3174 1897 1689 1553 1082 1045 846 712 54587 3332 1850 630 402 --1682
NM_001438chr132926 588 100 12839 --2930 664
NM_001448chrX71718 1586 1531 1501 1456 626 32 21413 1241 ----
NM_001453chr65545 80 51 36 23 ------
NM_001483chr731034 364 354 11070 ----
NM_001490chr993522 2442 2366 1355 739 642 366 322 243 ----1437
NM_001542chr172856 2214 1051 989 870 756 506 1652 22416 2354 --
NM_001546chr611351 11254 41207 1126 1086 410 1371
NM_001609chr1084516 3023 2922 2757 1793 1709 1214 518 44275 3931 3640 3180 ----
NM_001616chr221054 390 162 1534 12476
NM_001621chr782937 2738 2707 2671 2091 428 187 141 --23045 2458 --
NM_001621chr782937 2738 2707 2671 2091 428 187 141 --23045 2458 --
NM_001627chr342150 1927 490 138 128 41981 1787 1767 978 --
NM_001650chr18113742 3661 3475 3382 3182 2832 2514 1440 1213 806 629 43148 2879 1658 327 1645 --
NM_001663chr1472704 2043 1841 1714 1036 508 41 --11947 11798
NM_001682chr12102709 2520 2402 2391 2205 1831 950 932 656 595 ------
NM_001683chr342029 1827 1002 122 11922 22200 2146 1580
NM_001684chr1134113 3557 3330 3187 1488 1334 1079 1066 996 986 920 557 507 11143 23917 1021 --
NM_001695chr864305 3202 3133 1224 686 226 13929 13612 11672
NM_001699chr1971827 1562 728 671 355 298 276 21164 315 11402 --
NM_001718chr651172 1049 395 370 303 --1425 --
NM_001746chr532249 1056 663 ----12743
NM_001754chr21114091 2912 1578 1350 1302 1262 1217 1143 988 881 398 21054 414 14240 --
NM_001759chr12104277 3918 3691 3619 3588 3560 3363 1710 1205 784 11970 23442 818 --
NM_001777chr373907 3048 2905 1635 1605 423 173 1393 13806 --
NM_001791chr1268 50 ----175
NM_001806chr1952598 1017 846 792 221 1108 1695 --
NM_001830chrX63322 3037 2840 2661 2578 1070 23694 3513 13170 1475
NM_001855chr9------2191 138
NM_001858chr6125024 4755 4527 4391 4307 3484 1726 1233 975 861 739 691 12023 14613 11172
NM_001859chr9153681 3554 3268 3173 2840 2534 2456 1522 1263 1013 914 877 629 557 467 --1181 --
NM_001874chr12125077 4645 4603 3698 2075 1400 1329 1196 958 920 529 457 11021 11268 --
NM_001945chr561324 967 953 264 183 159 --2454 168 --
NM_001957chr472283 1524 895 649 450 286 239 1724 ----
NM_001969chr14153909 3702 3655 3449 3233 3211 3017 2974 2958 2601 2566 2502 1045 595 124 --33140 2749 504 --
NM_001977chr451578 1513 1447 1097 562 --1516 1356
NM_001987chr12134226 4134 4046 3848 3605 3088 1683 1259 1130 1077 820 778 148 23029 870 ----
NM_001995chr441505 1472 1115 943 1410 --21333 492
NM_001999chr551508 1412 1307 1285 290 21043 185 --11356
NM_002006chr495681 5374 4953 4817 4494 4247 1963 1468 1237 11210 --1894
NM_002009chr1542176 2142 2045 776 --1227 --
NM_002024chrX52179 1977 1517 622 266 181 11641 --
NM_002025chrX168790 8771 6418 5864 5813 3701 3587 3353 3247 2839 2421 2033 1603 1578 1477 835 47680 6056 3410 2267 25928 619 --
NM_002040chr21122949 2799 2608 2462 1231 692 532 506 455 433 303 27 ------
NM_002076chr1252855 1166 457 417 411 13058 ----
NM_002092chr464409 3189 1132 655 567 454 13950 1466 13132
NM_002126chr17114003 3796 3639 3385 3303 2601 2539 1391 933 724 404 --23879 104 --
NM_002158chr263599 3294 2770 2338 1037 743 12549 157 13798
NM_002203chr5123428 2957 2927 1602 1304 1273 1046 1017 799 645 527 270 13736 13392 --
NM_002210chr283416 3216 3199 2986 2231 818 716 94 ----1480
NM_002223chr12123930 3801 3795 3619 3590 2616 2467 1583 1386 1356 1290 118 13367 ----
NM_002227chr151117 1067 357 325 235 --11257 11328
NM_002247chr1082278 2248 736 653 535 491 250 214 11625 1638 11851
NM_002264chr3155026 4915 4803 4603 4561 4332 4305 4189 4126 4027 3277 1616 1517 394 215 24820 1799 13805 11488
NM_002267chr13102470 2382 1669 1628 779 507 162 128 62 51 ----1414
NM_002270chr5105588 5474 4867 3560 2269 1423 1261 746 677 345 ----1753
NM_002285chr2113967 3941 3603 3370 3257 2983 669 615 445 403 22 13187 11213 --
NM_002310chr5136493 5271 5112 4859 4274 2384 1892 1588 1339 1150 617 471 178 46539 4837 1798 246 --11117
NM_002336chr12114741 4412 3969 3271 3083 1796 912 810 372 268 246 23926 3873 --14504
NM_002356chr6142711 2650 2461 2249 2224 2199 2130 2024 1987 1886 933 462 408 151 --12337 --
NM_002374chr283652 2884 2828 2765 2392 1363 1253 995 13320 --1433
NM_002387chr584422 3723 1920 1678 1340 913 823 195 --33798 1193 624 11328
NM_002401chr1762200 2122 2084 1000 392 336 1950 21810 329 1567
NM_002451chr953657 1432 1149 892 433 43735 3639 1035 339 --1121
NM_002486chr952545 1768 783 525 418 --22143 811 --
NM_002522chr1783824 3668 3483 3073 2986 2564 915 567 33282 1382 1183 33782 3209 1003 --
NM_002545chr1173757 3149 1766 1192 1169 700 678 14472 23248 814 --
NM_002581chr9175298 5291 5169 4631 4179 4133 4083 4054 3630 1948 1889 1835 919 494 255 217 176 31366 1173 24 ----
NM_002610chr2102957 2050 2028 967 937 894 715 624 168 84 --11102 --
NM_002612chr77806 607 593 555 516 377 253 --134 11846
NM_002645chr1163034 2926 2584 2408 2050 1248 12673 21942 416 1718
NM_002655chr8105202 4661 4388 3900 3477 3258 2093 1779 1165 854 15173 11953 --
NM_002698chr19172955 2908 2895 2877 1937 951 929 877 659 604 595 570 559 523 491 443 427 --22389 532 --
NM_002709chr243508 3090 3004 317 12929 23132 1194 11165
NM_002716chr1193688 3248 3173 2849 2478 2469 1392 1199 418 1163 ----
NM_002718chr3112709 2625 2598 2544 2422 1972 1790 572 485 295 242 1526 12536 1274
NM_002719chr1462195 2114 2040 633 184 99 --1383 --
NM_002731chr172992 2850 2834 2315 2103 953 487 ----1530
NM_002737chr17116296 5754 5376 4974 4935 4552 4510 4414 4107 716 182 35358 2562 1190 --1372
NM_002745chr2264561 3927 3507 3472 2851 510 2190 172 --1376
NM_002834chr12124091 3561 3467 2940 2902 2693 2482 2476 1406 1249 807 534 12655 23741 3006 11362
NM_002837chr12144326 4314 4138 3771 3688 3622 3485 3359 3302 1608 1465 1192 1153 635 34042 2821 1656 34058 565 265 13034
NM_002839chr962885 2500 2249 1429 696 171 ----22309 822
NM_002843chr1153457 2912 1121 357 34 22837 764 --11287
NM_002886chr354109 3842 3501 319 44 34980 4735 4399 1793 --
NM_002941chr371479 1473 1433 1157 534 429 389 ------
NM_002959chr133113 2810 1544 22952 935 33540 3186 132 1154
NM_002998chr872218 2198 2020 1993 1709 439 363 31434 750 314 --11536
NM_003034chr12127989 7511 7471 6614 5772 5686 4971 2819 1715 1694 1575 927 12709 15387 12638
NM_003043chr383700 3677 3477 3132 1663 1279 741 640 33694 3317 813 11122 12882
NM_003046chr885018 4221 3289 1478 1468 1424 1080 490 13263 14905 21858 911
NM_003048chr262771 2524 2247 2038 1846 411 1163 12355 --
NM_003099chr15146588 6228 6206 5756 5455 4887 4221 4135 2039 1110 1064 857 835 468 34970 1262 995 ----
NM_003108chr2106789 6430 6196 6093 5391 5272 2088 1144 879 792 14880 17092 --
NM_003112chr762395 2271 1052 998 802 494 1975 --11247
NM_003137chr672007 1830 1763 1408 601 572 242 1229 32151 860 765 --
NM_003144chr692244 1485 1430 906 760 503 304 262 182 11659 ----
NM_003155chr8102463 1872 1757 1124 1056 960 776 598 571 31 ----1711
NM_003199chr18135532 5164 4172 3987 3453 2278 2204 1449 1357 1185 989 852 174 25606 288 23643 1133 --
NM_003221chr6103856 3353 3249 3055 2695 2639 1149 999 335 131 43527 3226 2631 1033 11101 13485
NM_003242chr342415 1864 437 394 133 1106 22273 54
NM_003262chr3125168 4998 4785 4668 4077 3985 3928 3644 3350 2014 1084 341 33716 3576 3560 12091 23863 264
NM_003272chr11287 1641 --1187
NM_003292chr172071 1681 776 559 346 212 41 2668 378 ----
NM_003298chr375117 4910 4714 4202 933 851 268 34592 4533 24 25871 1428 11230
NM_003344chr751388 1275 1226 382 101 21564 371 ----
NM_003369chr11102546 2365 2321 1886 1879 1771 879 814 752 178 12607 --11937
NM_003373chr1061455 1444 1277 764 80 41 11686 --11708
NM_003387chr262246 1817 979 872 685 306 11910 21018 987 --
NM_003392chr373681 3632 2873 2634 1411 441 210 12837 23043 978 --
NM_003412chr383071 2387 1202 681 577 275 235 90 ------
NM_003421chr1084326 3841 3625 3569 1432 1032 867 198 33487 832 521 33970 1730 1066 --
NM_003439chr742361 741 636 576 22161 1034 1540 1583
NM_003468chr2174274 4104 3868 3516 3415 3369 3282 3226 3134 2915 2878 1698 1674 986 600 178 72 13331 13062 --
NM_003483chr1282512 2442 2221 2169 2022 1923 806 354 11865 22274 1171 1516
NM_003505chr771882 1702 1609 1522 1314 201 56 ------
NM_003559chr1753820 959 495 153 23 21548 30 --23239 678
NM_003574chr1895792 4753 4445 4030 4014 1878 1819 212 50 14343 --14610
NM_003583chr1233432 3382 581 43917 1226 987 330 23198 506 --
NM_003589chr1331355 1180 505 --11126 1282
NM_003590chr263962 3290 3150 2679 2633 1226 21155 1025 13439 --
NM_003607chr1114369 4260 3877 3573 3339 3226 3189 1337 1279 1234 283 11153 1842 --
NM_003615chr383868 3407 2946 2786 2763 1584 1464 1434 13536 13123 --
NM_003644chr17136104 4137 2630 2019 1939 1723 1682 1404 1226 1214 851 814 346 35512 5100 1396 11673 15434
NM_003651chr121140 146 --2379 106
NM_003663chr383413 2808 2528 2225 675 667 645 637 ------
NM_003672chr181824 1523 1494 1487 1437 1342 638 438 ------
NM_003714chr5112913 2843 2813 2181 963 891 811 667 537 389 352 ------
NM_003743chr262259 1840 822 607 338 266 --2443 232 --
NM_003758chr1581386 1294 1023 567 286 221 189 88 1591 11168 --
NM_003758chr1581386 1294 1023 567 286 221 189 88 1591 11168 --
NM_003759chr4133882 3628 2991 2918 2769 2721 2682 2661 2604 1717 666 386 254 13778 ----
NM_003760chr14594 534 219 213 ------
NM_003763chr20112813 2392 2130 1998 1173 1031 1013 924 833 738 444 11114 ----
NM_003774chr1253121 2244 510 175 95 153 22826 946 --
NM_003822chr1112822 2426 2243 2205 1175 808 788 582 532 238 162 --21222 221 12051
NM_003829chr92470 339 ----1350
NM_003831chr1851539 1267 487 440 88 ----11448
NM_003873chr1062028 833 618 366 253 30 52548 2099 1998 1864 1768 ----
NM_003895chr2151551 1433 613 562 409 ----1399
NM_003916chrX3605 580 463 1511 --1399
NM_003939chr10103899 3580 3455 3116 2749 2711 2684 1146 514 100 12628 --13879
NM_003966chr5146954 6850 6655 6542 6253 6199 5881 5505 2313 1897 966 955 466 147 15120 1129 15380
NM_003983chr1694266 4005 3673 3527 3427 3362 3315 3300 1028 23680 3277 23002 593 --
NM_003994chr1284056 4038 3988 3646 3566 1601 1427 468 23404 1354 33487 2865 1347 11654
NM_004006chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004007chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004009chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004010chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004011chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004012chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004013chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004014chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004015chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004016chrX72536 2343 2011 1988 1827 799 521 12084 1323 --
NM_004017chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004018chrX72536 2343 2011 1988 1827 799 521 12084 1323 --
NM_004020chrX72622 2429 2097 2074 1913 885 607 12170 1409 --
NM_004021chrX72536 2343 2011 1988 1827 799 521 12084 1323 --
NM_004022chrX72536 2343 2011 1988 1827 799 521 12084 1323 --
NM_004023chrX72536 2343 2011 1988 1827 799 521 12084 1323 --
NM_004028chr18113742 3661 3475 3382 3182 2832 2514 1440 1213 806 629 43148 2879 1658 327 1645 --
NM_004035chr17155109 4938 4828 4703 4628 4563 4504 4257 4124 3752 3466 3184 1754 579 432 ------
NM_004094chr14102771 2674 2579 2495 2400 2021 1920 400 351 98 --12043 --
NM_004098chr1031199 389 382 1252 --11162
NM_004100chr662268 2150 1731 766 539 261 --12698 --
NM_004109chr1152268 2196 1496 670 207 1561 12296 1646
NM_004113chr332065 1907 1261 190 21395 180 1743
NM_004124chr1462827 2687 2619 1290 1154 23 1440 ----
NM_004133chr882708 2681 2627 2354 2199 861 721 96 1598 11022 --
NM_004136chr1582743 2481 2398 2309 1262 1152 846 609 23031 871 22760 1073 --
NM_004171chr11118604 7998 7824 7465 6041 3579 3248 2198 863 691 189 49042 6394 927 586 33811 1118 805 17409
NM_004227chr7113141 2914 2780 2301 1162 1130 678 415 216 153 123 22589 2573 ----
NM_004229chrX61600 1424 658 299 223 160 1497 ----
NM_004232chr1873786 3097 2708 2415 2403 270 83 13597 ----
NM_004273chr10174520 4098 3947 3844 3689 3659 3461 1898 1799 1743 1620 1591 983 889 483 328 144 ------
NM_004279chr772400 2008 1466 810 773 479 121 --11731 --
NM_004311chr1063030 2281 2021 928 257 81 21159 936 23072 2800 --
NM_004337chr892271 2023 1411 778 660 505 403 249 184 ------
NM_004338chr18176824 6768 6533 6147 6016 5588 4886 2787 2726 1818 1422 794 761 513 491 115 40 1677 16125 --
NM_004370chr662079 1987 1786 1691 508 436 --3628 474 323 11365
NM_004393chr372388 2037 1805 940 676 464 177 11982 3829 625 605 1452
NM_004397chr1173801 3616 3312 3162 2716 1143 799 33739 3716 1112 --21285 866
NM_004449chr213551 461 79 41505 1234 294 148 21418 370 --
NM_004454chr392179 1446 1423 1417 372 261 209 98 25 --11803 --
NM_004457chr261434 1420 1308 1103 478 45 ------
NM_004458chrX5805 642 523 437 137 22120 111 12192 --
NM_004459chr1711503 ----11705
NM_004464chr473423 2796 2789 1692 1588 1435 1158 23047 372 1672 --
NM_004482chr24919 784 702 183 ----1207
NM_004485chr1114257 3162 2690 1703 1647 1553 811 396 236 221 42 13961 1963 --
NM_004501chr163393 2605 2574 1597 603 415 11006 ----
NM_004529chr941457 292 142 121 2315 242 11385 --
NM_004540chr215884 629 301 141 67 ------
NM_004586chrX95295 5285 4864 4520 2032 1600 1137 1074 943 14300 ----
NM_004588chr1193748 2951 2576 1233 1176 875 770 477 164 1297 13836 13032
NM_004598chr563163 3109 2630 2246 156 82 1350 190 22514 2098
NM_004600chr13187 173 53 126 21185 481 --
NM_004602chr2051510 1355 1097 472 448 1425 --1464
NM_004612chr923336 836 21444 1104 23882 1839 2857 384
NM_004621chr1141290 1086 1033 817 11117 --11273
NM_004660chrY82338 2002 1991 1802 598 417 400 142 ------
NM_004713chr145793 576 285 134 110 163 ----
NM_004726chrX125570 5147 5042 4743 4350 3780 874 787 556 390 365 282 21742 637 24164 4109 --
NM_004730chr551972 1341 654 164 153 156 11361 11855
NM_004745chr8176616 6434 6270 6070 5670 5303 5235 4947 4696 4252 1949 1834 1652 1429 1369 1256 1135 12521 15105 16890
NM_004760chr7102242 2226 2195 2150 1617 1536 891 413 337 73 --1506 --
NM_004775chr1891969 1887 1824 946 868 754 482 468 284 1266 ----
NM_004788chr1192550 2312 2298 2034 325 234 131 37 24 --11748 --
NM_004796chr1452344 953 510 352 191 11548 12087 --
NM_004798chr20103316 3071 2949 2693 2673 2640 1424 1204 1127 873 1749 23062 2417 --
NM_004808chr1073414 3296 3024 2952 2340 831 762 22568 78 12608 --
NM_004815chr194493 4225 3284 3200 1801 1593 1206 290 109 14141 ----
NM_004822chr17133999 3669 3662 3629 3540 3349 3042 3000 2725 1610 1257 486 287 43156 2903 1235 917 11177 --
NM_004834chr292763 2506 2101 1371 1187 1168 1060 1051 35 12432 ----
NM_004857chr14114715 3831 3799 3493 3293 3013 1737 1367 1317 1251 681 43605 3437 1232 145 ----
NM_004859chr1772835 2593 2449 2136 2093 1170 438 32800 1112 428 11119 --
NM_004866chr574875 4567 4213 4144 1992 1351 1165 23088 1307 ----
NM_004871chr1763771 3147 2913 743 494 279 23465 378 14037 11739
NM_004904chr7125534 5439 5308 4789 4377 4011 2421 2174 1582 556 464 400 24921 114 25061 4019 --
NM_004921chr1112423 2301 2164 1771 1001 919 469 410 385 322 284 ------
NM_004937chr17112701 2028 1711 1028 846 614 585 388 317 304 150 22675 420 12595 11784
NM_004956chr7103991 3522 2993 2987 1489 1312 998 935 851 692 11374 ----
NM_004992chrX188388 8100 7695 7341 6877 6850 6345 6316 6289 6123 5800 3102 3023 2805 2485 1709 1074 298 37216 2982 2627 22677 2111 --
NM_004992chrX188388 8100 7695 7341 6877 6850 6345 6316 6289 6123 5800 3102 3023 2805 2485 1709 1074 298 37216 2982 2627 22677 2111 --
NM_004993chr143428 282 168 31082 196 90 ----
NM_004996chr16121560 1537 1163 1118 662 406 372 144 132 118 104 84 11621 ----
NM_005036chr22177998 7887 7713 7319 6443 6189 5986 5813 5445 3208 3131 3038 2324 1083 910 707 464 47557 6336 532 504 25690 2259 17631
NM_005044chrX103990 3546 3496 3381 3334 3284 3210 2993 1632 78 ------
NM_005056chr12105520 4808 4759 4676 4062 1897 1632 1523 1053 761 35102 736 347 ----
NM_005063chr1063472 2833 2401 1492 529 324 21139 98 22497 2353 --
NM_005065chr14125248 5148 4437 4355 4072 1685 1087 1038 901 815 391 137 34556 3615 646 --11055
NM_005076chr1123517 2783 1674 1621 1553 1531 1402 1320 667 485 402 77 43762 3354 1301 99 23374 822 --
NM_005082chr1753470 2907 2897 680 454 43312 1332 575 106 23612 1143 13081
NM_005093chr20105323 4951 4724 4571 4503 4230 3761 3594 2150 1617 34776 3671 1085 11827 23743 3733
NM_005095chr172150 1900 1614 1532 794 450 46 ------
NM_005105chr152118 848 817 730 202 ----1615
NM_005109chr372402 1876 1852 843 778 712 208 3963 460 89 12367 --
NM_005116chr2094530 1835 1463 1398 1162 814 387 248 116 13679 1453 --
NM_005126chr372089 1509 778 575 492 293 287 11426 ----
NM_005135chr1583152 2893 2774 1476 1405 1125 608 259 13476 --1439
NM_005156chr9105038 4950 4636 3750 3253 2024 1711 1224 435 186 14353 34654 4117 4060 14680
NM_005164chr1272184 2127 1878 1047 480 380 279 32224 806 49 ----
NM_005188chr11127783 7179 5816 5524 5107 2010 1866 1778 1604 825 578 153 46679 6144 2195 1472 27250 2931 18303
NM_005189chr17112468 2351 2179 1994 1823 1794 1761 1593 1547 968 940 1958 ----
NM_005197chr14175866 5803 5118 4742 4605 4503 4220 3985 3932 3893 3883 2361 2122 997 931 289 280 36118 6009 5422 14831 --
NM_005226chr992655 2524 2408 2116 1902 731 639 600 209 2822 154 ----
NM_005235chr2177147 7081 6842 5881 5694 5534 3126 3099 2320 1978 1812 1471 1225 848 298 268 92 35028 3042 1895 26934 736 15427
NM_005241chr361380 1254 996 929 121 31 --2900 21 --
NM_005256chr112787 596 1142 --1301
NM_005259chr261481 1461 1319 242 218 144 ------
NM_005277chr421253 436 --11215 1272
NM_005296chrX5941 678 210 197 103 ----168
NM_005359chr18176174 5402 5115 4918 4716 4697 4420 4412 4232 2337 1400 929 869 680 629 491 400 26398 4908 15486 --
NM_005399chr1134058 3913 3658 3316 1743 1693 1291 1200 1146 831 535 498 286 31072 759 410 22844 1481 --
NM_005400chr293038 2808 2725 2469 2285 809 736 620 185 12689 --1537
NM_005409chr43740 232 178 --11063 1908
NM_005433chr18102542 2303 2156 2098 1746 944 429 325 75 37 1342 1802 --
NM_005436chr10103027 2982 2963 2759 1029 629 439 312 193 65 ----13305
NM_005440chr1773194 3043 2999 1260 1054 449 277 32699 2605 360 12900 --
NM_005458chr982398 1996 1963 1957 1896 1760 920 284 21806 1628 1973 --
NM_005475chr1272973 2665 2188 2082 2035 1087 316 22938 96 --12804
NM_005476chr991414 1291 1257 1245 524 267 156 90 35 11423 ----
NM_005497chr17165584 5515 5405 5244 4953 4599 4349 4340 4271 4170 2125 1878 1596 1033 1022 681 36053 3740 1184 14214 --
NM_005502chr982678 2280 2190 1283 820 492 399 393 12839 22780 2166 --
NM_005504chr12126597 6380 5777 5646 5446 5354 4726 2116 1353 1301 311 182 1161 16491 --
NM_005530chr1541515 1005 502 463 21060 186 --11277
NM_005578chr3134936 4268 4246 3856 3422 3230 1896 1872 1562 938 697 169 80 65139 4183 3358 1219 717 223 ----
NM_005596chr975815 5660 5058 4446 4314 1855 902 --25418 1971 --
NM_005604chr652125 2067 382 361 349 --1783 --
NM_005647chrX92992 2983 2869 2637 2377 2126 381 352 214 22274 479 --11106
NM_005665chr174838 4621 4576 1294 755 456 180 24801 4184 ----
NM_005668chr574076 3855 3165 1065 1032 915 339 22980 54 --11132
NM_005715chr692631 2341 1797 1109 849 812 725 241 83 --1872 --
NM_005725chr182409 1492 853 732 601 583 45 32 11709 1908 1330
NM_005730chr12123342 2764 2516 2401 1302 1013 901 659 602 409 317 190 32964 2386 449 22432 2251 --
NM_005748chr1273463 3149 2597 2269 2242 1288 178 1426 ----
NM_005759chr294617 3980 3532 3157 1439 1211 580 281 254 ----13508
NM_005779chr593655 3496 3427 3370 3364 3072 2290 1222 501 1633 31318 540 102 --
NM_005795chr292921 2592 1110 965 772 550 503 361 260 12071 ----
NM_005798chr13115278 4903 4425 4284 4251 1811 1706 1345 1152 841 637 1678 1778 1955
NM_005813chr252639 2550 1955 1795 1633 22518 1945 12032 --
NM_005819chr1113390 3269 3011 2959 2783 2143 2128 1314 1201 903 818 22433 426 13215 --
NM_005828chr17104605 4187 3955 3367 3069 1709 1526 368 130 66 34327 4284 1752 ----
NM_005832chr341245 463 409 269 --21311 398 168
NM_005840chrX207420 7347 7170 6792 6586 6543 6507 6427 5702 5559 5160 2676 2647 1564 1247 1020 731 147 101 24 47643 6027 5242 1793 15918 --
NM_005868chr722444 76 21777 569 32486 1833 1706 --
NM_005885chr571514 1500 1464 1340 1108 1099 479 --21275 591 --
NM_005898chr1172011 993 592 520 408 68 32 12218 ----
NM_005901chr18138507 7597 7362 6849 5485 5439 2964 2049 1122 1054 768 561 276 --12071 15457
NM_005909chr583870 3752 3539 3203 2874 590 155 120 23027 458 1908 --
NM_005920chr1123607 3109 3065 2964 2618 1539 1389 998 652 466 430 419 ------
NM_005935chr482045 1569 1312 1230 931 922 592 94 35190 1834 219 1243 --
NM_005941chr864004 3359 1490 1223 667 138 22856 543 32663 1556 660 1298
NM_005955chr1115358 5002 4901 4808 4420 4107 3524 2101 1693 1418 1206 ------
NM_005957chr1104770 3991 3898 3628 3583 3532 1561 998 880 344 43311 3100 3050 2986 21752 332 --
NM_006007chr9104473 4310 3518 3375 1541 693 574 407 292 104 ------
NM_006016chr692301 2190 1840 1685 836 470 397 281 59 ------
NM_006047chr2073435 3007 2619 1174 1139 841 458 --1761 --
NM_006055chr2122752 2535 2525 2212 2082 2070 1134 1086 1002 667 502 228 2193 86 --12344
NM_006060chr784390 3403 3250 3003 1620 1381 1229 103 12972 2987 937 --
NM_006080chr762588 1932 1193 900 374 334 22329 626 ----
NM_006106chr1152899 1226 463 347 215 1209 22235 522 --
NM_006113chr152166 1688 394 257 31 1167 --12039
NM_006139chr292916 2871 2692 2352 936 678 659 624 150 ----12596
NM_006141chr16102649 2243 2139 2006 1804 1018 802 441 334 35 11901 22237 1825 --
NM_006154chr1582889 2456 1031 876 676 239 85 51 12096 --11055
NM_006194chr1461104 1013 948 473 460 303 ------
NM_006203chr5125552 5444 4774 4731 4337 4159 3997 3884 2070 2042 997 56 --11747 --
NM_006212chr174654 3480 3406 1589 1152 1095 995 23703 1278 15145 187
NM_006226chr231214 947 496 1398 1506 --
NM_006237chr1372317 2183 1878 1687 632 468 442 11980 1664 2408 378
NM_006241chr352318 2213 604 404 99 --11642 --
NM_006246chr1441292 1185 886 186 1273 11276 --
NM_006252chr1157593 6909 6839 6353 6163 6113 6075 5706 4988 4979 4907 2565 2087 1777 1487 15997 ----
NM_006256chr172042 1894 789 761 667 498 24 22442 1694 ----
NM_006258chr1051294 1268 1262 1184 1080 --11067 --
NM_006267chr241662 1619 1449 1279 11715 21627 510 --
NM_006275chr206946 772 659 650 489 138 --11902 --
NM_006282chr20103878 3809 3331 3292 1432 1245 1178 773 651 214 24274 2938 ----
NM_006300chr1962217 2145 1829 1746 413 65 1467 22364 758 --
NM_006306chrX65280 5178 5154 3583 2121 575 ----12153
NM_006371chr3105172 5133 4743 3576 3567 3552 1424 1380 1017 113 35181 4500 3968 11920 --
NM_006375chrX41777 1374 606 586 1184 ----
NM_006379chr7112296 2278 2198 1853 1816 1721 1661 1525 902 462 59 1774 2916 91 --
NM_006380chr17104005 3921 3188 2953 2926 2912 2773 1296 867 65 --1759 --
NM_006393chr10154365 4318 4009 3504 3422 1694 1688 1560 1449 1428 1222 1208 1051 691 558 13628 1620 --
NM_006420chr2043213 2479 2449 1276 1989 33157 3086 882 12717
NM_006457chr483624 3098 1255 991 885 643 572 146 12596 ----
NM_006464chr2144685 4435 4286 4164 3122 2956 1879 1859 1835 1824 1094 940 614 124 33630 1259 596 1341 --
NM_006482chr1233432 3382 581 43917 1226 987 330 23198 506 --
NM_006504chr1042505 1939 1808 744 12401 12278 1542
NM_006534chr2083168 3016 2136 2094 1290 910 337 174 22739 368 12076 --
NM_006540chr831377 1206 497 1611 --1482
NM_006544chr14125901 5880 5208 4364 3979 2346 2313 1577 1416 1400 1065 614 --21488 791 --
NM_006546chr17146265 5716 5655 5282 5189 4289 4245 2254 1989 1974 1148 1002 507 290 --26256 5306 --
NM_006547chr781843 1714 1543 1469 793 376 367 39 ----146
NM_006548chr381689 1643 1110 1093 645 491 345 70 --11243 1102
NM_006549chr1272906 2718 1836 739 488 340 297 11032 --12160
NM_006561chr10156144 5819 5477 5357 4788 4776 4602 4493 4358 4228 2087 1626 1450 1098 1090 25498 4814 13813 --
NM_006572chr17103082 2824 2769 2314 2148 2130 1412 1274 809 89 11240 1343 12893
NM_006591chr1171749 1456 1434 728 164 112 53 --21497 532 --
NM_006599chr16178133 7449 7017 6699 6595 5533 5413 5339 5254 3163 2924 2683 2549 2523 2263 1130 492 15833 --12809
NM_006609chr2102807 2723 2481 2235 2131 2069 1993 1128 946 804 1323 11085 --
NM_006614chr3113500 3455 2756 2652 1317 1055 1027 714 278 271 62 33254 591 106 ----
NM_006628chr1554439 3693 3123 893 802 --33929 3795 3295 14275
NM_006629chr1862423 2198 847 588 361 307 11895 ----
NM_006636chr22400 377 --1406 1889
NM_006654chr1264460 3906 3391 1677 1608 498 --1146 11478
NM_006691chr112224 78 2378 89 21130 394 2168 97
NM_006699chr15894 591 479 425 191 12624 22371 1041 --
NM_006722chr3112703 2685 2644 2636 2486 856 781 631 402 366 208 --1653 --
NM_006729chrX185616 5523 5462 5365 5173 4748 4592 4556 4206 3754 2267 1942 1662 1453 1219 867 695 366 --1685 --
NM_006731chr945571 5338 1239 936 12304 13674 21492 101
NM_006750chr16167900 7619 7139 6790 6753 6621 5852 5781 5659 2867 2778 2706 2206 1827 851 341 46973 1443 1027 115 36322 2762 551 --
NM_006775chr661934 1091 591 554 426 149 11145 12367 --
NM_006815chr122366 47 ----1416
NM_006851chr1292351 1893 1852 1793 1144 1022 723 548 490 --12523 --
NM_006885chr1664095 4011 3611 3123 103 91 11556 11411 11189
NM_006902chr163213 3115 2985 652 284 195 32878 511 116 1831 12041
NM_006912chr162381 1604 802 788 753 481 1390 21714 48 --
NM_006918chr1195571 5081 5000 4725 3930 2175 916 409 390 34080 1590 1576 15549 13884
NM_006922chr292515 2163 1985 1872 992 809 538 301 96 1513 11765 --
NM_006924chr1793613 3481 3420 3213 3041 2832 1561 541 109 11610 12855 13822
NM_006947chr451605 1522 1245 509 156 21351 1258 ----
NM_006948chr2162396 1595 940 642 368 174 11694 ----
NM_006954chr1073445 2305 1063 597 440 240 33 12546 ----
NM_006974chr1073445 2305 1063 597 440 240 33 12546 ----
NM_006981chr972906 2343 1846 1835 802 400 171 --2899 466 --
NM_006990chr182140 1988 1700 764 488 479 288 120 1598 --2994 143
NM_007005chr951488 1280 1274 328 199 ----196
NM_007007chr1253986 3499 1764 1569 878 24512 506 --11208
NM_007011chr15196926 6780 6134 5499 4446 4263 2683 2097 1793 1774 1509 1386 1334 1263 1041 842 731 500 346 --11632 --
NM_007038chr21165839 5589 4539 4433 4245 4145 4089 3963 3897 1953 1586 1271 1183 917 753 157 11436 1478 --
NM_007042chr362424 2262 2188 1002 414 348 --21741 229 1706
NM_007050chr20197682 7404 7225 6705 6544 5944 5398 4991 3158 2673 2620 2442 1477 1269 886 501 243 49 34 46931 5277 1166 119 27752 6119 17620
NM_007073chr6104247 3841 3679 3153 2931 1698 1440 1344 825 26 33564 3446 2797 12988 --
NM_007078chr10103082 2644 2434 2260 2175 500 422 307 212 194 1606 1333 --
NM_007106chr1382460 2438 2412 2308 1865 579 520 171 --21128 543 11946
NM_007145chr1961340 1036 542 246 141 123 ------
NM_007150chrX41757 1690 432 273 --1682 1265
NM_007172chr22103247 2766 2498 2444 1280 1128 896 468 322 207 1713 ----
NM_007173chr1172270 2229 1840 1834 883 673 62 1347 1738 11981
NM_007175chr873373 2898 2855 2709 1186 1174 402 33364 2756 1112 12871 --
NM_007195chr18103626 3055 2677 1423 937 877 713 542 320 215 11078 31009 505 463 11118
NM_007203chr993593 3355 1387 1348 699 205 130 53 45 11240 12759 13653
NM_007207chr13785 378 315 ----1343
NM_007212chr151746 1587 902 663 479 ----1847
NM_007214chr641288 1253 1046 77 ----11017
NM_007249chr13118825 8586 7844 7735 7471 7094 6289 5904 5717 2967 2621 38960 7906 1371 56372 3782 1079 915 128 --
NM_007287chr373173 3129 2466 2353 844 390 350 42735 2561 488 247 23008 2365 --
NM_007288chr373173 3129 2466 2353 844 390 350 42735 2561 488 247 23008 2365 --
NM_007289chr373173 3129 2466 2353 844 390 350 42735 2561 488 247 23008 2365 --
NM_007292chr17155109 4938 4828 4703 4628 4563 4504 4257 4124 3752 3466 3184 1754 579 432 ------
NM_007315chr251516 1379 543 505 272 ----1998
NM_007347chr1592935 2874 2746 2526 2487 2005 1967 1046 675 --167 --
NM_007350chr12114521 3628 3124 3002 2857 2826 1641 1353 1071 115 85 13374 ----
NM_007358chr171824 1642 1534 1375 404 66 58 11279 ----
NM_007361chr141528 156 --1625
NM_012097chr252200 917 897 722 201 ------
NM_012104chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_012104chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_012120chr693025 2659 2282 2079 1184 1084 991 661 619 --22171 536 --
NM_012137chr142844 1081 532 251 1739 --22045 1824
NM_012153chr1182038 1904 1030 984 865 567 41 29 22212 83 --11595
NM_012164chr996889 6612 3025 2600 2465 1558 1509 521 496 25707 4807 24563 91 --
NM_012193chr11105323 4782 4182 3739 3370 1461 248 233 165 72 23294 887 --14478
NM_012214chr2136175 5506 5398 5117 4970 4950 4913 4040 2382 2114 2087 1902 1375 24613 686 15813 --
NM_012219chr392987 2472 1125 1114 1088 1032 729 579 171 32772 198 107 1854 --
NM_012234chr353542 3208 3020 2813 1333 1688 1838 21480 162
NM_012238chr1021100 103 11444 --21518 411
NM_012249chr2143476 3361 3039 2827 2617 2539 910 881 747 666 625 534 475 442 21101 23 --12548
NM_012262chr1105219 3835 3521 3489 1903 990 749 289 120 34 1697 25076 641 11894
NM_012288chr6115754 5555 4757 4613 1766 1476 997 972 919 626 208 14395 ----
NM_012293chr292214 2063 2039 2012 1779 879 824 470 458 11565 1170 12255
NM_012294chr7103863 3584 3534 3096 2976 1137 1084 525 350 142 1432 12572 1175
NM_012297chr482615 2457 2188 2003 975 727 678 469 ------
NM_012300chr582544 2136 1968 1862 1828 802 428 65 22165 1595 11685 --
NM_012309chr11104062 3855 3564 3401 1952 1453 1097 809 766 732 1133 ----
NM_012316chr194243 4145 3572 3495 2077 2008 1262 1137 466 ------
NM_012334chr5134739 4689 4538 4441 4287 4033 3135 3096 1717 1218 1111 219 86 11601 1283 --
NM_012382chr564204 3256 3192 2905 493 140 ----13377
NM_012388chr1562987 2855 2594 2470 848 826 ------
NM_012398chr19122852 2815 2710 2447 2125 1924 1878 1863 1175 87 59 25 --1330 11939
NM_012405chr1153098 2905 2596 2414 1339 1294 1014 793 726 606 452 317 269 168 142 ------
NM_012425chr1062305 2234 1041 733 317 227 2901 766 11798 --
NM_013229chr1272658 2197 1920 1882 1131 828 425 21891 1802 ----
NM_013231chr14104065 4015 3821 3031 2936 2721 1716 1678 1337 294 --11328 --
NM_013238chr1361766 1507 1379 1177 607 581 ----11454
NM_013255chr7208500 8259 7845 7502 6736 6719 6435 6159 5760 5749 3233 2644 2343 2224 1690 1585 1308 1101 967 642 --26776 111 11413
NM_013261chr493309 3179 2996 2832 2582 1419 839 830 396 170 12588 --
NM_013269chr12154057 4001 3683 3314 3140 1821 1798 1316 1273 1262 1188 1140 1134 1078 147 --1581 23938 2897
NM_013352chr61786 --1185 1838
NM_013372chr15142983 2658 2558 2551 1004 925 865 736 679 541 353 296 266 71 33392 2344 1245 --1197
NM_013374chr342782 2573 637 73 ----23036 744
NM_013381chr1272026 1914 1522 1474 846 497 286 1221 11602 1757
NM_013943chr132873 2814 1023 23050 1049 --1553
NM_013989chr14104786 4345 4304 3937 3570 1843 1487 1277 838 327 14818 34718 1773 1707 --
NM_014000chr1061455 1444 1277 764 80 41 11686 --11708
NM_014021chr173313 2868 2657 2510 2412 1221 1043 33394 2429 145 ----
NM_014028chr683258 3239 3054 2954 2801 2666 2599 806 12789 --1743
NM_014033chr1262321 2020 857 829 695 391 2817 36 11858 --
NM_014035chr551372 1358 1350 1229 523 ------
NM_014048chr16154669 4591 4395 3797 2094 2065 1839 1820 1682 1371 961 942 847 501 103 2955 238 34647 3399 1175 13927
NM_014112chr895144 4982 4954 4345 4209 4165 336 301 169 14332 34228 895 379 --
NM_014117chr168810 718 699 668 629 609 309 275 12699 ----
NM_014141chr7105362 5340 5322 4970 4419 2118 1936 1755 1244 221 33684 3291 320 ----
NM_014155chr11126424 5333 5005 4793 2267 2048 1948 1534 1481 893 652 191 26385 201 25597 5233 1229
NM_014181chr262667 2452 917 625 285 228 22847 318 22430 374 12460
NM_014231chr1261628 811 776 643 295 272 2281 214 22164 515 --
NM_014240chr394017 3792 3520 3245 2577 1613 1485 1191 688 --31315 601 290 --
NM_014243chr451755 1730 1345 617 198 11833 22102 31 1223
NM_014253chrX72518 1972 1601 1018 749 651 325 --1692 132
NM_014309chr22114319 4215 4094 3409 2047 1654 1640 1422 1214 1189 933 35151 3433 214 23493 399 --
NM_014322chr121104 867 1859 --11089
NM_014325chr1272126 1404 778 715 533 428 422 22026 1439 21393 583 --
NM_014331chr4176841 6507 6469 6153 6054 5867 5708 5519 5369 4836 2968 2291 1950 1840 1463 557 36 ------
NM_014350chr51186 2932 90 --11049
NM_014352chr1181506 1315 1205 1018 586 398 391 186 --2991 493 --
NM_014388chr1125988 5542 4626 4403 3802 3764 2426 2174 1751 580 492 186 25253 4321 ----
NM_014394chr1041017 781 335 35 --1269 1429
NM_014423chr595646 5610 5256 5198 4237 4157 2082 1487 153 --11328 --
NM_014494chr1611714 --12244 2929 617
NM_014552chr261418 1292 1104 537 526 327 --11541 --
NM_014573chr1751571 702 623 611 574 1640 ----
NM_014574chr1421067 1016 --11103 11307
NM_014584chr1471344 1119 1026 550 265 96 66 ------
NM_014586chr2193861 3168 1928 776 563 557 345 139 86 53916 1483 1211 692 176 --21441 1223
NM_014615chr16123302 3147 3116 3018 2907 1097 766 707 580 545 357 315 22560 615 ----
NM_014616chr373506 2995 2828 2762 2565 2455 716 --12462 13134
NM_014634chr22123438 3420 3400 3104 2616 2466 1315 1101 718 382 311 132 23628 528 1285 2318 230
NM_014636chr9123989 3645 3510 3178 3128 2986 1595 1569 1154 1049 464 155 13637 ----
NM_014647chr1662273 2144 2018 321 267 107 11798 1502 --
NM_014671chr731310 1112 513 ----1307
NM_014674chr373947 2427 1536 762 63 47 33 --13192 12564
NM_014682chr811844 --12298 1329
NM_014701chr1593286 2758 2632 2611 2234 2106 392 261 237 ------
NM_014702chr683225 3043 2794 2746 2236 1378 1132 1115 1588 ----
NM_014707chr761883 1518 1496 690 258 206 31989 1613 284 ----
NM_014721chr6206559 5978 5169 5134 4901 4646 4542 2588 2564 2125 2006 1944 1575 1129 1116 978 908 902 327 319 37334 4605 543 12883 1280
NM_014729chr862267 1794 1736 1617 1459 792 ----21600 370
NM_014730chr12115247 5073 4995 4951 4684 3882 3813 2050 2000 1936 1389 14492 --14093
NM_014730chr12115247 5073 4995 4951 4684 3882 3813 2050 2000 1936 1389 14492 --14093
NM_014732chr16134992 4571 3999 3882 1802 1210 1054 708 326 284 233 207 112 11486 25816 657 --
NM_014733chr561652 1578 420 295 232 85 11434 163 --
NM_014735chrX111905 1868 1851 1646 839 770 758 409 368 205 69 1713 ----
NM_014747chr1105439 5390 5342 4837 3570 1818 1774 888 832 301 24665 4301 24813 1720 --
NM_014755chr2113943 3561 3433 2743 2692 2618 931 913 907 743 41 13555 23415 3328 --
NM_014757chr572344 2280 729 649 285 260 86 31670 1452 63 ----
NM_014758chr1182296 2087 1621 1542 686 674 501 470 21969 874 --158
NM_014781chr82278 259 --1527 1985
NM_014783chr1551559 1476 1252 1229 489 1545 11390 --
NM_014787chr162544 2375 202 179 114 85 1668 12554 --
NM_014800chr761053 826 445 399 379 284 --1385 --
NM_014810chr143575 709 566 276 23201 625 --1947
NM_014819chr552104 549 432 367 153 21802 1720 135 --
NM_014824chr1181790 1755 1611 1456 1431 1344 744 507 ------
NM_014826chr1114369 4260 3877 3573 3339 3226 3189 1337 1279 1234 283 11153 1842 --
NM_014828chr1451854 1828 1781 1743 640 1717 1633 --
NM_014830chr1293709 3557 3459 3342 3076 2983 2571 2420 693 21292 747 12637 --
NM_014832chr1351457 1302 784 397 79 21844 454 1326 --
NM_014836chr1061941 1864 1602 683 531 64 11446 21837 164 --
NM_014839chr192350 2258 2080 2073 1551 1007 680 276 93 ------
NM_014850chr3124818 4729 4531 4343 3702 3037 1653 1124 847 827 754 536 21498 801 24541 219 23421 3367
NM_014864chr1144334 3290 3190 3181 2888 1442 1299 1198 867 789 658 503 431 283 24281 3609 1163 --
NM_014870chr184010 3990 3823 3000 1681 1670 1647 1188 --54164 3686 3204 1743 817 --
NM_014873chr1134835 4801 4105 3935 3626 3564 3339 3034 1871 1811 1460 944 165 ------
NM_014877chr17157777 7573 7415 6967 6161 4792 4720 4694 2868 2672 2520 2391 1259 1096 417 37739 7523 4754 11503 --
NM_014883chr462158 2086 1877 1007 891 832 159 1976 12103
NM_014899chr572838 2772 2520 2499 1962 1196 86 13033 21950 1159 --
NM_014904chr1083723 2475 1609 1102 1011 708 573 436 --21118 739 --
NM_014906chr17113991 3380 2900 1587 1524 1078 1067 1022 897 517 154 13161 --23031 1288
NM_014912chr1022509 1226 11005 23426 443 11374
NM_014924chr1442925 2122 1222 25 32493 2479 287 --1629
NM_014935chr183327 3244 2990 2689 2645 2397 649 172 32905 1386 608 23040 2851 1466
NM_014946chr2103008 2743 2707 2452 1986 649 518 468 150 133 ------
NM_014951chr1082152 1898 1843 1060 395 266 180 116 --32383 338 150 --
NM_014953chr1344081 4074 1075 971 23682 26 1809 --
NM_014961chr4102106 1954 1917 1676 1669 1484 1416 578 364 111 21498 535 ----
NM_014982chr1495391 4997 3713 3532 3436 1521 810 368 48 11396 34528 904 583 15257
NM_014989chr691817 1709 1574 1565 624 585 314 194 62 1656 ----
NM_014991chr453320 2353 684 492 136 2852 579 ----
NM_014997chr752440 2345 1953 790 756 1938 --22192 2114
NM_015008chr383316 3305 2568 2460 1389 633 344 334 11439 53485 2419 1423 1334 298 --
NM_015020chr16103876 3283 2785 2562 2439 1276 844 811 454 366 ------
NM_015035chr20206395 6345 6100 5794 5649 5384 5313 4936 4779 4510 2586 2232 1755 1738 1489 1192 1138 186 153 66 21681 1571 --21437 802
NM_015042chr1594223 4092 3466 2886 2646 1589 1438 476 167 52914 2727 1685 322 61 43878 2631 1582 665 --
NM_015049chr2112984 2369 2316 2298 2253 1204 999 983 793 531 309 22134 842 ----
NM_015051chr993402 2946 2914 1363 1151 1092 895 416 272 33143 812 423 11049 --
NM_015055chr1152977 2823 2059 1052 208 166 --12565
NM_015068chr7123722 3093 2682 1386 1377 935 519 359 325 268 182 175 33343 2784 922 12519 1849
NM_015071chr5176420 6071 6006 5783 5207 5075 4869 4817 4745 4478 4442 4429 4038 2548 1327 739 578 24615 2010 25606 686 15196
NM_015074chr194726 4636 4499 4450 3959 3888 3556 1190 656 1779 13160 11416
NM_015076chr6134499 4139 3669 3186 2995 1393 893 836 619 531 354 76 36 1963 --13462
NM_015077chr17104683 4214 2900 2869 1788 1695 1644 1421 1105 752 33246 2861 1374 --13441
NM_015090chr1136256 6192 5256 4958 4810 4371 3845 2278 1463 1014 570 515 156 24454 4250 34549 1584 1539 --
NM_015092chr1683682 3450 2900 1629 1066 533 77 51 23832 445 13600 --
NM_015094chr2293919 3865 3205 3050 1837 808 643 172 148 2877 563 23928 1709 13020
NM_015097chr351976 1915 833 716 589 1599 11790 --
NM_015144chr16113576 3495 3367 3078 1361 800 546 459 178 161 108 43431 2869 783 290 22472 1577 13606
NM_015147chr293208 3144 2959 2546 2371 2257 1243 923 41 --21063 349 --
NM_015170chr871930 1830 1721 1557 439 283 204 21632 368 2713 678 --
NM_015185chrX92966 2820 2514 1991 1953 1042 746 738 582 --12488 --
NM_015192chr2093025 2630 2132 1122 804 766 369 262 142 12180 1128 --
NM_015199chr3112731 2610 2475 2430 2382 2124 1051 881 521 444 379 --21142 1095 --
NM_015205chr1344691 4253 1618 1018 14804 44840 3241 1000 26 11789
NM_015206chr15153908 3484 3106 2869 2477 2425 1097 859 793 731 696 651 491 294 245 11382 ----
NM_015208chr1893919 3850 3699 3645 3575 2529 1141 406 387 13179 1647 11156
NM_015267chr1271984 1838 1687 1615 524 494 105 11569 ----
NM_015271chr4104137 3179 3077 3057 1590 1308 507 296 125 74 13721 34184 1032 983 13636
NM_015275chr1252174 1548 1470 185 170 ------
NM_015278chr6103424 2859 2482 2428 2147 1182 430 268 128 98 1223 ----
NM_015291chr163231 2911 2297 2180 1390 995 11368 ----
NM_015299chr14123586 2988 2705 2579 2480 1496 1407 1241 884 717 673 98 43456 2925 2468 400 11214 --
NM_015310chr8147975 7782 7043 6854 6645 6549 6445 6155 5552 5261 3015 1451 1005 753 36397 5480 1747 27103 5323 22097 1573
NM_015313chr11113958 3172 1939 1513 1198 1170 757 619 271 153 144 33070 1636 450 ----
NM_015317chr272455 1964 1864 914 761 278 70 --12308 --
NM_015328chr762855 1988 1934 890 182 21 23039 806 21095 101 --
NM_015336chr1262342 1936 1734 539 367 361 ----1970
NM_015349chr6102580 2360 2308 2122 1239 1157 1034 1027 404 398 13100 11174 --
NM_015352chr2083913 3569 1243 932 860 547 437 82 33272 1524 123 144 11343
NM_015359chr842631 2229 1956 501 22754 533 11064 11825
NM_015365chrX73428 3123 2634 1630 769 660 515 11141 13869 13435
NM_015375chr1105021 4135 4105 3682 3349 1697 1161 762 654 104 33810 3169 3116 13160 23608 810
NM_015381chr2231801 1642 774 ----1484
NM_015387chr232138 1700 766 ----1369
NM_015409chr1262755 2680 879 500 434 31 3677 534 402 ----
NM_015435chr831153 1065 176 --11042 2962 410
NM_015436chr463114 3056 3032 2380 686 556 1752 --13137
NM_015455chr593998 3896 3115 2896 2764 2505 1149 964 499 33554 2940 377 23243 725 --
NM_015457chr115933 886 309 293 249 --146 1416
NM_015458chr874021 3952 3591 3451 893 684 304 ----2873 464
NM_015534chr11307 1317 --1842
NM_015550chr773476 3394 3267 2660 2650 1358 309 1751 32355 1330 1292 12764
NM_015553chr6124578 4277 3815 3575 3480 3152 2024 1611 1542 622 340 158 45192 3939 319 130 11391 --
NM_015560chr342096 1847 1057 855 --32885 2649 223 --
NM_015564chr5113303 3167 3138 3008 2937 2626 2562 2526 1419 830 556 22975 1071 23597 587 11008
NM_015565chr2142008 1924 1551 39 ----11855
NM_015568chr20144296 4258 4007 3904 3545 3496 3407 3344 3274 3077 2925 803 771 560 --23196 846 13471
NM_015569chr174787 4051 1605 1511 1223 1184 1133 24276 611 1232 11282
NM_015571chr672621 2531 1042 679 649 145 40 ----1702
NM_015576chr372984 2299 1098 1082 905 597 507 11964 ----
NM_015578chr1921912 335 31324 634 159 1268 --
NM_015640chr195342 5224 4773 4700 3666 1162 987 649 51 21752 131 24342 1047 --
NM_015879chr18248076 7604 7262 7188 6894 6868 6379 6020 5899 5670 5425 5335 3023 2880 2595 2185 2160 2132 1802 1666 1380 1040 53 24 33376 2564 2253 25954 5606 --
NM_015886chr8125105 4863 4276 4147 3522 2240 1913 1858 1662 1465 1132 284 --23677 632 --
NM_015906chr1124238 4215 4130 2954 1923 1705 1536 1243 992 939 768 223 11721 ----
NM_015948chr62187 66 --185 1330
NM_015995chr15125361 5279 5267 5258 5223 4340 4204 2226 2209 1846 192 134 24075 1636 ----
NM_016009chr194579 4484 4419 4099 3562 1820 1717 1342 540 1393 24769 1370 --
NM_016018chr852361 966 643 398 46 21785 238 21916 1114 --
NM_016023chr872194 1736 1626 1526 633 238 62 1672 1542 --
NM_016040chr132214 683 572 12261 22816 773 --
NM_016072chr1262060 1902 854 840 654 578 ----1488
NM_016081chr4112062 1592 1511 1434 783 659 475 467 361 332 64 11427 31890 484 131 --
NM_016083chr6123959 3944 3138 2857 2509 1454 1428 1305 1153 1003 316 242 33913 3089 1367 ----
NM_016132chr1553292 2741 2551 1277 835 --1821 12444
NM_016206chr3178825 8538 8506 8426 8190 8085 7980 7643 7484 5593 2995 2831 2291 2093 1488 841 43 48912 1524 791 757 46892 6696 1329 909 --
NM_016217chr693210 2785 2691 2655 2419 1348 356 246 137 --1197 1967
NM_016221chr561940 1853 1478 1456 395 29 1894 ----
NM_016231chr1751610 1506 656 289 220 1427 --1451
NM_016248chr1353735 3072 2765 2731 1027 12449 23892 3428 --
NM_016255chr6112499 2381 2342 2240 2197 1178 1113 849 816 217 39 1163 ----
NM_016260chr2137313 6499 6394 5374 4889 4837 4717 2767 2414 2049 1816 1754 1402 --26932 275 17450
NM_016275chr352702 2549 725 625 113 1371 --2921 616
NM_016297chr262731 2528 1196 650 464 90 21215 881 21187 1022 22810 867
NM_016308chr181961 1831 1812 1606 1511 427 419 224 ------
NM_016356chr662503 2365 1149 536 486 154 22523 848 1176 --
NM_016376chr1784235 3649 2680 1489 1153 1012 352 82 32876 926 595 33353 3300 998 --
NM_016422chr1183040 2552 1221 1063 819 300 279 188 ------
NM_016441chr282109 1918 639 556 514 394 203 46 21490 613 21957 222 --
NM_016442chr582128 1852 1680 1603 656 86 55 33 1515 1132 --
NM_016530chr1573440 1400 1308 1299 961 628 430 --21202 565 --
NM_016531chr451582 1141 1084 932 816 2401 210 --13604
NM_016559chr351164 245 203 97 60 2549 130 --1489
NM_016562chrX71573 1382 1190 1074 580 417 82 11436 11305 139
NM_016603chr571717 1632 648 558 508 502 140 ------
NM_016620chr151461 586 449 435 342 --198 11332
NM_016621chr11114637 4627 4529 4416 4167 3881 1063 810 634 576 488 2441 125 1158 --
NM_016626chr1871703 1447 625 357 261 171 130 21498 235 ----
NM_016653chr241203 350 170 159 11022 1906 1821
NM_016929chr6104119 4061 3782 3435 3370 3330 3058 1706 767 327 22987 409 ----
NM_016953chr2135359 5154 4903 4583 4186 4108 3778 2401 2192 1994 1383 675 401 35593 1131 291 14101 --
NM_017420chr1463493 2850 1313 1123 610 264 163 12746 13737
NM_017447chr2194292 3997 3624 3580 3216 1719 1209 228 116 31183 1034 589 13912 --
NM_017452chr2051510 1355 1097 472 448 1425 --1464
NM_017453chr2051510 1355 1097 472 448 1425 --1464
NM_017454chr2051510 1355 1097 472 448 1425 --1464
NM_017563chr3135811 5765 5740 5477 5106 4118 4050 2481 2082 1928 1807 904 250 11097 ----
NM_017580chr1092408 2133 1904 889 820 613 560 101 55 22225 1841 130 --
NM_017583chr1161260 1163 461 330 157 117 --11527 21785 702
NM_017628chr475006 4779 4341 3457 3352 1274 438 ----14157
NM_017633chr663857 3495 3487 3155 2448 1239 --22423 819 23273 731
NM_017635chr111370 ----11218
NM_017637chr9299444 9039 8976 8771 7725 7699 7470 7038 6677 6353 6109 5754 3564 3276 2953 2635 2452 2363 2331 2083 1787 1752 1617 1436 1312 1205 1070 963 38 36971 743 376 59156 9126 8112 6915 5829 --
NM_017643chr17103113 3038 2844 2558 2350 2303 2093 1953 935 889 --1701 --
NM_017644chr375042 4908 4261 4178 3909 1610 752 24429 4301 11628 122
NM_017650chr7175315 4990 4370 4133 3919 2410 2334 2004 1996 1717 1693 1412 1259 620 189 93 75 11147 23728 1821 1229
NM_017658chr1432971 906 201 23436 3229 24567 2835 --
NM_017666chrX62090 1566 843 737 670 64 31944 835 650 1867 --
NM_017709chr1124133 3694 3601 3235 2739 1606 1553 1540 1255 935 533 191 --1592 13984
NM_017744chr182465 2444 2393 2214 772 464 117 39 2649 320 ----
NM_017754chr673188 3178 1929 1750 589 430 110 34756 3539 30 23129 1292 21513 415
NM_017761chr151029 997 946 592 225 21493 1112 ----
NM_017762chr1592401 2260 1919 1759 1664 1570 873 779 242 ------
NM_017799chr14101845 1740 1453 743 587 524 401 323 269 212 ----1408
NM_017813chr8145820 5699 5364 5130 4984 4854 4590 4319 2201 1837 1795 1651 1519 70 --24456 4067 11458
NM_017824chr1052570 2180 502 442 299 12014 31974 1796 1045 --
NM_017831chr1864420 3940 3013 1133 850 657 1420 --14477
NM_017847chr172276 1894 1834 1605 1504 736 721 31625 848 35 ----
NM_017902chr10115231 5089 4922 4521 4457 4431 4326 3626 1637 495 246 24106 2018 33677 997 799 --
NM_017919chr9135675 5645 5415 5232 5131 4572 4064 3971 3654 1867 1716 955 682 55686 3768 1576 718 249 23827 1907 --
NM_017923chr41170 1143 --2300 31
NM_018003chr1562487 2046 1651 828 767 392 --12181 --
NM_018015chrX51123 442 320 204 117 11053 1471 --
NM_018017chr1072114 2089 2027 1947 1924 1044 432 22000 1841 ----
NM_018018chr1251716 1608 677 396 372 1118 21254 458 --
NM_018036chr14143525 3510 3167 3130 3077 2893 1705 1457 1392 1385 1266 221 161 145 --13999 --
NM_018043chr1181427 1294 1185 1156 1109 968 941 239 ----11008
NM_018046chr521744 241 1741 1213 11289
NM_018084chr293340 3314 3101 2784 2747 2349 1171 421 225 --12169 12580
NM_018085chr1197944 6216 6042 5775 5616 3275 2871 2419 2252 2172 1710 1639 1422 1288 1079 837 805 208 97 32819 1939 1134 67982 7563 7465 5305 2973 1656 --
NM_018086chr251485 1229 659 480 174 11536 --2448 261
NM_018155chr362875 2650 2570 642 567 40 2358 215 ----
NM_018243chr452990 2471 1271 485 378 --13929 --
NM_018254chr152439 2013 1529 287 178 --22413 2230 --
NM_018257chr2052300 2077 625 366 239 21639 696 ----
NM_018293chr352392 2128 2108 601 207 ----1126
NM_018299chr842751 2573 2263 1198 12149 12126 13274
NM_018323chr451731 727 532 511 143 --11878 --
NM_018348chr162987 124 ----1892
NM_018351chr1294513 4408 3913 3049 1864 576 274 252 115 23241 35 11741 2630 129
NM_018362chr11113839 3815 3427 2782 2586 2518 2466 1207 1111 1089 774 1169 ----
NM_018364chr183485 3155 2943 2879 2849 1429 1261 277 33746 660 533 ----
NM_018367chr1172270 2064 1660 1614 676 504 348 --1966 --
NM_018373chr14176412 6372 6264 5916 5813 5685 5673 5390 4781 4712 4694 4006 3938 1859 1243 1155 1102 25085 279 --14484
NM_018374chr7114891 4619 4173 4138 3560 1988 1346 1293 1091 598 106 ----24317 955
NM_018400chr1194331 3792 3727 2835 1411 1257 618 296 95 --13415 --
NM_018403chr3124137 3913 3772 3185 3114 2866 2777 2501 1066 751 498 22 13242 ----
NM_018429chr532490 1170 50 12884 21887 1022 --
NM_018440chr8198687 7177 6667 6608 6255 6051 5946 5906 5813 5428 3467 3445 2900 2445 2368 2338 1686 710 364 47743 5508 584 480 --1342
NM_018452chr6_random103702 3556 3408 3147 2971 1434 1375 805 760 308 22932 1031 ----
NM_018489chr172007 1976 1871 580 555 401 279 1468 ----
NM_018566chr155150 3923 2013 1966 569 21066 86 23963 1104 13611
NM_018638chr12115186 4907 4331 3637 1943 1673 966 818 803 726 142 ------
NM_018640chr1252533 2281 2012 871 539 ----11909
NM_018660chr862529 718 705 579 232 89 21071 676 1243 1272
NM_018697chr761731 824 728 50 40 22 1510 1146 --
NM_018710chr831006 407 266 41324 1231 852 526 ----
NM_018841chr1103275 3099 3060 2994 2802 2753 1268 723 384 107 23495 636 43211 1410 1051 491 --
NM_018845chr11384 ----2143 49
NM_018847chr961742 1333 1305 524 355 301 21255 1229 11600 1748
NM_018945chr692891 2546 2411 1164 1080 827 805 699 48 1428 23191 1412 --
NM_018958chr1554051 2883 2771 1065 921 23563 3265 33525 2891 601 --
NM_018970chr772623 2134 884 875 566 460 334 12280 22963 2027 1497
NM_018976chr12112901 2703 2619 2578 1989 1916 1037 893 744 614 447 21054 264 ----
NM_018999chr1084366 3723 3539 972 613 585 212 71 11520 --33474 1152 716
NM_019000chr571426 1194 1088 533 488 302 40 11334 --11121
NM_019001chr3114250 4213 3827 3046 1912 1883 1372 953 294 250 178 --22948 624 --
NM_019004chr762378 1967 1539 1522 799 611 --31778 572 351 --
NM_019050chr461957 1651 1551 1540 549 162 1510 11751 --
NM_019072chr584276 3872 3761 3241 2603 867 411 97 ------
NM_019084chr1072562 2512 2479 2265 689 612 399 22171 366 12470 --
NM_019098chr861761 1712 1230 520 392 42 11175 11362 1690
NM_019106chr2283445 3265 3230 3097 2898 2783 2663 571 51204 1150 963 948 432 1668 --
NM_019116chr1683661 3272 2590 2483 2362 343 150 38 43088 1039 808 594 ----
NM_019117chrX93445 3327 2861 2421 1277 948 638 529 442 1502 ----
NM_019596chr2182485 2358 2065 911 835 651 543 138 1934 12078 --
NM_019610chr1122001 1976 1954 1791 1618 881 822 685 668 364 92 24 3287 84 39 ----
NM_019862chr16121560 1537 1163 1118 662 406 372 144 132 118 104 84 11621 ----
NM_019895chr36896 869 364 297 171 150 1471 1342 --
NM_019898chr16121560 1537 1163 1118 662 406 372 144 132 118 104 84 11621 ----
NM_019899chr16121560 1537 1163 1118 662 406 372 144 132 118 104 84 11621 ----
NM_019900chr16121560 1537 1163 1118 662 406 372 144 132 118 104 84 11621 ----
NM_020116chr451122 570 518 299 243 --1505 --
NM_020122chr2145404 5325 4814 4748 4153 3895 3878 2396 2189 1546 1404 1251 1028 468 ----14582
NM_020130chr851349 1091 990 418 128 21037 48 --1323
NM_020132chr21105199 4801 4579 4400 4203 4106 1736 1434 746 328 33972 1888 861 13595 15145
NM_020144chr761968 1698 1356 461 56 47 ------
NM_020148chr1893064 2921 2747 2665 2175 2151 1246 983 455 ------
NM_020159chr411322 ----21289 658
NM_020177chr573248 2625 1046 964 250 144 128 --11138 12866
NM_020228chr1182442 2090 2046 1722 938 824 176 162 12024 2410 346 --
NM_020245chr6114752 3505 3419 3205 3098 1153 1136 799 436 102 66 23487 1761 24598 3425 13530
NM_020337chr473197 2921 2751 2123 1010 924 349 12167 ----
NM_020342chr262557 1868 973 865 345 86 12652 --1854
NM_020348chr1082258 2163 1968 1940 531 517 86 42 1805 1836 1908
NM_020390chr3114434 4114 3611 2971 1928 1743 1333 1179 568 503 342 13572 177 --
NM_020425chr672028 1459 1311 721 647 623 135 --11818 --
NM_020432chr732149 2096 1839 12247 21632 850 --
NM_020440chr153156 2476 1033 497 95 23017 975 --12397
NM_020443chr1176898 6253 6032 5993 5696 5122 5004 4667 4659 4451 4445 4280 2600 1239 720 641 344 42285 1735 1453 494 11229 --
NM_020452chr162067 1788 374 275 263 214 1434 136 11946
NM_020455chr672309 2243 2103 1933 1091 824 331 21139 678 ----
NM_020466chr6154857 4773 4646 4225 3635 1806 1552 1519 1363 1280 847 819 415 282 30 34438 3934 3096 14240 --
NM_020546chr5122909 2868 2572 2284 2160 2138 2087 2041 1265 593 556 477 11147 ----
NM_020663chr146803 531 280 267 94 76 2740 543 1590 --
NM_020673chr20136933 6860 6223 5531 3063 2707 2072 1888 1867 1539 1126 659 544 26881 156 12585 12032
NM_020699chr194938 4515 4509 4479 3992 1584 1259 1031 331 ----1616
NM_020711chr272593 2373 1983 982 511 334 188 --137 1736
NM_020717chrX174799 4642 4041 3487 3090 1587 1508 1429 1410 1366 1352 1322 1014 791 372 260 204 34053 3415 1685 --41673 1189 327 290
NM_020718chr16156487 6087 6059 5226 4545 4157 2084 1930 1287 1060 737 356 236 205 177 --171 --
NM_020727chr2173788 3422 3134 2841 2735 1623 1340 11291 13669 --
NM_020752chr1072299 1901 1042 960 352 131 70 182 ----
NM_020766chrX74139 3710 3648 3411 3317 2826 1352 ----11551
NM_020772chr17218652 8442 7782 7484 7291 7224 7143 6385 6341 6306 6164 6155 3052 2588 2557 2006 1062 971 943 346 213 16424 37669 5410 5322 --
NM_020774chr1886247 5738 4987 3837 1502 424 214 145 15747 1509 --
NM_020782chr12124070 3667 3616 3059 1777 1674 1618 848 314 277 87 70 23810 3255 14288 13021
NM_020802chr11143361 3242 3102 2880 2696 2378 2309 2172 1244 1213 1122 1037 980 624 1314 ----
NM_020805chr1871805 1537 1283 1235 429 199 104 21342 326 ----
NM_020810chr14112805 2756 2750 2691 2676 2478 1101 519 440 169 31 11321 22584 959 --
NM_020830chr272878 2668 1139 1041 346 314 48 23226 2808 --1486
NM_020834chr1481860 1732 1718 1576 1512 629 539 108 ------
NM_020844chr8147688 7098 7060 5943 5347 5259 2568 2331 1686 1676 1142 717 580 502 25661 289 16840 16021
NM_020858chr1581966 1924 1820 1696 769 685 474 111 3452 247 121 21713 955 --
NM_020859chr4103869 3794 3778 3060 3044 2517 2508 1457 1389 24 33390 2993 611 11547 --
NM_020914chr1761680 837 630 564 499 127 21813 726 1140 --
NM_020921chr14103508 3272 3266 3259 2935 2819 1254 1224 409 243 --23389 3287 --
NM_020935chr284244 4141 3767 3661 2819 893 357 127 1416 ----
NM_020940chr1082833 2601 2309 2248 1942 1886 467 54 11009 2938 252 --
NM_020948chr163236 3229 1309 1097 478 49 ----2312 234
NM_020956chr19294762 4466 4370 4226 3965 3139 3110 3073 3030 1903 1879 1840 1801 1762 1723 1700 1684 1645 1622 1606 1591 1544 1520 1343 1334 971 860 719 597 54158 1811 1733 1655 807 ----
NM_020977chr462069 1893 1823 752 194 81 21461 534 --1359
NM_021032chr332065 1907 1261 190 21395 180 1743
NM_021072chr562614 1860 1806 954 691 416 ------
NM_021097chr263101 2633 2443 1871 986 148 --22313 557 --
NM_021101chr342382 1961 706 41 --1765 1539
NM_021116chr7178635 8427 7998 7720 7493 7167 6678 6356 5711 3575 3179 3038 2984 2683 1415 688 509 26935 1340 27785 2924 --
NM_021120chrX103174 3025 2338 2188 2020 1089 1081 992 865 310 32850 2486 2062 ----
NM_021148chr731858 549 501 ----1364
NM_021167chr782730 2499 2350 2331 1143 742 437 217 21012 907 21738 1132 --
NM_021183chrX72244 1982 1974 1902 1890 1762 1703 ----1559
NM_021215chr2082369 2281 2153 1874 1708 1687 628 528 ----11842
NM_021269chr1941694 1653 1380 208 --21275 835 11839
NM_021572chr641189 1004 919 171 ----11269
NM_021629chr3125125 4802 3567 3305 1762 1642 1304 1216 1200 1164 198 148 24763 642 1594 --
NM_021638chr4114730 4269 4258 4099 3665 3324 3267 633 298 113 88 23905 3865 14554 --
NM_021647chr4174382 4265 4235 4075 4046 3911 3795 3231 3215 2898 2891 1355 1218 1128 622 271 222 1933 ----
NM_021813chr6155351 5054 4917 4688 3998 3849 3691 2103 1807 1551 1451 1228 1019 690 148 33753 1739 90 1405 24255 3939
NM_021814chr641651 1539 1076 442 11176 --1516
NM_021815chr262989 2453 2374 2367 1197 284 ------
NM_021911chr595027 4930 4781 3838 3395 2204 2071 1293 354 34822 3816 914 24732 4475 14652
NM_021913chr1971827 1562 728 671 355 298 276 21164 315 11402 --
NM_021954chr13143631 3541 3230 2809 2473 890 656 628 511 501 436 415 397 56 13287 21302 63 1938
NM_021961chr11196155 5987 5762 5751 5648 5069 4959 4880 4638 2754 2730 2548 2294 1695 1495 1057 922 597 554 35630 5600 1601 11892 12741
NM_021964chr3116019 5394 5151 2661 2133 1910 1221 958 676 504 263 26637 1135 25864 2473 11144
NM_021977chr693377 3310 3195 3122 2504 798 524 411 145 1306 22514 1212 1377
NM_021998chrX51405 1330 1126 102 90 ------
NM_022037chr241014 407 83 22 ----1806
NM_022048chr15195597 5251 5227 4973 4890 4551 4003 3882 2450 2282 2114 1771 1424 1314 940 888 400 221 118 11137 11035 14016
NM_022049chr151619 1544 1493 257 196 --2420 170 1272
NM_022058chr261991 1722 749 632 537 26 ------
NM_022091chr672544 2200 1800 1113 1063 1011 204 ------
NM_022114chr1164739 4273 3789 3577 3482 3460 3292 3119 1643 1593 1537 1145 684 516 178 32 3755 259 207 ----
NM_022133chr8101727 1691 1496 1477 1469 656 611 362 221 81 --1573 --
NM_022154chr431355 1250 450 1514 --1380
NM_022166chr16176283 5588 5557 5350 4981 4415 2379 1251 1106 1092 1021 868 764 504 440 159 54 25829 5661 16056 --
NM_022173chr241014 407 83 22 ----1806
NM_022351chr8103587 3394 3262 2919 2607 2373 2365 981 549 190 ------
NM_022444chr761641 1540 1308 1294 630 387 31755 456 297 1475 1192
NM_022456chr12147319 7019 6740 6699 5856 5593 5554 5253 2769 1708 1627 731 424 241 2625 88 46418 5799 2349 1599 11766
NM_022459chr1375563 5503 5431 4834 2255 2168 343 26324 5964 11982 23952 2058
NM_022482chr2072604 2443 2416 2334 1648 1639 1039 ----22118 760
NM_022491chr1263026 2827 2445 2226 2196 1411 23284 3110 22717 2338 --
NM_022494chr102478 114 ----168
NM_022716chr163057 2959 2829 496 128 39 22722 355 1675 --
NM_022726chr651591 1488 1444 444 294 21208 655 1239 --
NM_022745chr172653 2591 1099 1002 941 495 466 42970 2187 542 265 12127 --
NM_022753chr172484 2312 2235 2022 1917 1891 926 32411 2131 372 ----
NM_022763chr372395 2133 858 659 568 244 237 12791 ----
NM_022777chr761624 1420 1359 1100 649 210 21579 243 ----
NM_022817chr282232 1907 1891 1839 1575 492 414 385 12150 --1660
NM_022824chr541710 738 250 155 11365 ----
NM_022841chr1531992 1738 621 2184 38 22102 1722 --
NM_022893chr262771 2764 1186 1142 1003 622 --13053 --
NM_022898chr14114809 4389 4251 4085 4060 3822 3795 3024 1798 1457 1334 1812 ----
NM_022918chr1141637 1592 257 30 --11682 --
NM_022977chrX5805 642 523 437 137 22120 111 12192 --
NM_023923chr1113507 3190 2849 2519 2359 2303 1284 844 702 423 56 --1266 --
NM_023929chr862434 2201 756 560 401 139 --1245 --
NM_024090chr471702 1495 1339 754 664 446 130 11527 3671 526 312 --
NM_024423chr1894237 3911 3880 3469 2780 2605 1536 706 453 32830 1630 1173 ----
NM_024512chr383460 3132 1187 475 404 343 308 300 ------
NM_024524chr372742 2064 1277 1212 1094 1046 699 2915 513 ----
NM_024607chr883886 2871 1699 1628 1066 724 367 203 11270 11540 14347
NM_024612chr174879 296 127 88 2322 186 2153 139 --
NM_024617chr93693 680 320 ----1778
NM_024636chr782835 2408 1976 1917 1856 813 795 243 22533 806 --22626 290
NM_024665chr3103078 1710 1606 1111 941 631 335 211 117 50 23493 3335 ----
NM_024670chr1051492 1131 1079 225 139 1689 --1355
NM_024674chr1102913 2788 2758 2547 2407 2343 1196 383 358 174 11116 12979 --
NM_024721chr882462 2305 2228 2029 1779 278 112 82 21015 369 12342 --
NM_024740chr11103500 3394 3313 3186 2853 2639 243 158 146 22 --2444 169 11355
NM_024749chr172295 2180 1668 1563 911 618 176 ------
NM_024770chr2166742 6300 6066 6042 5027 4848 4415 2195 2029 1681 1177 1171 1161 470 464 32 --24733 992 --
NM_024798chr15112927 2447 2240 1870 1796 1005 936 759 718 370 212 12872 ----
NM_024817chr15125723 5675 5346 5137 4266 3997 3941 2319 1443 1352 933 812 34335 510 413 22162 1066 11927
NM_024834chr102587 369 ----21601 1292
NM_024837chr15101846 1747 1707 1511 1279 667 448 189 156 71 ------
NM_024881chr19113819 3654 3194 2894 2881 2482 1346 1167 618 508 21 --22525 753 --
NM_024884chr1464330 4028 3125 2876 1583 378 24265 113 13887 --
NM_024920chr431556 180 106 --1249 --
NM_024930chr582781 2414 2171 1917 690 655 256 155 22148 321 ----
NM_024939chr1651569 1226 1154 646 110 31330 559 183 11593 --
NM_024947chr3198756 8310 7634 7191 7071 6253 6244 3387 2606 1495 1445 1337 1304 953 923 873 602 413 134 2789 268 19045 11693
NM_024949chr4165028 4703 4625 4516 4342 4292 4192 3906 3775 3737 3500 990 949 765 625 501 44200 3534 3382 602 24485 982 --
NM_024989chr2177201 6709 6489 6291 5206 4997 3255 3112 3059 2576 2560 2552 2435 876 838 483 378 17141 36051 5516 1322 12753
NM_025054chr893354 3081 2580 2560 1636 1274 1042 922 456 1113 13575 --
NM_025073chr1124568 4264 4118 3195 2888 1687 1644 1273 766 736 677 661 23655 221 ----
NM_025134chr1692352 2136 2037 2020 1863 806 396 206 104 --12308 --
NM_025152chr1441721 1549 1322 361 21675 1298 ----
NM_025164chr1162203 1871 1856 331 201 82 --21476 512 1211
NM_025179chr1124531 3746 3064 1913 1768 1529 1160 968 925 687 634 98 1515 23475 1509 1231
NM_025191chr173130 3118 2734 2417 1087 298 202 12494 1630 --
NM_025222chr3112766 2371 2160 2014 994 814 680 514 393 270 248 11992 12149 --
NM_025235chr1051756 1435 861 564 252 1724 147 1757
NM_025238chr1561400 1313 1244 1184 1156 469 11474 ----
NM_030579chr1693322 2939 2855 2769 2502 2276 653 493 193 23424 900 1932 11042
NM_030621chr1464055 3749 3506 2647 859 818 --21164 926 --
NM_030627chr553036 1289 1071 825 256 13522 1845 11622
NM_030647chr7135423 5386 5353 5093 4648 4342 4260 4164 4038 2330 1913 1396 666 41723 1249 908 122 11818 --
NM_030648chr4165364 5307 4834 4751 4233 4000 3979 3955 3846 3493 1995 1121 1083 548 300 176 --23827 1850 14765
NM_030650chr274126 3515 3137 2723 1288 672 151 --33906 2954 1505 --
NM_030660chr143428 282 168 31082 196 90 ----
NM_030674chr12105903 5791 4775 4762 3898 3826 3701 2045 1732 1394 34784 1652 652 --11312
NM_030761chr192575 2534 2352 2302 2201 1978 1972 193 169 --21672 224 12405
NM_030773chr2051847 1446 1434 533 284 11624 --1689
NM_030799chr5112176 2161 1944 1926 1738 1682 1556 1502 777 510 331 1729 ----
NM_030806chr1199321 9081 8636 8432 8384 7615 7195 6848 6620 6142 5892 5766 3777 3322 1907 1801 1304 1165 902 47508 3084 2118 1255 37410 6807 6767 --
NM_030816chr173469 3096 2478 1437 1194 1136 583 12393 --23532 33
NM_030885chr352342 680 572 426 36 ----11609
NM_030918chr1105477 3965 3580 3312 2087 1078 1027 950 598 278 23629 388 12162 25134 3420
NM_030934chr141774 640 632 497 11721 ----
NM_031216chr1862077 1938 843 798 258 137 --21983 1474 1722
NM_031292chr1251718 1199 1185 525 210 --11220 --
NM_031296chr452152 1749 1095 1040 418 --12623 139
NM_031362chr2102704 2675 2655 2122 2033 1903 1075 200 176 133 ------
NM_031365chr2112840 2811 2791 2258 2169 2039 1806 336 312 269 155 1104 ----
NM_031366chr2112840 2811 2791 2258 2169 2039 1806 336 312 269 155 1104 ----
NM_031427chr14175911 5713 5402 5246 4682 4250 3856 3625 1926 1641 1476 1292 1280 837 517 508 280 ------
NM_031435chr1283472 3401 3231 2675 2478 2243 817 76 --1343 --
NM_031438chr561566 1423 1366 764 743 138 --1400 --
NM_031468chr7208195 8178 8116 7800 7660 7399 6925 6595 6580 6574 6467 5828 2953 2241 1660 1539 1142 536 407 143 47651 7538 3222 1304 1198 26865 1897
NM_031469chr683920 3558 3489 2752 2563 1584 1328 185 --12788 22625 1522
NM_031844chr163393 2605 2574 1597 603 415 11006 ----
NM_031845chr283652 2884 2828 2765 2392 1363 1253 995 13320 --1433
NM_031847chr283652 2884 2828 2765 2392 1363 1253 995 13320 --1433
NM_031911chr482361 1782 1737 761 628 552 138 105 32438 724 83 1424 --
NM_031940chr872275 2037 2014 1681 1628 650 220 --22308 999 --
NM_032047chr342350 1783 631 349 1200 21923 248 --
NM_032105chr1157835 6954 6668 6609 6498 5765 5719 5675 5008 2297 1492 1058 788 650 217 47174 7035 6390 3142 47822 7247 5745 78 --
NM_032116chr1395422 5141 4709 1811 1470 1439 955 407 149 ------
NM_032121chrX52806 2416 2004 1063 900 1370 --1145
NM_032160chr18103978 3578 3402 3289 3205 1408 1183 958 922 370 13334 ----
NM_032186chr151461 586 449 435 342 --198 11332
NM_032189chr1344493 4055 1420 820 14606 24642 802 11591
NM_032199chr1083740 2798 1152 945 437 369 140 26 23299 507 --11034
NM_032228chr1172990 2693 2288 789 748 539 222 ------
NM_032288chr322262 2068 ----11572
NM_032291chr161859 1806 1760 1650 1225 470 1614 ----
NM_032321chr263143 2987 2576 2090 910 627 12885 --1296
NM_032373chr10105474 4008 3938 3689 2236 2038 1097 234 183 102 22128 1263 --14680
NM_032439chr1061687 1398 1221 284 120 81 ----1663
NM_032440chr1062817 2660 1849 1822 1124 655 --12310 1507
NM_032445chr1562458 743 727 673 538 188 ----2460 136
NM_032446chr593864 3738 3201 2873 2815 2731 2355 1320 131 23815 3278 --13597
NM_032449chr192595 2392 2350 2253 2165 1945 1879 1080 191 --11067 1413
NM_032457chr473387 2421 1484 952 840 710 533 23442 848 2587 499 1107
NM_032458chrX93325 3188 2886 2326 964 868 692 413 129 --13252 --
NM_032466chr821388 549 ----21263 129
NM_032468chr821388 549 ----21263 129
NM_032499chr1551459 1323 1098 524 373 11489 --11359
NM_032521chr2073197 3173 3124 2955 2091 1184 1121 --22717 2406 --
NM_032664chr851387 1290 1104 623 200 ----11556
NM_032731chr1741491 1178 270 225 --11330 11265
NM_032784chr63952 176 50 1383 --1186
NM_032804chr1072239 2035 1774 1703 886 555 282 133 ----
NM_032826chr775414 4916 4243 2042 1795 863 175 25181 4963 24037 1541 25085 4584
NM_032842chr771594 1517 1108 639 367 61 48 --11411 --
NM_032873chr1174430 4264 3550 1702 1275 707 324 --32908 2761 991 13172
NM_032876chr14102139 1845 1500 1361 662 579 538 396 131 76 1147 1544 --
NM_032932chr1796203 5874 4881 4532 4238 2394 2138 1722 569 36104 4052 64 46455 6053 3966 46 25091 844
NM_032961chr41904 1856 --1523
NM_032968chrX124131 3784 3626 3343 2847 1506 1287 1185 1067 913 164 124 24184 2596 22938 1012 --
NM_032969chrX124131 3784 3626 3343 2847 1506 1287 1185 1067 913 164 124 24184 2596 22938 1012 --
NM_032973chrY114123 3776 3618 3338 1506 1287 1185 1067 913 164 124 24176 2595 22933 1012 --
NM_032975chr1863340 3130 2589 2385 699 291 31335 1312 192 2968 922 33457 1275 143
NM_032980chr1863340 3130 2589 2385 699 291 31335 1312 192 2968 922 33457 1275 143
NM_033020chr1124238 4215 4130 2954 1923 1705 1536 1243 992 939 768 223 11721 ----
NM_033121chr1251543 1281 1173 630 574 ----1461
NM_033132chr1362022 1776 1637 524 449 234 11471 1430 31648 1441 286
NM_033133chr17173790 3757 3635 3494 3397 3344 3151 3142 2976 2844 2817 2502 2329 1003 891 351 108 23369 3267 1242 --
NM_033143chr473754 3127 3120 2929 1766 1489 121 33378 703 263 11003 --
NM_033181chr6123959 3944 3138 2857 2509 1454 1428 1305 1153 1003 316 242 33913 3089 1367 ----
NM_033221chr992651 2399 2374 2177 1931 1917 1840 732 84 --11115 1679
NM_033224chr7197633 7586 7466 7330 7268 6927 6300 6141 5201 5192 3239 3207 1619 1550 1137 941 777 765 632 45762 4909 798 203 2902 682 22688 1193
NM_033238chr15132447 1805 985 708 632 617 561 527 481 465 222 190 151 1769 12103 --
NM_033360chr1254522 3689 904 318 187 34061 2825 101 11111 --
NM_033380chrX3747 303 185 ----1214
NM_033381chrX3747 303 185 ----1214
NM_033389chr17164528 4425 4371 4276 4024 3431 3341 1891 1541 1425 1385 1289 1163 574 462 235 13350 24108 274 --
NM_033425chr11133490 2544 2512 2360 2278 1286 1245 989 546 485 112 79 73 13375 33456 3439 275 1511
NM_033429chr15143222 3097 2955 2407 2325 2153 2066 1270 1255 1204 743 562 425 336 33113 2585 1066 1734 --
NM_033503chr15143557 3090 3058 2957 2840 1413 1350 1336 1286 1149 684 413 364 266 11460 ----
NM_033505chr2166687 6606 6392 5756 5267 5057 4961 2542 2377 2049 2017 888 502 484 464 332 34565 4112 633 12570 --
NM_033631chr1143477 3353 3060 2840 2708 2405 1489 1292 1024 714 565 258 168 79 23169 1274 --23767 3067
NM_033637chr10103899 3580 3455 3116 2749 2711 2684 1146 514 100 12628 --13879
NM_033644chr582544 2136 1968 1862 1828 802 428 65 22165 1595 11685 --
NM_033645chr582544 2136 1968 1862 1828 802 428 65 22165 1595 11685 --
NM_033656chr21114877 4691 3665 1990 1230 1105 826 554 301 203 139 34454 4085 364 1723 --
NM_052811chr13115278 4903 4425 4284 4251 1811 1706 1345 1152 841 637 1678 1778 1955
NM_052832chr842092 1018 652 536 22900 1179 12140 --
NM_052851chr1352412 899 722 45 23 11913 2581 537 1567
NM_052885chr12154975 4832 4807 4627 4484 4043 3688 1902 1797 1391 1224 530 497 412 363 --11743 14122
NM_052898chr841170 1164 249 174 --1284 21801 749
NM_052917chr252113 803 756 719 171 32936 1264 1112 1189 --
NM_052918chr1053516 2702 2609 2312 264 1505 22891 165 12556
NM_052927chr582006 1986 1900 1804 1635 750 499 418 11682 152 1173
NM_052950chr1321381 276 --172 2113 40
NM_052954chr2182241 1813 1597 1442 1388 759 618 171 195 ----
NM_052966chr1103805 2374 1449 1339 1153 1094 1061 914 88 42 22419 1084 1130 22726 2700
NM_052978chr1441331 559 514 137 ----2711 144
NM_052996chr1631467 1447 116 --51419 470 386 303 29 21461 45
NM_053016chr9167309 6708 6629 5722 5679 5670 5564 3104 2891 2617 2447 1916 1759 1356 630 493 --36415 1968 1386 15045
NM_053043chr7166374 5231 4842 4471 2526 2398 2061 1673 1539 1473 1212 447 270 235 163 133 15878 14600 --
NM_053064chr1472789 2672 2055 1884 1026 981 825 23004 1208 --12764
NM_057175chr492591 1802 1675 914 786 757 721 706 571 11690 ----
NM_057178chr1782403 1854 1797 625 537 520 476 196 --12452 --
NM_058170chr151339 1272 263 237 107 ------
NM_058172chr491818 1662 1520 1510 1291 351 166 67 21 ------
NM_078473chr872275 2037 2014 1681 1628 650 220 --22308 999 --
NM_078476chr651870 1558 1392 1252 1160 31659 1545 326 11305 21288 1237
NM_080546chr982095 2046 2009 1851 1557 1460 385 150 ----1526
NM_080591chr992865 2731 2627 2114 1230 794 755 403 54 --1684 11179
NM_080645chr662079 1987 1786 1691 508 436 --3628 474 323 11365
NM_080664chr1461812 1687 1569 684 554 51 ----11991
NM_080669chr1794656 4532 4525 3938 1395 1353 752 306 50 34934 4141 4005 44764 1643 344 152 14668
NM_080676chr2093246 2535 1275 1141 945 886 619 564 385 --12625 12412
NM_080764chr22123275 3063 2950 1273 1171 1077 1035 1025 880 97 41 23 22732 1018 ----
NM_080836chr20144240 3871 3412 3331 3296 3209 1890 1808 1544 1520 1241 874 553 81 34788 4118 2943 11674 --
NM_080867chr14104806 3819 3451 3225 1282 858 663 634 621 580 23273 1805 24352 850 1992
NM_080872chr8123982 3546 3405 3348 3149 3064 3038 2984 2967 2520 377 144 12668 32700 1476 1404 --
NM_080874chr431779 1523 36 187 11855 --
NM_101395chr2163018 2912 2547 2328 420 269 --33423 3027 403 --
NM_130391chr962885 2500 2249 1429 696 171 ----22309 822
NM_130392chr962885 2500 2249 1429 696 171 ----22309 822
NM_130393chr962885 2500 2249 1429 696 171 ----22309 822
NM_130435chr1042505 1939 1808 744 12401 12278 1542
NM_130437chr2162977 2871 2506 2287 379 228 --43382 2986 1380 362 --
NM_130438chr2162927 2821 2456 2237 329 178 --43332 2936 1330 312 --
NM_130442chr761053 826 445 399 379 284 --1385 --
NM_130831chr342096 1847 1057 855 --32885 2649 223 --
NM_130832chr342096 1847 1057 855 --32885 2649 223 --
NM_130833chr342096 1847 1057 855 --32885 2649 223 --
NM_130834chr342096 1847 1057 855 --32885 2649 223 --
NM_130835chr342096 1847 1057 855 --32885 2649 223 --
NM_130836chr342096 1847 1057 855 --32885 2649 223 --
NM_130837chr342096 1847 1057 855 --32885 2649 223 --
NM_130847chr1185722 5293 4992 4447 3726 2318 2186 1337 35804 4247 3946 14667 --
NM_133170chr20197682 7404 7225 6705 6544 5944 5398 4991 3158 2673 2620 2442 1477 1269 886 501 243 49 34 46931 5277 1166 119 27752 6119 17620
NM_133264chr1773877 3687 2849 2489 2469 1452 628 23472 1349 33927 3178 2425 --
NM_133372chr582554 2258 2172 2061 1153 925 486 259 22443 1079 1875 151
NM_133496chr1144319 4297 4059 3729 3700 3446 3408 3160 2787 1490 932 598 579 37 --13673 14540
NM_133631chr371479 1473 1433 1157 534 429 389 ------
NM_133646chr2135398 5267 4334 4132 3904 3833 3642 2149 1443 1406 1335 816 576 21302 203 --1800
NM_133647chr1583152 2893 2774 1476 1405 1125 608 259 13476 --1439
NM_138270chrX93383 3275 3237 2804 2633 2577 2149 1198 967 ------
NM_138286chr1961366 1183 654 536 296 71 --1692 1889
NM_138348chr5175880 5821 5534 5411 4858 4743 4392 4256 2444 2099 1774 1677 963 919 680 335 178 16289 1957 --
NM_138423chr1581924 1794 1772 842 693 252 228 31 ------
NM_138426chr732277 2224 319 1592 11783 --
NM_138444chr1354793 4250 3365 603 233 13131 23572 1519 24975 1256
NM_138457chr683297 3031 3009 2803 2354 1026 807 428 12375 11140 1997
NM_138459chr6103070 2724 2647 2552 2320 940 819 496 427 52 --33272 1171 1007 --
NM_138473chr12104310 4164 4008 1917 1591 1317 1162 926 499 346 123 --13677
NM_138494chr741793 921 390 31 1368 --2481 152
NM_138576chr14114809 4389 4251 4085 4060 3822 3795 3024 1798 1457 1334 1812 ----
NM_138694chr683463 3431 3195 2577 1011 842 704 612 12767 --13278
NM_138713chr16178133 7449 7017 6699 6595 5533 5413 5339 5254 3163 2924 2683 2549 2523 2263 1130 492 15833 --12809
NM_138714chr16178133 7449 7017 6699 6595 5533 5413 5339 5254 3163 2924 2683 2549 2523 2263 1130 492 15833 --12809
NM_138727chr182465 2444 2393 2214 772 464 117 39 2649 320 ----
NM_138728chr182465 2444 2393 2214 772 464 117 39 2649 320 ----
NM_138731chr1463854 2717 2637 1107 815 149 11519 2369 80 --
NM_138782chr582251 2074 1997 1924 1822 1683 485 333 --21780 519 1788
NM_138959chr1116842 6088 5425 5381 4390 4179 1626 1040 1030 338 70 24239 611 1274 26241 5755
NM_138970chr1452344 953 510 352 191 11548 12087 --
NM_138971chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_138971chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_138972chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_138972chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_138973chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_138973chr11143573 3505 3497 3201 2493 1507 1289 1053 761 443 422 329 126 98 22809 793 32944 1258 633 12739
NM_139168chr5247 40 1336 --1311
NM_139279chr2103132 2744 2626 2452 1385 849 765 713 669 585 ------
NM_139319chr1251376 1175 542 517 88 3759 306 243 1508 --
NM_144567chr1112585 2552 2533 2511 2474 2431 2400 2129 1980 1004 360 32777 2759 53 ----
NM_144571chr4146814 6712 6310 5530 5334 5031 4874 4795 4522 2805 1729 1118 638 479 16433 64942 4571 4437 958 190 63 --
NM_144578chr14125519 5167 4981 3896 3888 2121 1894 1840 1589 1356 1092 907 23542 3395 1645 --
NM_144599chr15125257 5127 4598 4487 4377 3953 3785 3719 2084 1903 1880 1285 13995 1161 21623 1161
NM_144609chr1731132 141 101 --142 1218
NM_144618chr171322 1188 1056 498 221 205 170 ------
NM_144664chr1162606 2142 2034 1749 1665 106 1958 1813 --
NM_144684chr19162993 2684 2575 2412 2091 2042 1207 981 831 729 712 684 619 484 467 397 42879 2520 305 30 12342 --
NM_144721chr4102575 2267 2143 2096 1122 982 668 472 356 76 32399 283 146 1498 --
NM_144728chr13785 378 315 ----1343
NM_144729chr13785 378 315 ----1343
NM_144775chr1784784 4524 3548 906 342 188 72 26 --24773 766 11597
NM_144778chr13102636 2596 2400 2140 1995 1684 932 732 438 50 --2621 493 --
NM_144963chr872607 2419 2346 2322 1008 347 78 12187 --21918 838
NM_144973chr12145066 5016 4770 3766 3732 3608 3459 3332 1987 1964 1748 1544 1238 103 34397 1556 1162 ----
NM_144979chr42133 126 ----1512
NM_145176chr693569 2806 2304 2181 1320 1191 1179 463 424 12884 ----
NM_145206chr1083212 2978 2813 2598 2545 2171 831 279 22991 622 --1999
NM_145207chr4125141 4543 3846 3544 1979 1679 1435 1393 1114 955 586 332 21105 42 25323 3396 --
NM_145259chr2136907 6696 6621 6406 6233 4575 4533 1438 1161 987 632 332 157 36765 978 101 --14328
NM_145268chr761029 958 894 869 822 34 1881 170 2811 216
NM_145305chrX41208 1192 1119 328 21092 982 1246 1302
NM_145307chr10124690 4167 4009 3540 3402 3079 3031 1793 1709 1363 1200 414 --24628 3842 --
NM_145320chr773476 3394 3267 2660 2650 1358 309 1751 32355 1330 1292 12764
NM_145321chr773476 3394 3267 2660 2650 1358 309 1751 32355 1330 1292 12764
NM_145322chr773476 3394 3267 2660 2650 1358 309 1751 32355 1330 1292 12764
NM_145686chr292763 2506 2101 1371 1187 1168 1060 1051 35 12432 ----
NM_145687chr292763 2506 2101 1371 1187 1168 1060 1051 35 12432 ----
NM_145698chr1062018 1742 1473 622 374 349 ----11853
NM_145753chr341522 630 525 315 ----1533
NM_147147chr6104247 3841 3679 3153 2931 1698 1440 1344 825 26 33564 3446 2797 12988 --
NM_147150chr993593 3355 1387 1348 699 205 130 53 45 11240 12759 13653
NM_147175chrX81528 1405 451 405 260 246 226 36 ------
NM_147233chr262259 1840 822 607 338 266 --2443 232 --
NM_148955chr15146588 6228 6206 5756 5455 4887 4221 4135 2039 1110 1064 857 835 468 34970 1262 995 ----
NM_152253chr22123943 3735 3559 3420 3255 3166 2737 986 625 425 411 304 24064 2935 1283 1753
NM_152263chr1166027 5955 5897 5812 5712 5492 4949 4335 4125 2394 1775 1510 1077 818 110 59 15129 35157 377 314 --
NM_152267chr2252234 2078 819 585 378 2793 622 11655 1614
NM_152330chr1462601 2193 1861 874 604 511 22285 560 11880 --
NM_152332chr1472842 2666 2362 1021 654 259 188 --22453 240 11858
NM_152352chr1882992 2815 2180 1972 875 814 691 460 ------
NM_152388chr273908 2938 1521 1374 1009 964 597 33659 3344 1468 --11404
NM_152400chr482011 1519 582 450 295 275 160 84 ------
NM_152407chr583199 2787 2541 2232 682 606 236 33 12181 13189 --
NM_152409chr563466 3419 1014 691 231 55 22363 2315 22608 1322 12904
NM_152422chr981807 1664 1479 1437 744 580 452 382 21635 34 11263 11335
NM_152433chr1151295 519 180 53 36 ------
NM_152470chr18103569 1663 1612 1103 949 625 546 507 496 72 13593 22926 603 --
NM_152487chr151408 966 457 268 198 --11209 --
NM_152588chr1261853 1802 1784 1355 1342 182 --1243 --
NM_152594chr1571851 1831 1637 519 453 366 280 ------
NM_152605chr1931333 1192 431 11416 --1182
NM_152621chr44353 309 114 34 1273 156 --
NM_152622chr583243 3156 3148 2946 2713 2156 1279 990 --13073 23132 2968
NM_152624chr5107343 6754 6729 6702 6441 5010 2922 2577 2170 1984 37219 6044 393 17152 --
NM_152629chr983999 2904 1636 1531 1496 1013 480 244 41393 951 895 882 ----
NM_152630chrX31425 969 402 ----11003
NM_152636chr1152427 1240 467 435 98 ----1806
NM_152678chr3122736 2729 2269 2044 1868 1803 1750 822 256 223 66 25 1702 ----
NM_152724chr1062305 2234 1041 733 317 227 2901 766 11798 --
NM_152731chr651129 1009 782 355 224 ----1231
NM_152733chr6115949 5514 5312 1963 1462 1201 1078 890 849 459 145 56352 3974 1811 1357 163 11315 16206
NM_152734chr6124621 4520 3938 3790 1175 985 945 831 778 653 166 34 23425 2191 11339 14752
NM_152754chr753453 3355 2950 2601 1444 12903 ----
NM_152756chr593956 3828 3198 1197 1091 1033 871 570 172 --14346 13590
NM_152765chr892007 1938 1488 1459 827 807 356 211 36 1311 --11671
NM_152774chr752565 2513 2270 913 118 1240 160 --
NM_152787chrX73974 3687 3579 1502 887 399 51 13950 1436 1472
NM_152793chr785065 4653 4079 3810 3342 2006 1983 684 35024 4185 3887 11625 --
NM_152826chr15146588 6228 6206 5756 5455 4887 4221 4135 2039 1110 1064 857 835 468 34970 1262 995 ----
NM_152835chr172757 2498 2296 1832 1153 998 698 11862 12253 --
NM_152836chr8101727 1691 1496 1477 1469 656 611 362 221 81 --1573 --
NM_152837chr8101727 1691 1496 1477 1469 656 611 362 221 81 --1573 --
NM_152838chr2073435 3007 2619 1174 1139 841 458 --1761 --
NM_152903chr1392791 2331 2165 2092 2059 1056 1048 642 99 ------
NM_152924chr15196926 6780 6134 5499 4446 4263 2683 2097 1793 1774 1509 1386 1334 1263 1041 842 731 500 346 --11632 --
NM_152999chr794915 4884 4559 4516 4431 4059 3422 1115 1056 14537 24524 1033 --
NM_153020chr621505 1054 21143 226 1601 11250
NM_153184chr361816 1777 1512 1419 1283 1257 21583 495 ----
NM_153188chr5105588 5474 4867 3560 2269 1423 1261 746 677 345 ----1753
NM_153207chr1283451 3312 2965 2710 1540 1226 625 410 --1937 --
NM_153235chr682103 2086 2073 1885 1689 780 629 234 22248 689 12399 --
NM_153262chr172296 699 588 350 325 123 72 22382 692 132 --
NM_153365chr482754 2499 2391 1789 975 509 460 293 ----1773
NM_153426chr42484 173 ----2151 99
NM_153427chr42484 173 ----2151 99
NM_153456chr13185650 5393 5250 4968 4949 4648 4508 4067 4003 2471 2066 1958 1661 1250 1067 776 361 273 34408 1019 260 35884 5293 5137 15190
NM_153487chr694584 4293 4079 3594 3493 3470 3291 1035 613 24566 3915 34640 4498 48 168
NM_153616chr1581966 1924 1820 1696 769 685 474 111 3452 247 121 21713 955 --
NM_153617chr1581966 1924 1820 1696 769 685 474 111 3452 247 121 21713 955 --
NM_153618chr1581966 1924 1820 1696 769 685 474 111 3452 247 121 21713 955 --
NM_153619chr15173204 3162 3058 2934 2562 2309 1349 970 928 845 780 732 699 363 317 281 164 11359 22951 1181 11146
NM_153645chr22103247 2766 2498 2444 1280 1128 896 468 322 207 1713 ----
NM_153705chr1192528 2186 2130 1934 1898 955 945 518 94 ----11033
NM_153810chr10104877 4656 4255 3885 3490 686 477 438 307 172 --34295 1583 778 --
NM_153812chr181853 1704 756 454 211 199 178 150 21793 940 11543 --
NM_170665chr12104026 3577 3501 3293 3230 3204 1378 1363 1149 388 14077 ----
NM_170768chr1151545 1482 1081 452 339 --21655 279 11745
NM_171998chrX62120 1773 1728 555 432 110 --2480 185 --
NM_172071chr185482 4889 4512 2696 1358 568 473 154 --24895 127 27280 5240
NM_172103chr662268 2150 1731 766 539 261 --12698 --
NM_172105chr662268 2150 1731 766 539 261 --12698 --
NM_172216chr1272906 2718 1836 739 488 340 297 11032 --12160
NM_173075chr441666 1561 673 130 --11628 157
NM_173198chr972906 2343 1846 1835 802 400 171 --2899 466 --
NM_173200chr972906 2343 1846 1835 802 400 171 --2899 466 --
NM_173214chr16178133 7449 7017 6699 6595 5533 5413 5339 5254 3163 2924 2683 2549 2523 2263 1130 492 15833 --12809
NM_173354chr2142167 688 563 79 21637 1474 21862 1697 --
NM_173355chr25763 683 299 216 179 ------
NM_173463chr484508 4493 3132 2970 1568 831 545 58 14316 --41754 1147 1019 901
NM_173468chr484977 4945 4411 4048 3845 3726 1733 838 --15907 --
NM_173470chrX92871 2680 2306 2294 2176 943 930 873 456 1918 ----
NM_173495chrX122432 2198 1959 1935 1832 873 807 614 567 403 120 80 --11737 149
NM_173496chr1052613 2571 2259 1018 196 12798 ----
NM_173510chr2242572 2526 2098 2031 32078 258 185 32766 2140 21 --
NM_173511chr283707 3632 2932 2751 2665 2536 866 373 11009 2557 213 --
NM_173536chr4124621 4576 3640 3500 3481 3319 1906 1756 1705 1073 41 26 --13139 --
NM_173552chr381905 1850 1562 784 736 152 63 55 1903 1328 --
NM_173576chr1061763 895 810 387 188 73 --22034 1448 11791
NM_173582chr11186299 5835 5670 5511 5462 5213 5142 4800 4737 4465 4406 2164 1353 1102 933 694 242 159 --26141 2406 --
NM_173595chr12115154 4621 4559 4031 3959 3869 3409 1965 1303 1284 598 23968 1102 34251 4107 3303 --
NM_173602chr12133576 3494 3373 3330 3135 2905 2559 2448 2370 1450 1207 872 695 --2770 245 13590
NM_173642chr1219107 9036 8729 8027 7483 7337 6718 6342 6038 3008 2489 2254 2114 1844 1834 1693 1679 1457 1276 1146 31 38693 8493 1617 18216 19055
NM_173694chrX82286 2230 789 616 532 232 183 135 11675 ----
NM_173808chr1144276 4245 4036 3951 3837 3423 3368 3126 1779 1422 1371 1320 991 943 --34450 3346 702 11543
NM_173825chr362941 2642 2010 994 662 614 1482 --12713
NM_173829chr574796 4468 4128 2486 2365 459 244 --24891 1289 45737 5428 4903 1349
NM_173851chr883786 3679 2574 778 494 403 293 260 53634 3295 1081 1069 710 2683 92 --
NM_175061chr772150 1982 1794 1621 794 446 426 11935 ----
NM_175085chr212673 146 ----1570
NM_175623chr12147319 7019 6740 6699 5856 5593 5554 5253 2769 1708 1627 731 424 241 2625 88 46418 5799 2349 1599 11766
NM_175624chr12147414 7114 6835 6794 5951 5688 5649 5348 2864 1803 1722 826 519 336 3720 183 85 46513 5894 2444 1694 11861
NM_175625chr12147414 7114 6835 6794 5951 5688 5649 5348 2864 1803 1722 826 519 336 3720 183 85 46513 5894 2444 1694 11861
NM_175736chr12247403 7064 6472 6291 6231 5314 5307 5284 4853 4733 3123 2925 2714 2689 2461 2339 2116 1970 1832 1536 1463 323 211 76 37489 6910 6769 1244 --
NM_175876chr172437 2333 2071 1720 1709 650 144 ----12272
NM_175907chr1852783 2397 2231 2090 290 12777 --22736 1956
NM_175921chr5103634 3571 3116 3086 2687 1425 1316 683 210 142 1796 11583 13814
NM_176814chr751443 1331 526 157 77 ------
NM_176823chr173787 3572 3271 2941 2927 2902 61 22728 28 12853 13173
NM_177438chr1464055 3749 3506 2647 859 818 --21164 926 --
NM_177553chr112787 596 1142 --1301
NM_177974chr1581924 1794 1772 842 693 252 228 31 ------
NM_177985chr252200 917 897 722 201 ------
NM_177995chr981807 1664 1479 1437 744 580 452 382 21635 34 11263 11335
NM_178006chr1352412 899 722 45 23 11913 2581 537 1567
NM_178007chr1352412 899 722 45 23 11913 2581 537 1567
NM_178011chr10103103 2550 2506 2433 2178 2148 1132 970 602 34 33143 3009 2359 12489 1684
NM_178140chr562720 2415 2197 1698 969 387 ----11978
NM_178151chrX167091 6756 6565 6499 6228 5180 5066 3090 2341 1861 1466 1227 1114 1057 601 28 47791 7270 6413 674 12250 17169
NM_178152chrX167091 6756 6565 6499 6228 5180 5066 3090 2341 1861 1466 1227 1114 1057 601 28 47791 7270 6413 674 12250 17169
NM_178153chrX167091 6756 6565 6499 6228 5180 5066 3090 2341 1861 1466 1227 1114 1057 601 28 47791 7270 6413 674 12250 17169
NM_178498chr11123999 3760 3537 3434 3379 3337 2612 2601 1340 679 607 359 43716 3664 3364 3316 --12710
NM_178585chr453320 2353 684 492 136 2852 579 ----
NM_178586chr1462195 2114 2040 633 184 99 --1383 --
NM_178812chr841237 549 450 155 --1437 --
NM_181351chr1182925 2262 1194 617 309 270 164 29 --22565 59 12514
NM_181358chr1113423 3033 2952 2865 2589 1430 1332 1096 1058 763 201 1958 --1290
NM_181361chr341245 463 409 269 --21311 398 168
NM_181481chr18176824 6768 6533 6147 6016 5588 4886 2787 2726 1818 1422 794 761 513 491 115 40 1677 16125 --
NM_181482chr18176824 6768 6533 6147 6016 5588 4886 2787 2726 1818 1422 794 761 513 491 115 40 1677 16125 --
NM_181483chr18176824 6768 6533 6147 6016 5588 4886 2787 2726 1818 1422 794 761 513 491 115 40 1677 16125 --
NM_181504chr583924 3600 3074 2655 1119 1054 763 738 12869 ----
NM_181523chr583924 3600 3074 2655 1119 1054 763 738 12869 ----
NM_181524chr583924 3600 3074 2655 1119 1054 763 738 12869 ----
NM_181656chr174978 850 712 698 --2813 755 --
NM_181659chr2083168 3016 2136 2094 1290 910 337 174 22739 368 12076 --
NM_181659chr2083168 3016 2136 2094 1290 910 337 174 22739 368 12076 --
NM_181672chrX61606 1590 1568 1453 773 233 ----12021
NM_181673chrX61606 1590 1568 1453 773 233 ----12021
NM_181704chr2161296 1234 547 462 152 40 11408 --1888
NM_181705chr5135637 4994 4953 4792 4663 3933 3581 1956 1553 681 488 237 195 14703 12314 1173
NM_181706chr11102365 2180 2166 1997 1774 1703 882 561 497 398 --12316 --
NM_181782chr641645 1427 383 60 11664 11704 --
NM_181784chr272473 2372 949 844 602 355 292 196 ----
NM_181789chr1582793 2741 2707 2260 1043 940 494 388 --32657 1284 933 --
NM_181847chr1281589 1239 516 497 466 270 205 121 21547 1456 1377 11612
NM_181861chr1272658 2197 1920 1882 1131 828 425 21891 1802 ----
NM_181868chr1272658 2197 1920 1882 1131 828 425 21891 1802 ----
NM_181869chr1272743 2282 2005 1967 1788 913 510 21976 1887 ----
NM_181897chr3112709 2625 2598 2544 2422 1972 1790 572 485 295 242 1526 12536 1274
NM_182314chrX41777 1374 606 586 1184 ----
NM_182484chr2161296 1234 547 462 152 40 11408 --1888
NM_182485chr453318 1206 484 176 147 22873 1118 1398 11176
NM_182503chr6175509 5399 5157 5111 4525 4186 4129 4055 3770 3707 3657 1814 1765 1087 712 34 24 11800 13475 --
NM_182551chr2123494 3400 2779 2756 2531 2422 2189 1205 1046 902 590 483 13180 22525 334 --
NM_182641chr1711503 ----11705
NM_182646chr453318 1206 484 176 147 22873 1118 1398 11176
NM_182663chr1112159 2097 1718 1710 1505 870 799 686 523 308 285 2624 220 22080 596 --
NM_182664chr1122289 2227 1848 1840 1635 1502 1479 929 816 653 438 415 2754 350 22210 726 --
NM_182665chr1112159 2097 1718 1710 1505 870 799 686 523 308 285 2624 220 22080 596 --
NM_182697chr751388 1275 1226 382 101 21564 371 ----
NM_182734chr20103272 2877 2379 2054 1051 1013 616 509 389 50 12427 1375 --
NM_182797chr2071575 1359 1181 641 623 203 45 --11288 1142
NM_182830chr1472146 1887 1390 817 783 347 198 ----22261 94
NM_182898chr7125534 5439 5308 4789 4377 4011 2421 2174 1582 556 464 400 24921 114 25061 4019 --
NM_182899chr7125534 5439 5308 4789 4377 4011 2421 2174 1582 556 464 400 24921 114 25061 4019 --
NM_182907chr662313 2137 1910 1485 963 155 --22329 2114 --
NM_182918chr213551 461 79 41505 1234 294 148 21418 370 --
NM_182948chr172992 2850 2834 2315 2103 953 487 ----1530
NM_183004chr14153909 3702 3655 3449 3233 3211 3017 2974 2958 2601 2566 2502 1045 595 124 --33140 2749 504 --
NM_183397chr20105151 5107 5028 4477 4406 3904 2051 1827 1584 284 ----11021
NM_183419chr831153 1065 176 --11042 2962 410
NM_194247chr254130 3761 3406 3114 520 33578 3391 1330 --11199
NM_194282chr4112976 2729 2504 2267 2167 2136 2056 1200 747 582 361 22307 713 ----
NM_194283chr553929 3238 2651 1178 49 34075 3521 74 11498 --
NM_194285chr1173123 2823 2539 994 987 908 413 12676 ----
NM_194286chr12206162 6038 5951 5931 5598 5578 5173 4986 4924 4305 4286 4083 2490 2470 2300 1965 1957 1543 1149 592 25902 5138 --25405 3942
NM_194291chr832933 615 109 1994 22646 856 --
NM_194292chr151691 633 585 346 76 ----1380
NM_194313chr981899 1853 1694 1372 1345 461 224 99 21357 241 1420 11994
NM_194314chr164470 3671 1927 1284 992 593 --11659 --
NM_194317chr231719 1668 805 32529 2212 986 32344 1928 203 --
NM_194434chr1895792 4753 4445 4030 4014 1878 1819 212 50 14343 --14610
NM_197941chr562704 2224 827 552 195 73 22066 1913 1851 21231 60
NM_198086chr14102139 1845 1500 1361 662 579 538 396 131 76 1147 1544 --
NM_198158chr3112703 2685 2644 2636 2486 856 781 631 402 366 208 --1653 --
NM_198159chr3112703 2685 2644 2636 2486 856 781 631 402 366 208 --1653 --
NM_198177chr3112703 2685 2644 2636 2486 856 781 631 402 366 208 --1653 --
NM_198178chr3112703 2685 2644 2636 2486 856 781 631 402 366 208 --1653 --
NM_198181chr1552880 2661 2568 2245 2060 12002 12348 --
NM_198182chr261418 1292 1104 537 526 327 --11541 --
NM_198225chr1061941 1864 1602 683 531 64 11446 21837 164 --
NM_198268chr1113423 3033 2952 2865 2589 1430 1332 1096 1058 763 201 1958 --1290
NM_198269chr1113423 3033 2952 2865 2589 1430 1332 1096 1058 763 201 1958 --1290
NM_198270chrX63111 2836 765 600 320 34 --3677 419 341 --
NM_198320chr12125077 4645 4603 3698 2075 1400 1329 1196 958 920 529 457 11021 11268 --
NM_198392chr64434 361 223 201 12103 31752 403 180 22048 447
NM_198400chr1582889 2456 1031 876 676 239 85 51 12096 --11055
NM_198439chr1151295 519 180 53 36 ------
NM_198465chrX92909 2061 2053 1902 901 859 836 729 428 1520 1446 --
NM_198468chr6144461 4217 4196 3639 2961 1799 1640 1501 832 661 585 425 251 45 --11561 --
NM_198485chr381955 1640 832 719 553 257 244 202 1936 22207 2070 --
NM_198503chr132113 1672 637 ----11573
NM_198549chr183170 2912 2409 2403 909 838 373 131 --12049 1556
NM_198569chr682176 2110 1970 1800 1045 958 691 198 21006 545 ----
NM_198578chr1241307 1116 968 292 ----11458
NM_198581chr2147259 6925 6899 6669 5725 5397 4793 2783 1997 1978 1954 1787 656 154 15998 ----
NM_198595chr4114730 4269 4258 4099 3665 3324 3267 633 298 113 88 23905 3865 14554 --
NM_198715chr1136009 5721 5053 4886 4779 4430 2058 1528 1140 1017 989 833 164 25958 396 14520 --
NM_198793chr373903 3044 2901 1631 1601 419 169 1389 13802 --
NM_198859chr394999 4972 4698 4376 3840 3155 1058 676 620 45076 3996 3219 1283 54340 2063 1323 1013 469 --
NM_198900chr12247403 7064 6472 6291 6231 5314 5307 5284 4853 4733 3123 2925 2714 2689 2461 2339 2116 1970 1832 1536 1463 323 211 76 37489 6910 6769 1244 --
NM_198990chr772798 2143 1302 1283 534 235 218 ------
NM_199000chr781830 1723 1677 1595 1410 861 628 375 11717 11754 --
NM_199050chr2192806 1558 1510 1504 1463 1013 925 886 214 43905 1314 1253 186 33587 3401 2526 --
NM_199245chr1242034 1049 701 678 2687 620 22570 921 --
NM_199320chr482780 2510 2214 928 378 342 262 145 --11124 --
NM_199320chr482780 2510 2214 928 378 342 262 145 --11124 --
NM_199421chr14104806 3819 3451 3225 1282 858 663 634 621 580 23273 1805 24352 850 1992
NM_199436chr2103008 2743 2707 2452 1986 649 518 468 150 133 ------
NM_199437chr1182442 2090 2046 1722 938 824 176 162 12024 2410 346 --
NM_199438chr1182442 2090 2046 1722 938 824 176 162 12024 2410 346 --
NM_199439chr1182442 2090 2046 1722 938 824 176 162 12024 2410 346 --
NM_199454chr1164739 4273 3789 3577 3482 3460 3292 3119 1643 1593 1537 1145 684 516 178 32 3755 259 207 ----
NM_199461chr1063505 3020 2743 2556 2356 1246 --1930 --
NM_199462chr1105021 4135 4105 3682 3349 1697 1161 762 654 104 33810 3169 3116 13160 23608 810
NM_199482chr232138 1700 766 ----1369
NM_201269chr151461 586 449 435 342 --198 11332
NM_201432chr17136104 4137 2630 2019 1939 1723 1682 1404 1226 1214 851 814 346 35512 5100 1396 11673 15434
NM_201433chr17136104 4137 2630 2019 1939 1723 1682 1404 1226 1214 851 814 346 35512 5100 1396 11673 15434
NM_201591chr421253 436 --11215 1272
NM_201592chr421253 436 --11215 1272
NM_203327chr2094530 1835 1463 1398 1162 814 387 248 116 13679 1453 --
NM_203351chr1762200 2122 2084 1000 392 336 1950 21810 329 1567
NM_203372chr261434 1420 1308 1103 478 45 ------
NM_203394chr1272456 1785 1764 1103 660 310 33 ----12101
NM_203406chr592846 2690 2405 2085 1885 1864 485 217 142 ------
NM_203446chr2142361 2243 1953 579 2386 148 199 11209
NM_203451chr1372340 2208 1689 1583 776 457 209 12304 ----
NM_203453chr941971 1634 1580 1280 ----11272
NM_203458chr173626 3455 3358 2498 1083 1024 516 1390 --11522
NM_203459chr182448 2316 2046 1977 1887 1862 1811 715 --11902 --
NM_203463chr2134429 4380 4097 4050 3848 3619 3554 3331 3284 3244 1655 1160 100 33671 3461 1362 1123 11539
NM_203504chr482615 2457 2188 2003 975 727 678 469 ------
NM_203505chr482615 2457 2188 2003 975 727 678 469 ------
NM_205860chr1112822 2426 2243 2205 1175 808 788 582 532 238 162 --21222 221 12051
NM_206594chr132926 588 100 12839 --2930 664
NM_206595chr132926 588 100 12839 --2930 664
NM_206853chr683573 3500 3113 3095 2809 2522 1453 1071 --2804 767 --
NM_206854chr684834 4761 4374 4356 4070 3783 890 95 13521 22065 2028 --
NM_206855chr6115799 5726 5339 5321 5035 4748 1855 1060 664 104 97 24486 4210 14045 --
NM_206876chr243508 3090 3004 317 12929 23132 1194 11165
NM_206909chr8147975 7782 7043 6854 6645 6549 6445 6155 5552 5261 3015 1451 1005 753 36397 5480 1747 27103 5323 22097 1573
NM_207015chr332261 1973 66 1968 21929 1528 --
NM_207297chr3103005 2774 2751 2373 1211 788 710 426 180 41 2326 56 1823 --
NM_207304chr1382523 2483 2287 2027 1882 819 619 325 --2508 380 --
NM_207361chr13156310 6000 5874 5211 5184 5122 5103 4958 4944 4016 2293 2202 1386 1315 212 34659 1453 1322 34049 3929 178 1679
NM_207404chr342220 2171 1521 791 --12014 22157 1659
NM_207406chr4145970 5586 5394 4910 4902 2287 1993 1649 1257 849 789 533 337 86 31799 698 452 25481 1350 1546
NM_207577chr11112513 2504 2249 2140 1979 1868 1132 1122 892 666 77 12935 12110 --
NM_207578chr16703 640 631 541 314 124 --195 --
NM_212558chr984240 4075 3911 3426 2667 1548 1077 360 11352 ----
NM_213589chr295587 5234 4818 4696 3700 3395 1895 485 353 24209 4008 24754 2108 14589
NM_213590chr13115278 4903 4425 4284 4251 1811 1706 1345 1152 841 637 1678 1778 1955
NM_213606chr1092087 2000 1888 871 735 629 311 189 54 32161 1672 107 1322 --