TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-920
miRNA Sequence: GGGGAGCUGUGGAAGCAGUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1291886 1550 1535 1499 524 474 297 230 214 22058 1512 32208 1877 1557 --
NM_000021chr141943 --1129 --
NM_000037chr892255 1951 1945 1914 1822 1657 1556 609 463 ------
NM_000068chr1931140 988 451 --172 --
NM_000084chrX106423 6302 6286 5561 5227 4852 4441 2535 1744 1520 36728 1163 204 1825 12647
NM_000088chr1771215 1160 1093 865 508 365 25 ------
NM_000129chr63323 128 81 ----1253
NM_000135chr164789 747 712 70 --133 --
NM_000183chr2191 --199 --
NM_000194chrX----2555 210 --
NM_000217chr1252051 2029 1780 1613 315 15175 ----
NM_000226chr17146 2308 234 1342 --
NM_000248chr332051 683 38 ----22021 1928
NM_000259chr1585714 4883 4436 3881 2433 1868 1800 1455 ------
NM_000314chr1011050 --12689 --
NM_000325chr4----1161 --
NM_000332chr686642 4362 2294 1270 959 540 239 32 24761 509 25479 4525 --
NM_000334chr1772176 1847 1747 1479 534 213 114 31760 714 178 3700 599 52 --
NM_000335chr311779 51871 1611 787 631 485 21715 1533 --
NM_000362chr2242922 2881 2711 1418 12937 32943 1432 49 --
NM_000368chr954670 3721 1313 1251 702 1404 24238 619 --
NM_000376chr1252555 1229 875 677 40 --12634 1474
NM_000408chr242688 2336 2287 2266 --12742 1665
NM_000430chr1743694 3060 749 78 13723 13617 --
NM_000452chr1331514 779 29 11715 12020 --
NM_000461chr353580 3306 3231 1092 69 12888 21116 886 1291
NM_000478chr12212 157 --1646 --
NM_000516chr20----1230 --
NM_000523chr211008 ----2758 474
NM_000533chrX------31706 1485 1440
NM_000539chr361394 1378 1347 230 162 120 ----21514 1439
NM_000555chrX57825 5354 2628 1841 997 27819 7010 42889 2572 2294 495 --
NM_000578chr251471 1296 1277 376 101 ------
NM_000599chr274475 3759 3696 3664 3561 3139 1062 13743 34049 1677 1085 --
NM_000610chr1142570 2253 1978 961 ----2819 249
NM_000615chr113627 288 52 11063 11966 --
NM_000723chr1751603 675 444 360 273 --2502 166 11251
NM_000725chr125870 857 659 638 135 1216 ----
NM_000739chr71164 ----171
NM_000801chr204962 932 789 169 --127 --
NM_000827chr541682 771 556 42 11592 11598 --
NM_000829chr1111879 --12250 --
NM_000883chr73527 515 197 1250 2449 117 --
NM_000924chr1241141 415 319 75 1233 21018 308 --
NM_000960chr19----1490 1312
NM_000964chr1771171 999 955 867 460 387 355 1200 ----
NM_000966chr124986 670 359 189 2432 221 1126 --
NM_001001132chr2111475 ----11179
NM_001001323chr12--1140 1787 --
NM_001001396chr1114297 3908 3679 3554 3261 1503 1367 1322 980 168 55 --32977 257 240 13949
NM_001001522chr11----2158 43 --
NM_001001549chr732779 2503 2480 1530 --1581
NM_001001556chr151510 --1156 --
NM_001001557chr821675 694 --11585 --
NM_001001974chr1032062 1912 675 ----11999
NM_001003398chr12----144 173
NM_001003656chr101216 ------
NM_001003674chr1876557 5584 2660 2481 2293 1942 861 44914 4349 2345 1198 1551 36466 2489 2221
NM_001003682chr151362 1225 1219 1028 409 --21232 1098 --
NM_001004304chr1282997 2835 2683 2023 1250 1136 602 173 32785 2413 310 32547 520 486 --
NM_001005271chr172816 368 --2737 148 --
NM_001005463chr1011972 --22432 730 --
NM_001005743chr14--11120 --1546
NM_001005845chr83356 226 50 --21710 378 1287
NM_001005910chr31543 ------
NM_001006115chr3122752 2685 2624 2461 2249 2018 1931 873 625 488 415 206 --1696 --
NM_001007226chr171223 --1563 --
NM_001007277chr113302 176 53 --173 --
NM_001007278chr1363494 3303 2095 1549 1121 1104 ------
NM_001007565chr3----1275 --
NM_001008220chr553904 3819 2711 940 312 23132 910 1153 13275
NM_001008222chrX31253 1166 998 ------
NM_001008407chr7--21809 1190 2676 63 --
NM_001008660chr11------11357
NM_001008701chr1982762 2442 2309 2273 527 433 386 223 22780 2575 1611 1766
NM_001008895chr1341328 398 290 133 ------
NM_001008938chr111385 ------
NM_001009955chr12406 119 ------
NM_001009958chr71219 --268 34 --
NM_001010935chr1122 --2800 168 --
NM_001010942chr12123 ----1417
NM_001011513chr412737 13929 12942 --
NM_001011545chr21----2532 150 --
NM_001011546chr20------131
NM_001011885chr15----1138 --
NM_001012329chr152379 1771 350 330 59 --2492 342 12226
NM_001012426chr692447 2092 1361 1350 1252 858 705 631 455 22843 1298 4942 915 794 323 2507 142
NM_001012974chr61229 ------
NM_001012977chrX3479 416 166 ------
NM_001013693chr172673 2547 794 781 732 255 171 --32630 2278 404 --
NM_001014336chr121331 ------
NM_001014797chr10127728 7602 7495 2925 2795 2765 2495 2320 1427 1215 707 663 21833 300 --11791
NM_001015881chrX2389 74 1268 ----
NM_001017395chr373263 3024 2778 2710 960 810 25 13355 ----
NM_001017923chr14146 ----21203 671
NM_001017926chr821570 1269 ------
NM_001017930chrX2483 173 ------
NM_001017979chr4----1166 --
NM_001018025chrX133 ------
NM_001018050chr2242106 685 175 153 13185 ----
NM_001018064chr921921 99 --1143 --
NM_001018065chr954903 4113 1373 1074 25 --45697 4334 3737 2429 1140
NM_001018067chr124607 677 --23451 390 --
NM_001018108chr1572094 1581 1434 781 733 509 153 ------
NM_001023567chr1541719 932 455 347 --1734 --
NM_001024808chr1252453 2380 2359 730 535 12525 1588 --
NM_001024858chr1492629 2500 2474 2299 1818 883 637 554 209 22970 231 42528 2381 2271 237 --
NM_001024937chr172225 62 --2245 43 1774
NM_001025081chr1831141 1079 36 --1452 --
NM_001025205chr34418 316 186 64 --1355 --
NM_001025366chr641502 1479 1364 1354 1518 ----
NM_001025580chrX53931 3256 1088 344 133 13074 14025 --
NM_001029858chr653348 2648 2085 839 487 ------
NM_001029859chr1162305 1744 1573 550 460 321 --21804 1000 --
NM_001030006chr1732345 1650 639 --21979 177 12190
NM_001030007chr1673859 3705 3086 2832 2819 572 544 1916 1767 11228
NM_001030055chr1413141 11432 --12972
NM_001031694chr12903 232 --1778 --
NM_001031695chr2231690 1607 1283 2881 711 --13399
NM_001031740chr131295 1150 599 1443 ----
NM_001032288chr2021233 576 --1989 1126
NM_001032289chrX5772 372 275 170 106 ------
NM_001032293chr171492 --176 --
NM_001032296chr1332520 1943 854 --22605 212 --
NM_001032380chr1011370 ----11843
NM_001032999chr2075119 4676 4356 4098 3932 1704 970 24488 3423 44886 1266 442 311 14187
NM_001033049chr213738 583 324 --22300 919 --
NM_001033112chr51366 --184 --
NM_001033506chr11----1172 --
NM_001033507chr131554 725 332 133 ----
NM_001033557chr2------1466
NM_001033602chr1362321 2298 1826 1781 651 27 --1505 --
NM_001034837chr5------128
NM_001034845chr4----1226 --
NM_001037533chr11656 1601 1253 --
NM_001037582chr421476 589 --21256 69 --
NM_001038493chr22541 37 1108 ----
NM_001039350chr741723 1528 1118 396 11208 1169 11432
NM_001039366chr222182 54 --291 33 --
NM_001039577chr1144488 4039 3980 3875 3867 3723 3385 3302 2811 2784 1793 1089 874 77 33141 1302 699 14425 13710
NM_001039577chr1144488 4039 3980 3875 3867 3723 3385 3302 2811 2784 1793 1089 874 77 33141 1302 699 14425 13710
NM_001039590chrX24012 2474 --21161 398 --
NM_001039618chr1155985 653 537 274 245 14388 ----
NM_001039690chr1662016 2008 1973 868 220 84 --22160 960 --
NM_001039802chr121189 367 ------
NM_001039960chr121454 21167 482 21417 301 --
NM_001040057chr711251 --11512 --
NM_001040439chr1671362 1350 1120 950 924 374 222 11013 1246 2967 258
NM_001042404chr121752 389 ------
NM_001042406chr6--1259 1389 --
NM_001042430chr142544 533 1182 1444 1366
NM_001042506chrX3479 416 166 ------
NM_001042539chr165955 902 363 182 117 --1238 1152
NM_001042555chr1233538 1855 1285 --21174 552 --
NM_001042599chr255507 5363 2525 740 690 ------
NM_001042681chr132471 2425 2018 22055 827 1267 --
NM_001042683chr621435 1150 ----11213
NM_001044305chr621180 302 --167 --
NM_001092chr1741939 1840 550 419 21951 438 21565 840 21627 130
NM_001095chr1241606 1280 1197 465 ----1286
NM_001148chr4--22128 767 2224 126 --
NM_001174chrX2424 154 --1403 --
NM_001191chr2061429 1377 1333 1179 1105 472 --1204 --
NM_001204chr246863 6696 5365 1668 21145 177 22772 552 --
NM_001219chr751896 1824 1765 338 50 11510 12203 --
NM_001232chr11835 --2447 105 --
NM_001259chr725684 1557 26104 1190 ----
NM_001264chr62705 340 2898 369 1215 --
NM_001290chr411025 ----2894 194
NM_001292chr154701 246 183 96 --1160 --
NM_001304chr1733032 2937 53 --22502 1197 --
NM_001319chr1931078 948 723 --1828 --
NM_001338chr2121194 28 ----1855
NM_001364chr111893 13608 1337 --
NM_001390chr1832679 2569 1125 --21054 170 --
NM_001396chr212697 239 11791 --1551
NM_001400chr11181 ----1296
NM_001406chr1741668 1304 659 51 --21645 1378 11639
NM_001408chr161434 1066 392 95 67 32 11231 11121 --
NM_001420chr1962690 2577 2105 1922 1153 371 22880 2856 ----
NM_001427chr751989 766 685 641 301 ----1425
NM_001431chr621217 175 1192 ----
NM_001438chr111203 ----23681 301
NM_001448chrX1209 ----11510
NM_001455chr653956 3442 3296 3157 1779 23522 89 1907 11763
NM_001610chr114675 254 75 59 ----1779
NM_001616chr253113 2730 2553 982 600 1558 --1867
NM_001620chr112198 169 1659 1288 --
NM_001627chr332308 2142 1904 --11604 --
NM_001635chr72431 425 --1953 --
NM_001650chr1811076 12591 ----
NM_001655chr1131393 653 322 --1270 --
NM_001660chr31264 ------
NM_001697chr21------163
NM_001702chr8160 --1425 --
NM_001707chr72328 198 --1793 --
NM_001709chr1121992 1840 --12350 1601
NM_001740chr162492 349 ------
NM_001755chr162872 475 --21881 340 --
NM_001797chr161779 ------
NM_001842chr9--1504 1401 --
NM_001852chr11436 ----1640
NM_001859chr963537 2888 1471 1280 346 95 --13935 --
NM_001893chr17----2298 119 --
NM_001896chr161298 ------
NM_001927chr2155 ------
NM_001949chr662301 1174 1144 527 237 206 22133 1006 ----
NM_001962chr51429 ------
NM_001964chr52914 332 ------
NM_001970chr171590 --1188 --
NM_001987chr1233917 3649 1590 --31633 1112 602 11668
NM_001990chr1----134 --
NM_002014chr124653 544 479 277 ------
NM_002025chrX98980 8686 8378 7024 5799 2906 2819 2438 349 28738 1892 ----
NM_002039chr4------1229
NM_002070chr33158 99 88 --2847 141 --
NM_002074chr1----11643 --
NM_002128chr13------1882
NM_002139chrX----1131 --
NM_002140chr921147 203 ------
NM_002146chr174499 262 115 58 1533 1140 11319
NM_002147chr172637 163 3819 237 103 ----
NM_002152chr19193 ------
NM_002193chr21163 --11820 --
NM_002196chr2031088 1019 405 --1737 --
NM_002204chr1711250 ----11396
NM_002205chr122844 380 --1115 --
NM_002232chr11948 --1206 --
NM_002254chr261562 861 576 511 469 204 1829 31904 647 293 --
NM_002264chr364392 3083 1257 308 178 148 11344 ----
NM_002265chr17------1827
NM_002270chr521981 1026 --11407 --
NM_002271chr1321894 204 ----1582
NM_002309chr22122970 2850 2817 2802 2566 2488 2441 2400 2065 1999 1165 1028 --12921 --
NM_002373chr1531320 1308 1278 --144 11335
NM_002382chr1421307 155 --2344 170 --
NM_002390chr1751647 1594 1284 829 131 22077 1900 --1275
NM_002401chr1792374 2218 1971 1901 1755 1697 879 861 223 11763 --1459
NM_002430chr2242200 1891 779 653 1916 1705 --
NM_002442chr121189 --21566 1324 --
NM_002479chr11115 1488 1306 --
NM_002480chr121291 ----1396
NM_002481chr157682 6496 5896 5507 856 --46826 5924 5518 1977 --
NM_002499chr151153 --22312 214 --
NM_002501chr19114052 3898 3870 3652 1146 985 831 630 613 607 549 --21493 1390 --
NM_002507chr1761876 1599 1584 1528 1402 1268 --1118 --
NM_002515chr1411539 ------
NM_002519chr11----1160 --
NM_002524chr121030 379 --1122 1141
NM_002547chrX3587 356 237 11273 2760 112 --
NM_002556chr1131525 1508 771 --1432 --
NM_002558chr1761118 353 288 232 185 179 --1742 11145
NM_002572chr11----136 --
NM_002576chr111832 --11048 --
NM_002577chr342573 1135 523 443 23521 1613 1503 --
NM_002588chr551568 382 207 130 55 --11363 11704
NM_002594chr2042427 805 130 43 2707 205 12082 --
NM_002607chr711010 11041 1243 --
NM_002616chr171112 --1368 --
NM_002634chr171287 181 ----
NM_002648chr62928 58 --21072 72 1947
NM_002651chr12558 211 ----1674
NM_002693chr15239 29 161 ----
NM_002699chr151087 1044 953 586 270 --31506 1364 1077 --
NM_002717chr82490 162 ------
NM_002734chr1712212 --1113 --
NM_002740chr3----1996 1196
NM_002742chr14----1215 --
NM_002753chr41546 --1821 1847
NM_002829chr92970 940 --1851 --
NM_002840chr13594 275 42 --2263 60 --
NM_002843chr1143046 2694 700 640 1541 --22270 1233
NM_002849chr122930 106 --2168 81 --
NM_002867chr1--2497 81 ----
NM_002868chr1242273 2212 1748 138 1116 --11956
NM_002898chr12--165 --1567
NM_002903chr17----1336 --
NM_002906chr111152 --1775 --
NM_002911chr1931531 1105 413 --11304 1653
NM_002942chr31325 11339 2976 941 --
NM_003011chr931426 309 283 11327 --11383
NM_003042chr34847 511 409 333 ------
NM_003047chr141020 516 303 71 --1158 --
NM_003075chr12----1124 --
NM_003081chr20----2149 50 --
NM_003091chr20130 --1199 --
NM_003099chr15115858 5535 5268 5101 4727 4313 1269 1135 1001 774 528 --21195 974 1175
NM_003107chr632428 565 342 1196 1383 --
NM_003108chr297199 6309 6176 5101 2917 2878 2659 2604 853 --45640 2813 1961 1833 15388
NM_003110chr172879 151 1365 1215 --
NM_003131chr64840 647 619 599 --1537 --
NM_003146chr111124 ----1342
NM_003150chr1732182 1915 309 --1940 --
NM_003173chrX41204 1197 1046 477 1128 ----
NM_003178chr32660 562 12017 1154 --
NM_003202chr561741 1315 1190 718 696 60 1126 123 --
NM_003214chr621007 573 --21389 1222 11055
NM_003216chr2293046 2957 2910 2470 2393 2343 642 148 60 22807 499 32971 1021 530 --
NM_003221chr673954 2599 1657 1047 1025 798 645 12566 33074 2644 1645 1822
NM_003244chr18----1124 --
NM_003250chr171321 ------
NM_003255chr1792489 2316 1826 1013 947 759 279 140 68 1509 12363 2537 473
NM_003290chr19275 43 --1223 --
NM_003337chr521754 1283 21712 1348 1485 --
NM_003340chr4190 ------
NM_003367chr191450 ------
NM_003371chr911317 2603 469 175 --
NM_003392chr353604 2649 1141 1092 431 21346 32 ----
NM_003405chr22----2533 210 --
NM_003406chr831593 1566 1227 21380 317 11887 --
NM_003453chr131653 ------
NM_003463chr633131 2693 2667 ----1103
NM_003466chr292377 1631 1558 1532 966 887 850 474 393 --2977 867 --
NM_003482chr1242625 2170 1994 240 1380 --11111
NM_003655chr173276 161 79 --1711 1754
NM_003670chr331111 943 353 --1220 1453
NM_003673chr17122 ----1167
NM_003722chr322649 2124 --193 11672
NM_003737chr11----2361 130 --
NM_003822chr132643 576 21 --11972 --
NM_003861chr1432344 857 142 1867 12165 --
NM_003884chr31573 ----11878
NM_003888chr1511115 11607 21302 1150 175
NM_003947chr33342 237 197 11213 ----
NM_003955chr1751205 546 534 223 110 --1295 --
NM_003958chr633558 3514 656 1527 13166 --
NM_003988chr1062160 1845 826 117 103 38 1883 1845 --
NM_004050chr1462653 2468 2344 2330 1999 1979 12372 11874 --
NM_004082chr23224 127 108 ------
NM_004093chr1331076 620 203 --12568 --
NM_004117chr641810 1398 895 546 --1144 --
NM_004171chr1189016 8009 6786 5949 3324 2283 1693 146 23863 2332 23592 290 --
NM_004172chr5----11272 11542
NM_004183chr11--1681 ----
NM_004187chrX4949 940 920 557 --1188 11105
NM_004205chr11148 ------
NM_004228chr19----1120 --
NM_004230chr1922165 426 --12349 --
NM_004232chr1823414 3056 --1848 --
NM_004235chr91747 ----1125
NM_004241chr10188 --1173 --
NM_004274chr1412064 --11220 11090
NM_004293chr943324 2745 2675 2401 21258 819 23839 1511 --
NM_004311chr1052990 2853 1188 1091 106 12087 --32693 2214 812
NM_004331chr81929 --12482 12707
NM_004379chr21651 --1357 --
NM_004393chr362239 2095 1800 1679 736 363 ----1576
NM_004395chr54502 293 146 95 ------
NM_004397chr1164101 3751 1388 1338 1300 71 1796 ----
NM_004423chr362662 2402 2332 2075 914 22 42216 2088 653 34 32715 1082 389 --
NM_004427chr16997 456 334 284 253 112 1163 1812 --
NM_004440chr621774 684 --1271 --
NM_004441chr3----1515 1301
NM_004451chr111535 ----1548
NM_004454chr331507 571 506 ----146
NM_004481chr151690 1012 816 509 282 --2698 638 --
NM_004514chr17103070 2805 2613 2475 2312 1956 1948 1901 1895 244 --22680 1880 --
NM_004615chrX1119 ------
NM_004637chr331235 1113 240 --1887 --
NM_004654chrY122 --11174 --
NM_004714chr191331 167 ----
NM_004717chr721243 236 1262 171 --
NM_004730chr521789 222 11525 21926 1517 --
NM_004734chr1322203 90 1843 32920 72 29 --
NM_004736chr131892 373 126 ----11880
NM_004758chr172383 95 1769 2754 181 --
NM_004772chr541368 1270 599 584 11166 1346 --
NM_004774chr1711169 --12096 --
NM_004783chr162147 113 1599 1120 --
NM_004786chr18----149 --
NM_004798chr20103504 3099 1285 1260 1145 713 372 326 287 104 1568 ----
NM_004822chr1751570 1505 1487 302 279 --43069 1033 628 550 --
NM_004922chr103966 255 205 --1661 2773 40
NM_004926chr1421580 210 ------
NM_004930chr13486 183 75 1212 ----
NM_004932chr51298 ----1178
NM_004934chr5136 --1122 --
NM_004991chr31353 ----1311
NM_004992chrX258164 8084 7656 7459 6971 6931 6781 6493 5822 5741 5529 5257 3046 2813 2638 2552 2331 2234 1807 1672 1489 1345 1163 648 263 47953 2142 1154 1002 56352 2975 437 428 91 13180
NM_004993chr1421378 1345 --1330 --
NM_004999chr624512 1518 1913 ----
NM_005017chr3----157 --
NM_005022chr17131 ------
NM_005029chr102278 87 --1232 --
NM_005045chr72933 50 ----1722
NM_005053chr19--1177 1149 --
NM_005065chr1414145 21662 919 24538 3572 --
NM_005105chr131763 1525 343 ------
NM_005110chr54801 733 543 114 --1277 1134
NM_005116chr2053814 1427 561 259 52 --34605 1710 316 --
NM_005121chr1722913 1129 12705 --12350
NM_005146chr114306 260 213 132 1732 153 --
NM_005156chr945275 3570 3376 3348 33653 3520 3428 14739 --
NM_005168chr221417 1297 ------
NM_005206chr171339 --1893 --
NM_005229chrX152 --1988 1191
NM_005230chr121248 --1478 --
NM_005233chr341761 1044 725 101 --21032 586 --
NM_005238chr1142864 2545 2504 625 1743 ----
NM_005240chr12546 191 --2708 587 --
NM_005242chr5--1994 1145 --
NM_005266chr131518 378 109 --21192 212 1432
NM_005276chr1251694 1519 1406 584 524 --21434 1161 --
NM_005277chr421721 1600 ----1215
NM_005312chr992364 2267 2086 1875 1003 539 394 380 170 --1861 154
NM_005386chr203573 106 45 --1834 --
NM_005407chr1441522 1369 519 52 --21531 272 --
NM_005412chr121397 1449 ----
NM_005417chr2041940 1326 753 271 1535 1228 11798
NM_005436chr1053377 2659 861 316 72 22592 1644 12922 --
NM_005461chr20--21314 535 --11664
NM_005465chr1180 ----11805
NM_005522chr711053 --41281 377 312 134 --
NM_005544chr21753 --1970 --
NM_005546chr522221 1708 1874 1549 --
NM_005552chr14----181 --
NM_005596chr944512 3884 2343 2188 --14941 --
NM_005604chr642171 664 79 35 --1409 --
NM_005789chr1731942 1892 518 11473 1594 --
NM_005832chr31300 --1106 --
NM_005834chrX139 177 1235 --
NM_005875chr3--1372 ----
NM_005885chr531630 1279 224 ----1429
NM_005902chr1554232 3693 3280 1754 1681 22944 1360 44639 3609 1301 454 --
NM_005909chr564301 3903 3549 2958 2905 1183 1815 23925 690 --
NM_005911chr26591 545 527 461 396 61 --21030 110 1580
NM_005920chr192988 2432 2357 1462 1183 1160 1002 266 80 1218 21174 871 --
NM_005924chr7121 --1826 1188
NM_005928chr15------1686
NM_005933chr1132239 931 695 --42758 844 135 89 --
NM_005941chr8--12694 1554 1188
NM_005964chr173380 178 129 ------
NM_005966chr222403 1707 ------
NM_006039chr171439 --2809 792 --
NM_006099chr11734 ----1899
NM_006106chr111916 --1419 --
NM_006141chr1621056 1046 11726 21087 854 12090
NM_006142chr11120 --1486 --
NM_006157chr11----1377 --
NM_006164chr21419 ----162
NM_006166chr12----1128 12620
NM_006176chr114736 590 319 163 1265 2635 28 --
NM_006185chr111227 ----198
NM_006187chr1272414 2216 2135 1068 306 260 174 ----22993 458
NM_006191chr124765 202 170 32 1950 1138 --
NM_006201chrX--1888 --1212
NM_006235chr1131814 695 28 ----1684
NM_006238chr681969 1861 1827 1683 1403 228 179 157 21530 1340 42031 1352 538 193 --
NM_006245chr64810 332 275 76 1764 ----
NM_006251chr522164 425 168 33348 745 612 --
NM_006252chr132486 2044 1440 --16309 16921
NM_006267chr2----1600 --
NM_006282chr2054684 1609 1417 152 30 --24637 4285 22934 888
NM_006328chr111495 ------
NM_006336chr971419 1385 1124 1116 552 482 401 --1272 --
NM_006350chr5----1244 --
NM_006352chr12650 327 ----1563
NM_006458chr111282 ------
NM_006516chr151512 503 434 172 120 133 ----
NM_006546chr1785612 5490 4083 4044 2423 1681 765 63 22094 1040 86274 6016 4863 4152 4094 1548 1135 276 14200
NM_006614chr312635 ----1579
NM_006622chr5------1367
NM_006668chr142383 168 1123 ----
NM_006690chr2082080 2069 2042 1685 854 345 267 75 32184 2027 861 12282 1396
NM_006691chr112437 51 --1229 --
NM_006699chr122521 993 --1576 12484
NM_006717chr91796 12351 23297 1067 --
NM_006772chr641576 1084 694 320 --21545 1308 --
NM_006775chr6----21208 431 --
NM_006777chrX22933 2458 12471 12419 21969 1176
NM_006791chr15----1165 --
NM_006801chr191117 1650 ----
NM_006803chr822086 118 ------
NM_006814chr203826 546 31 22448 435 3260 239 179 1202
NM_006851chr1222957 251 --12282 1904
NM_006852chr1731023 722 193 --1588 11894
NM_006856chr1221136 1027 --1361 --
NM_006875chrX2861 767 1300 1186 --
NM_006885chr1621383 95 --1969 --
NM_006892chr2011077 --2367 128 --
NM_006930chr531858 1230 203 11422 11779 --
NM_006951chr101155 ----1629
NM_006981chr932919 2335 456 1597 32808 904 118 --
NM_006997chr10174 ----1313
NM_007011chr15195836 5068 5030 5014 4991 4874 4626 4578 4528 4221 2491 2375 2216 2146 1110 490 462 173 160 16524 --26058 830
NM_007026chr173438 64 50 ------
NM_007034chr1------1359
NM_007040chr195883 744 159 42 21 --2722 389 --
NM_007050chr20198047 7687 7143 6812 6328 5896 5648 5602 5098 2797 2300 2022 1842 751 540 417 369 215 91 22576 293 25627 1681 11035
NM_007067chr1721207 144 --11435 --
NM_007100chr4----150 --
NM_007124chr641300 99 91 74 ----11738
NM_007146chr1742805 2787 2185 582 --12666 1815
NM_007162chr61470 --2510 377 --
NM_007181chr19--139 ----
NM_007189chr74439 246 118 31 ------
NM_007212chr11356 --1907 --
NM_007232chr205975 736 360 240 90 1709 ----
NM_007245chr164620 362 129 110 ----1189
NM_007245chr164620 362 129 110 ----1189
NM_007249chr1388124 7160 6957 6903 3565 1510 1322 1198 12401 ----
NM_007271chr641326 436 395 373 ----183
NM_007286chr592114 2094 1750 1729 1510 1392 629 572 125 1177 --11984
NM_007294chr1731183 1160 1034 --181 --
NM_007371chr91458 --1639 --
NM_012166chr931100 1018 153 ----11196
NM_012180chr41117 --1534 --
NM_012189chr181537 ------
NM_012193chr1185220 5088 4803 3689 3674 2048 1623 1284 14471 24369 1907 12157
NM_012199chr1104607 4112 3634 3129 2950 2898 2842 1606 1430 599 --13100 13611
NM_012231chr141885 1714 1173 280 21790 1524 2459 355 --
NM_012244chr1441158 751 553 495 --11503 1735
NM_012249chr232853 2335 742 21097 1001 32457 1363 826 --
NM_012261chr202465 35 ------
NM_012282chrX1260 ------
NM_012290chr21152 142 11679 --
NM_012297chr432247 739 424 ------
NM_012300chr531959 662 186 --22073 211 --
NM_012306chr12153538 3448 3167 3112 3008 2378 2317 1259 1158 1119 712 675 264 72 52 22253 739 33518 3508 3304 11272
NM_012307chr181809 --177 --
NM_012308chr1172012 967 802 712 574 190 118 21814 297 11989 --
NM_012309chr11104057 3594 3543 1637 1225 1132 949 840 343 314 44227 4114 1489 526 24168 3352 1413
NM_012325chr2011291 1424 11106 --
NM_012395chr722124 122 11287 21377 1163 --
NM_013230chrY------1429
NM_013233chr221277 967 11229 ----
NM_013247chr22493 26 --1554 --
NM_013261chr433013 1378 434 ----13400
NM_013279chr1172299 2105 1695 843 516 498 104 21527 631 ----
NM_013281chr20----11197 --
NM_013316chr7----180 --
NM_013444chrX1997 ------
NM_013960chr8----2254 86 --
NM_014007chr93513 324 143 11253 1988 --
NM_014016chr3----1346 --
NM_014023chr1062109 1916 1050 865 509 372 ----12234
NM_014112chr854618 3757 3674 3464 1857 --11222 14979
NM_014117chr1632567 1966 843 1447 42554 2507 1781 980 --
NM_014154chr341358 602 591 252 --1475 --
NM_014181chr231158 1140 856 ----12387
NM_014183chr20----1260 --
NM_014232chr173497 435 250 --11252 --
NM_014289chrX1268 --1425 --
NM_014294chr821229 1128 --11381 --
NM_014297chr19--124 1107 --
NM_014331chr446330 4846 2623 501 15905 17535 --
NM_014352chr112295 276 ----11024
NM_014400chr193444 391 138 178 1476 --
NM_014423chr531871 1261 1070 14631 --34585 4304 328
NM_014445chr31562 --11937 --
NM_014452chr61287 21073 974 ----
NM_014454chr61190 --1914 --
NM_014469chr11----1222 --
NM_014488chr114612 119 94 87 ------
NM_014494chr1621845 492 --1956 --
NM_014515chr12----11074 --
NM_014554chr124680 630 293 46 187 ----
NM_014562chr2----1681 --
NM_014575chr31490 --1429 --
NM_014601chr1971278 1202 622 561 526 42 34 1396 ----
NM_014636chr931237 923 834 1756 11098 --
NM_014647chr1611445 2567 353 1711 --
NM_014661chr1083750 1426 1250 1203 1180 550 473 213 --43935 3294 1271 112 --
NM_014665chr893324 3199 3098 2581 2426 1216 877 808 465 1922 22793 1160 --
NM_014686chr1952355 2140 656 329 161 12526 --12564
NM_014705chr741829 764 732 705 --21902 105 --
NM_014742chr2051251 704 514 450 397 --1256 --
NM_014748chr2----1379 --
NM_014751chr82685 120 --11680 --
NM_014757chr521906 128 --21720 712 22159 1666
NM_014766chr773475 3398 3193 2932 898 609 590 1676 33521 2735 790 33354 2388 1373
NM_014771chr162382 180 --2884 286 --
NM_014795chr2--1105 124 --
NM_014806chr92330 139 ------
NM_014810chr142554 2342 1358 1100 1793 ----
NM_014868chr121115 --1186 --
NM_014877chr1787694 7055 6866 5641 4703 1699 1664 900 26158 2490 195 22883 2856
NM_014897chr1741978 916 903 118 --1538 --
NM_014904chr1023671 405 13928 --13795
NM_014906chr1763368 3136 1604 1501 1448 1163 --130 --
NM_014908chr9----1154 --
NM_014909chr1483837 3828 3194 3086 2525 772 746 155 1162 53970 3654 2966 2938 2476 1710
NM_014926chr32173 77 ------
NM_014931chr191707 --1662 --
NM_014932chr3----1708 --
NM_014936chr6--1856 1459 --
NM_014947chr142957 2090 723 629 1786 2861 525 1230
NM_014952chr1571522 1479 711 490 446 244 163 1534 ----
NM_014977chr14------1435
NM_014978chr102695 377 11569 11321 --
NM_014990chr14--130 --1834
NM_014994chr1552323 1509 1469 752 145 11900 1362 --
NM_015015chr1941875 742 673 657 --1261 --
NM_015023chr191714 1542 1421 1237 1169 1147 629 611 437 11816 1458 --
NM_015026chr1254596 1482 682 584 184 154 24741 863 --
NM_015033chr972531 2511 2154 2142 305 248 152 162 --13287
NM_015037chr101107 ------
NM_015042chr1583710 3470 2707 1616 1341 737 340 34 --33969 3670 2827 --
NM_015044chr1653145 3073 2484 828 694 2600 431 --22276 719
NM_015059chr1573928 3219 3008 2660 1428 735 352 1795 31553 865 596 --
NM_015063chr1921269 519 ----1490
NM_015064chr1243254 2609 2333 231 --32223 1374 164 12451
NM_015071chr584786 4565 4545 2469 2249 1888 900 148 24670 1101 25202 1541 --
NM_015074chr194287 3796 1770 1675 1668 1515 910 355 156 14155 31404 860 148 --
NM_015075chrX41569 400 278 106 21869 729 32084 2072 2046 --
NM_015076chr63358 162 46 ----21425 715
NM_015077chr17124288 4156 4031 3337 1668 1506 967 913 818 792 475 123 13298 53993 3531 3130 592 68 14360
NM_015086chr122970 242 --21586 1216 --
NM_015090chr185729 5721 4438 4305 1124 749 713 652 35804 3842 1375 11381 11367
NM_015092chr1633193 676 648 --24583 4320 --
NM_015111chr562991 2905 2622 1181 1071 234 11104 52676 2523 1377 1019 484 13670
NM_015206chr1523368 825 --12750 13740
NM_015284chr141882 1513 517 474 --41809 1568 564 336 --
NM_015288chr561075 963 844 566 281 214 23819 697 22999 2750 23783 2589
NM_015293chr6----2495 279 --
NM_015299chr1493711 3696 3269 2834 709 413 303 281 38 --63916 3553 3427 2719 917 426 1194
NM_015305chr1451748 288 260 131 26 --1763 --
NM_015315chr532922 400 235 1560 --1989
NM_015344chr821367 126 ------
NM_015349chr652760 2229 2088 682 648 ------
NM_015355chr172586 403 --21531 1290 --
NM_015388chr6----1233 --
NM_015460chr322081 1932 2255 217 ----
NM_015477chr151862 --1676 --
NM_015481chr123857 439 416 167 ----
NM_015488chr251514 1180 1171 1127 346 --11428 --
NM_015508chr311010 11370 11241 --
NM_015520chr352736 1007 635 528 407 12150 ----
NM_015526chr191464 11077 ----
NM_015530chr22726 341 ----1604
NM_015531chr11------145
NM_015534chr11152 --1126 --
NM_015635chr911426 ------
NM_015638chr203641 98 79 --1509 --
NM_015686chrX82332 1965 1917 791 397 166 76 45 --152 1254
NM_015831chr74882 664 371 99 --1913 1680
NM_015855chr111363 2770 269 1574 --
NM_015872chr151407 1183 600 278 183 ------
NM_015912chr851937 1853 1650 1007 99 --31774 857 300 --
NM_015926chr3------1266
NM_015995chr15105239 5174 4997 4955 2205 2094 1842 1711 1296 927 130 13390 15419
NM_016009chr163951 3298 3202 3172 1960 253 14565 --11514
NM_016019chr7----135 --
NM_016035chr93280 67 48 1418 ----
NM_016131chr211974 ----11659
NM_016138chr1611561 11165 --11471
NM_016147chr117870 268 230 221 206 116 36 --1258 --
NM_016154chr19------1261
NM_016169chr10102671 2621 2490 2439 2271 2178 1287 1106 977 46 --1452 --
NM_016201chr34895 781 715 499 --2904 325 --
NM_016250chr14----1184 --
NM_016271chr181736 --11725 --
NM_016275chr311718 ----1458
NM_016284chr163667 378 86 --1952 --
NM_016320chr112823 56 --2359 272 1705
NM_016436chr2052531 2042 2014 464 58 --1782 --
NM_016441chr22910 715 --11530 --
NM_016453chr32247 31 --1670 --
NM_016484chrX3714 552 185 --1165 --
NM_016530chr1543854 2497 1248 1073 --13994 --
NM_016545chr12719 625 ------
NM_016577chr374070 3322 2733 1492 581 54 23 23357 691 23075 69 --
NM_016578chr11------146
NM_016588chr6151 1642 ----
NM_016605chr582534 2170 1946 1742 898 599 487 115 ----11974
NM_016607chrX41197 541 512 483 --1294 --
NM_017409chr12133 1179 1783 --
NM_017410chr123783 435 144 --11062 --
NM_017415chr594207 3804 3176 1328 908 816 666 188 125 13389 23130 2858 13533
NM_017450chr1741323 1156 996 924 --282 40 --
NM_017633chr633230 2427 130 1336 12942 --
NM_017637chr967856 7715 7399 7095 5903 654 --39209 6192 6033 28065 33
NM_017643chr1762076 1235 972 872 460 123 ----12174
NM_017666chrX51851 1382 231 138 53 ----1126
NM_017668chr161141 1733 1550 1115
NM_017670chr111331 --2828 263 --
NM_017693chr13----11260 --
NM_017744chr141700 662 308 140 --1777 --
NM_017754chr6104811 4795 4535 4309 3878 3192 3173 1973 926 350 13943 2641 435 --
NM_017789chr2--2799 573 --148
NM_017799chr1421525 733 21724 1684 --141
NM_017811chr952445 2356 1911 629 161 12000 22872 128 --
NM_017848chrX54508 4330 4161 3538 349 11144 ----
NM_017849chr263169 2750 2621 2223 1037 441 22796 174 42651 876 75 54 --
NM_017893chr1041026 275 238 221 --21446 1232 11140
NM_017902chr10175579 5437 4660 4322 4191 3828 3798 3779 3768 3639 1839 1662 1556 1170 776 551 368 21670 405 21313 1206 --
NM_018028chr192521 33 1919 1503 --
NM_018045chr172708 2628 2289 1897 761 118 81 12743 2696 29 --
NM_018061chr1----21373 103 --
NM_018110chr162962 528 11241 ----
NM_018116chr1----1464 --
NM_018133chr311991 1844 192 --
NM_018214chr6285 65 --1368 --
NM_018327chr2021273 488 1112 --11216
NM_018362chr111963 12766 ----
NM_018440chr867226 7130 6959 5962 5728 5605 --37108 6893 1295 16721
NM_018566chr123598 1355 --1790 --
NM_018674chr22122 73 1130 2560 506 1554
NM_018710chr8----11109 --
NM_018717chr442905 2610 2073 727 --12093 --
NM_018719chr71363 --21267 335 --
NM_018841chr153592 1160 1016 976 543 23477 847 258 21 --
NM_018896chr174235 199 118 87 --156 --
NM_018898chr542089 2051 284 80 --1135 --
NM_018958chr1562879 2542 1212 854 608 171 --33254 2896 1187 13699
NM_018975chr161507 ------
NM_018977chrX3764 430 34 --1293 --
NM_018979chr1271981 1947 765 749 443 365 237 12075 1638 --
NM_019004chr71155 --1140 --
NM_019008chr2253673 3199 3147 231 214 --13277 --
NM_019046chr10----1230 --
NM_019049chr1----1580 --
NM_019098chr8------139
NM_019116chr16133334 3055 2976 2875 2433 2339 2301 2293 813 643 630 561 219 --1201 2917 720
NM_019605chr11184 --152 --
NM_019884chr19----2534 82 --
NM_020123chr10----1297 --
NM_020142chr121595 2179 133 ----
NM_020150chr1022110 1982 --3547 96 61 --
NM_020168chr1551250 908 471 414 408 ------
NM_020177chr532998 1275 1268 1118 --13280
NM_020205chr123374 3255 ------
NM_020225chr4--1360 ----
NM_020310chr176598 325 280 274 262 75 1883 1694 --
NM_020336chr2022684 1524 1192 ----
NM_020337chr411991 --1274 --
NM_020357chr321309 575 1400 ----
NM_020362chr12746 83 --1833 --
NM_020390chr31270 ----13797
NM_020428chr193953 304 68 --2801 294 --
NM_020429chr742634 2243 330 60 22147 179 12379 --
NM_020647chr832262 1838 191 --11887 --
NM_020699chr131949 1570 1316 13430 34285 3974 1802 --
NM_020703chr1------1432
NM_020706chr211142 ------
NM_020708chr208943 775 741 719 418 411 397 48 12460 2605 202 1863
NM_020764chr1631303 230 178 --1896 1964
NM_020778chr15164666 3892 3845 3830 3751 3191 3041 1358 1154 839 769 674 665 312 228 144 11177 ----
NM_020795chr1731258 587 409 --21943 1808 --
NM_020801chr541969 1784 1665 370 ------
NM_020836chr14294 35 ------
NM_020899chr1792459 2375 1774 1660 777 437 348 329 202 --168 32195 593 255
NM_020920chr14--1160 ----
NM_020946chr94355 216 193 69 --1383 11272
NM_020988chr162916 407 --1371 --
NM_021003chr14----1754 --
NM_021136chr141682 --159 --
NM_021155chr1972487 2362 1974 998 983 476 32 1527 22202 2066 --
NM_021183chrX21563 724 --12260 --
NM_021189chr131084 887 112 1426 ----
NM_021643chr21642 21635 1444 ----
NM_021813chr665206 4841 2318 2202 1357 391 24962 1250 21825 1750 13589
NM_021908chr73575 307 39 --1828 --
NM_021914chr14--21855 1793 --140
NM_021943chr652013 1972 1834 1824 670 ----1384
NM_021947chr17--11352 1468 --
NM_021961chr1157378 4646 1960 1586 1099 --11595 --
NM_021970chr4------1252
NM_021973chr42537 185 ------
NM_021998chrX11344 ------
NM_022048chr1545501 5219 4841 2557 --34221 1077 62 --
NM_022058chr211426 --1376 --
NM_022064chr3----175 --
NM_022114chr173875 3866 3761 3726 3512 3152 1085 13201 --14541
NM_022143chr711309 --11352 --
NM_022169chr114440 346 185 128 1159 1240 --
NM_022361chr6----188 --
NM_022465chr1282706 2487 2461 1167 1132 1040 509 428 11032 32498 2070 402 --
NM_022469chr132894 631 109 --12314 12706
NM_022477chr2041626 1587 635 275 11386 ----
NM_022481chr5----175 --
NM_022552chr211216 --1250 1904
NM_022574chr742168 2095 2049 81 11638 51733 1367 862 698 594 --
NM_022739chr1731226 862 746 --1447 --
NM_022748chr732875 2573 143 --12353 11811
NM_022749chr851113 1076 557 380 107 ------
NM_022756chr141226 322 110 46 ----126
NM_022780chr23595 565 168 --11747 --
NM_022823chr21478 ------
NM_022841chr15----11846 --
NM_022893chr22965 440 ------
NM_022912chr232090 1976 861 ----1648
NM_022918chr11----1195 --
NM_023009chr12255 139 --1225 --
NM_023079chr173484 172 139 31717 1621 1317 1322 --
NM_024015chr17----1325 --
NM_024016chr173260 183 91 ------
NM_024090chr441402 1373 1175 745 11626 ----
NM_024345chr985640 5152 5035 4843 4353 4154 283 229 --26061 1213 --
NM_024411chr2031534 1277 427 --11183 --
NM_024496chr14----140 --
NM_024527chr192200 193 ------
NM_024541chr1041736 642 436 260 --11200 --
NM_024557chr111212 --1691 --
NM_024595chr1191 --1797 --
NM_024665chr344586 4259 3908 1060 1628 14665 13059
NM_024667chr1211474 --1685 --
NM_024674chr132338 825 618 12049 ----
NM_024676chr15938 543 508 345 187 --1214 --
NM_024771chr1161734 727 570 280 169 34 ------
NM_024834chr101307 1610 11639 --
NM_024854chr1221314 34 --11473 --
NM_024887chr18862 717 534 520 371 183 109 50 11499 11356 1406
NM_024939chr1651640 1145 373 149 93 --1238 1116
NM_024944chr2121298 1203 --2878 121 --
NM_025076chr2----1167 --
NM_025083chr1542007 1817 75 44 ----31962 1603 295
NM_025146chr322094 1802 --12637 --
NM_025160chr134117 2948 2734 --11563 --
NM_025182chr93723 422 155 ----1280
NM_025222chr352932 2199 732 354 252 1298 --1988
NM_025235chr103842 763 729 --21700 1428 11791
NM_030576chr1762357 1948 1668 1627 908 230 1681 42041 878 359 297 --
NM_030625chr1041628 1617 735 399 ----12014
NM_030647chr785456 4455 4401 4086 3974 2159 1426 646 11495 168 --
NM_030648chr484801 4725 4329 4309 3719 3380 1709 1509 11831 15181 --
NM_030650chr223697 3629 12857 1447 --
NM_030661chr751097 1078 469 365 248 11139 11582 --
NM_030761chr192620 2452 2433 2297 2094 2034 1896 1840 1792 21772 1662 11786 --
NM_030795chr8252 43 2465 89 ----
NM_030796chr72751 111 1226 22086 141 1618
NM_030809chr1232319 1960 614 1100 11794 --
NM_030912chr101355 --1284 --
NM_030913chr15788 525 499 305 267 ------
NM_030915chr241818 1700 907 795 1707 --12183
NM_030918chr1115015 4883 4788 4619 4374 4226 4148 4023 3804 1338 698 14712 24980 4903 24514 4495
NM_030981chr1131135 993 128 11128 ----
NM_031216chr18----31675 787 73 --
NM_031445chr252665 2127 731 575 250 22605 2411 21022 126 --
NM_031469chr633026 2792 822 --1872 1516
NM_031477chr164277 85 65 28 --1124 --
NM_031891chr18----1135 --
NM_031911chr432327 1755 1725 ------
NM_032017chr151378 1335 832 447 376 11747 2668 431 11427
NM_032160chr1842747 1420 1313 431 12702 11323 1544
NM_032207chr1931050 982 111 21019 852 158 --
NM_032208chr2127 1280 13432 --
NM_032217chr421120 960 2941 81 ----
NM_032233chr141813 --3844 316 168 --
NM_032246chr152536 455 ----1338
NM_032283chr181730 1382 722 667 567 466 411 176 41811 1279 1161 192 1657 --
NM_032298chr192135 36 --1179 --
NM_032420chr54561 277 258 233 ----151
NM_032431chr113739 213 117 2394 168 2387 81 --
NM_032434chr231361 349 272 124 2249 125 --
NM_032458chrX42956 949 647 287 12557 12134 --
NM_032512chrX1346 ------
NM_032536chr93255 152 22 1112 ----
NM_032538chr6102577 2117 1986 1911 979 901 746 660 509 394 12190 12593 21783 79
NM_032552chr951639 1334 774 248 105 1336 31854 1793 1363 11775
NM_032558chr911060 --11475 --
NM_032560chr14----1215 --
NM_032578chr102300 292 ----2500 103
NM_032603chr22748 713 1210 ----
NM_032632chr1441731 798 743 541 --21279 1239 --
NM_032689chr1941660 1406 1366 480 ----11359
NM_032801chr1142560 2205 2123 874 21954 1790 12169 11980
NM_032818chr941839 971 716 420 12462 21741 655 --
NM_032846chr142545 42 --11036 --
NM_032959chr76819 438 342 266 230 36 ----192
NM_033036chr1141664 417 396 161 1472 ----
NM_033088chr11532 2179 88 1589 --
NM_033129chr2081970 1809 1779 1476 1460 740 689 37 1271 --1769
NM_033141chr1431896 335 226 --21375 404 --
NM_033201chr164749 429 410 354 1436 188 --
NM_033224chr747913 910 267 198 --37354 6848 6581 --
NM_033225chr833070 2311 882 22293 2094 1574 --
NM_033312chr1----157 --
NM_033315chr1791990 1806 1635 1387 866 845 513 460 207 32117 653 476 1644 --
NM_033389chr17104688 4454 4232 3449 3345 3313 1694 805 520 407 21432 488 23436 1379 11553
NM_033426chr1432323 2015 1985 --22043 1948 --
NM_033449chr552118 2006 1322 861 333 1572 11511 11751
NM_033495chrX11016 ----1786
NM_033631chr1103879 3817 3750 3528 942 607 483 339 48 35 12698 33919 2396 696 --
NM_052832chr832563 719 25 ------
NM_052879chr1223781 2579 --13600 21371 1052
NM_052896chr172527 2077 1990 1956 422 80 58 --11935 --
NM_052905chr211242 --1156 --
NM_052910chr1331862 618 424 --21341 180 --
NM_052978chr143475 185 162 21202 293 11236 --
NM_053023chr1152633 2361 1304 252 191 3704 672 435 11022 --
NM_054035chr174748 642 358 261 --1179 --
NM_054114chr61307 --1102 --
NM_057161chr6179 --1351 --
NM_058175chr213799 261 215 1644 3615 73 62 1715
NM_078471chr1731205 446 225 11150 1332 --
NM_078483chr583737 3488 2808 2794 2531 2492 1122 659 23538 2899 23374 262 12906
NM_080546chr922175 1549 ------
NM_080738chr12663 549 --11747 --
NM_080836chr2054693 4082 3851 3461 1319 13471 34028 3569 1417 13882
NM_080867chr14----33535 3485 457 13682
NM_080927chr31784 --1265 11286
NM_101395chr2131365 907 71 12459 1297 31219 196 99
NM_101395chr2131365 907 71 12459 1297 31219 196 99
NM_133171chr203974 517 346 --11267 --
NM_133264chr1743592 3405 2809 1442 ----196
NM_133433chr5----1167 --
NM_138328chr1773219 2344 1202 732 700 493 352 12918 23030 2412 --
NM_138396chr122758 321 --1215 1299
NM_138434chr731354 1267 1093 11325 1111 --
NM_138462chr91380 ------
NM_138479chr152069 1978 1735 1678 21 21826 402 147 1132
NM_138689chr11--132 ----
NM_138693chr7------1354
NM_138775chr111590 --1263 --
NM_138966chr181218 ------
NM_139072chr2----1218 --
NM_139076chr4----11453 --
NM_139136chr121237 --1975 --
NM_139321chr2043714 3354 1491 1126 --21580 1014 13061
NM_144499chr341094 1023 997 130 --31173 879 347 --
NM_144582chr272364 2217 1765 1704 995 733 468 --12564 1900
NM_144642chr311033 11119 1123 --
NM_144664chr11----1952 --
NM_144723chr52718 622 ----1254
NM_144967chrX2794 118 --1235 --
NM_144982chr121262 --1132 --
NM_145207chr465299 5242 4510 4429 3355 1205 --24821 1974 --
NM_145260chr24585 557 283 200 ------
NM_145349chr1771831 1555 760 428 357 338 91 11522 1730 1367
NM_145800chrX----1236 --
NM_145805chr15280 42 1403 190 --
NM_145808chr732569 452 91 --1318 --
NM_145909chr61569 ----11230
NM_147161chr141031 972 445 347 --1792 --
NM_147202chr982497 2472 2236 1968 879 630 288 143 12417 12398 --
NM_152237chr2251143 494 221 214 136 --31252 1116 111 --
NM_152253chr22114105 4071 4059 3671 3239 2846 2733 677 458 225 79 33289 3078 1044 13649 23940 3124
NM_152272chr831050 908 323 1193 --1380
NM_152277chr521805 40 --21980 630 125
NM_152280chr153187 2943 2306 2272 975 --12742 --
NM_152341chr1661357 1350 1333 1227 473 86 199 1928 1216
NM_152344chr17----11001 --
NM_152345chr173938 352 258 --1453 --
NM_152398chr4----144 --
NM_152424chrX33681 3250 887 --14597 14661
NM_152450chr1521846 410 ----12120
NM_152470chr1853094 1510 941 892 856 23490 1160 13472 13032
NM_152520chr21995 21084 190 2865 814 --
NM_152608chr131950 898 560 1624 ----
NM_152694chrX2568 312 1142 ----
NM_152749chr75768 470 387 311 74 1300 --1121
NM_152753chr642097 556 459 205 --31950 1808 734 --
NM_152787chrX61412 708 463 440 423 283 11549 ----
NM_152860chr123263 114 55 21366 310 ----
NM_153029chr1693903 3475 3064 2901 2725 1388 1026 856 779 --14081 33319 2640 1622
NM_153035chr162736 2669 2282 2155 2127 435 1665 1552 --
NM_153207chr122691 287 12481 ----
NM_153261chr161441 ----11524
NM_153266chr112917 660 1940 --1285
NM_153350chr1631460 1073 512 --21119 375 --
NM_153371chr1331977 547 470 1767 ----
NM_153450chr11----1711 1556
NM_153487chr654762 3681 3314 1671 548 24076 3263 11060 --
NM_153689chr21640 ------
NM_153810chr1054448 4172 4156 1116 101 11686 2921 320 --
NM_171999chr181162 --1218 --
NM_172071chr136161 1493 611 47368 7348 7203 35 16768 --
NM_172115chr4122 --150 --
NM_173462chr1451738 1271 175 124 77 --1281 11633
NM_173475chr1631591 1567 590 ----11758
NM_173495chrX42356 834 751 468 1444 21589 514 --
NM_173525chr11185 ------
NM_173588chr11177 2379 29 ----
NM_173595chr12144689 4615 4492 3924 3806 1884 1444 1181 1157 1031 827 668 303 273 45335 4330 4301 1905 24634 323 --
NM_173681chr7101920 1583 805 769 754 653 364 305 177 80 31901 1444 686 --1125
NM_173698chrX21806 1625 --139 --
NM_173808chr163613 3054 2723 1116 579 235 --1399 --
NM_174937chr10----1173 --
NM_175058chr111536 ------
NM_175575chr1741195 1135 875 310 11026 ----
NM_175607chr311111 11059 --11652
NM_175736chr12156330 4996 4942 4919 4836 2768 2395 2266 2053 1987 1909 1856 393 125 102 37131 4744 189 37815 2573 1872 26440 4796
NM_175854chr131705 --1535 --
NM_175856chr5----1650 --
NM_175898chr155467 366 259 251 230 --2281 76 --
NM_177424chr131820 740 236 ------
NM_177999chr982681 2453 2439 1133 744 545 168 135 23283 226 12844 13493
NM_181077chr1541717 932 455 347 1187 1734 --
NM_181358chr133715 1135 673 12628 11104 13439
NM_181504chr543589 1115 770 68 --1870 --
NM_181571chr1011127 ----1267
NM_181656chr172406 79 1889 170 --
NM_182481chr212823 816 --11030 --
NM_182485chr432702 2687 509 --1823 --
NM_182488chr131217 --1254 --
NM_182501chr262970 2703 2020 1003 831 685 11186 13020 --
NM_182509chr1451665 1493 1395 601 409 --21657 135 --
NM_182565chr171504 --1710 --
NM_182970chr2064112 3895 3153 3052 102 22 --43752 3357 3223 537 1496
NM_194250chr21320 ------
NM_194286chr1254863 3955 3847 1952 1190 44302 2064 683 102 15756 16237
NM_198256chr251973 1494 1395 264 107 ------
NM_198402chr3------175
NM_198513chr841598 808 356 54 133 --1260
NM_198859chr323510 3197 1726 --11279
NM_198904chr522075 1577 ------
NM_198988chr192114 78 ------
NM_199000chr7--1746 11800 --
NM_199141chr19----2868 117 --
NM_199181chr20----1225 --
NM_199334chr172491 409 ----1134
NM_199461chr1021269 1051 23062 1182 22407 684 --
NM_203394chr1242617 1778 429 197 --1399 --
NM_207387chr172704 113 11310 127 --
NM_207497chr651326 1070 1051 922 300 ------
NM_207645chr112345 22 --1511 --
NM_212467chr1582437 2279 1962 1827 972 473 349 330 22256 429 ----
NM_213589chr255342 5071 822 775 612 ----11518