TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-924
miRNA Sequence: AGAGUCUUGUGAUGUCUUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000041chr19------1129
NM_000052chrX42958 929 844 364 23458 2902 ----
NM_000084chrX65700 2775 2126 779 282 247 ----31586 1016 514
NM_000092chr254366 3863 3068 1452 100 --24497 57 11141
NM_000109chrX52615 2110 1696 999 398 --1588 --
NM_000125chr643984 1112 639 211 23787 666 --24098 1533
NM_000129chr681315 1157 1134 1119 956 487 378 116 11043 1371 --
NM_000138chr151839 --1695 --
NM_000141chr1031124 336 155 ----1282
NM_000176chr553499 2583 1074 899 388 13548 1166 --
NM_000217chr1295024 3849 3697 2026 1612 1591 585 417 116 --13420 2273 52
NM_000222chr42405 301 11352 --11565
NM_000252chrX31469 1260 1215 --11172 --
NM_000259chr15116155 5713 5187 5130 4203 1951 1818 1584 1542 1445 181 1762 --11524
NM_000264chr942634 817 709 36 ----12496
NM_000266chrX4714 671 120 69 2975 241 2724 144 --
NM_000318chr862563 2337 1083 400 336 327 ------
NM_000332chr676660 4671 2527 2220 1825 1061 162 22568 1780 15352 26119 5636
NM_000362chr2273402 2988 2934 2674 2243 840 800 1499 --1738
NM_000368chr964063 4003 3277 1599 1214 513 33578 3421 3415 24492 990 --
NM_000393chr252037 694 561 476 91 ------
NM_000408chr233384 2837 1045 12199 --1943
NM_000411chr2142481 924 527 181 12061 23046 2146 --
NM_000441chr722057 130 179 22235 1913 --
NM_000447chr11184 --195 --
NM_000461chr364433 4415 3531 2838 1201 783 23364 802 2467 312 --
NM_000484chr211289 1948 1879 --
NM_000489chrX32509 2486 368 23279 3189 12400 12156
NM_000495chrX2796 359 ----1160
NM_000599chr2104547 4171 3970 3758 3348 3282 3204 3121 1808 1483 --34161 963 822 --
NM_000615chr1162255 2156 1124 661 593 434 12186 22393 1092 --
NM_000618chr1286081 5014 4621 4525 4386 2610 2168 1154 11226 22380 585 11354
NM_000783chr101424 129 1214 --
NM_000793chr14154477 4395 4227 4220 4187 4091 3968 3881 3869 3773 3645 2062 1661 1596 725 24790 4322 14626 1339
NM_000801chr20--1854 --1282
NM_000813chr5115649 5472 4445 2101 1228 1214 654 500 70 35 29 43444 2089 998 568 44655 4597 2075 525 21650 322
NM_000814chr1553162 3153 1137 1046 547 --128 --
NM_000816chr5----1663 --
NM_000838chr63822 711 582 1601 12512 --
NM_000855chr111299 --123 --
NM_000875chr1564704 4584 4553 1521 1142 560 25327 1018 16161 12321
NM_000891chr1743055 2964 2273 152 22905 1018 22309 367 --
NM_000933chr2041640 1614 693 126 ----132
NM_000961chr2063868 3652 3198 1479 602 140 --33980 1518 781 --
NM_000963chr142051 1922 1767 178 --1156 --
NM_001001323chr1222496 2019 12908 --188
NM_001001481chr8103224 3195 2959 2669 2151 862 778 645 574 117 --11272 --
NM_001001664chr253749 2667 1499 694 288 ----13999
NM_001001890chr2143667 3600 908 368 11084 1310 11547
NM_001002860chr1474093 3697 1528 1066 1050 784 368 ----24406 3871
NM_001003652chr1867089 6955 5507 2338 500 227 27803 2657 15706 2238 33
NM_001003760chr633440 2938 2239 ----1493
NM_001003810chr42739 602 ----164
NM_001004419chr1234271 3062 296 14125 24017 593 23738 1187
NM_001005404chr1784280 3388 3343 2828 1636 1219 1188 826 ------
NM_001005463chr1042554 2502 900 148 1427 1136 --
NM_001005609chrX53565 3497 2519 2466 373 33298 3158 1337 33628 3101 57 --
NM_001005739chr21757 1258 --1665
NM_001007094chr1074129 3936 2785 1726 904 824 806 11586 14505 13535
NM_001007237chr152247 901 737 120 46 --1468 1544
NM_001007527chr56724 601 595 511 255 198 ------
NM_001008239chr1833793 2547 393 --11303 --
NM_001008391chr111629 ------
NM_001008539chr843411 2029 986 557 --34829 4042 1547 --
NM_001008660chr1131553 1287 226 --2974 393 --
NM_001008701chr1973122 2761 2510 1057 535 313 156 ----13037
NM_001009554chr494269 3540 1666 1544 1400 1221 898 556 98 1944 ----
NM_001009899chr331896 667 330 --26010 5835 12355
NM_001009909chr1163970 3744 3139 2839 1353 1296 11088 1152 --
NM_001009959chr262006 1937 1658 716 464 341 --12393 --
NM_001010861chr172653 2085 2054 2045 1949 1760 623 12269 22613 886 --
NM_001010862chrX102817 1145 1022 888 857 810 681 514 333 34 22909 995 12640 --
NM_001010891chr5106835 6619 5981 4745 2143 1971 1669 1595 1240 320 --25546 107 11320
NM_001011666chr796548 6496 5854 5780 5557 5137 1133 634 116 15086 24792 98 12376
NM_001011713chr142249 189 ----11377
NM_001011885chr152116 55 --1522 --
NM_001012393chr1194804 4634 4559 3618 3606 3279 3198 1139 52 --15066 11834
NM_001012753chr1941226 1074 813 375 ----51021 937 499 231 147
NM_001012761chr522184 779 11839 --12546
NM_001013031chr1053409 2560 883 529 372 12375 11254 12879
NM_001014434chr1----187 --
NM_001014797chr10138112 7426 6836 6422 6262 5317 5170 3205 2898 1387 961 637 482 17617 --27165 7002
NM_001017440chr7147777 7374 6976 6840 5778 2735 2478 1787 1750 1647 1182 629 421 65 27690 6002 46512 6333 5059 2924 --
NM_001018089chr1553971 3646 2787 1422 1384 22442 672 ----
NM_001018108chr1532119 2045 486 2387 366 21849 1458 --
NM_001024401chr1621953 383 ----12396
NM_001024460chr6140 --1980 168
NM_001024599chr12255 165 --147 11318
NM_001024647chr12106660 6420 5669 5663 5551 2845 2478 1761 1611 485 --1103 --
NM_001024649chr532852 2648 127 --11136 12590
NM_001024666chrX3245 126 90 149 ----
NM_001024680chr241439 1213 598 413 1403 --1377
NM_001024948chr143223 2129 1122 108 11377 13210 --
NM_001025068chr341440 1295 401 105 11123 190 --
NM_001025076chr1085737 5116 5019 4816 4168 2317 362 273 11766 26108 4884 --
NM_001025077chr10117095 6474 6377 6174 5526 1720 1631 1366 1309 1291 694 --27466 6242 --
NM_001025105chr5----2574 549 1622
NM_001025266chr354757 3371 1534 1064 382 --23576 606 --
NM_001025356chr12--2784 496 ----
NM_001025580chrX83991 3290 3249 3126 3070 976 810 733 --22799 2640 --
NM_001029875chr542290 2250 1023 982 21884 202 11842 --
NM_001030007chr1673563 3045 2628 988 571 336 173 --21345 756 --
NM_001030055chr1474735 4454 3804 3434 1382 1073 967 23349 1423 11429 --
NM_001031695chr2234125 4013 226 --24604 4419 24903 896
NM_001031804chr1643742 3543 2808 698 --23178 944 33398 3154 1062
NM_001033506chr11------1148
NM_001033518chr792603 2206 2198 1134 718 487 134 112 56 22766 1928 ----
NM_001033925chr10----12040 --
NM_001034850chr531336 1116 516 1623 11456 --
NM_001035511chr1------12201
NM_001035chr151074 809 298 195 188 11237 ----
NM_001039348chr21797 ----1175
NM_001039538chr273322 3011 2377 1216 1139 679 314 13283 23406 1465 1514
NM_001039570chr22114487 4373 3207 1845 1031 938 688 514 89 48 22 22981 225 23693 1623 --
NM_001039577chr1144372 3979 3937 2827 2803 1812 1783 1350 827 733 673 504 88 75 11776 22795 873 --
NM_001039590chrX104019 4000 3348 3015 2547 1547 964 908 522 32 23922 303 --13679
NM_001039618chr1185199 4665 4005 1873 890 521 447 244 25358 4641 ----
NM_001039802chr131230 1187 77 --11217 --
NM_001039840chrX35222 4427 4230 14539 1554 11497
NM_001040057chr711275 11104 ----
NM_001040152chr7105144 4780 4514 4409 3129 1880 1865 1692 1644 204 188 ----
NM_001040429chr1363412 2731 2453 792 753 119 11041 12833 2994 868
NM_001040613chr82384 186 --21153 297 --
NM_001040613chr82384 186 --21153 297 --
NM_001040633chr72199 162 ----1181
NM_001040665chr774041 3817 1139 666 485 400 394 --11801 --
NM_001042404chr141630 807 682 638 --11447 --
NM_001042413chr963514 2618 2560 884 232 148 ----1631
NM_001042437chr2----1242 --
NM_001042510chr812091 --22011 1955 --
NM_001042537chrX42504 2298 663 644 1608 22021 1919 --
NM_001042555chr1223763 638 2707 416 ----
NM_001042599chr286013 5659 3121 2440 1834 1398 1211 180 --12825 16247
NM_001042603chr1254645 4340 2091 1137 158 --35386 4911 4176 --
NM_001042604chr374735 4081 3189 3064 3029 1379 168 11596 24888 4647 12968
NM_001044305chr631675 1564 1216 ----11635
NM_001083621chr184122 3534 3165 3094 3041 1762 1745 820 --11707 --
NM_001092chr1762085 2076 628 112 76 68 --11938 22103 878
NM_001100108chr1107327 6400 5679 3246 3117 3078 2480 965 345 57 15397 16571 197
NM_001106chr3149106 8388 8356 8275 7951 7484 7414 6408 3592 3412 3261 1714 685 438 130 39149 8924 1191 16420
NM_001121chr1011639 1165 --1532
NM_001127chr221789 --1953 --
NM_001167chrX106350 6281 4780 4553 2453 2432 2308 1350 926 731 24754 2673 22524 1663 12426
NM_001174chrX52245 2070 1500 281 86 ----1515
NM_001177chr1231509 413 33 1420 11635 --
NM_001198chr652054 1647 787 515 322 --22215 430 --
NM_001200chr202861 231 --1119 --
NM_001204chr2107752 7690 7362 6929 5747 5095 4723 2529 1289 1155 15984 1129 --
NM_001206chr943176 2680 2541 368 --1647 1390
NM_001259chr755075 4890 3951 456 135 --15811 1517
NM_001292chr1521066 295 --1760 --
NM_001333chr9127 --1229 1210
NM_001343chr521564 631 ------
NM_001356chrX42375 2144 1696 876 --1211 --
NM_001364chr11114362 4032 3835 3673 3088 1608 1355 798 784 598 216 --23049 914 13922
NM_001390chr1863459 2592 2401 1392 1292 1211 --22507 281 --
NM_001396chr2162652 2474 2048 972 850 156 ------
NM_001419chr1974109 3996 3985 1550 1460 1071 320 --14500 --
NM_001455chr654692 3672 3559 1602 165 13243 11480 --
NM_001460chr153631 3175 2291 447 258 --22788 88 22650 990
NM_001463chr22601 207 ----147
NM_001482chr153870 833 386 ------
NM_001527chr684857 4490 1815 1232 901 717 608 572 33492 3427 415 2651 77 --
NM_001627chr321649 509 ------
NM_001650chr1854038 2537 1651 724 296 1710 33068 2945 32 --
NM_001679chr3------1726
NM_001699chr1931813 1323 1230 1295 71557 1369 1339 1288 1268 1246 264 21534 1212
NM_001718chr641373 1175 144 102 1978 21293 1259 --
NM_001769chr122306 44 ------
NM_001800chr19----1585 --
NM_001819chr20------1299
NM_001854chr1----11321 --
NM_001901chr6----2209 129 --
NM_001980chr1262248 2151 1399 692 359 243 32142 2122 37 11852 --
NM_001981chr161644 1517 666 606 167 115 ------
NM_001999chr561358 1321 187 170 132 74 127 ----
NM_002025chrX107839 6707 6393 3607 2208 1800 1749 623 348 244 32468 854 483 58510 7410 2299 2020 1483 13201
NM_002035chr1883404 3366 3019 2535 1145 1101 392 25 1748 13899 24044 607
NM_002039chr41695 1156 1663 --
NM_002040chr2133033 269 21 --1929 11180
NM_002056chr22585 202 --1245 --
NM_002126chr1733730 3247 3097 --22644 385 11073
NM_002129chr4----1139 --
NM_002141chr73480 272 245 1627 --1718
NM_002166chr21752 --1226 --
NM_002211chr10----2893 197 --
NM_002264chr384734 4420 3186 2015 1584 1493 709 391 --1339 14282
NM_002268chr33704 552 165 ------
NM_002270chr554981 1305 1136 1037 55 --13643 --
NM_002336chr1284747 4463 3843 3558 3490 1951 1209 945 --24122 3156 13677
NM_002375chr341569 1502 474 284 --11411 --
NM_002399chr1541399 1121 994 966 --2554 377 --
NM_002451chr953660 3450 1146 361 163 ----23798 440
NM_002487chr151812 --1559 --
NM_002556chr1142032 1885 800 376 11902 --1456
NM_002572chr11----1334 --
NM_002577chr341372 1219 774 712 --21442 757 12476
NM_002581chr983959 3679 2114 2067 1193 1175 796 637 24735 531 14659 1155
NM_002609chr511893 --1364 11807
NM_002645chr1142933 2917 1160 981 12141 21196 287 1826
NM_002655chr834530 993 661 --2563 243 13696
NM_002703chr421741 687 11623 ----
NM_002709chr242636 1350 1167 1151 13153 --1782
NM_002718chr342674 2027 499 178 12620 194 11785
NM_002719chr1452412 2178 2138 1855 1634 --31915 842 420 --
NM_002737chr1786192 5815 5537 2363 2236 1834 1594 1524 --25510 5361 15907
NM_002745chr2274521 3672 1596 816 434 383 28 --12828 21679 804
NM_002755chr151629 --1142 --
NM_002758chr172227 220 1447 1422 --
NM_002822chr1211510 --1652 1169
NM_002843chr1173308 3045 2997 2839 2624 2364 332 --1767 13446
NM_002844chr651402 1229 176 115 93 ------
NM_002851chr7----1180 --
NM_002886chr354800 4691 4425 4323 4061 24331 3477 21450 999 --
NM_002890chr51670 --1148 --
NM_002961chr1----1127 --
NM_002973chr12----1391 --
NM_003010chr1751844 842 364 117 21 21927 321 --1736
NM_003016chr17----21530 1513 --
NM_003026chr921238 998 ------
NM_003043chr394100 3674 3197 1215 942 840 672 482 56 22743 857 --13524
NM_003068chr821067 334 --1968 --
NM_003070chr91588 ----1227
NM_003106chr3----1973 --
NM_003108chr2116677 6308 6222 6175 6015 5236 5058 1911 1304 1277 1226 11494 27312 1022 24775 4761
NM_003127chr9------1123
NM_003142chr2----1225 --
NM_003202chr541820 1663 357 340 ----132
NM_003205chr1551838 1702 1561 288 63 --1886 --
NM_003206chr61157 ------
NM_003234chr332201 795 54 22374 782 --1663
NM_003246chr154646 556 137 25 2354 188 --1391
NM_003262chr375300 5153 4618 4382 2019 1512 1131 1956 1495 --
NM_003274chr212193 67 --12974 1946
NM_003340chr41318 ----2245 169
NM_003392chr324322 3568 --23511 255 13293
NM_003439chr7123174 2610 2475 2214 1134 963 640 585 558 355 318 210 --1862 --
NM_003463chr633191 2355 343 --1207 --
NM_003466chr251843 1586 1550 534 472 21912 1704 22130 204 144
NM_003482chr1252233 2083 917 885 418 --12558 --
NM_003507chr22311 211 --1225 11528
NM_003557chr121097 385 --133 --
NM_003583chr1243875 3021 1467 992 --23457 2553 --
NM_003590chr274056 4009 2935 2822 2800 2514 1535 --22969 1200 --
NM_003607chr184372 3725 3526 3323 2722 766 332 201 --24327 3686 --
NM_003624chr1921425 163 --1275 --
NM_003713chr12629 552 --11703 --
NM_003774chr1252259 1021 948 713 77 2814 305 ----
NM_003791chr163498 235 166 --3415 266 186 --
NM_003794chr32373 182 ------
NM_003861chr1451129 1095 1059 802 711 22360 696 1278 --
NM_003939chr1074182 4031 2968 1132 803 612 148 1997 --11117
NM_003941chr742203 1666 726 295 12431 22440 1659 --
NM_003955chr17----11467 --
NM_004048chr15------1460
NM_004061chr5----1142 --
NM_004065chrX1199 --3234 217 35 --
NM_004077chr1231337 982 250 --2408 150 189
NM_004080chr71499 ------
NM_004113chr341869 634 305 224 --1133 --
NM_004114chrX31116 977 244 ----11033
NM_004130chr3------1691
NM_004136chr151425 --1314 --
NM_004172chr541981 1799 459 127 ----11871
NM_004200chr1143225 2546 1190 606 12859 12680 2910 144
NM_004232chr1853064 2867 2515 2379 519 ------
NM_004267chr31495 185 1215 --
NM_004272chr54369 81 69 59 --11242 --
NM_004321chr243558 3532 2469 907 1315 21106 377 --
NM_004329chr1041188 414 396 105 --1276 --
NM_004397chr1163874 3850 2707 1407 868 165 --131 1117
NM_004430chr8----42447 1931 583 412 --
NM_004437chr193428 2658 2515 2351 1198 166 107 99 92 13478 22681 381 13595
NM_004438chr243040 2329 1125 830 ----32168 1050 458
NM_004447chr12--21082 88 1921 --
NM_004459chr1731707 787 683 11610 1106 --
NM_004496chr1431356 505 167 ----11028
NM_004498chr15------1149
NM_004501chr122834 429 33777 689 419 1459 --
NM_004504chr252622 2532 2184 2001 1975 --1722 --
NM_004514chr1763043 2942 2415 2082 492 340 1782 --1948
NM_004580chr1531763 1694 1507 ----2430 194
NM_004598chr522516 671 13254 2586 77 --
NM_004612chr944782 3734 1819 454 --11671 11108
NM_004654chrY21154 493 --21426 1231 --
NM_004660chrY41629 1479 536 517 ------
NM_004711chr222980 575 --23445 2456 13654
NM_004717chr751513 1228 553 538 464 ----1314
NM_004734chr1383200 2396 2190 2111 874 150 80 57 ----13009
NM_004744chr4103711 3515 3429 3348 2969 2843 2590 1306 353 175 ----33575 2710 363
NM_004779chr521335 1074 --2397 134 --
NM_004781chr111379 11294 149 --
NM_004787chr4--1118 1142 --
NM_004788chr1152201 2096 745 701 551 1486 22261 172 --
NM_004801chr221417 449 --2560 135 11043
NM_004824chr631172 512 128 ----1537
NM_004839chr15----1213 --
NM_004842chr61121 1701 ----
NM_004849chr631317 1226 483 --1140 1236
NM_004850chr24318 250 113 62 --11779 11121
NM_004852chr182013969 12952 12394 12349 12244 12188 10968 9643 8766 5367 5209 5149 4630 3554 3345 2975 2351 2252 1959 1643 15684 414288 11801 3034 430 --
NM_004857chr1454376 4125 904 866 147 11248 --13403
NM_004888chr91191 1174 ----
NM_004956chr7114454 4244 3352 3037 3025 2984 2833 1775 1476 682 420 14269 13367 11617
NM_004985chr1263764 3510 3305 947 806 251 13427 31795 1550 695 13140
NM_004992chrX97512 6890 6758 5740 5685 3045 1199 275 262 --26150 2637 --
NM_005022chr17----1239 --
NM_005057chr151816 1565 550 232 217 ------
NM_005065chr1494399 4091 3887 2092 2011 1781 1574 1376 1221 --14030 --
NM_005109chr362472 2133 1798 1669 920 35 ------
NM_005121chr1783266 3054 2763 2683 2376 1300 1275 1199 12454 ----
NM_005156chr994682 4626 4113 3941 2035 1858 1705 653 391 13836 12133 --
NM_005180chr101192 --1234 --
NM_005188chr11207940 7700 7579 7379 7231 6206 6180 5873 5483 5316 5294 5249 5117 3226 2696 2521 2356 414 334 147 17709 2489 342 18190
NM_005221chr7----1249 1111
NM_005233chr31990 --1383 11749
NM_005329chr1672014 1995 1955 1832 1799 815 498 --12378 --
NM_005388chr9----1237 11230
NM_005460chr5------1239
NM_005465chr171816 1585 1456 680 579 441 368 ------
NM_005504chr1256588 6223 2202 1126 661 --34778 4023 470 24723 2529
NM_005509chr521493 1270 ----11723
NM_005520chr5------1267
NM_005542chr741681 447 74 37 --11332 1343
NM_005578chr3105152 5141 5076 4930 4496 3888 967 801 644 225 11999 33636 3495 1112 --
NM_005596chr995939 4622 4200 4117 2313 2294 939 521 183 14590 1773 14523
NM_005603chr1841887 1476 183 68 --2477 60 --
NM_005607chr81818 ------
NM_005610chr13331 86 31 2317 198 ----
NM_005652chr1621217 973 --1812 --
NM_005667chr21449 --1284 --
NM_005668chr574292 4168 3469 3094 1134 449 56 --2664 482 --
NM_005721chr21865 --1296 --
NM_005730chr12103144 2966 2620 2578 2217 1016 1001 661 605 388 23544 2533 2399 321 --
NM_005737chr242152 945 641 175 11041 12218 1353
NM_005746chr73792 457 383 --12467 --
NM_005824chr71710 --1127 --
NM_005828chr1774929 4854 3962 3726 3504 852 228 1184 33226 1823 1761 13312
NM_005860chr1921295 162 ----21676 1155
NM_005880chr1611178 --1240 11554
NM_005909chr573485 3200 3040 1523 1206 778 704 ------
NM_005933chr1162348 987 786 577 436 281 ----22208 1105
NM_005941chr863961 3178 3150 3024 2751 1178 157 21262 323 --
NM_005999chr121532 399 ----164
NM_006015chr1----21353 281 --
NM_006047chr2033424 3112 1190 1505 31421 1301 720 1163
NM_006055chr233233 3162 1956 11176 21991 1233 --
NM_006139chr262272 1797 1088 707 390 171 --12540 --
NM_006186chr22791 323 --1467 --
NM_006265chr831227 612 527 --11075 1236
NM_006282chr20124276 3583 3353 1857 1664 1372 1212 1051 831 467 399 266 24153 1069 1350 --
NM_006283chr894111 4104 4040 4009 3928 3716 3201 843 715 34344 3112 1303 14194 11011
NM_006298chr642683 2539 2460 1326 43225 3083 2994 784 ----
NM_006371chr365128 4789 4129 3533 50 21 --13708 --
NM_006378chr941391 1272 1068 377 ------
NM_006379chr72877 577 1770 ----
NM_006449chr252110 1456 878 695 427 1451 ----
NM_006496chr1----1681 --
NM_006540chr841563 1024 436 430 11428 11434 --
NM_006544chr1442178 1558 1020 258 16081 25850 1802 --
NM_006547chr71708 ------
NM_006572chr1763446 2317 1414 1088 1062 195 13110 13394 --
NM_006599chr1687726 5971 5770 5218 2804 1576 452 319 13308 26376 5979 --
NM_006609chr232468 2015 325 11971 --12644
NM_006624chr1011811 12122 11709 --
NM_006710chr22400 280 ----125
NM_006744chr101204 --1197 --
NM_006750chr16106983 6481 6039 6005 2409 1934 1273 1052 794 640 26953 1196 26414 209 17757
NM_006751chr221030 1000 1210 1201 --
NM_006777chrX62596 2028 1065 937 924 809 11984 32235 1782 651 --
NM_006851chr1212537 1413 12723 22679 632
NM_006873chr253336 3059 2946 2745 829 ----12310
NM_006874chr4--2912 133 3462 298 93 --
NM_006877chr6------1362
NM_006885chr1634108 782 594 --11675 11642
NM_006914chr921426 579 ----176
NM_006981chr952133 2014 1953 1149 434 --32533 777 135 --
NM_007005chr951569 1477 1047 1029 307 --1564 --
NM_007084chr1321097 1086 11008 ----
NM_007106chr1352414 2085 2068 1095 372 ------
NM_007159chr311112 --1259 1534
NM_007212chr142096 367 167 25 ----32076 483 332
NM_007249chr13129171 7704 6676 6160 6133 5989 3625 3367 3286 2461 1190 1024 27765 6174 28078 7752 23237 1052
NM_007350chr1264161 3870 3315 2854 1219 38 --34277 3824 218 --
NM_007361chr141490 --2150 24 --
NM_007375chr192748 2710 2632 2525 2327 860 822 765 744 --21792 1009 --
NM_012081chr583581 3571 2853 2843 2785 2668 1135 76 23591 553 33666 2660 214 --
NM_012082chr8------1134
NM_012096chr3103733 3708 3463 3384 2699 2290 1147 775 662 147 12415 11420 --
NM_012104chr1173597 2619 2584 1346 525 157 29 11012 13659 13198
NM_012193chr11134844 4323 3885 3653 3488 3344 2047 2035 1972 1294 1201 303 190 23798 1772 11283 --
NM_012214chr2136289 6013 5698 5142 4715 4701 4019 2404 1529 1136 722 713 617 1841 26433 2370 --
NM_012215chr1031217 161 130 --11633 11269
NM_012257chr71829 ----164
NM_012287chr354233 4204 4072 3238 2935 --13812 14326
NM_012297chr44751 635 226 211 --11675 --
NM_012302chr11955 --2449 257 --
NM_012325chr2021564 344 11478 --193
NM_012329chr1741217 271 243 149 --1232 --
NM_012342chr101339 1171 ----
NM_012347chr652740 2200 1866 883 610 ----1464
NM_012399chr2251763 1678 1327 1227 552 ------
NM_012412chr72327 159 ------
NM_012414chr11705 --1338 --
NM_012417chr173568 482 85 --2623 207 --
NM_012419chr6------1233
NM_012425chr1052541 2244 1969 726 159 --32681 2458 686 11764
NM_012464chr432168 1072 360 12209 21088 257 --
NM_013231chr1464198 4143 3114 1525 730 41 2939 403 24310 786 --
NM_013236chr222951 91 ----1498
NM_013320chr12163 --1185 --
NM_013348chr1931326 289 274 11131 11044 1425
NM_013372chr1542384 606 389 74 --13001 13024
NM_013374chr333046 2920 1027 --23175 747 --
NM_013995chrX21985 735 12444 12633 --
NM_014011chr262217 2199 1773 847 473 214 1635 11945 --
NM_014016chr3----138 --
NM_014159chr32578 46 --1469 --
NM_014170chr3------126
NM_014212chr121746 1878 1273 --
NM_014246chr2262339 2216 1992 588 491 254 --11889 --
NM_014283chr121356 250 --130 --
NM_014294chr82508 488 --21154 1096 --
NM_014299chr1972198 2038 1591 574 239 198 46 11870 31639 613 101 1565
NM_014372chr131883 1587 326 ----11654
NM_014382chr321535 85 --21669 146 1140
NM_014423chr593793 2184 1917 1804 1728 1697 1569 260 197 --11447 1351
NM_014515chr1221042 274 --128 1357
NM_014517chr351847 1749 775 519 63 --1679 --
NM_014520chr17--1452 1443 --
NM_014572chr13----21596 1263 1183
NM_014606chr421133 528 ----11342
NM_014614chr2128 ----11025
NM_014636chr9124173 3492 3297 3143 2921 2886 2860 2721 1715 1425 804 646 1122 33449 1053 552 13517
NM_014637chr821024 556 11208 125 --
NM_014670chr221355 662 --21625 1285 --
NM_014673chr8------1215
NM_014702chr663361 2575 2155 1269 1123 796 ------
NM_014705chr722092 731 --2434 254 --
NM_014729chr811518 --1373 --
NM_014730chr1244238 3976 2096 1085 13687 34179 444 316 1505
NM_014766chr731020 967 314 1730 136 --
NM_014774chr143067 2836 2482 1103 22339 400 ----
NM_014782chrX----2364 25 --
NM_014802chr122378 321 181 1967 --
NM_014810chr172812 2341 2307 1325 699 187 123 13119 --11066
NM_014824chr1121661 150 2613 300 1395 --
NM_014877chr17107510 6790 6315 5187 4795 2511 2090 1785 817 146 ----17743
NM_014897chr17123282 3112 2814 1033 902 785 593 385 334 274 165 94 ------
NM_014905chr221890 573 --1418 --
NM_014912chr1043177 2919 2490 826 ----1437
NM_014917chr14987 812 279 185 --1937 --
NM_014918chr1541483 1276 393 137 --1127 --
NM_014926chr33926 291 244 ----11050
NM_014932chr341640 738 535 261 --161 2496 86
NM_014934chr1353918 3694 1395 1057 123 --33893 622 220 --
NM_014946chr262998 2606 2304 2212 2167 103 21227 161 12288 --
NM_014949chr1--1125 175 --
NM_014982chr1454965 4138 3319 1853 494 ----24723 3699
NM_014988chr432643 634 448 22110 896 21759 120 --
NM_014989chr631943 1740 557 11629 1832 --
NM_014992chr142891 221 ----1861
NM_014997chr762447 2143 2116 457 314 49 12852 --1701
NM_015000chr1262604 2494 2308 1926 874 153 ------
NM_015020chr1653481 2840 1377 1278 682 23344 991 --13811
NM_015025chr251973 1840 1671 849 480 --1129 1741
NM_015026chr1223573 207 24049 3662 2921 183 --
NM_015027chr165592 566 479 412 23 1557 11936 11452
NM_015054chr12----187 1422
NM_015061chr91906 ------
NM_015071chr586097 5526 5332 4564 4028 1400 1291 1284 1486 45904 5137 2357 251 --
NM_015074chr154623 4073 3435 3256 500 --54730 4187 4112 3565 1342 24138 3837
NM_015076chr684120 3559 3271 1746 1623 1298 153 45 --1186 --
NM_015090chr184662 3862 2424 2178 1221 1180 940 848 --26124 5555 11318
NM_015092chr16104662 4206 3811 3460 3180 1785 536 529 466 450 14154 23905 3104 --
NM_015101chr162326 2077 1139 1061 812 614 11983 12293 --
NM_015155chr1033370 3263 1238 --11287 --
NM_015156chr1453729 3439 1298 1207 982 23681 3118 12477 --
NM_015161chr1641114 1078 156 143 ----1493
NM_015170chr852249 2145 1586 1528 463 198 --1192
NM_015180chr142910 119 --1762 --
NM_015187chr41266 --1685 --
NM_015192chr204948 280 173 54 ----21114 676
NM_015199chr321926 1129 ----12339
NM_015231chr113671 55 48 ----1310
NM_015254chr852518 2511 1106 734 266 12262 33114 3095 2302 12535
NM_015275chr122861 678 1283 1174 12060
NM_015291chr153515 1135 1118 1106 36 ----174
NM_015310chr8107978 7442 6558 5698 5549 3338 2585 1752 725 714 27078 6237 27338 7046 --
NM_015313chr1154664 4658 4106 3927 3850 --24484 3785 --
NM_015328chr742377 1941 518 468 2978 330 1613 --
NM_015335chr1211758 --12570 --
NM_015336chr1222045 1742 ----12002
NM_015347chr12--22627 94 --22691 999
NM_015349chr643102 2778 2443 1093 1393 ----
NM_015359chr862703 2456 1975 911 847 67 1772 22953 1966 --
NM_015461chr182293 276 ------
NM_015464chr71274 126 --170
NM_015497chr1541121 1030 356 251 ------
NM_015526chr1971074 1048 546 526 264 211 88 ------
NM_015534chr11919 --185 --
NM_015550chr773415 2843 2662 1408 806 570 257 --1323 --
NM_015564chr593313 2980 2910 2745 2693 2528 2372 863 527 2436 125 12306 --
NM_015578chr1942045 1437 1326 834 ----1193
NM_015630chr22941 792 ----1420
NM_015651chr951961 678 665 206 63 ----12204
NM_015878chr811998 1761 ----
NM_015879chr18196567 6065 5584 5555 5458 5445 2882 2566 2554 2462 2337 2166 2086 1942 1306 662 412 315 206 25314 2441 ----
NM_015888chr172850 2735 2492 2420 2315 847 492 12322 13271 --
NM_015981chr563009 2470 2341 2313 2005 867 22744 1015 ----
NM_015995chr15105476 4989 4532 4524 4305 4297 3784 1295 1250 470 31619 1216 227 1806 --
NM_016059chr61854 --1832 --
NM_016072chr1262120 2007 1969 1929 1635 266 --11529 2355 23
NM_016083chr633785 1545 508 12605 1695 --
NM_016100chr20----2294 117 --
NM_016206chr3208962 8914 8489 8047 7833 7756 7546 6922 6733 6080 3606 3432 2528 2439 2339 1856 1450 1444 865 680 --38379 6330 3505 17300
NM_016224chr6----12074 --
NM_016271chr1822154 556 --21736 1574 --
NM_016293chr12------1410
NM_016322chr962381 1137 1077 927 334 233 --13080 --
NM_016374chr131479 1470 580 --21597 565 --
NM_016424chr1741697 1556 1542 228 --11788 --
NM_016436chr2032700 843 219 --32420 1984 545 --
NM_016577chr374220 3967 3252 2975 1647 1254 246 21404 1398 --14510
NM_016620chr121253 498 1309 2373 352 --
NM_016952chr1143482 2816 737 435 --11492 23220 1285
NM_017420chr141128 12756 23083 1457 12508
NM_017423chr461805 1388 729 395 197 55 11607 ----
NM_017548chr362058 1667 1559 588 509 395 --11843 --
NM_017553chr1521172 901 --11152 --
NM_017613chr21----166 --
NM_017617chr921339 1056 --21537 298 1330
NM_017628chr4135220 5080 4914 4351 4291 4178 1728 1427 1393 1196 931 618 356 11000 24569 1475 133
NM_017634chr81546 11357 1556 --
NM_017635chr1111220 1998 --1256
NM_017637chr9159473 8436 8426 8114 7702 6973 6588 6557 6355 5986 2999 2666 2553 2222 1647 38944 2647 519 38602 7351 2529 15833
NM_017658chr1443813 3055 952 269 --23706 234 1127
NM_017660chr1963424 3264 3069 1142 501 455 1767 ----
NM_017676chr531853 1727 462 11687 ----
NM_017680chr9------139
NM_017693chr1361636 1578 1164 320 76 55 ----21356 595
NM_017736chr1662727 2588 1173 1024 874 266 1729 32861 2635 2606 --
NM_017752chrX1486 ------
NM_017754chr674612 4457 3872 3131 1679 1537 564 11625 33542 3475 418 --
NM_017772chr611115 --1420 21290 297
NM_017778chr831481 56 37 --1156 --
NM_017799chr1451958 1721 732 651 290 1703 11783 --
NM_017847chr142110 1903 1710 463 21867 1582 ----
NM_017848chrX84466 3291 3279 3133 2987 1546 832 228 2825 178 43537 1717 1680 1670 1399
NM_017864chr8--1214 1165 --
NM_017915chr123447 389 368 1837 ----
NM_017919chr9135105 4991 4616 3948 3546 1746 1580 1340 1311 1095 337 303 241 2665 575 34913 2006 1915 24700 1214
NM_018013chr632917 2396 747 21901 1155 12981 2918 358
NM_018018chr12----1112 --
NM_018036chr1422761 863 --13375 1260
NM_018121chr1043147 2552 2100 580 ------
NM_018159chrX61623 1358 1161 577 289 205 ------
NM_018227chr462235 1178 835 797 693 408 12797 ----
NM_018254chr132241 784 267 --1359 --
NM_018287chr1021282 1025 --1411 1369
NM_018293chr342346 2099 567 182 12832 1802 --
NM_018364chr151325 1264 1054 388 304 --33836 3291 3051 --
NM_018374chr754978 4396 4070 3590 3256 1793 1417 --
NM_018403chr3103966 3916 3016 2780 2590 722 678 340 314 293 1125 ----
NM_018424chr921492 348 ----1220
NM_018440chr898571 7745 7624 7127 3411 1035 835 461 435 --16411 27250 1268
NM_018444chr871712 1589 849 785 719 634 400 11581 1923 --
NM_018557chr241321 649 485 388 --11481 --
NM_018566chr143613 3395 1049 158 24534 3852 34668 3821 52 --
NM_018638chr1245613 3860 1564 402 23650 2112 12145 --
NM_018710chr831394 1238 476 --2529 126 --
NM_018712chr111277 --1465 --
NM_018718chr762339 1923 1862 1818 436 223 21482 528 1918 11619
NM_018970chr732743 655 457 --1421 --
NM_018992chr1651340 1274 1240 1137 624 11427 --11575
NM_019087chr561477 1307 415 128 85 23 21425 1132 --2358 348
NM_020122chr295964 5957 5265 4965 4075 1832 1484 1308 1234 25894 1354 55598 3764 2377 2147 253 --
NM_020130chr841236 379 165 69 --41353 892 188 123 --
NM_020198chr171414 --1432 --
NM_020311chr21785 ------
NM_020336chr2063883 3261 2960 2725 1272 298 --1165 1441
NM_020342chr222094 229 --1263 1685
NM_020386chr32120 100 ------
NM_020390chr364391 3884 1679 937 740 673 14370 ----
NM_020466chr674775 4700 4574 4259 1161 946 834 1607 21439 1380 --
NM_020474chr1851539 397 240 216 147 1471 1717 --
NM_020640chr362246 1886 1460 769 658 446 ------
NM_020644chr112780 713 ----1122
NM_020648chr1842762 929 848 717 --32434 2151 116 --
NM_020673chr20157614 6720 6441 6311 4807 3048 2977 2786 1503 1206 919 510 312 158 23 26465 1032 17497 --
NM_020682chr1021123 1097 --1380 1832
NM_020689chr2051285 597 390 282 151 125 --1369
NM_020699chr154315 3743 3427 1140 1033 35349 1796 1102 13494 --
NM_020708chr2042502 1797 1775 585 ------
NM_020718chr1684850 1786 1501 1189 930 912 891 418 14682 34886 4537 844 --
NM_020752chr1022740 193 --22293 1105 1871
NM_020772chr1795488 3371 3096 2793 2282 921 229 199 68 32770 1674 328 25414 2202 18115
NM_020794chr111011 --1539 --
NM_020796chr522203 536 1209 33017 739 271 --
NM_020801chr562580 2429 741 732 408 182 ------
NM_020805chr1861773 708 531 495 315 219 ------
NM_020839chr34564 447 289 267 --199 --
NM_020843chr15------1426
NM_020865chr3------1140
NM_020918chr1073443 3388 2413 1392 748 321 293 --13534 13339
NM_021064chr621625 1107 1598 2585 135 --
NM_021072chr572643 2103 1768 1062 577 278 49 --21629 695 --
NM_021090chr2274545 4126 4094 3548 1754 1592 1444 34580 1229 944 ----
NM_021144chr93515 164 151 1100 ----
NM_021190chr131266 995 880 ----11259
NM_021202chr2062957 2939 2196 2122 1106 651 22985 2015 11197 12168
NM_021255chr1473568 3124 3008 2579 1314 874 49 --1328 12750
NM_021638chr484781 3802 3749 3240 3136 1963 117 32 33662 3328 1363 1209 --
NM_021728chr141742 1110 ----
NM_021813chr685665 5542 4345 3841 2183 1606 1554 1153 14940 15186 13831
NM_021947chr1751235 1089 188 121 91 --1423 11304
NM_021961chr11116635 6431 6411 6401 5784 5398 5019 4548 2952 1684 1451 56665 1470 1439 1322 504 --11076
NM_021964chr396639 6206 2355 2297 2017 1977 1726 1319 1101 14195 46265 1931 618 287 15323
NM_021977chr683457 3140 1380 1044 784 692 501 458 ------
NM_022037chr2176 ----1130
NM_022048chr15136281 5269 4515 4479 4018 2224 1582 1544 1509 403 316 86 37 --26304 205 16148
NM_022459chr13116392 6181 5030 4949 4896 4735 1737 1308 1046 452 228 16238 24602 1424 --
NM_022730chr21991 1208 --1982
NM_022781chr943201 2482 1214 298 --22913 221 --
NM_022818chr1631337 1147 358 --11534 --
NM_022893chr212155 --12053 --
NM_022898chr1454725 4314 4071 3367 1352 1799 22999 1672 --
NM_022918chr1131798 1587 1467 --1216 --
NM_024007chr532905 988 870 --1362 --
NM_024015chr17--1782 --1226
NM_024052chr1763019 2281 709 683 534 119 11199 ----
NM_024090chr441615 384 325 304 --1695 1195
NM_024430chr1821280 434 --1103 1467
NM_024551chr1241996 864 678 485 --31569 833 507 11853
NM_024557chr1171607 1404 1219 1058 415 407 385 --2615 517 --
NM_024613chr8----170 --
NM_024631chr112158 98 --1491 --
NM_024646chr152500 1480 800 318 274 --13003 --
NM_024665chr364524 3498 3337 1623 1552 859 --11237 --
NM_024674chr163082 2926 2474 1129 1043 993 1387 12700 13252
NM_024686chr12513 482 ----1218
NM_024692chr241515 1341 1303 585 1254 1245 11278
NM_024769chr1151102 981 920 815 53 1140 11141 --
NM_024828chr931137 377 352 --1471 1120
NM_024887chr171475 1316 823 733 716 415 182 --12163 1604
NM_024947chr3139542 9089 8987 8673 8440 8266 8153 7690 7131 6406 2321 1688 1667 17119 1238 11919
NM_024953chr123929 762 125 --32459 1126 698 --
NM_024989chr2117365 7323 5692 5622 5203 5058 4964 2778 2597 713 619 27759 6990 36159 5047 263 --
NM_025054chr854061 3854 3375 603 115 --13543 --
NM_025133chr23753 102 70 11075 1225 --
NM_025134chr161148 ----1176
NM_025160chr174334 4243 4226 4008 1612 874 400 12756 11532 1938
NM_025182chr941063 933 847 729 ------
NM_025191chr173537 3236 2614 1251 674 421 275 --1957 12498
NM_030627chr52601 167 --23296 1625 --
NM_030647chr765083 4101 1628 1046 520 403 13848 45550 4790 4059 750 15264
NM_030650chr263696 3362 2958 994 958 405 ------
NM_030806chr1128492 7216 6811 6787 5962 5817 3735 3727 3613 2813 1632 915 22921 1708 13492 27651 6840
NM_030920chr131420 1291 637 1247 --11936
NM_031296chr442287 2176 1821 77 --1616 --
NM_031372chr43536 461 68 --1109 --
NM_031427chr1465718 5644 5347 1793 1422 1305 --2512 86 14888
NM_031445chr273327 3262 3040 2095 1054 653 574 12465 13351 --
NM_031483chr2053570 2205 1057 1048 387 --1565 12920
NM_031935chr14994 906 675 253 ------
NM_032172chr71973 1315 ----
NM_032299chr11------1258
NM_032434chr271334 1060 555 490 271 107 73 --185 --
NM_032445chr1532535 555 371 --2708 608 --
NM_032457chr423657 609 11348 23091 1115 --
NM_032505chr362646 2300 2173 1942 413 132 1903 1852 --
NM_032521chr2053252 3241 2014 298 44 ----12213
NM_032552chr941969 1219 350 99 11474 21919 1591 --
NM_032560chr1411036 1361 --1200
NM_032578chr1031498 614 66 11167 1204 --
NM_032804chr1042541 2038 796 615 1779 --1883
NM_032905chr102861 119 --21109 108 --
NM_032968chrX44042 1078 973 246 --14083 --
NM_032973chrY54034 3540 1078 973 246 --14075 --
NM_033132chr1331817 1676 104 --11780 --
NM_033143chr474047 3891 3542 3382 3276 1769 1116 1314 1266 21008 182
NM_033225chr842143 309 268 22 1510 22605 682 --
NM_033280chr18------1139
NM_033387chr952110 911 738 490 293 32090 67 30 12655 --
NM_033393chr441880 1175 288 47 --1368 --
NM_052906chr22105058 4512 4202 4099 2016 1927 1530 961 281 90 ------
NM_080617chr2041106 929 337 207 ----1263
NM_080738chr171778 1700 1643 1557 785 350 332 --1681 --
NM_080743chr61690 1412 --1751
NM_080867chr1474823 4667 4079 3992 3173 1995 1694 11754 34609 3378 1041 --
NM_080927chr331159 901 835 --12140 12464
NM_101395chr2163320 3142 2716 2174 824 512 --1310 --
NM_133264chr1793464 2915 1404 1171 1131 1080 436 192 130 --11269 13834
NM_133265chrX42697 2299 836 124 22394 926 ----
NM_133468chr762111 1988 1979 1832 934 72 --21665 24 --
NM_133474chr451439 1169 1112 391 181 --1267 --
NM_133477chr4103236 2276 2245 1293 1105 1056 1019 989 951 930 32229 2110 92 ----
NM_133646chr2105453 5427 5084 5064 4928 4603 4056 2146 951 274 14828 25587 1393 --
NM_138288chr1481765 1562 1556 563 516 459 197 121 11958 ----
NM_138357chr1011444 1275 ----
NM_138426chr751856 854 292 233 51 ----11876
NM_138444chr1374852 4722 4308 1160 849 546 407 11959 2987 559 14627
NM_138473chr1265146 4246 3962 3270 1527 406 --14682 --
NM_144571chr446483 6435 5239 4921 25538 4342 1138 14718
NM_144664chr1132609 2144 960 ----11728
NM_144772chr1------137
NM_144963chr852171 1080 881 615 431 --1657 12194
NM_145000chr5----186 --
NM_145176chr653145 2759 2603 873 568 --23114 1126 --
NM_145206chr1042816 2414 2358 217 --11289 12283
NM_145235chr10------1120
NM_145693chr242141 1614 700 565 --22609 1716 1497
NM_147156chr1021412 403 --1595 --
NM_152277chr532105 1674 579 1207 ----
NM_152373chr11114 --1542 --
NM_152390chr21173 --1511 --
NM_152402chr43504 196 184 1514 ----
NM_152450chr1551796 836 448 330 260 ----21367 660
NM_152475chr1962652 2144 1670 952 451 139 ----12753
NM_152542chr422049 440 --21612 295 --
NM_152574chr9--158 1280 --
NM_152613chr222915 819 --11035 129
NM_152624chr5167123 6886 6732 6423 6314 5861 5742 5503 5468 5371 5091 1759 950 804 703 516 --26522 6484 --
NM_152636chr1162701 2561 715 274 244 111 --1102 168
NM_152641chr1242717 2057 1857 722 22859 32 ----
NM_152758chr83796 291 48 12044 12590 --
NM_152787chrX53710 3630 3582 1204 73 1407 33953 3904 439 --
NM_152835chr122070 96 11937 1960 --
NM_152857chr61774 1884 127 195
NM_153207chr1263529 3319 703 296 249 183 11278 12803 --
NM_153226chr102977 796 --21180 1064 --
NM_153235chr652010 1852 658 315 158 1110 22128 331 --
NM_153262chr162384 2052 1148 1114 1061 820 --21981 1279 12710
NM_153346chrX21542 44 --11405 12002
NM_153347chr1162492 2183 2097 1790 499 266 21834 1733 --1458
NM_153607chr542857 2518 2120 752 --12498 --
NM_153704chr82394 135 ----128
NM_153825chr441215 1180 131 46 21171 1125 21375 79 --
NM_172071chr166326 5862 5308 5218 5203 2129 36715 6407 1137 17365 12535
NM_173039chr11157 --1204 --
NM_173075chr451866 1646 1354 1222 39 11173 ----
NM_173172chr231099 631 104 --1253 --
NM_173355chr2----2799 123 --
NM_173511chr253521 3507 3501 3291 290 --1483 13594
NM_173515chr61773 1363 1729 --
NM_173519chr81300 --2255 184 --
NM_173560chr62625 76 ----1484
NM_173570chr351637 1359 660 230 38 12139 --1647
NM_173602chr1243585 2723 2589 1305 ----1896
NM_173797chr52863 142 ----1440
NM_173808chr164033 3601 3131 2736 377 22 --13574 14380
NM_173814chr15286 33 --1388 --
NM_173829chr596081 4008 3977 3875 3851 1799 1351 771 566 14022 14442 11526
NM_174911chr863901 3459 3266 2963 1077 718 --23513 652 --
NM_175061chr71374 --2845 498 --
NM_175736chr1297741 7096 5705 4769 2174 1951 1425 872 852 45176 2929 571 534 16378 37493 6196 5808
NM_176814chr721360 1033 --2381 53 --
NM_178140chr552529 1980 1067 873 732 ----1538
NM_178313chr251692 821 459 424 235 11912 ----
NM_178423chr731002 912 462 1107 1190 --
NM_178505chr1033368 3125 309 --22318 1099 --
NM_178539chr1262136 1803 677 202 89 30 --1164 --
NM_178583chr41924 --123 --
NM_178815chr1062683 2011 1079 430 160 21 12130 22304 535 --
NM_178842chr1541682 809 237 228 ----1213
NM_181358chr163305 3195 2910 960 659 497 ----11148
NM_181504chr553683 791 681 380 180 14139 11206 --
NM_181670chr123967 543 101 --1192 --
NM_181672chrX41806 781 633 149 --11553 11949
NM_181705chr595014 4607 4433 3711 3689 2018 1807 1705 733 24566 4552 23550 1028 --
NM_181782chr652325 1666 1648 1576 37 --31993 226 159 11619
NM_182501chr253055 2307 2131 2061 1028 21232 281 1907 --
NM_182607chrX21736 1202 21643 686 --11692
NM_182765chr101610 --1521 2927 816
NM_182830chr1421393 263 12267 21580 97 131
NM_182976chr11697 1212 1649 --
NM_194282chr452277 2216 937 675 480 ------
NM_194286chr1285338 5179 4070 4040 1949 1791 1660 546 45727 4974 4554 3966 12335 --
NM_194314chr1105106 4427 3484 1909 1734 1323 1163 638 619 226 12008 --24462 454
NM_198467chr7183 ----157
NM_198503chr162069 2000 1778 1575 968 866 --12267 --
NM_198513chr83661 584 169 --1790 --
NM_198581chr287422 7142 6003 4957 4719 2958 2014 196 46275 4712 2618 2483 --16908
NM_198859chr3115078 4875 4828 3814 3772 3401 1792 1430 1159 390 226 --24445 3932 24194 492
NM_198904chr511445 21556 335 2742 663 --
NM_198990chr722510 1147 12715 31165 296 91 141
NM_199320chr481816 1142 906 717 483 440 295 240 12106 ----
NM_203446chr2142406 780 318 54 1597 --22147 104
NM_203459chr142380 2094 813 334 --2903 93 --
NM_206853chr633254 1370 1272 --23128 2937 --
NM_207303chr1064177 4110 3737 3594 1655 486 23766 2751 23307 334 13388
NM_207371chr101615 ----1249
NM_207429chr1132296 1871 360 3298 228 205 22152 215 --