TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-92a-1-5p
miRNA Sequence: AGGUUGGGAUCGGUUGCAAUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262289 1980 911 554 427 379 --22110 142 1152
NM_000037chr822525 2216 --3556 434 58 --
NM_000084chrX116912 6305 6147 4696 4263 2649 1811 1775 1097 898 347 36428 6041 1411 15191 14398
NM_000088chr1771165 1097 519 455 347 220 187 --21102 54 139
NM_000104chr232264 235 161 32287 1046 817 ----
NM_000118chr94698 598 260 121 1183 2737 647 1604
NM_000125chr663668 3600 3127 1301 1232 110 11542 14276 --
NM_000138chr1531916 1854 1729 1527 --173
NM_000168chr732652 2069 120 22952 2769 22810 2625 23280 2923
NM_000176chr552538 1391 941 836 691 --12799 --
NM_000208chr1944644 3758 2958 301 24362 4355 21418 444 --
NM_000217chr1244651 1220 789 739 1498 13675 --
NM_000237chr831845 1287 231 1540 1135 --
NM_000248chr342258 2032 628 448 --12363 --
NM_000259chr15105746 5378 5222 2455 2430 1289 1208 1128 1073 995 22218 228 --14491
NM_000304chr1731096 1013 296 ------
NM_000314chr1033033 364 139 ----13212
NM_000332chr696529 6226 4682 4599 2171 1649 613 537 124 36626 5625 889 16516 --
NM_000335chr341960 1817 267 84 21393 140 42081 1739 1614 634 --
NM_000337chr5106047 5468 5457 5431 4866 2655 1691 1242 905 325 12476 1685 --
NM_000345chr4------1841
NM_000346chr172532 250 2235 72 11927 --
NM_000351chrX83859 2996 2879 1321 1252 1113 167 156 --33840 3770 3753 --
NM_000367chr642130 1818 1542 529 1282 21508 412 --
NM_000368chr964351 3834 1799 1573 1303 1113 --21668 213 11692
NM_000369chr1451402 1365 725 87 71 --1601 --
NM_000376chr12112630 2464 2239 2158 2064 2009 1240 973 828 780 163 13109 31245 169 143 --
NM_000408chr252904 2250 2188 1204 1193 ------
NM_000430chr1743785 2546 1315 1166 11498 ----
NM_000445chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_000449chr1--31289 1087 552 ----
NM_000461chr353632 3440 3197 1794 1316 --21304 386 --
NM_000489chrX62960 2920 2901 1368 119 85 ------
NM_000522chr74914 856 260 224 11134 1238 --
NM_000533chrX41825 647 637 99 21754 45 1260 --
NM_000555chrX77175 7049 6360 5795 5215 2157 80 15771 37498 2607 500 17118
NM_000572chr14862 776 641 205 --2149 89 1693
NM_000575chr21976 1216 ----
NM_000599chr284092 4045 3301 1370 1271 809 417 169 23806 58 31405 404 45 23552 3277
NM_000609chr1082177 1230 1218 1193 1122 822 426 42 --32620 1986 600 --
NM_000612chr1183851 3769 3643 3214 3189 2505 313 275 23567 3520 ----
NM_000618chr1265990 5751 2472 575 160 135 21526 708 25180 5175 --
NM_000618chr1265990 5751 2472 575 160 135 21526 708 25180 5175 --
NM_000633chr1843691 3564 998 836 44924 3935 2018 305 1830 --
NM_000680chr8--1100 2417 143 --
NM_000719chr1296365 5783 4485 2270 2194 978 793 618 255 24161 963 45768 4463 587 471 36005 2599 672
NM_000726chr221155 948 167 ----
NM_000738chr113739 372 160 --2965 919 2944 890
NM_000793chr1464490 4333 4177 4048 3972 834 11623 13702 --
NM_000806chr5161 11379 ----
NM_000813chr545184 4176 884 324 25155 4648 ----
NM_000814chr1563951 3890 3583 3202 1294 891 11234 ----
NM_000827chr532404 877 834 1109 2447 48 --
NM_000829chr1162303 2296 2083 416 131 100 1638 ----
NM_000831chr186049 5814 5732 4118 3864 847 290 228 46184 5375 1616 1393 55887 5409 4287 4256 3894 14650
NM_000836chr197929 871 833 801 681 256 189 --3720 376 201 --
NM_000839chr32342 153 --1347 2361 324
NM_000868chrX11635 1394 22264 845 --
NM_000875chr1546078 5369 4407 1512 24566 435 56453 1587 962 875 863 --
NM_000899chr1223223 3206 24054 3938 14342 --
NM_000945chr22131 25 1153 --11738
NM_000961chr2093545 1498 1412 1332 1277 1196 478 253 69 1775 73373 1202 846 339 62 52 42 13078
NM_001001323chr1233083 2582 175 12804 ----
NM_001001331chr342206 2158 888 456 1295 21898 86 1311
NM_001001342chr1041478 1289 935 136 11066 ----
NM_001001396chr153819 3037 2869 1697 1646 1992 44266 3885 3077 1578 --
NM_001001419chr593559 1546 1460 1380 1327 1058 1025 443 293 ------
NM_001001420chr593559 1546 1460 1380 1327 1058 1025 443 293 ------
NM_001001433chr2043053 2322 2236 2161 --22412 2033 1868
NM_001001486chr32303 292 ------
NM_001001487chr32303 292 ------
NM_001001664chr233430 638 473 ------
NM_001001890chr2163910 2805 1456 1086 273 137 23024 2646 14197 --
NM_001001924chr831381 785 607 ------
NM_001001925chr831381 785 607 ------
NM_001001931chr831381 785 607 ------
NM_001002814chr8143905 3817 3801 3529 3273 3263 2509 1262 1176 1096 1041 982 810 534 190 ----
NM_001002838chrX21763 1172 21646 734 ----
NM_001003674chr1896482 6214 5030 4352 2057 1219 1200 748 736 35790 2673 433 12262 --
NM_001003675chr1896482 6214 5030 4352 2057 1219 1200 748 736 35790 2673 433 12262 --
NM_001003679chr1349 42 33 ------
NM_001003712chr12----13989 11537
NM_001003945chr951924 1685 1640 1567 137 --11840 11663
NM_001004023chr1------1178
NM_001004065chr931489 333 258 ----13649
NM_001004317chr624183 1132 14119 ----
NM_001004342chr1125556 5004 4611 4554 4112 4101 4020 2296 1694 1590 1243 555 --35539 3751 2357 --
NM_001004419chr1233981 3718 2792 11149 24044 3588 196
NM_001004441chr521393 1176 11142 ----
NM_001005404chr1744495 3522 1580 48 12820 24270 21 --
NM_001005473chr5126240 5768 5650 4989 4839 4564 4337 4068 1658 1417 431 327 ----14101
NM_001005502chr12174847 4277 3841 3749 3665 3610 3515 3424 1536 1450 1367 1312 1112 496 440 222 75 --21696 21 15114
NM_001005609chrX93723 3467 3288 2409 1524 1504 1425 1251 281 12333 33205 873 810 --
NM_001005732chr21--148 --1118
NM_001005733chr21--148 --1118
NM_001005746chr221155 948 167 ----
NM_001005747chr221155 948 167 ----
NM_001005920chr164844 191 152 125 1692 21064 102 1326
NM_001006623chr242284 1956 211 44 ------
NM_001006636chr23854 823 182 1776 1200 --
NM_001006641chr951607 1107 554 478 185 --31573 1363 535 --
NM_001006642chr951607 1107 554 478 185 --31573 1363 535 --
NM_001006643chr951607 1107 554 478 185 --31573 1363 535 --
NM_001006932chr683393 2968 1285 1030 796 377 200 22 --22739 2579 --
NM_001006938chrX3814 132 98 ----1202
NM_001007023chr1464490 4333 4177 4048 3972 834 11623 13702 --
NM_001007026chr12--1511 --1501
NM_001007097chr9104704 4692 3909 3605 3516 3467 1868 1835 1553 1113 24894 4221 34487 3596 3100 14589
NM_001007156chr1551860 1837 1266 389 378 2601 207 11535 1350
NM_001007257chr151418 955 195 135 56 ------
NM_001007794chr12682 148 ------
NM_001008220chr583598 3510 3489 756 399 376 367 237 23946 2716 2597 574 1342
NM_001008239chr18----23223 2419 13288
NM_001008392chr352858 2275 723 591 352 --22662 372 11302
NM_001008407chr781800 560 362 261 149 109 102 25 --1658 --
NM_001008408chr764725 4557 4315 2353 2342 1027 34836 2524 142 15759 21684 445
NM_001008491chr222055 1445 1349 --1262
NM_001008492chr222055 1445 1349 --1262
NM_001008495chr832162 2090 1826 ----11792
NM_001008701chr19102912 2856 2706 2554 2472 2416 2143 1008 677 161 1209 62956 2670 2488 2400 2173 735 12676
NM_001009899chr325590 5534 12425 ----
NM_001009955chr11163 --1126 1429
NM_001009955chr11163 --1126 1429
NM_001009993chr274186 3853 3195 1038 502 155 145 187 ----
NM_001010862chrX72956 2447 1139 1039 834 557 181 ----22868 605
NM_001010867chr1116406 5975 5957 5840 5643 4616 4530 4450 4395 1490 1367 16695 35222 2225 272 11587
NM_001010922chr153919 3871 3713 3278 1017 11619 24033 4028 13289
NM_001010942chr1241145 1115 74 52 ------
NM_001011666chr775643 5625 5592 4726 4461 2321 313 --11618 25961 760
NM_001012264chr144964 678 646 56 --121 --
NM_001012393chr1184154 4093 3850 3775 1776 1336 672 311 11000 11354 --
NM_001012426chr692789 2468 2413 2309 1063 874 712 502 445 13029 63349 2771 2399 1260 647 72 1286
NM_001012427chr692789 2468 2413 2309 1063 874 712 502 445 13029 63349 2771 2399 1260 647 72 1286
NM_001012755chrX33442 1104 148 24532 4430 31480 1409 1147 1142
NM_001013438chr3------141
NM_001013635chr12------21062 198
NM_001013693chr171983 970 931 914 896 778 711 --42305 2198 652 117 1842
NM_001013693chr171983 970 931 914 896 778 711 --42305 2198 652 117 1842
NM_001013843chr15------1830
NM_001014380chr1355482 4357 4112 2085 1921 34074 1293 953 ----
NM_001014797chr1056291 3145 2392 2357 2045 75731 1621 1482 863 107 72 63 18145 --
NM_001015887chr33499 446 327 11652 --11642
NM_001017395chr341373 1081 748 386 22458 1420 13365 --
NM_001017440chr7167840 7526 7341 5644 5585 5123 4988 2972 2834 2497 2014 1881 1097 739 438 402 27658 275 23063 2841 22178 982
NM_001017535chr12112630 2464 2239 2158 2064 2009 1240 973 828 780 163 13109 31245 169 143 --
NM_001017977chr11137 --1266 --
NM_001017999chr1----31737 1504 935 --
NM_001017999chr1----31737 1504 935 --
NM_001018000chr1----31737 1504 935 --
NM_001018000chr1----31737 1504 935 --
NM_001018001chr1----31737 1504 935 --
NM_001018065chr9105887 5843 3889 3685 2221 1657 1527 1080 315 201 32309 2137 510 12271 15763
NM_001018066chr9105887 5843 3889 3685 2221 1657 1527 1080 315 201 32309 2137 510 12271 15763
NM_001018067chr144282 3905 2102 395 ------
NM_001018068chr144282 3905 2102 395 ------
NM_001018069chr144282 3905 2102 395 ------
NM_001018074chr552538 1391 941 836 691 --12799 --
NM_001018075chr552538 1391 941 836 691 --12799 --
NM_001018076chr552538 1391 941 836 691 --12799 --
NM_001018077chr552538 1391 941 836 691 --12799 --
NM_001018111chr763694 3340 3239 1488 1193 158 150 31198 568 126 --
NM_001024024chr142665 97 ------
NM_001024070chr142661 93 ------
NM_001024094chr552538 1391 941 836 691 --12799 --
NM_001024401chr1652212 2205 1068 922 908 --52789 2172 2116 1883 965 1795
NM_001024455chrX4811 592 437 416 --1340 21848 189
NM_001024858chr1472662 2050 1898 943 618 502 233 22977 2317 32961 2639 2583 1352
NM_001024912chr1941800 93 73 56 11303 2428 349 --
NM_001025076chr1065166 4962 4379 2194 1775 1621 --25702 2015 --
NM_001025077chr1076524 6320 5737 2979 105 73 64 1539 17060 --
NM_001025079chr354147 3129 1045 435 224 ------
NM_001025108chr244076 932 520 51 2864 401 1713 186
NM_001025266chr364879 4517 2981 1493 895 676 23366 117 ----
NM_001025603chr1--31289 1087 552 ----
NM_001029858chr683186 2838 1351 1032 334 160 32 22 ------
NM_001029875chr532404 990 465 --12116 --
NM_001029883chr263006 2607 2140 1990 1012 70 22834 810 13176 --
NM_001030006chr1742217 1679 941 133 127 12137 --
NM_001030007chr1634049 3060 549 --188 --
NM_001030055chr1423897 701 14168 11484 14647
NM_001031680chr192371 2107 2077 767 645 571 467 135 42 21000 958 41785 664 623 425 --
NM_001031684chr211506 1101 --1946
NM_001032999chr20105281 5094 4692 4509 3337 2017 1962 1521 672 219 1819 33426 1692 533 --
NM_001033044chr151858 1646 1505 443 54 ------
NM_001033056chr151858 1646 1505 443 54 ------
NM_001033081chr161675 1261 623 352 246 185 11242 21323 408 --
NM_001033082chr161675 1261 623 352 246 185 11242 21323 408 --
NM_001033117chr374062 3082 1883 1861 835 633 262 1176 11667 1248
NM_001033506chr112124 82 139 ----
NM_001033551chr1773707 3476 3246 2684 1347 614 86 43756 2870 1465 1257 43426 3269 1607 284 --
NM_001033576chr1742565 2490 2334 862 22509 1000 ----
NM_001033910chr132111 1897 719 1786 ----
NM_001034837chr55728 527 192 162 95 1797 ----
NM_001034838chr55728 527 192 162 95 1797 ----
NM_001035003chr421106 26 ------
NM_001035004chr421106 26 ------
NM_001035521chr21214 ----1609
NM_001037339chr15694 649 394 326 69 1615 ----
NM_001037340chr15694 649 394 326 69 1615 ----
NM_001037341chr15694 649 394 326 69 1615 ----
NM_001037341chr15694 649 394 326 69 1615 ----
NM_001038702chr552286 1954 1023 799 288 ------
NM_001039395chr93994 961 429 --21893 1535 --
NM_001039538chr253538 2908 2789 2285 1469 --12807 --
NM_001039547chr3177540 7406 7279 6840 5730 5644 5564 5509 5422 5367 5147 2772 2217 2135 2087 2020 1218 46432 3144 633 267 --11909
NM_001039569chr273140 2974 2920 2590 2178 1162 1093 --1259 --
NM_001039570chr22113698 3404 2835 1603 1517 1383 1011 925 845 790 61 14186 13875 13860
NM_001039571chr22113698 3404 2835 1603 1517 1383 1011 925 845 790 61 14186 13875 13860
NM_001039590chrX33132 2884 57 --23225 2580 13683
NM_001039591chrX33132 2884 57 --23225 2580 13683
NM_001039618chr1145008 4838 582 171 ------
NM_001039690chr1662212 1809 1507 470 429 35 --4708 633 594 549 12238
NM_001039709chr20105281 5094 4692 4509 3337 2017 1962 1521 672 219 1819 33426 1692 533 --
NM_001039762chr1041939 1568 1495 315 ----11975
NM_001039840chrX34443 3885 1722 15695 14920 --
NM_001039888chr14666 632 619 525 --1587 1532
NM_001039937chr1354123 2616 1499 660 313 ------
NM_001040002chr1731253 187 144 --164 293 50
NM_001040100chr331060 890 325 ------
NM_001040108chr1431165 1038 826 ----1832
NM_001040144chr1662212 1809 1507 470 429 35 --4708 633 594 549 12238
NM_001040146chr1662212 1809 1507 470 429 35 --4708 633 594 549 12238
NM_001040152chr774817 3875 1918 1408 1066 742 386 21443 536 1962 --
NM_001040284chr1675753 5673 4878 4109 3617 1067 134 11667 ----
NM_001040402chr453164 3135 1100 969 483 12964 ----
NM_001040429chr1323070 785 ------
NM_001040439chr1671130 962 590 350 296 261 105 181 51208 1076 532 113 25 21228 46
NM_001040441chr1125173 5092 5037 4704 1882 1796 1717 1663 1028 942 862 809 11358 ----
NM_001040624chr852591 2527 1724 928 541 --1987 --
NM_001040625chr852591 2527 1724 928 541 --1987 --
NM_001040626chr852591 2527 1724 928 541 --1987 --
NM_001040627chr852591 2527 1724 928 541 --1987 --
NM_001040628chr852591 2527 1724 928 541 --1987 --
NM_001040629chr852591 2527 1724 928 541 --1987 --
NM_001040630chr852591 2527 1724 928 541 --1987 --
NM_001040712chr953345 3051 2292 1210 195 ----11159
NM_001042371chr1672100 2045 1854 1833 677 493 376 --11868 --
NM_001042404chr12686 555 ------
NM_001042413chr973113 2890 1647 1165 716 497 296 1546 --1104
NM_001042486chr2061521 1207 975 419 175 120 --31170 301 81 --
NM_001042494chr1593674 3655 3487 2665 2343 1523 1388 212 91 --12742 23749 2811
NM_001042495chr1593674 3655 3487 2665 2343 1523 1388 212 91 --12742 23749 2811
NM_001042496chr1593674 3655 3487 2665 2343 1523 1388 212 91 --12742 23749 2811
NM_001042497chr1593674 3655 3487 2665 2343 1523 1388 212 91 --12742 23749 2811
NM_001042533chr333109 2298 1277 12878 ----
NM_001042555chr1284809 4182 3885 3193 3130 1661 1239 1216 --13214 --
NM_001042576chr20--2445 76 1104 --
NM_001042599chr2137795 7595 7526 7429 6312 5337 2094 2029 1548 1006 575 542 158 ------
NM_001042601chr353307 3249 1308 683 452 11128 ----
NM_001042603chr1244865 1001 985 392 --24391 1380 15206
NM_001042604chr354569 4431 4163 4152 1553 ------
NM_001042749chrX21804 704 11774 ----
NM_001042750chrX21804 704 11774 ----
NM_001042751chrX21804 704 11774 ----
NM_001048183chr1113645 3091 2492 2326 1420 1251 1196 954 811 756 89 43818 3345 700 418 33226 2817 464 22408 1336
NM_001092chr17102313 2294 2181 1676 708 378 101 60 49 40 --3498 192 186 --
NM_001095chr1231961 1305 65 --61703 1510 1229 772 471 289 --
NM_001099678chr345689 4986 4900 4191 25431 2233 ----
NM_001100108chr1116297 6214 6137 6082 5938 5662 5576 5442 5334 5171 2499 15388 11122 11240
NM_001106chr349737 8998 7132 6909 17177 37308 7283 2639 --
NM_001116chr1632611 717 133 --31027 777 476 12171
NM_001128chr1634049 3060 549 --188 --
NM_001167chrX146262 6176 6098 6043 5427 5262 5201 4975 4269 4183 4104 2648 2011 1791 15013 --1406
NM_001173chr1423897 701 14168 11484 14647
NM_001174chrX2904 90 11911 ----
NM_001200chr2031011 270 111 ------
NM_001204chr2106947 6536 5286 5076 4987 4854 2788 2324 1800 560 15516 ----
NM_001249chr141292 ----1158
NM_001259chr754545 2439 1570 1279 304 14743 15982 --
NM_001282chr1742217 1679 941 133 127 12137 --
NM_001304chr1773658 3305 2958 2498 1026 446 26 31277 1154 298 --1917
NM_001329chr1031562 1463 221 ------
NM_001331chr1152549 2474 689 193 103 --22284 165 12556
NM_001346chr342864 864 346 203 21847 125 12134 --
NM_001364chr1184348 3683 3626 3526 3508 3073 602 303 --12941 11426
NM_001387chr5--11983 32894 2575 2546 1666
NM_001396chr21--1339 --1750
NM_001397chr182486 2224 2156 1031 739 689 163 65 --22295 2000 22264 1008
NM_001399chrX93723 3467 3288 2409 1524 1504 1425 1251 281 12333 33205 873 810 --
NM_001418chr11------170
NM_001418chr11------170
NM_001419chr1944789 1312 1275 198 1271 23230 437 --
NM_001421chrX51605 1409 1388 1204 167 --11277 --
NM_001438chr132400 647 580 23612 2806 ----
NM_001448chrX1339 ----11575
NM_001521chr21214 ----1609
NM_001543chr594794 3463 3425 3219 3130 3085 3062 1584 243 1858 34184 814 543 11927
NM_001616chr222910 582 23269 2260 13297 --
NM_001650chr1854014 3299 2687 1539 1260 --11067 12671
NM_001655chr1151893 1491 1363 857 646 ------
NM_001664chr31173 21037 152 ----
NM_001682chr1222797 2296 12518 ----
NM_001683chr342206 2158 888 456 1295 21898 86 1311
NM_001684chr153536 2754 2586 1414 1363 1709 43983 3602 2794 1295 --
NM_001695chr843404 3284 2746 153 ------
NM_001753chr721538 363 2576 256 ----
NM_001754chr2163910 2805 1456 1086 273 137 23024 2646 14197 --
NM_001777chr354147 3129 1045 435 224 ------
NM_001830chrX42925 1463 959 79 --22770 898 --
NM_001854chr141088 248 241 56 ------
NM_001858chr674566 4474 4158 3779 3112 1124 636 21390 647 ----
NM_001859chr9123814 3728 3648 3318 2494 2439 2417 1105 762 676 540 150 33171 1011 80 11248 1465
NM_001874chr12174847 4277 3841 3749 3665 3610 3515 3424 1536 1450 1367 1312 1112 496 440 222 75 --21696 21 15114
NM_001918chr1229065 8683 8600 7698 7569 7017 6939 5975 3108 2606 2561 2442 1957 1873 1787 1644 1566 1306 546 460 380 325 12724 ----
NM_001939chrX63199 2612 1175 1014 947 111 --21493 78 --
NM_001940chr12--1511 --1501
NM_001968chr41800 ----1218
NM_001969chr1433609 444 161 23907 2825 ----
NM_001981chr121873 620 ------
NM_001987chr1284011 3778 2939 1703 1025 791 459 183 --34032 1293 1199 --
NM_002015chr1343038 2839 201 90 --22901 2895 --
NM_002017chr11156 --1515 --
NM_002024chrX11938 ----11975
NM_002025chrX109205 8929 8901 8002 7958 3539 3092 2166 1876 891 22911 1660 ----
NM_002026chr23929 144 80 21000 312 ----
NM_002035chr1863385 3210 3157 2726 2559 69 13764 ----
NM_002040chr2112582 --1811 --
NM_002065chr151858 1646 1505 443 54 ------
NM_002076chr1222208 2007 1737 ----
NM_002077chr961543 1499 1450 443 405 259 31799 1743 267 ----
NM_002126chr1763398 3125 2885 660 260 78 11366 ----
NM_002128chr1342437 2324 815 210 ------
NM_002146chr173506 252 207 1377 ----
NM_002158chr243706 2567 659 373 --1273 --
NM_002214chr7105346 5058 4388 4287 4275 4157 2110 1899 1321 1087 ------
NM_002241chr173079 2423 1910 511 213 201 156 --1980 --
NM_002247chr1022188 67 1723 ----
NM_002264chr344442 3927 1738 1163 13289 13374 --
NM_002270chr534502 1708 1387 --1141 --
NM_002285chr244076 932 520 51 2864 401 1713 186
NM_002309chr2262944 2170 1169 1146 393 387 --12451 12792
NM_002310chr565502 4100 2131 2031 1925 668 35053 4082 1782 12470 --
NM_002336chr1264449 4103 1403 558 522 32 ------
NM_002350chr82487 375 ----1311
NM_002356chr61224 ----1931
NM_002359chr1753927 3117 3085 534 467 11065 33812 3069 245 --
NM_002373chr1561361 1337 928 909 894 40 --1361 1509
NM_002374chr253538 2908 2789 2285 1469 --12807 --
NM_002387chr543494 3310 1821 527 11500 2151 146 13643
NM_002398chr24473 284 200 21 --1119 --
NM_002399chr1541078 322 288 164 ----1202
NM_002429chr1251212 300 247 233 181 1189 1266 11293
NM_002442chr1231333 615 176 --4413 290 142 31 11610
NM_002444chrX51235 748 274 73 64 --11338 --
NM_002480chr121415 ----11066
NM_002481chr1147856 6980 6500 5056 2363 2298 2212 2078 2041 1961 1715 1316 608 299 36788 2441 82 12155 15347
NM_002501chr19114041 3711 3701 3439 3394 3145 2997 1489 1208 623 192 23305 2726 93638 3614 3255 1400 948 849 135 130 125 23750 635
NM_002505chr631531 545 284 1327 --1358
NM_002519chr1141349 499 312 235 ----11308
NM_002522chr17103650 3635 3408 3190 1541 1131 1073 966 792 437 13779 23036 1078 --
NM_002545chr1184154 4093 3850 3775 1776 1336 672 311 11000 11354 --
NM_002547chrX32978 2720 504 --13948 --
NM_002556chr11--1122 21332 825 22027 1955
NM_002576chr113426 230 70 ------
NM_002581chr985311 4674 1927 1395 713 661 82 33 14146 2694 122 --
NM_002586chr63441 135 83 ----1452
NM_002588chr551130 649 526 376 95 21149 229 --145
NM_002594chr2042485 2347 207 40 --1787 --
NM_002595chr1211566 21827 49 235 28 --
NM_002600chr15694 649 394 326 69 1615 ----
NM_002610chr222910 2819 1518 12076 --
NM_002613chr1694596 4020 3978 1821 1504 1237 295 279 49 2890 95 24051 381 24773 171
NM_002628chr33829 170 133 11261 ----
NM_002645chr1142704 2143 1231 192 1596 ----
NM_002698chr1941078 1027 982 737 3473 441 305 62872 2755 1202 813 806 744 1674
NM_002709chr21623 33525 497 86 --23088 800
NM_002718chr372171 2089 2008 1656 1647 931 622 ------
NM_002730chr1961330 969 914 455 385 311 --3931 279 262 1414
NM_002731chr162843 2625 2159 1266 703 112 12304 ----
NM_002738chr163352 282 47 ----1345
NM_002745chr2261788 1081 707 655 392 90 ----13057
NM_002747chr1831703 1514 370 11546 --1362
NM_002776chr1921335 725 --4612 598 304 274 --
NM_002834chr1251266 911 669 206 189 --1864 --
NM_002839chr953345 3051 2292 1210 195 ----11159
NM_002840chr171347 1024 600 542 204 87 56 2165 77 ----
NM_002855chr11143624 3559 3407 2873 2750 2532 2389 1457 751 713 477 346 125 110 13073 32360 1441 43 --
NM_002886chr341080 1070 1025 671 --34606 1993 1643 --
NM_002890chr52891 43 1777 ----
NM_002941chr32451 411 --1191 --
NM_002942chr321226 945 11343 ----
NM_002957chr922497 772 --63372 1571 1500 1232 811 334 2466 253
NM_002959chr161437 384 335 107 71 24 13308 ----
NM_002977chr252696 2547 1195 1176 862 13176 ----
NM_002996chr1651951 1743 1592 785 172 --61495 478 318 286 229 219 --
NM_003028chr931044 911 834 33820 3577 70 32527 1025 216 179
NM_003029chr14403 263 60 39 --11337 --
NM_003045chr1354208 3492 806 485 444 13191 33777 3497 156 13296
NM_003099chr15135946 5910 5803 4683 4610 4528 2602 2202 2115 2079 1247 155 136 16226 --1466
NM_003108chr225367 832 27194 5602 ----
NM_003112chr71491 --1826 --
NM_003128chr232007 1054 465 ------
NM_003155chr852189 1893 1104 254 169 2596 328 21051 1041 12174
NM_003173chrX31349 1336 462 --51396 1108 323 318 198 1483
NM_003178chr322189 442 1882 21769 400 --
NM_003188chr62304 118 ------
NM_003189chr153208 2233 1093 679 458 11122 12622 --
NM_003199chr1864489 3626 3491 1608 840 167 ------
NM_003204chr1761679 1467 1260 1142 684 529 ------
NM_003217chr1261871 1622 492 307 231 24 --11238 --
NM_003221chr643409 2568 1641 1216 --32813 825 615 1498
NM_003234chr31391 11619 11541 --
NM_003247chr631788 1342 210 ------
NM_003253chr21150 --1157 --
NM_003262chr354567 4132 4110 792 373 24180 540 ----
NM_003268chr12173 21 ------
NM_003319chr24744 357 332 116 ------
NM_003338chr1031826 1477 509 ------
NM_003339chr521530 639 1503 1612 --
NM_003342chr172190 179 12736 ----
NM_003344chr721547 1166 31406 484 389 1184 145
NM_003369chr1152651 2396 1916 1825 517 1670 --12701
NM_003387chr24891 615 484 291 1304 ----
NM_003404chr2031887 1374 48 ------
NM_003412chr342567 533 286 172 --1622 --
NM_003430chr192246 50 11206 --1337
NM_003452chr92627 70 ------
NM_003453chr13------1709
NM_003458chr363496 3214 2735 2598 799 653 11214 21125 727 1821
NM_003463chr663253 2780 2713 947 362 182 11149 22929 989 --
NM_003466chr252492 1731 970 739 444 31929 1708 485 1289 --
NM_003468chr264332 3630 2644 1047 708 186 13524 --13327
NM_003471chr312010 175 2776 110 --
NM_003483chr1232301 1857 696 --1477 12020
NM_003486chr1662866 2548 2367 2086 505 185 12795 --12762
NM_003489chr2153055 2417 1308 1176 586 13158 ----
NM_003575chr741100 1038 202 182 162 21374 614 1586
NM_003582chr1------1178
NM_003583chr1233618 3505 1174 ------
NM_003590chr223512 163 ------
NM_003607chr183997 3926 3697 3659 3276 1658 1351 469 23368 3106 23800 176 --
NM_003617chr174596 4392 4291 4248 4062 3975 1947 1851 ----
NM_003629chr183495 3311 3137 2851 2667 801 621 290 13163 ----
NM_003645chr15270 24 ------
NM_003651chr12--1138 --1375
NM_003655chr172100 92 1758 ----
NM_003670chr311008 11106 --2958 457
NM_003722chr352706 833 154 45 37 ------
NM_003735chr551130 649 526 376 95 21149 229 --145
NM_003736chr551130 649 526 376 95 21149 229 --145
NM_003759chr413309 13754 1849 13152
NM_003763chr2043053 2322 2236 2161 --22412 2033 1868
NM_003768chr131857 1774 108 --31452 461 119 --
NM_003774chr1222958 2614 ----1898
NM_003829chr92177 25 2797 346 130 --
NM_003861chr1432564 2348 153 --22540 1011 --
NM_003870chr1541913 1817 1695 676 22018 1682 ----
NM_003872chr222591 1220 21955 577 22423 1098 --
NM_003884chr321476 1237 11195 11179 --
NM_003885chr1742377 1050 732 451 1444 --1669
NM_003888chr1531363 1351 70 11660 2630 30 --
NM_003895chr212582 353 --31891 715 330 --
NM_003908chr2041372 1299 1114 856 1364 21317 1271 --
NM_003924chr42636 181 --1205 1420
NM_003930chr742040 1591 956 870 --188 1799
NM_003939chr1083972 3920 3377 2951 2698 1362 1152 681 23852 3719 33815 2556 524 11535
NM_003947chr33894 295 287 179 1917 --
NM_003949chr1751602 1567 1405 1299 313 1415 31849 282 45 1584
NM_003958chr673917 3564 3172 2956 1241 1058 172 --31192 1015 221 --
NM_003983chr1663866 3783 1787 1343 1229 182 143 21092 79 1112
NM_003994chr1223223 3206 24054 3938 14342 --
NM_004004chr133895 415 97 1868 ----
NM_004024chr141051 574 469 330 --21541 255 --
NM_004028chr1854014 3299 2687 1539 1260 --11067 12671
NM_004035chr1733282 1878 604 --25051 1600 13796
NM_004079chr182359 1804 1095 926 870 544 393 308 --21940 1896 --
NM_004090chr1783204 2640 2208 1255 836 405 136 102 --1374 --
NM_004098chr101940 11010 --1476
NM_004100chr622615 1911 1924 1417 --
NM_004117chr64876 637 327 287 12119 165 --
NM_004124chr1412397 21288 958 12852 --
NM_004171chr1176866 6029 6012 3821 3255 2840 40 37653 3261 3154 16208 --
NM_004187chrX41309 992 985 401 1233 ----
NM_004193chr101159 ----2345 174
NM_004200chr11102343 2256 2146 1245 1114 960 945 392 174 146 12184 --12298
NM_004229chrX21472 708 11944 11571 --
NM_004232chr1821104 358 13031 ----
NM_004274chr1463089 3051 2813 2786 369 293 ----13038
NM_004286chr2292836 2810 2461 2415 2363 2155 1964 782 380 12876 21137 94 --
NM_004293chr963678 3415 2882 2432 2366 180 13548 ----
NM_004302chr1272692 2566 2174 1014 842 547 401 --22312 99 --
NM_004308chr1181658 1579 1371 1233 718 537 140 23 11905 21584 666 --
NM_004309chr172451 163 --3199 149 69 21001 876
NM_004319chr132896 2830 868 22190 207 22752 1255 11240
NM_004321chr283594 3482 3252 3184 3163 2318 2304 179 22998 2382 282 36 1448
NM_004331chr832224 225 183 --199 --
NM_004338chr1896482 6214 5030 4352 2057 1219 1200 748 736 35790 2673 433 12262 --
NM_004350chr192371 2107 2077 767 645 571 467 135 42 21000 958 41785 664 623 425 --
NM_004370chr61264 1320 ----
NM_004380chr1672542 2493 2400 2109 1858 1823 854 ------
NM_004393chr352292 2055 958 801 225 12316 21843 888 --
NM_004399chr122707 671 ----1637
NM_004404chr222055 1445 1349 --1262
NM_004423chr3112563 2415 2335 2183 1948 1786 1731 929 852 791 334 2730 518 72343 2091 984 868 720 193 42 12430
NM_004437chr192740 2381 2289 2190 1052 536 482 326 76 --21151 25 --
NM_004441chr341250 511 296 137 --1875 1329
NM_004447chr12147 --1949 --
NM_004454chr331879 905 225 ----1670
NM_004458chrX21923 54 1475 31898 1887 1694 --
NM_004459chr1741471 471 170 21 ------
NM_004485chr184201 4133 4023 3905 3499 1258 712 416 11515 24114 3019 1110
NM_004501chr133785 3595 1363 --13514 --
NM_004527chr1731253 187 144 --164 293 50
NM_004530chr163402 236 227 11202 --1850
NM_004583chr172719 51 2766 69 1627 --
NM_004586chrX94025 3910 1734 1567 1512 1154 737 444 107 13372 13548 --
NM_004587chr20--2445 76 1104 --
NM_004588chr11113287 3181 3073 2861 1600 1280 1159 1090 1050 739 139 22525 1445 23191 472 13890
NM_004602chr202567 36 --21412 498 1271
NM_004612chr934463 4295 3676 ------
NM_004619chr132111 1897 719 1786 ----
NM_004726chrX55728 5666 1141 930 716 1463 15269 175
NM_004734chr1353120 2487 2219 95 41 12978 ----
NM_004742chr341685 1358 427 67 21137 220 1468 --
NM_004745chr875959 5225 5036 1639 1467 685 328 25233 614 56251 6032 5567 4286 1588 --
NM_004781chr131296 412 378 11188 ----
NM_004781chr131296 412 378 11188 ----
NM_004788chr1132610 1809 31 --11704 --
NM_004798chr2042993 2859 2287 1436 23567 140 ----
NM_004801chr21224 --1470 --
NM_004807chr272241 1878 761 597 528 502 459 1384 22108 946 11991
NM_004845chrX84175 3603 3258 3122 1582 500 424 252 1516 24108 372 11180
NM_004859chr173761 742 595 ------
NM_004860chr172524 48 --2141 72 --
NM_004863chr14144909 4822 4687 4628 4552 4297 4211 3580 3381 1600 1101 727 479 341 1317 --14991
NM_004904chr775643 5625 5592 4726 4461 2321 313 --11618 25961 760
NM_004932chr541402 350 342 229 --11458 --
NM_004943chr195923 838 403 381 275 199 41150 1052 41 27 --
NM_004947chr362531 2099 1622 659 620 591 22379 51 181 11021
NM_004965chr21------1774
NM_004976chr11104854 4556 3744 3703 3423 3241 1752 1668 627 553 24904 1803 84802 4053 3871 3765 3755 3296 2014 1394 24324 893
NM_004992chrX128168 8095 7762 2549 2091 1681 1663 1445 1395 764 584 433 22710 2336 56544 2997 2502 1793 590 31331 460 224
NM_004992chrX128168 8095 7762 2549 2091 1681 1663 1445 1395 764 584 433 22710 2336 56544 2997 2502 1793 590 31331 460 224
NM_004999chr664199 3913 3860 3706 1336 915 --11265 11667
NM_005028chr1092260 2046 1653 1461 1439 645 623 322 185 --1704 --
NM_005054chr221462 392 ------
NM_005056chr1255109 3466 1245 1229 636 --24635 1624 15450
NM_005065chr1474877 4769 4542 4534 1962 1434 1358 21164 362 ----
NM_005076chr1114026 3639 3591 3487 3049 2874 1251 981 769 711 60 23525 905 34235 3004 954 --
NM_005093chr20105281 5094 4692 4509 3337 2017 1962 1521 672 219 1819 33426 1692 533 --
NM_005095chr141936 899 497 484 1558 ----
NM_005099chr111284 ----11078
NM_005126chr322281 551 2718 211 ----
NM_005135chr1593674 3655 3487 2665 2343 1523 1388 212 91 --12742 23749 2811
NM_005144chr861105 940 469 405 283 111 ----11068
NM_005156chr955357 3491 1904 1791 1725 14187 ----
NM_005160chr2256161 5433 4677 1537 1120 --22144 1751 26171 2686
NM_005180chr1021318 341 1436 ----
NM_005184chr1971394 1191 610 499 473 391 315 --11433 11475
NM_005187chr16101973 1658 1629 1367 1360 1337 1298 585 52 43 31987 786 136 11391 11546
NM_005188chr1158006 6527 5509 5183 680 27432 6488 37665 3101 1269 --
NM_005197chr1434181 2075 1994 --55496 4587 3791 1701 422 --
NM_005202chr161874 1733 1591 1432 807 314 11751 21793 260 --
NM_005206chr1771435 1385 1349 1268 1215 954 187 11052 ----
NM_005219chr571806 1404 1274 700 230 220 152 --1327 11329
NM_005235chr2137795 7595 7526 7429 6312 5337 2094 2029 1548 1006 575 542 158 ------
NM_005238chr1123294 1219 1303 13010 --
NM_005259chr231369 1273 54 ------
NM_005277chr43222 173 70 164 ----
NM_005281chr110992 951 851 839 700 235 170 105 84 24 --1998 --
NM_005291chr24826 238 92 55 --2323 150 182
NM_005338chr7113944 3891 3694 3608 3473 2880 1602 1508 1287 677 300 --42831 2516 1135 725 171
NM_005359chr1835134 1374 1307 16573 26349 3972 --
NM_005375chr62314 69 ----1180
NM_005397chr763694 3340 3239 1488 1193 158 150 31198 568 126 --
NM_005402chr721777 1662 ----11712
NM_005436chr1043883 3150 1430 59 33355 3025 191 ----
NM_005440chr17103260 2940 2751 2414 1101 968 598 516 494 429 --12566 22320 836
NM_005465chr121589 284 1121 --11271
NM_005477chr151692 --32470 2261 827 12418
NM_005477chr151692 --32470 2261 827 12418
NM_005497chr17105938 5553 5498 5377 5291 5156 4762 4388 4307 4254 23856 1020 24990 1914 --
NM_005504chr1224393 42 36229 5609 1351 26046 987 15069
NM_005562chr121225 23 11650 ----
NM_005566chr112550 360 2539 519 ----
NM_005578chr363312 3174 3119 1326 926 380 23698 3657 ----
NM_005638chrX21712 113 ------
NM_005665chr134118 3069 1070 13230 2791 723 --
NM_005670chr641423 829 589 208 1126 ----
NM_005715chr642514 1009 989 592 ----22433 779
NM_005746chr732735 594 429 ------
NM_005795chr23754 247 43 ----12146
NM_005808chr352858 2275 723 591 352 --22662 372 11302
NM_005840chrX97605 5455 5429 5400 2622 1903 438 330 47 17282 12609 11562
NM_005843chr241362 779 96 65 ------
NM_005862chr33727 351 251 ------
NM_005902chr1584450 3652 2923 2877 1362 1060 450 120 1352 52971 1437 501 496 82 --
NM_005903chr593559 1546 1460 1380 1327 1058 1025 443 293 ------
NM_005909chr574066 3737 2942 1097 887 817 280 11722 1285 --
NM_005910chr1783100 2870 2694 1663 1373 491 276 98 33473 1004 393 21346 1235 23581 1188
NM_005911chr241466 1186 595 312 1555 ----
NM_005937chr1783868 3659 1630 933 902 524 467 275 11238 43936 2719 618 609 13792
NM_005943chr671597 1106 469 286 232 169 30 3503 113 43 11238 --
NM_005955chr145017 4286 2068 1383 34181 1653 1018 ----
NM_005957chr1114817 4682 4473 3974 3704 3437 1773 1498 808 558 350 21544 316 11278 --
NM_005990chr581969 1910 1869 1850 1743 1020 167 121 --1144 --
NM_006016chr632285 2072 881 ------
NM_006038chr2071794 1616 1387 665 536 382 40 21934 1773 --1182
NM_006079chr61311 --140 --
NM_006090chr12682 148 ------
NM_006095chr411741 2365 76 13384 --
NM_006106chr1112517 23091 336 ----
NM_006108chr1142279 1671 781 634 1208 --12311
NM_006155chr222055 1445 1349 --1262
NM_006167chr862353 1920 845 635 422 385 ------
NM_006191chr124752 173 157 21 --2679 143 1208
NM_006203chr534943 4742 4152 35323 1474 1410 14214 --
NM_006206chr482572 2467 2347 2093 1145 1054 591 313 1373 22081 919 1127
NM_006210chr192864 75 ------
NM_006224chr1762275 1954 1675 1551 826 56 --2402 313 1661
NM_006226chr221205 1081 11051 ----
NM_006238chr672027 1839 1436 1397 1329 835 83 1187 31942 1751 710 --
NM_006282chr2074455 3926 3838 764 540 321 27 --14315 --
NM_006283chr853264 1521 1332 651 23 23249 3020 ----
NM_006293chr154861 416 404 196 --5952 832 643 163 83 --
NM_006306chrX55082 1400 1304 1065 1014 33888 2149 1512 41271 1223 77 55 --
NM_006315chr444203 3592 3267 153 11459 34228 3747 685 --
NM_006352chr121438 342 --11318 --
NM_006366chr62525 116 1891 ----
NM_006380chr1754296 2679 729 512 234 --11636 --
NM_006386chr2222247 2188 1885 32238 1784 292 1135
NM_006390chr1221792 1531 --1744 --
NM_006449chr2--41790 1681 1474 53 22044 1387 11584
NM_006454chr462407 1239 990 608 226 82 141 42604 2549 613 377 12080
NM_006464chr2104655 4398 4302 3783 3513 3428 3295 1737 1529 660 11854 1354 --
NM_006465chr1531687 512 295 22208 220 3837 807 692 1286
NM_006469chr131508 1330 1055 ------
NM_006482chr1233618 3505 1174 ------
NM_006538chr284049 4031 3438 3157 2769 1180 632 65 11592 --11336
NM_006539chr163551 202 31 1411 1171 --
NM_006540chr841082 1035 107 90 --195 --
NM_006544chr1455816 5394 4865 4615 1515 ------
NM_006546chr1765862 2114 2028 414 202 193 36487 2123 593 65507 4731 4225 1688 1125 1028 45969 4993 1086 604
NM_006547chr751874 648 560 488 203 ------
NM_006548chr331439 500 49 21100 82 ----
NM_006555chr741956 1453 297 22 --21876 1871 --
NM_006561chr1065166 4962 4379 2194 1775 1621 --25702 2015 --
NM_006599chr1666810 6070 5925 5109 2720 2677 38037 7104 180 12584 15273
NM_006603chrX21804 704 11774 ----
NM_006606chr2032599 1233 32 12637 --12838
NM_006609chr22553 490 --1539 1625
NM_006614chr342909 2749 2555 267 --21204 40 --
NM_006620chr653126 1819 1733 189 48 13288 ----
NM_006626chr931757 1069 921 1353 196 --
NM_006628chr1534346 4224 251 1800 14191 13595
NM_006650chr583598 3510 3489 756 399 376 367 237 23946 2716 2597 574 1342
NM_006654chr1284809 4182 3885 3193 3130 1661 1239 1216 --13214 --
NM_006722chr342258 2032 628 448 --12363 --
NM_006731chr985375 5176 5094 4833 3969 2189 2087 921 --15380 --
NM_006750chr16117913 6852 6828 6638 5986 5900 5819 2737 2106 1809 1034 15361 12174 --
NM_006756chr831393 590 137 ------
NM_006766chr842611 2183 838 392 --2945 457 --
NM_006775chr683084 2718 2331 2013 1978 264 179 36 1147 ----
NM_006802chr161165 984 845 757 296 251 ----175
NM_006827chr1432832 633 170 --22779 801 --
NM_006828chr61109 ----1116
NM_006874chr4------11226
NM_006885chr1643306 3176 3082 2831 1101 1238 --
NM_006888chr1483472 2967 2473 2257 1019 1012 985 569 ------
NM_006895chr222200 229 11503 ----
NM_006896chr75729 416 399 357 276 --41142 265 185 144 --
NM_006922chr252244 1838 1031 398 246 11656 ----
NM_006924chr1744131 3500 826 148 23818 2812 23081 1438 11559
NM_006927chr1682097 2023 1937 1847 1785 830 794 162 42106 253 127 88 --1201
NM_006930chr521722 567 ------
NM_006943chr2083225 3192 3061 2661 2367 575 260 207 23241 676 2853 190 --
NM_006981chr952689 2174 2045 890 309 ------
NM_007011chr15105632 5546 5466 5412 4181 2403 1869 1835 1660 1307 26496 5194 --12010
NM_007030chr584483 4059 3198 1614 1477 1005 407 179 13558 34310 1787 991 32015 1568 414
NM_007039chr1441742 1430 191 70 11770 ----
NM_007042chr352275 2248 2034 969 465 1140 11906 --
NM_007050chr20177790 7694 7266 6631 6133 5525 3118 3092 2813 2801 2519 2163 1803 1677 1174 341 224 37616 5696 1759 55530 5265 2828 623 578 35406 3148 230
NM_007073chr673830 3794 3632 2940 1622 1123 725 --13808 --
NM_007084chr131245 --2440 433 1621
NM_007106chr1342526 1785 491 69 ------
NM_007146chr1722727 774 32582 1036 287 --1943
NM_007153chr19104507 3827 3167 3087 1645 1609 1488 1032 1022 204 24049 26 ----
NM_007170chr13669 585 128 ------
NM_007172chr2252050 2041 870 333 269 ------
NM_007174chr1281707 1577 1469 877 796 567 322 22 --1811 --
NM_007175chr842562 1311 342 82 23278 3207 ----
NM_007189chr791511 1433 1353 1211 1025 527 253 65 56 --4958 400 143 124 --
NM_007203chr931489 333 258 ----13649
NM_007249chr13149410 8974 8217 7249 6962 6218 6024 2085 1735 1337 1101 596 469 55 12147 ----
NM_007276chr721076 985 --1953 --
NM_007292chr1733282 1878 604 --25051 1600 13796
NM_007353chr762902 1033 757 666 462 445 1149 2856 536 --
NM_012104chr1153526 3394 2709 510 323 12790 1934 --
NM_012104chr1153526 3394 2709 510 323 12790 1934 --
NM_012137chr111945 32936 2852 2815 21980 1146 --
NM_012141chr1354123 2616 1499 660 313 ------
NM_012156chr2093068 3012 2877 2406 2187 1075 682 103 35 22146 553 ----
NM_012164chr997582 6512 6368 6051 6010 5539 5015 4869 801 27280 5425 11135 36088 5403 2367
NM_012193chr1185239 4620 4085 3771 3326 1507 1077 134 21359 1244 1154 --
NM_012199chr184588 4358 3928 3478 886 690 607 204 2899 185 23204 2869 --
NM_012214chr2105211 4337 2508 2321 2178 1745 1509 1423 1289 823 14968 14314 25396 1577
NM_012219chr363125 2586 586 268 66 43 32233 2094 89 ----
NM_012234chr342603 653 522 229 11227 ----
NM_012244chr1481651 1512 1499 717 711 588 243 187 --21178 686 21373 546
NM_012262chr124352 4234 23833 358 ----
NM_012281chr742070 1847 142 57 11730 ----
NM_012282chrX6643 615 324 315 295 237 --181 --
NM_012294chr753787 3410 3343 1292 863 31135 1128 140 13271 --
NM_012296chr11103398 2850 2807 2685 2647 1217 875 725 449 211 --12419 --
NM_012300chr51145 12230 --22204 695
NM_012307chr18187 --192 --
NM_012308chr1161853 1769 1629 659 611 368 --2948 651 1961
NM_012309chr1163827 3500 1865 683 276 99 23783 819 13375 11094
NM_012316chr1135175 5011 4776 4696 4643 4558 4484 4032 3663 3630 2195 1351 640 24241 45 22202 877 15330
NM_012326chr26868 801 677 664 264 83 ----2699 299
NM_012329chr172681 251 11532 ----
NM_012334chr544238 4105 618 422 23489 1285 23057 430 184
NM_012384chr2022093 2060 22253 759 21989 627 22282 428
NM_012398chr1952526 793 696 240 168 1327 22688 1871 --
NM_012399chr2211461 ----1176
NM_012405chr133407 2803 36 ----33716 2942 1094
NM_012420chr10--1780 1880 --
NM_013231chr1423627 287 21148 336 ----
NM_013233chr231260 1136 63 ------
NM_013255chr788754 8695 8102 5704 2664 2600 2491 1667 25965 2642 36584 3517 172 --
NM_013266chr10------149
NM_013269chr1223908 3645 11076 23971 3515 123
NM_013277chr12127 --2793 773 1831
NM_013279chr1172248 1897 1541 659 447 391 58 --11530 --
NM_013286chr373421 3377 2971 2714 2652 278 21 --13312 12305
NM_013372chr1583365 2905 2410 2283 931 859 113 22 ------
NM_013382chr1462328 2030 1634 163 133 22 22336 1516 --12004
NM_013402chr1182705 2634 2613 2329 2173 2086 486 400 --12367 --
NM_013423chrX3245 200 50 1873 1306 --
NM_013427chrX3245 200 50 1873 1306 --
NM_013436chr2------1738
NM_013951chr252492 1731 970 739 444 31929 1708 485 1289 --
NM_013952chr242569 1808 816 521 32006 1785 562 1366 --
NM_013953chr242569 1808 816 521 32006 1785 562 1366 --
NM_013989chr1464490 4333 4177 4048 3972 834 11623 13702 --
NM_013992chr242569 1808 816 521 32006 1785 562 1366 --
NM_013995chrX51995 1032 884 743 56 1189 ----
NM_013999chr1731290 224 181 --1101 2130 87
NM_014021chr133035 2121 1279 23105 2655 11240 12141
NM_014043chr31357 --1139 --
NM_014048chr1634991 4004 1131 24457 1297 13427 --
NM_014112chr854767 4029 3507 3394 118 22128 1098 1637 11367
NM_014117chr1642578 2274 1049 54 --22735 1031 --
NM_014155chr1186621 6176 6075 5521 4850 2405 971 446 12912 22679 119 11554
NM_014190chr481561 1473 1439 491 184 173 108 58 --1196 --
NM_014191chr121107 2866 280 2905 755 --
NM_014231chr1251672 521 169 107 74 --22113 1808 --
NM_014233chr1722155 263 --32037 377 56 11366
NM_014235chrX71794 1253 626 544 441 396 29 11523 1457 1593
NM_014238chr1751556 1522 485 399 100 21464 1258 ----
NM_014240chr383924 3838 3759 3704 2583 1060 454 403 11557 11281 12835
NM_014253chrX52090 881 528 441 124 ------
NM_014268chr1861115 452 396 313 237 85 1144 1106 --
NM_014292chr2231399 625 352 --61574 1285 1181 617 600 85 --
NM_014299chr1971964 1776 1700 424 324 214 55 --2837 260 --
NM_014323chr222165 138 --2333 128 --
NM_014335chr15--1419 148 --
NM_014368chr941877 1766 583 440 11854 11723 --
NM_014372chr132055 732 219 --11438 --
NM_014381chr1431165 1038 826 ----1832
NM_014388chr195818 5582 4429 4393 1748 1458 1228 849 70 15872 --22434 490
NM_014423chr521242 929 25254 1617 ----
NM_014458chr12885 117 1480 --11286
NM_014521chr211647 21613 208 --11868
NM_014591chr1031165 1036 48 1438 1211 11187
NM_014592chr55728 527 192 162 95 1797 ----
NM_014601chr194673 217 105 39 --41271 555 455 319 1539
NM_014612chr921442 968 --11384 --
NM_014614chr211492 --1187 1528
NM_014630chr1573858 3263 3135 1500 1475 839 272 12595 32884 297 163 --
NM_014634chr22113230 2732 2643 2430 1173 429 413 301 257 123 74 12670 13116 1497
NM_014635chr221434 356 ------
NM_014665chr873362 2905 2696 2473 963 644 613 13602 --1483
NM_014686chr1972002 1719 1690 1604 697 668 95 2768 452 --11816
NM_014701chr1543258 1360 117 73 13284 11378 --
NM_014703chr32369 354 --11207 --
NM_014730chr1275079 4931 1996 1412 1271 1026 966 24917 53 1231 21543 823
NM_014730chr1275079 4931 1996 1412 1271 1026 966 24917 53 1231 21543 823
NM_014742chr2071487 1402 1385 1373 1277 1216 262 2616 543 21191 581 --
NM_014746chr253271 3051 1578 1102 505 --158 12907
NM_014747chr1105678 5261 5106 4881 4486 4330 3703 3520 1635 138 --14124 15500
NM_014762chr151992 1577 1038 859 132 --1771 1702
NM_014767chr10103544 3336 3315 3117 3076 2479 1322 621 410 36 --52695 706 468 415 397 1651
NM_014770chr1261159 986 374 292 207 188 --21164 1140 11046
NM_014771chr1631064 856 838 1864 6844 767 694 332 304 115 1932
NM_014772chr1862917 2412 1170 816 537 475 12775 42930 1282 1190 201 --
NM_014774chr1151 22458 1057 23104 742 1958
NM_014810chr122311 493 ----12519
NM_014812chr12686 555 ------
NM_014819chr51754 --22461 766 11879
NM_014826chr183997 3926 3697 3659 3276 1658 1351 469 23368 3106 23800 176 --
NM_014828chr14--1213 --1864
NM_014830chr1253678 1532 510 424 81 2666 358 23002 308 --
NM_014839chr131691 329 202 ----11762
NM_014844chr1463611 3258 3172 2810 2595 92 14170 --11589
NM_014850chr374062 3082 1883 1861 835 633 262 1176 11667 1248
NM_014860chr23490 264 44 ------
NM_014873chr164852 4207 4201 3254 636 425 --11181 --
NM_014876chr2252159 1851 1665 1546 521 21835 1825 1796 --
NM_014877chr1756062 5333 5290 2784 1913 25452 2585 36852 2075 1435 --
NM_014897chr1753263 2754 2338 543 226 12833 ----
NM_014899chr543071 573 449 400 32087 1088 442 ----
NM_014901chr581909 1856 1781 1683 1577 895 600 147 --51894 1593 1441 743 629 --
NM_014902chr2061521 1207 975 419 175 120 --31170 301 81 --
NM_014903chr1242330 630 425 249 ------
NM_014909chr14113966 3558 3353 2934 2662 2647 2552 743 719 181 66 13214 21108 416 --
NM_014912chr1022385 766 --12930 --
NM_014917chr12325 135 1395 ----
NM_014921chr19102912 2856 2706 2554 2472 2416 2143 1008 677 161 1209 62956 2670 2488 2400 2173 735 12676
NM_014932chr321679 75 ------
NM_014934chr1351324 1091 910 547 160 23239 3128 ----
NM_014935chr153909 3197 2968 1567 454 13034 22935 215 --
NM_014936chr632037 925 261 ------
NM_014945chr572030 1555 711 496 487 289 268 ----11915
NM_014947chr162139 2094 1211 605 232 31 11997 ----
NM_014964chr1752364 2173 2086 1742 576 11911 41643 378 297 156 --
NM_014988chr432249 2224 2167 ------
NM_015001chr15939 898 727 230 124 --1932 171
NM_015008chr341373 1081 748 386 22458 1420 13365 --
NM_015020chr161928 1842 22390 402 13535
NM_015027chr1651973 1702 1668 1574 535 11523 ----
NM_015035chr20125858 5517 5431 5351 5296 4264 4121 4074 2503 2453 1783 72 24508 2680 11285 12368
NM_015039chr1104020 3685 3533 3112 613 441 402 363 324 285 11017 44118 3391 3152 1163 13036
NM_015042chr15124112 4070 4061 3784 3647 1363 1112 1037 966 721 678 375 --43292 3277 864 836 14221
NM_015045chr1032138 1974 504 1388 11522 --
NM_015052chr741383 882 455 183 --11376 11406
NM_015055chr1152879 1008 258 184 120 ----21952 927
NM_015059chr1543892 3442 3296 970 23971 2818 23796 2924 --
NM_015063chr1931353 1314 241 1979 4506 493 360 235 11248
NM_015064chr12123645 3565 3510 3485 3278 3218 2453 1013 571 399 323 49 11186 1480 --
NM_015068chr763669 2727 1520 1457 770 260 1295 1961 --
NM_015071chr585748 5141 4008 1205 1135 1120 1043 561 15683 2724 323 --
NM_015074chr1114092 4006 3926 3871 3840 3339 3184 1578 1322 1157 226 24395 3271 --13391
NM_015075chrX122042 1991 1843 899 625 614 576 482 392 371 344 85 --11612 --
NM_015076chr674395 2813 1483 717 266 204 26 11676 131 --
NM_015077chr1784739 4530 3012 1717 973 810 645 161 22913 451 31581 824 21 24327 3972
NM_015082chr532413 2261 1875 21969 668 22493 1846 1377
NM_015090chr1116065 5914 5738 5726 4362 3866 2102 1477 1377 398 179 11754 45813 5682 4679 609 14369
NM_015093chr631607 310 242 ------
NM_015113chr1762248 1795 338 273 101 65 --1444 --
NM_015115chr453164 3135 1100 969 483 12964 ----
NM_015133chr1671130 962 590 350 296 261 105 181 51208 1076 532 113 25 21228 46
NM_015138chr1542466 1145 1004 193 22537 2388 1826 --
NM_015144chr1663529 3163 2672 1561 1261 981 ----1827
NM_015191chr1162535 2215 2154 801 105 66 --1129 --
NM_015193chr8111438 1361 1323 1279 1182 1101 1010 505 287 177 41 --123 --
NM_015194chr1771873 1857 1442 554 454 441 259 1516 51824 508 501 496 76 --
NM_015199chr362593 2564 2045 939 300 91 ------
NM_015205chr13155123 4466 4348 4265 4211 4102 1985 1859 1069 834 616 604 363 315 252 --24270 3944 --
NM_015209chr1----31737 1504 935 --
NM_015215chr132983 2139 1960 ------
NM_015245chr642659 2299 405 345 --1576 22235 543
NM_015267chr1231385 369 68 --31664 1651 754 1100
NM_015270chr124492 259 251 132 32211 1950 113 11546 22041 523
NM_015271chr443199 1429 556 451 21247 980 22942 613 --
NM_015277chr1851256 1235 337 173 67 ------
NM_015284chr181982 1919 1742 811 770 466 239 84 11828 1165 --
NM_015285chr1832310 2265 1832 1601 2380 352 --
NM_015288chr563224 3160 999 847 817 325 23168 2568 33786 2592 672 22726 490
NM_015291chr162941 1031 727 580 455 160 22909 1292 1415 13078
NM_015299chr1483468 3200 1247 1065 1021 714 224 42 --33450 2752 2622 --
NM_015305chr1441405 1297 752 734 21855 647 2413 202 --
NM_015310chr898428 7708 6928 3310 3057 2704 1957 1226 991 27798 2610 27038 1428 17552
NM_015313chr1123562 749 21511 728 ----
NM_015315chr553154 2829 2393 976 457 22595 414 32840 676 390 --
NM_015317chr262598 2521 2243 2075 614 82 --12513 --
NM_015321chr1964941 3446 1272 1013 137 38 13605 94767 4532 4281 1264 475 457 290 172 53 14538
NM_015326chr182948 2684 2621 2476 2317 2275 2173 2036 ------
NM_015328chr722327 995 32212 724 98 1480 --
NM_015335chr1241926 905 799 685 ----1263
NM_015336chr121261 12325 ----
NM_015344chr831694 861 481 ------
NM_015347chr1252468 2127 857 373 59 52379 1931 1917 1137 1100 11870 --
NM_015375chr1114367 4281 4201 3312 3183 1985 1899 1783 1217 1096 942 ----11695
NM_015387chr221305 464 --11567 --
NM_015396chr351437 1408 967 958 65 ----1905
NM_015455chr553527 2797 703 272 186 13747 ----
NM_015460chr351436 1420 793 257 66 ----1547
NM_015477chr151333 --2998 640 --
NM_015520chr372613 719 687 510 196 179 140 22204 586 1414 --
NM_015526chr194993 921 530 128 --31203 353 249 21410 1017
NM_015535chr283601 3442 3015 1681 1582 1548 1351 63 11399 ----
NM_015550chr742758 1302 970 372 ------
NM_015557chr183424 3408 939 749 626 589 472 174 12509 21188 74 13502
NM_015559chr181434 1923 1838 --
NM_015564chr563254 2779 2223 993 724 705 22494 1161 ----
NM_015568chr2083882 2686 1243 1168 1125 1068 284 59 33272 769 576 63987 1463 1441 1326 1111 138 --
NM_015569chr154360 1618 1431 1321 199 14461 --14508
NM_015576chr312088 --12166 --
NM_015609chr162571 2497 2452 1147 821 283 1902 22755 2674 32690 1988 1849
NM_015640chr144282 3905 2102 395 ------
NM_015646chr1241145 1115 74 52 ------
NM_015651chr972169 2129 1934 1864 1480 1471 69 11831 ----
NM_015691chrX42962 2578 1038 651 --32090 1944 1800 --
NM_015726chr161873 1706 1528 1346 501 39 21593 1178 --1553
NM_015866chr151418 955 195 135 56 ------
NM_015878chr822131 1369 --11653 --
NM_015898chr1952525 2447 1730 1688 611 --52129 2100 1922 1723 533 --
NM_015902chr82227 214 ----1234
NM_015906chr131392 1364 1318 13265 13495 1766
NM_016009chr1104921 4804 4452 4119 3605 3440 3386 3224 530 270 1119 13998 --
NM_016018chr842780 2404 1766 867 ------
NM_016021chr642629 1987 1926 33 --11860 --
NM_016025chr1611318 1346 2716 198 --
NM_016040chr132030 762 264 --22423 482 --
NM_016059chr61619 ----1347
NM_016081chr42155 143 11883 134 --
NM_016083chr622661 676 11252 22866 1558 13133
NM_016131chr221488 251 ----1805
NM_016132chr1522365 562 22549 683 1663 --
NM_016147chr1131089 147 26 --21189 407 1101
NM_016169chr1073197 1259 733 686 419 369 39 12121 21022 870 1899
NM_016206chr357463 3258 2648 2237 230 1316 ----
NM_016231chr1721560 1226 1479 11565 --
NM_016248chr1324004 3032 1272 1900 --
NM_016257chr183015 2708 2690 1407 1331 610 470 100 --2476 54 --
NM_016260chr226542 1854 22074 1578 --12177
NM_016272chr2292030 1895 1835 1800 1732 1713 511 485 138 ------
NM_016275chr352567 2229 1983 683 635 ------
NM_016284chr16--1989 2726 103 1132
NM_016287chr131280 523 510 --21712 280 11705
NM_016298chr383344 2764 2038 894 754 556 316 153 ------
NM_016315chr221874 1190 ------
NM_016376chr1774015 3712 3345 2810 1024 67 47 11150 24214 3315 --
NM_016396chr1542966 2240 1080 135 --12612 --
NM_016418chr2263682 3295 1184 856 733 192 11161 63410 3055 1079 535 403 210 21048 75
NM_016433chr1251540 1342 496 441 29 11221 11102 --
NM_016472chr144942 449 368 123 ------
NM_016485chr611741 ----1172
NM_016530chr1552966 1329 233 157 132 11306 2616 75 --
NM_016559chr321483 1400 --1605 --
NM_016577chr3104339 4249 4035 3867 3702 3167 2865 893 885 619 --1449 --
NM_016587chr721076 985 --1953 --
NM_016591chr541210 1055 275 78 ------
NM_016621chr1144326 3810 3651 513 24449 3752 34459 3014 2941 13111
NM_016626chr1811172 ----1365
NM_016734chr941992 1887 215 105 --61966 582 344 294 289 63 --
NM_016823chr1771305 1255 1219 1138 1085 824 57 1922 ----
NM_016834chr1783100 2870 2694 1663 1373 491 276 98 33473 1004 393 21346 1235 23581 1188
NM_016835chr1783100 2870 2694 1663 1373 491 276 98 33473 1004 393 21346 1235 23581 1188
NM_016841chr1783100 2870 2694 1663 1373 491 276 98 33473 1004 393 21346 1235 23581 1188
NM_016929chr684016 3693 1640 1301 1024 366 241 146 1790 11396 144
NM_017410chr1231055 899 379 1346 2192 173 1337
NM_017415chr543592 3456 2861 2767 13491 21701 1259 11735
NM_017420chr1452346 894 794 548 346 --12883 13733
NM_017423chr421625 422 31744 1687 836 ----
NM_017447chr2133986 3743 3563 ------
NM_017452chr202567 36 --21412 498 1271
NM_017453chr202567 36 --21412 498 1271
NM_017454chr202567 36 --21412 498 1271
NM_017548chr321918 1425 31789 699 49 ----
NM_017551chr1022191 194 12002 12563 144
NM_017575chr1761583 1543 658 570 130 100 --21122 1086 --
NM_017580chr1011826 ----1558
NM_017592chr19122125 2000 1989 1949 1808 1722 1029 897 791 616 512 505 --1848 --
NM_017610chr151401 164 ----
NM_017628chr495098 4958 4295 4057 3896 3698 2094 2078 1669 24271 4259 ----
NM_017633chr693729 3058 2945 2519 754 494 430 225 90 ------
NM_017637chr988265 8142 7102 6307 6029 2680 1039 996 --11320 --
NM_017650chr765995 5507 4749 4599 2314 1504 15491 34683 4678 873 24420 4131
NM_017660chr1932684 2172 279 --42642 2637 2134 2105 1800
NM_017672chr15------1488
NM_017694chr231990 1464 408 1760 --175
NM_017704chr113773 747 675 ------
NM_017709chr164227 3372 3286 1174 184 38 33674 3022 1525 14032 --
NM_017741chr4102797 2318 2152 2096 918 781 540 422 256 201 ------
NM_017742chr1831466 747 407 ----1448
NM_017754chr6114059 3135 1843 1696 1525 1473 1167 1100 923 867 300 21978 1442 23839 1009 --
NM_017791chr1431172 1098 573 21313 620 ----
NM_017801chr341677 995 973 281 22547 1792 ----
NM_017848chrX21829 508 ----24132 716
NM_017849chr231180 84 42 1262 43132 2733 2504 720 --
NM_017893chr1051071 995 589 72 38 1456 31316 287 120 1160
NM_017919chr985749 5521 5186 4887 4871 2112 1246 577 1526 45027 1368 1282 1277 14857
NM_017944chr1172863 2312 643 532 468 265 158 22492 141 ----
NM_017994chr752355 2100 457 392 232 1121 166 --
NM_018013chr62933 531 --1225 22796 2181
NM_018026chr1171343 1117 383 314 181 89 45 1418 51208 1191 1186 1039 408 11065
NM_018027chr1092546 2048 899 814 509 411 340 135 112 21121 533 --11311
NM_018053chr12547 246 2706 575 1620 138
NM_018061chr121512 187 11647 ----
NM_018070chr11163 --1126 1429
NM_018084chr223219 2366 --22454 2401 --
NM_018085chr1117131 7032 6351 6130 5225 1990 1757 1677 1622 253 40 12081 192 1756
NM_018086chr231576 1276 745 11265 ----
NM_018121chr1031177 862 283 11113 ----
NM_018133chr311799 --1480 --
NM_018172chr1171547 1309 1292 1256 1049 322 34 --11228 --
NM_018182chr1751886 1832 1601 804 768 22081 280 22010 211 12092
NM_018195chr1121956 325 12052 ----
NM_018199chr1431180 481 123 ------
NM_018202chr12342 273 ------
NM_018241chr42752 726 ----1254
NM_018247chr652251 2182 825 423 57 12368 1709 --
NM_018302chr42961 464 1537 2442 353 --
NM_018313chr312407 22027 1630 1989 --
NM_018330chr1041556 599 205 120 1154 ----
NM_018351chr12134601 4188 3925 3760 3676 3536 2976 2889 1828 1524 1358 742 720 1113 14041 --
NM_018364chr142765 2748 1149 932 1509 ----
NM_018373chr14104391 4323 2051 1534 1362 1111 1008 803 755 29 34789 4454 921 ----
NM_018374chr731431 584 241 --13681 11475
NM_018383chr231374 706 181 --21810 219 11279
NM_018403chr363332 3285 2913 1323 885 362 13112 32833 405 36 11334
NM_018440chr887679 7568 7027 6391 6167 5699 564 276 38486 8252 5944 15736 26307 5254
NM_018442chr11137 --1266 --
NM_018452chr6_random31535 859 831 --1896 --
NM_018534chr2----2229 130 1156
NM_018557chr221400 66 1554 ----
NM_018566chr154835 3270 3194 416 309 24457 3590 14322 --
NM_018644chr1121557 623 21807 267 41674 1427 635 145 1463
NM_018667chr1672080 1115 1012 973 741 672 31 2586 495 11941 21129 223
NM_018689chr1562042 1688 726 681 492 362 --21992 89 11944
NM_018717chr482614 930 897 877 788 321 296 155 22880 2121 12728 --
NM_018841chr151535 987 937 421 35 12539 --11088
NM_018912chr551130 649 526 376 95 21149 229 --145
NM_018913chr551130 649 526 376 95 21149 229 --145
NM_018914chr551130 649 526 376 95 21149 229 --145
NM_018915chr551130 649 526 376 95 21149 229 --145
NM_018916chr551130 649 526 376 95 21149 229 --145
NM_018917chr551130 649 526 376 95 21149 229 --145
NM_018918chr551130 649 526 376 95 21149 229 --145
NM_018919chr551130 649 526 376 95 21149 229 --145
NM_018920chr551130 649 526 376 95 21149 229 --145
NM_018921chr551130 649 526 376 95 21149 229 --145
NM_018922chr551130 649 526 376 95 21149 229 --145
NM_018923chr551130 649 526 376 95 21149 229 --145
NM_018924chr551130 649 526 376 95 21149 229 --145
NM_018925chr551130 649 526 376 95 21149 229 --145
NM_018926chr551130 649 526 376 95 21149 229 --145
NM_018927chr551130 649 526 376 95 21149 229 --145
NM_018928chr551130 649 526 376 95 21149 229 --145
NM_018929chr551130 649 526 376 95 21149 229 --145
NM_018945chr653024 2938 1030 742 694 11354 11003 191
NM_018970chr763193 2729 2566 2429 772 39 ------
NM_018976chr1242345 2111 980 58 ------
NM_018999chr1034671 4126 3250 ----1574
NM_019001chr354569 4431 4163 4152 1553 ------
NM_019008chr2263808 2902 2353 1210 1089 1081 2905 204 2612 181 --
NM_019009chr1192311 1909 1858 1671 883 803 478 78 49 2694 594 ----
NM_019035chr41524 21926 324 ----
NM_019071chr7------1281
NM_019072chr553050 2716 1651 1484 840 11228 13316 --
NM_019084chr1042149 1942 531 25 --12021 --
NM_019098chr861700 1553 746 738 531 343 1720 ----
NM_019106chr2243374 2522 691 85 22188 69 33021 2136 2126 13340
NM_019114chr932238 2214 976 22553 346 --1866
NM_019596chr2192921 2669 1014 720 680 589 510 455 147 --198 --
NM_019610chr121659 813 2693 362 ----
NM_019885chr272444 2193 2002 1819 644 509 483 1213 2905 28 --
NM_020039chr1231961 1305 65 --61703 1510 1229 772 471 289 --
NM_020123chr102631 195 --1543 --
NM_020134chr271044 994 303 283 177 62 47 1820 ----
NM_020177chr523019 166 ----1431
NM_020184chr252064 1936 1712 1589 196 --1135 1417
NM_020198chr1711040 --186 --
NM_020225chr4------199
NM_020240chr552286 1954 1023 799 288 ------
NM_020310chr1762269 2049 1823 1130 1093 103 189 42526 2176 860 712 1681
NM_020342chr222217 1825 1909 --1138
NM_020346chr1121473 1290 1104 ----
NM_020374chr122190 184 12017 11562 --
NM_020390chr364237 4103 3165 1077 907 806 21227 862 23132 1215 --
NM_020416chr462652 2000 1691 926 168 53 1489 133 --
NM_020440chr132817 1344 1284 --32566 602 240 --
NM_020443chr1156981 6740 6523 5893 5449 4702 4514 4307 2594 2583 2029 1162 705 459 102 14483 26945 2051 32511 2231 1400
NM_020478chr822525 2216 --3556 434 58 --
NM_020546chr593182 3096 3014 2959 2705 2353 2025 1218 368 --22852 2308 --
NM_020638chr1261699 1426 295 240 227 164 ------
NM_020673chr2076781 5195 2875 2248 1469 1282 1216 ----15332
NM_020689chr2051334 1194 1102 333 235 11325 11620 --
NM_020693chr111528 1111 1425 1136
NM_020699chr174976 3910 3758 3732 1251 1129 527 34760 992 904 23886 67 2741 421
NM_020713chr2071928 997 783 705 499 476 224 21112 139 12167 --
NM_020717chrX104847 4713 4263 3982 3933 3803 1561 1146 619 113 64139 1950 1669 1349 1283 428 --41584 1384 164 38
NM_020718chr1646152 4813 2005 116 12550 --14717
NM_020727chr2143088 2961 497 47 21498 906 ----
NM_020734chr1233014 600 70 12410 ----
NM_020742chrX62089 816 589 481 335 283 ------
NM_020749chr831381 785 607 ------
NM_020752chr1012581 --12644 --
NM_020766chrX44030 3369 1379 524 11013 --11101
NM_020772chr1726910 1676 16137 16567 --
NM_020774chr1846146 4583 2298 1621 21950 1500 ----
NM_020776chr1823004 2525 22632 2204 12610 1639
NM_020778chr15103989 3349 3071 1750 1639 1187 1151 712 408 31 31126 555 44 54185 3226 1847 849 359 24812 998
NM_020782chr1234379 638 188 33614 3296 1189 ----
NM_020783chr1822249 1595 ----11649
NM_020792chr321971 226 22365 254 ----
NM_020807chr1651384 365 110 54 26 11495 21625 370 --
NM_020830chr211100 --11081 2825 627
NM_020834chr144599 227 218 48 11697 1418 11537
NM_020841chr12----13989 11537
NM_020845chr12121950 1673 1653 915 896 698 454 445 417 405 220 54 21909 1767 11901 --
NM_020859chr432636 888 44 53946 2833 2506 1544 523 --122
NM_020909chr263574 3240 2864 2555 512 164 ------
NM_020918chr1053169 2878 2299 913 171 1895 ----
NM_020921chr142572 70 --188 --
NM_020922chrX21763 1172 21646 734 ----
NM_020935chr254356 3786 3655 1838 942 --13094 --
NM_020946chr941444 379 209 197 ----21211 670
NM_020948chr122506 1452 13610 --13261
NM_020956chr19124673 4522 4039 3866 3452 3245 1021 489 249 233 53 29 --44259 1066 543 130 --
NM_020964chr1854169 4111 3362 3124 631 --13916 13569
NM_020973chr42230 84 ------
NM_020983chr124492 259 251 132 32211 1950 113 11546 22041 523
NM_021033chr1321024 38 23213 467 ----
NM_021061chr864176 3563 3488 1595 328 202 ----14044
NM_021072chr541634 728 612 292 1414 11897 --
NM_021079chr17122915 2763 2753 2564 2492 2361 2211 2074 1071 1051 825 789 ------
NM_021090chr2224189 4033 1983 161 14533
NM_021097chr222563 810 --1837 1479
NM_021120chrX32990 2831 687 22336 666 22307 1974 --
NM_021135chr683393 2968 1285 1030 796 377 200 22 --22739 2579 --
NM_021143chr191189 1587 1492 --
NM_021191chr1222453 777 11690 ----
NM_021202chr2093004 2649 2629 1973 1932 914 496 218 133 --22707 2142 --
NM_021255chr1422843 1518 1970 12931 --
NM_021638chr474460 3110 3069 1767 1137 325 23 1296 3829 331 221 --
NM_021705chr631531 545 284 1327 --1358
NM_021783chrX52268 1686 823 437 267 ------
NM_021813chr685097 4771 4493 3787 3591 1882 554 502 11377 --21781 303
NM_021911chr545184 4176 884 324 25155 4648 ----
NM_021912chr1563951 3890 3583 3202 1294 891 11234 ----
NM_021949chrX32867 1918 1134 ----1174
NM_021950chr1142221 1604 648 275 ------
NM_021956chr62356 324 1196 --1487
NM_021960chr122774 2350 22733 38 ----
NM_021961chr11136040 5641 5197 4732 4687 1819 1761 1481 1408 1160 1127 417 138 25760 5123 26009 5289 --
NM_021962chr17102313 2294 2181 1676 708 378 101 60 49 40 --3498 192 186 --
NM_021964chr356628 5325 4148 2510 307 ------
NM_022041chr1622517 482 --1473 --
NM_022048chr15115614 5240 4772 4244 2488 2433 1742 1446 1378 1099 558 34190 1860 1198 25436 370 --
NM_022062chr1151850 1479 1276 1205 687 11670 2707 197 1172
NM_022080chr2032619 2061 230 22822 1888 11027 --
NM_022166chr16125567 5361 5244 5049 5017 4955 2232 1819 1176 620 565 38 36065 772 547 13918 --
NM_022169chr113980 257 189 --4618 162 55 27 11236
NM_022351chr833290 2785 1036 33389 3260 2936 2491 486 --
NM_022455chr5----1258 1222
NM_022459chr1355883 5849 4210 1618 766 11091 1464 --
NM_022469chr173060 2897 2586 2264 2166 285 203 12572 ----
NM_022477chr2051584 1445 1253 311 217 11564 --21390 282
NM_022497chr382874 2642 1213 1127 1047 993 653 610 --13016 1666
NM_022648chr284464 4446 4006 3026 1098 841 394 289 34249 4045 277 23759 1171 --
NM_022650chr52891 43 1777 ----
NM_022737chr192859 294 1419 --3321 127 33
NM_022744chr1661292 963 877 403 376 289 1147 1856 --
NM_022755chr952331 1813 811 448 368 --12072 1288
NM_022758chr683008 2908 2574 2217 2189 2083 1278 672 11162 12451 --
NM_022763chr333201 3163 2880 ------
NM_022776chr321272 200 31348 527 450 ----
NM_022781chr943302 848 197 91 --12776 12598
NM_022802chr1031562 1463 221 ------
NM_022824chr531406 593 568 --11658 --
NM_022842chr362844 2216 255 232 197 138 1620 32734 2521 2513 173
NM_022898chr1464262 1816 1276 850 137 50 --24209 143 11796
NM_022977chrX21923 54 1475 31898 1887 1694 --
NM_023923chr1113645 3091 2492 2326 1420 1251 1196 954 811 756 89 43818 3345 700 418 33226 2817 464 22408 1336
NM_023929chr822549 502 ----1387
NM_024076chr1982047 2028 1949 1588 907 827 775 256 1763 --12302
NM_024103chr1951599 1513 515 477 163 171 41311 586 334 26 4487 305 201 143
NM_024294chr683008 2908 2574 2217 2189 2083 1278 672 11162 12451 --
NM_024312chr1221540 179 21092 1060 11412 --
NM_024423chr1824194 519 23776 2870 --12603
NM_024522chr181804 1757 1745 1678 1553 1185 342 318 --21778 122 --
NM_024524chr332655 2545 179 ------
NM_024554chr131693 1364 64 --11253 --
NM_024607chr852910 1666 1495 1115 980 33424 444 169 --22958 386
NM_024610chr31307 ----1297
NM_024613chr811848 21727 409 ----
NM_024624chr221498 509 2168 132 ----
NM_024639chr642815 453 190 166 --1599 --
NM_024659chr23854 823 182 1776 1200 --
NM_024721chr842388 1005 734 93 ------
NM_024740chr1163919 3580 1361 682 518 325 ----23557 1314
NM_024755chr15------1830
NM_024770chr2114724 2584 2165 2079 1996 1944 1574 808 728 673 511 25474 242 22376 1717 --
NM_024798chr1572813 919 828 419 337 282 204 1974 --12340
NM_024811chr1151518 1404 1208 533 116 --41673 1631 670 185 --
NM_024817chr15125239 4308 2399 2391 2261 2171 1745 1205 1113 886 764 681 24936 114 35244 1215 429 32350 1430 1102
NM_024884chr1484107 3686 3323 2974 2962 710 626 292 34501 2786 1259 21038 795 12850
NM_024887chr172042 1970 1596 1414 849 615 401 11543 ----
NM_024889chr10131711 1249 1201 1186 1164 1150 1135 719 704 660 646 634 619 ------
NM_024920chr431596 999 244 ------
NM_024930chr532544 2230 2091 --12254 --
NM_024939chr1641021 496 441 146 1232 21413 83 --
NM_024947chr347737 6549 6210 71 ------
NM_024949chr444436 3985 1687 1619 24691 738 34831 4224 1240 --
NM_024989chr267528 5984 2968 2740 1530 1317 --27688 2471 --
NM_025054chr833179 1180 304 ------
NM_025073chr154659 4500 4435 4245 3598 13900 --11561
NM_025074chr433018 2717 2365 --1399 1764
NM_025106chr1101856 1816 1741 1347 571 472 305 201 174 45 --31760 1259 1217 --
NM_025134chr1612425 11915 --1561
NM_025164chr1132042 1913 855 11847 11929 --
NM_025179chr174364 3653 3616 3528 1660 878 428 33434 1119 160 --13980
NM_025221chr421106 26 ------
NM_025222chr352338 2283 2128 983 377 ----1992
NM_025250chr7112876 2425 2299 2232 2046 1845 997 622 230 201 36 2991 802 42589 665 319 242 --
NM_030579chr1633279 1233 531 1965 2762 749 --
NM_030623chr241728 643 456 44 11217 1294 --
NM_030627chr531633 1591 1347 13071 175 --
NM_030647chr71849 15030 11315 --
NM_030653chr122707 671 ----1637
NM_030674chr1261668 1337 998 945 893 568 --11924 11308
NM_030758chr2251420 1212 554 323 201 21154 404 41189 330 106 95 --
NM_030761chr172634 2617 2449 2078 2058 1844 1050 22380 179 2675 665 21934 1666
NM_030806chr1119212 8002 7405 6879 6723 6454 6344 3204 2426 1598 331 26365 6159 37178 7172 3461 18609
NM_030881chr2222247 2188 1885 32238 1784 292 1135
NM_030918chr194858 4695 4628 4540 4234 4223 4145 3929 744 25398 665 11730 11068
NM_030964chr593172 3057 2719 2556 2450 1384 1271 702 134 --23553 349 --
NM_031268chr1694596 4020 3978 1821 1504 1237 295 279 49 2890 95 24051 381 24773 171
NM_031309chr861981 1970 1677 740 669 250 11912 11485 21767 23
NM_031417chr1972429 2207 1839 934 905 602 257 31902 501 86 1864 --
NM_031426chr952494 2394 2091 530 301 22630 1995 2903 24 --
NM_031427chr14115823 4384 4298 4217 4162 3827 3747 1774 1608 1553 190 ----25240 1690
NM_031439chr861346 751 564 435 250 199 21418 78 ----
NM_031442chrX42910 927 433 41 --1858 --
NM_031444chr222584 286 22150 804 52404 1822 925 432 51 11807
NM_031468chr7167840 7526 7341 5644 5585 5123 4988 2972 2834 2497 2014 1881 1097 739 438 402 27658 275 23063 2841 22178 982
NM_031844chr133785 3595 1363 --13514 --
NM_031845chr253538 2908 2789 2285 1469 --12807 --
NM_031847chr253538 2908 2789 2285 1469 --12807 --
NM_031890chr2242832 2325 2096 360 12567 2238 46 --
NM_032012chr964962 3496 3202 1680 1450 1133 ------
NM_032013chr2051584 1445 1253 311 217 11564 --21390 282
NM_032017chr151588 575 357 346 45 --21750 626 152
NM_032041chr852591 2527 1724 928 541 --1987 --
NM_032042chr552916 2335 1762 821 420 11809 184 --
NM_032050chr222165 138 --2333 128 --
NM_032088chr551130 649 526 376 95 21149 229 --145
NM_032092chr551130 649 526 376 95 21149 229 --145
NM_032105chr1177989 7113 6633 5189 4927 4901 2496 2431 2345 2211 2174 2094 1848 1449 741 432 21 36921 2574 215 12288 15480
NM_032116chr1355482 4357 4112 2085 1921 34074 1293 953 ----
NM_032148chr12------1438
NM_032189chr13154925 4268 4150 4067 4013 3904 1787 1661 871 636 418 406 165 117 54 --24072 3746 --
NM_032193chr1131782 302 80 11435 1266 --
NM_032199chr1063694 3394 2607 1228 221 125 13758 13029 23841 943
NM_032208chr243285 3278 532 282 23404 229 ----
NM_032256chr123924 201 135 1300 1370 --
NM_032268chr1632442 502 438 12744 32248 1212 482 1390
NM_032373chr1064243 4141 4055 3921 1699 1370 11095 --22036 709
NM_032403chr551130 649 526 376 95 21149 229 --145
NM_032424chr1141103 500 452 420 ------
NM_032439chr1031702 1186 466 ------
NM_032444chr1671019 813 797 752 445 239 82 --3878 161 27 1804
NM_032446chr513646 13159 11113 1733
NM_032449chr1122729 2643 2562 2434 2117 1923 1781 1046 792 356 64 52 12174 22091 2086 --
NM_032452chr1431343 611 364 --21461 237 --
NM_032457chr441568 602 235 217 13843 12742 --
NM_032521chr2032968 2934 454 --1771 --
NM_032538chr6152800 2639 2589 2503 2114 1997 956 532 513 443 399 281 122 100 81 2984 455 32346 2193 2023 12525
NM_032595chr1781229 539 386 375 144 112 93 69 --11487 --
NM_032632chr14138 --143 --
NM_032646chr1751510 1380 1368 1323 188 --1703 2413 147
NM_032711chr1753927 3117 3085 534 467 11065 33812 3069 245 --
NM_032778chr333109 2298 1277 12878 ----
NM_032782chr511006 --2842 217 --
NM_032784chr62770 716 ----148
NM_032809chr931352 1290 1053 --1456 --
NM_032810chr102576 212 11174 --21199 473
NM_032818chr9142525 2464 2098 1932 1877 1749 995 388 382 356 263 244 208 161 21662 770 --2857 363
NM_032827chr22249 85 --1122 31134 797 187
NM_032833chr162319 2168 1635 945 532 182 ------
NM_032837chr1711483 --11613 11904
NM_032866chr1523222 2924 1104 --1811
NM_032900chr1073797 3504 1578 1557 350 156 142 2257 127 ----
NM_032968chrX43841 3690 1451 1105 14143 ----
NM_032969chrX43841 3690 1451 1105 14143 ----
NM_032973chrY43833 3682 1451 1105 ------
NM_033020chr131392 1364 1318 13265 13495 1766
NM_033030chr231255 241 30 11533 ----
NM_033102chr12943 49 --41081 1064 979 840 1957
NM_033102chr12943 49 --41081 1064 979 840 1957
NM_033129chr2051818 1265 515 418 196 11529 71989 790 732 274 207 157 85 --
NM_033133chr1773681 3622 3530 2686 1286 1160 199 --41204 936 333 328 --
NM_033143chr474302 4149 4019 1619 1499 296 152 13752 ----
NM_033181chr622661 676 11252 22866 1558 13133
NM_033201chr1681056 1005 972 860 484 382 358 318 ------
NM_033224chr7106752 6549 5701 5325 5239 5118 3199 2889 2387 281 17227 15552 21655 36
NM_033225chr873184 3074 3032 2851 2096 2000 119 ------
NM_033240chr1591365 1086 685 667 639 590 575 560 488 --21622 61 --
NM_033244chr158885 468 205 187 159 110 95 80 --11142 1436
NM_033285chr843014 2832 1040 767 23313 110 ----
NM_033315chr1771941 1640 1500 707 673 457 409 --32048 256 183 --
NM_033326chr1131831 760 54 --1273 --
NM_033375chr1751451 1015 244 34 27 --11020 --
NM_033389chr1754254 4202 4068 3984 502 11370 34131 3077 843 24460 1510
NM_033429chr1522040 594 13220 --1123
NM_033505chr235095 5040 2445 35264 4959 1496 12433 --
NM_033516chr941499 1454 1120 226 --11589 --
NM_033549chr52371 218 --2813 287 1717
NM_033551chr553154 2829 2393 976 457 22595 414 32840 676 390 --
NM_033631chr173532 3333 896 868 443 306 219 1475 2687 210 --
NM_033637chr1083972 3920 3377 2951 2698 1362 1152 681 23852 3719 33815 2556 524 11535
NM_033644chr51145 12230 --22204 695
NM_033645chr51145 12230 --22204 695
NM_033656chr2144479 4262 1275 381 35781 3944 1228 14926 14689
NM_052834chr1832310 2265 1832 1601 2380 352 --
NM_052846chr203403 89 39 --31153 66 22 1157
NM_052860chr53142 94 62 ------
NM_052869chr1751510 1380 1368 1323 188 --1703 2413 147
NM_052875chr1181969 1840 1831 869 828 463 246 38 --11807 --
NM_052876chr1952505 1887 1821 586 42 22467 1971 42531 1790 265 260 --
NM_052877chr12440 42 ------
NM_052879chr1222594 1248 3925 716 205 ----
NM_052885chr1234062 3894 3643 ----13102
NM_052901chr951607 1107 554 478 185 --31573 1363 535 --
NM_052905chr221652 165 ------
NM_052948chr191286 --1147 296 61
NM_052950chr1331990 1670 191 1572 21743 903 1721
NM_053016chr9107573 7336 7320 6841 6755 6612 4895 3155 3070 965 25720 5102 37330 5867 5605 --
NM_053023chr1162994 2366 1004 706 635 329 1288 1656 --
NM_053024chr331151 492 455 11583 ----
NM_053043chr764725 4557 4315 2353 2342 1027 34836 2524 142 15759 21684 445
NM_053056chr1163111 2248 959 926 727 306 1777 --12883
NM_054025chr1121557 623 21807 267 41674 1427 635 145 1463
NM_054033chr23238 120 87 ------
NM_057175chr422483 2171 21980 810 ----
NM_058240chr1441433 1326 386 83 11041 1139 --
NM_080391chr1------1125
NM_080491chr11103398 2850 2807 2685 2647 1217 875 725 449 211 --12419 --
NM_080546chr94810 654 627 569 1508 --1522
NM_080629chr141088 248 241 56 ------
NM_080630chr141088 248 241 56 ------
NM_080645chr61264 1320 ----
NM_080669chr1764430 3153 3128 468 408 377 44761 1351 764 596 54133 3071 1061 180 81 21087 398
NM_080836chr2093918 3859 3820 3345 2975 1802 947 683 130 --13474 11326
NM_080867chr1444324 3720 3262 1385 --1750 --
NM_080872chr833324 486 422 ------
NM_080927chr323086 1142 --1852 --
NM_130391chr953345 3051 2292 1210 195 ----11159
NM_130392chr953345 3051 2292 1210 195 ----11159
NM_130393chr953345 3051 2292 1210 195 ----11159
NM_130436chr21--1339 --1750
NM_130438chr215441 407 270 195 68 1916 --11327
NM_130440chr171347 1024 600 542 204 87 56 2165 77 ----
NM_130807chr1941571 1447 434 159 --32094 755 616 12324
NM_130830chr373828 2848 2784 2557 721 481 213 12623 ----
NM_133170chr20177790 7694 7266 6631 6133 5525 3118 3092 2813 2801 2519 2163 1803 1677 1174 341 224 37616 5696 1759 55530 5265 2828 623 578 35406 3148 230
NM_133264chr1752994 2555 2496 146 98 11316 33666 3410 3332 --
NM_133334chr466120 4772 4440 4432 674 495 11498 15057 12513
NM_133367chr693132 2905 2842 2381 2173 1053 1010 873 566 12829 --1782
NM_133378chr24744 357 332 116 ------
NM_133432chr24744 357 332 116 ------
NM_133437chr24744 357 332 116 ------
NM_133468chr732152 2137 964 --1237 --
NM_133478chr272251 2007 1741 978 892 812 726 12174 --12089
NM_133631chr32451 411 --1191 --
NM_133647chr1593674 3655 3487 2665 2343 1523 1388 212 91 --12742 23749 2811
NM_134325chr151450 1223 677 48 39 1579 ----
NM_138270chrX62960 2920 2901 1368 119 85 ------
NM_138286chr1944105 3845 3834 216 --11334 --
NM_138300chr151530 1331 401 373 360 --1566 --
NM_138434chr721276 98 ----1117
NM_138455chr82387 324 --1245 --
NM_138457chr692789 2468 2413 2309 1063 874 712 502 445 13029 63349 2771 2399 1260 647 72 1286
NM_138473chr1284924 4805 4423 4370 4084 3893 3155 710 --1285 11612
NM_138576chr1464262 1816 1276 850 137 50 --24209 143 11796
NM_138621chr284049 4031 3438 3157 2769 1180 632 65 11592 --11336
NM_138713chr1666810 6070 5925 5109 2720 2677 38037 7104 180 12584 15273
NM_138714chr1666810 6070 5925 5109 2720 2677 38037 7104 180 12584 15273
NM_138735chr21224 --1470 --
NM_138959chr1116773 6215 6101 5361 5308 4438 2330 2115 2046 822 789 36482 1052 923 34677 4301 680 --
NM_138971chr1153526 3394 2709 510 323 12790 1934 --
NM_138971chr1153526 3394 2709 510 323 12790 1934 --
NM_138972chr1153526 3394 2709 510 323 12790 1934 --
NM_138972chr1153526 3394 2709 510 323 12790 1934 --
NM_138973chr1153526 3394 2709 510 323 12790 1934 --
NM_138973chr1153526 3394 2709 510 323 12790 1934 --
NM_139279chr222944 657 2645 93 ----
NM_139321chr2043189 2917 341 193 13719 ----
NM_139323chr2031887 1374 48 ------
NM_144571chr485690 2264 2021 1983 1195 1002 843 301 26111 363 ----
NM_144578chr1445367 4954 4349 453 23677 567 ----
NM_144599chr1573831 3682 3535 3400 1821 1563 202 --15071 1175
NM_144609chr1721235 870 ------
NM_144664chr11------11809
NM_144973chr1294998 4018 3370 3351 3315 2109 1870 1662 1531 --13964 149
NM_145055chr18----23223 2419 13288
NM_145056chr193840 744 139 ----159
NM_145113chr1441373 1243 622 509 1133 31316 538 121 --
NM_145117chr1142942 2220 1211 92 32299 667 532 --1100
NM_145185chr1951930 1384 355 222 75 31939 1866 1647 21834 797 2564 497
NM_145206chr1083000 2296 2245 2159 2117 2111 512 474 --11027 --
NM_145239chr164851 375 215 182 --4444 419 321 82 --
NM_145254chr16------1204
NM_145259chr2106010 5976 5735 5706 5558 5393 4393 2568 232 190 --14418 --
NM_145313chr1031578 1230 155 1388 --1346
NM_145320chr742758 1302 970 372 ------
NM_145321chr742758 1302 970 372 ------
NM_145322chr742758 1302 970 372 ------
NM_145331chr62304 118 ------
NM_145716chr11163 --1126 1429
NM_145759chr132111 1897 719 1786 ----
NM_145800chrX2281 197 1144 1714 --
NM_145802chrX2230 146 193 1663 --
NM_145808chr731118 390 368 ------
NM_145888chr1921335 725 --4612 598 304 274 --
NM_145912chr2273823 3061 2975 2895 978 494 366 24508 1809 54076 3726 3698 1630 1388 2260 182
NM_147147chr673830 3794 3632 2940 1622 1123 725 --13808 --
NM_147150chr931489 333 258 ----13649
NM_147175chrX11510 --1394 --
NM_147181chr421106 26 ------
NM_147182chr421106 26 ------
NM_147183chr421106 26 ------
NM_147202chr9112419 2203 2010 1861 746 471 380 272 121 78 68 --42168 857 804 565 22622 419
NM_148174chr822131 1369 --11653 --
NM_148921chr1752364 2173 2086 1742 576 11911 41643 378 297 156 --
NM_148955chr15135946 5910 5803 4683 4610 4528 2602 2202 2115 2079 1247 155 136 16226 --1466
NM_152237chr2241751 1187 1091 1080 1373 21105 602 1158
NM_152277chr522053 275 ------
NM_152280chr153177 2403 1025 647 292 11335 ----
NM_152287chr1662363 2277 2197 2146 1892 1876 21778 561 --21626 948
NM_152342chr162546 439 --127 --
NM_152352chr1822397 959 12985 ----
NM_152371chr151875 1837 1748 677 539 21862 1800 ----
NM_152384chr291726 1624 1575 1526 1400 1309 1273 740 624 11352 1606 1323
NM_152390chr23658 113 97 --1156 --
NM_152424chrX84298 3972 3620 3136 2956 1209 669 494 13996 11533 --
NM_152470chr18123349 3208 2879 2776 2733 1670 1024 986 924 910 665 252 13342 23493 564 --
NM_152519chr21770 --12027 --
NM_152538chr33499 446 327 11652 --11642
NM_152563chr1171547 1309 1292 1256 1049 322 34 --11228 --
NM_152586chr102425 90 --1702 1225
NM_152594chr152780 167 2919 278 ----
NM_152624chr596814 6438 6106 5777 2561 1748 785 746 413 1507 15079 12683
NM_152629chr973113 2890 1647 1165 716 497 296 1546 --1104
NM_152678chr342427 1055 940 860 264 23 11718 1357
NM_152688chr6------1366
NM_152695chrX11648 --12022 --
NM_152699chr363343 2841 2806 1256 891 511 21508 1330 13743 --
NM_152749chr721043 810 --1754 --
NM_152756chr52651 588 14043 --1170
NM_152787chrX43741 3190 568 302 --32554 1568 90 --
NM_152826chr15135946 5910 5803 4683 4610 4528 2602 2202 2115 2079 1247 155 136 16226 --1466
NM_152866chr1142221 1604 648 275 ------
NM_152924chr15105632 5546 5466 5412 4181 2403 1869 1835 1660 1307 26496 5194 --12010
NM_152996chr121746 815 ------
NM_153013chr521980 1631 ------
NM_153029chr1664174 3630 3612 2635 1562 471 11595 33921 2690 928 23795 786
NM_153050chr2224189 4033 1983 161 14533
NM_153051chr2224189 4033 1983 161 14533
NM_153182chr333109 2298 1277 12878 ----
NM_153188chr534502 1708 1387 --1141 --
NM_153262chr152365 2197 466 113 54 ------
NM_153321chr1731096 1013 296 ------
NM_153322chr1731096 1013 296 ------
NM_153350chr1661579 1494 1448 1115 636 119 11627 41283 1248 184 160 --
NM_153354chr51736 --1641 --
NM_153367chr10133866 3772 3759 3691 3669 3661 3635 3584 3566 2843 824 512 40 23398 402 11188 --
NM_153456chr13126255 5728 5620 4559 4228 2092 2017 1522 1176 1157 867 488 24855 4646 14270 22036 1320
NM_153487chr674551 1543 859 823 716 420 325 --64753 4624 4513 4438 1280 28 24410 1863
NM_153605chr331186 571 137 --11107 --
NM_153619chr1563306 2699 2412 2268 880 269 33237 2628 246 1789 1843
NM_153620chr761792 1778 404 190 89 69 --11143 --
NM_153645chr2252050 2041 870 333 269 ------
NM_153836chr241780 1715 1631 197 ------
NM_170665chr1273915 3477 3000 2807 1307 1278 911 23499 1196 23965 2830 12917
NM_170672chr221549 177 11560 ----
NM_170674chr1541078 322 288 164 ----1202
NM_170677chr1541078 322 288 164 ----1202
NM_170696chr1531363 1351 70 11660 2630 30 --
NM_170697chr1531363 1351 70 11660 2630 30 --
NM_170706chr1104020 3685 3533 3112 613 441 402 363 324 285 11017 44118 3391 3152 1163 13036
NM_172037chr811472 11157 ----
NM_172103chr622615 1911 1924 1417 --
NM_172105chr622615 1911 1924 1417 --
NM_172159chr312010 175 2776 110 --
NM_172160chr312010 175 2776 110 --
NM_172315chr1541078 322 288 164 ----1202
NM_172316chr1541078 322 288 164 ----1202
NM_172349chr5----1258 1222
NM_172350chr12660 375 21581 400 ----
NM_172359chr12664 379 21585 404 ----
NM_172373chr1321130 161 ------
NM_172375chr144369 328 168 141 ------
NM_173083chr14852 89 74 22 ------
NM_173156chr162258 1995 1780 1625 600 141 11963 1729 1310
NM_173167chr1742565 2490 2334 862 22509 1000 ----
NM_173172chr221211 161 --1500 --
NM_173191chr1031165 1036 48 1438 1211 11187
NM_173192chr1031165 1036 48 1438 1211 11187
NM_173193chr1031165 1036 48 1438 1211 11187
NM_173194chr1031165 1036 48 1438 1211 11187
NM_173195chr1031165 1036 48 1438 1211 11187
NM_173198chr952689 2174 2045 890 309 ------
NM_173200chr952689 2174 2045 890 309 ------
NM_173214chr1666810 6070 5925 5109 2720 2677 38037 7104 180 12584 15273
NM_173463chr473746 3580 3071 1650 1522 1376 358 2209 73 11611 --
NM_173470chrX42904 2126 1172 677 32678 2628 163 ----
NM_173473chr1092395 2309 2223 2140 1922 1787 1054 544 321 12485 ----
NM_173495chrX32480 2105 518 12430 ----
NM_173496chr1022384 650 --32446 2295 1053 --
NM_173510chr2252407 2175 1948 977 820 --11068 --
NM_173557chr183677 176 36 ------
NM_173595chr1253810 3217 1758 1232 328 --65222 3941 3936 2074 1875 648 23225 751
NM_173602chr1263409 3260 2854 2459 1195 465 ------
NM_173642chr1158892 8760 8173 7838 7832 7536 7433 6260 2935 2849 2366 1927 1437 1010 214 36507 3169 3066 46980 5590 2372 2211 --
NM_173694chrX22350 1692 21904 771 ----
NM_173808chr121251 62 1650 ----
NM_173809chr1041478 1289 935 136 11066 ----
NM_173812chr1241596 1432 1007 517 1332 ----
NM_173854chr162268 2019 1917 1897 830 497 12058 ----
NM_174934chr1153190 1340 1109 962 915 --31038 155 71 1638
NM_175607chr321432 635 --21655 640 --
NM_175612chr321432 635 --21655 640 --
NM_175624chr12147694 7373 7336 6585 6578 6145 5480 5394 5260 2985 2400 2213 1925 927 16893 --17000
NM_175625chr12147694 7373 7336 6585 6578 6145 5480 5394 5260 2985 2400 2213 1925 927 16893 --17000
NM_175736chr12137686 6962 6482 6431 6253 6247 2765 2157 1313 865 660 278 122 35840 624 54 65468 4970 4867 2323 1712 1116 27135 109
NM_175907chr1862695 2536 2501 1809 636 375 32088 511 449 ----
NM_175921chr563687 3126 1531 840 803 272 --11245 --
NM_175931chr16101973 1658 1629 1367 1360 1337 1298 585 52 43 31987 786 136 11391 11546
NM_176801chr481561 1473 1439 491 184 173 108 58 --1196 --
NM_177968chr272147 2061 1928 1685 1617 219 106 ------
NM_177977chr1751602 1567 1405 1299 313 1415 31849 282 45 1584
NM_177996chr2093068 3012 2877 2406 2187 1075 682 103 35 22146 553 ----
NM_177999chr993310 3249 2883 2833 2500 2446 506 306 54 1696 22650 71 --
NM_178037chr12123645 3565 3510 3485 3278 3218 2453 1013 571 399 323 49 11186 1480 --
NM_178038chr12123645 3565 3510 3485 3278 3218 2453 1013 571 399 323 49 11186 1480 --
NM_178151chrX77175 7049 6360 5795 5215 2157 80 15771 37498 2607 500 17118
NM_178152chrX77175 7049 6360 5795 5215 2157 80 15771 37498 2607 500 17118
NM_178153chrX77175 7049 6360 5795 5215 2157 80 15771 37498 2607 500 17118
NM_178177chr3134 ----1576
NM_178314chr121164 1833 1672 --
NM_178505chr1063193 2544 2392 517 324 79 --12567 --
NM_178815chr10--22116 695 1724 1372
NM_180989chr1321646 801 11843 --1835
NM_181332chrX62089 816 589 481 335 283 ------
NM_181358chr133480 3338 1310 ------
NM_181453chr221434 356 ------
NM_181457chr21162 ----11301
NM_181458chr22295 127 ----11434
NM_181459chr2161 ----11200
NM_181460chr21108 ----11247
NM_181481chr1896482 6214 5030 4352 2057 1219 1200 748 736 35790 2673 433 12262 --
NM_181482chr1896482 6214 5030 4352 2057 1219 1200 748 736 35790 2673 433 12262 --
NM_181483chr1896482 6214 5030 4352 2057 1219 1200 748 736 35790 2673 433 12262 --
NM_181504chr563690 2763 2670 1188 650 438 ------
NM_181521chr1677239 7103 5633 4674 2025 507 460 1812 15547 --
NM_181523chr563690 2763 2670 1188 650 438 ------
NM_181524chr563690 2763 2670 1188 650 438 ------
NM_181672chrX21318 710 --145 --
NM_181673chrX21318 710 --145 --
NM_181784chr242061 1901 506 122 21641 153 32401 1935 1051 --
NM_181828chr2263682 3295 1184 856 733 192 11161 63410 3055 1079 535 403 210 21048 75
NM_181829chr2263682 3295 1184 856 733 192 11161 63410 3055 1079 535 403 210 21048 75
NM_181830chr2263682 3295 1184 856 733 192 11161 63410 3055 1079 535 403 210 21048 75
NM_181832chr2273697 3310 1199 871 748 207 25 11176 63425 3070 1094 550 418 225 21063 90
NM_181836chr532179 2057 885 12137 ----
NM_181838chr521530 639 1503 1612 --
NM_181846chr1963003 1810 868 608 501 375 11049 ----
NM_181876chr462652 2000 1691 926 168 53 1489 133 --
NM_181897chr372171 2089 2008 1656 1647 931 622 ------
NM_182485chr422918 115 23702 1197 ----
NM_182507chr122722 238 11790 4891 876 850 368 1713
NM_182509chr1491582 1416 1174 1129 1105 416 246 184 59 --1309 --
NM_182515chr19156717 6662 5566 4795 4709 4630 4575 4164 4092 1873 957 878 825 713 93 34348 470 201 --16554
NM_182526chr1462982 2040 2016 761 634 142 --42907 2517 2476 814 --
NM_182527chr2241745 777 618 406 1883 51853 808 581 411 222 --
NM_182641chr1741471 471 170 21 ------
NM_182646chr422918 115 23702 1197 ----
NM_182664chr151653 1574 457 248 53 21468 413 11659 --
NM_182697chr721547 1166 31406 484 389 1184 145
NM_182728chr1481651 1512 1499 717 711 588 243 187 --21178 686 21373 546
NM_182757chr673146 2656 1006 744 207 142 98 1306 ----
NM_182758chr1553342 1281 615 448 282 ------
NM_182763chr122763 2339 22722 27 ----
NM_182765chr1031485 1469 111 ------
NM_182898chr775643 5625 5592 4726 4461 2321 313 --11618 25961 760
NM_182899chr775643 5625 5592 4726 4461 2321 313 --11618 25961 760
NM_182925chr581522 1458 1346 1196 1043 1023 142 24 1581 --11212
NM_182936chr1441433 1326 386 83 11041 1139 --
NM_182948chr162843 2625 2159 1266 703 112 12304 ----
NM_182964chr1142942 2220 1211 92 32299 667 532 --1100
NM_182970chr20104028 3989 3655 3328 3241 2838 2765 1500 318 200 --62819 1175 1170 812 378 49 --
NM_183002chr1441433 1326 386 83 11041 1139 --
NM_183004chr1433609 444 161 23907 2825 ----
NM_183006chr2061521 1207 975 419 175 120 --31170 301 81 --
NM_183078chr673823 3470 3078 2862 1147 964 78 --31098 921 127 --
NM_183397chr20134887 4797 4731 4639 4270 4112 1960 1874 1794 1739 989 840 323 24168 481 ----
NM_183425chr2051527 1469 1369 108 41 127 21288 56 --
NM_194286chr12206024 5866 5789 5062 4860 4523 4342 2406 1644 1505 988 945 883 840 726 716 685 422 211 47 25401 953 46001 2436 1742 1626 158
NM_194313chr941765 448 286 166 --31604 1594 140 --
NM_194314chr133655 3493 1686 --23421 1478 14388
NM_194328chr943302 848 197 91 --12776 12598
NM_194329chr943302 848 197 91 --12776 12598
NM_194330chr943302 848 197 91 --12776 12598
NM_194332chr943302 848 197 91 --12776 12598
NM_197941chr572956 2346 2171 1978 1881 911 750 --11897 1939
NM_197968chr13------1709
NM_197970chr231255 241 30 11533 ----
NM_197977chr92627 70 ------
NM_198056chr341960 1817 267 84 21393 140 42081 1739 1614 634 --
NM_198158chr342258 2032 628 448 --12363 --
NM_198159chr342258 2032 628 448 --12363 --
NM_198177chr342258 2032 628 448 --12363 --
NM_198178chr342258 2032 628 448 --12363 --
NM_198196chr392403 2284 2207 2162 2051 1963 1829 945 146 12171 1804 --
NM_198268chr133480 3338 1310 ------
NM_198269chr133480 3338 1310 ------
NM_198270chrX42620 875 535 91 ------
NM_198279chrX3989 933 164 ------
NM_198281chr411224 13212 ----
NM_198320chr12174847 4277 3841 3749 3665 3610 3515 3424 1536 1450 1367 1312 1112 496 440 222 75 --21696 21 15114
NM_198392chr641835 500 121 50 1742 41529 606 425 325 --
NM_198440chr2292447 2154 2097 2030 972 725 682 134 79 --21583 421 --
NM_198490chr362608 2388 1188 1164 906 82 1213 4877 498 68 54 --
NM_198552chr1--1603 --1585
NM_198562chr372369 2203 2148 1668 527 447 392 ----21951 1470
NM_198581chr297426 6655 6567 5295 4998 2746 2328 1417 272 16764 25797 5089 --
NM_198595chr474460 3110 3069 1767 1137 325 23 1296 3829 331 221 --
NM_198715chr136204 5822 1389 14454 24836 558 --
NM_198793chr354143 3125 1041 431 220 ------
NM_198859chr323649 812 13601 --13301
NM_198900chr12137686 6962 6482 6431 6253 6247 2765 2157 1313 865 660 278 122 35840 624 54 65468 4970 4867 2323 1712 1116 27135 109
NM_198904chr532119 837 414 --1165 --
NM_198935chr2042246 1222 923 876 --1748 --
NM_198968chr1351324 1091 910 547 160 23239 3128 ----
NM_199160chr941818 1707 524 381 11795 11664 --
NM_199188chr1222594 1248 3925 716 205 ----
NM_199190chr1222594 1248 3925 716 205 ----
NM_199245chr1252078 927 575 513 480 --22519 2214 --
NM_199320chr422424 969 1935 12826 1798
NM_199320chr422424 969 1935 12826 1798
NM_199355chr1651359 1336 463 433 49 ------
NM_199421chr1444324 3720 3262 1385 --1750 --
NM_199462chr1114367 4281 4201 3312 3183 1985 1899 1783 1217 1096 942 ----11695
NM_199478chrX41825 647 637 99 21754 45 1260 --
NM_199482chr221305 464 --11567 --
NM_201263chr161719 1608 828 700 316 188 ------
NM_201266chr222591 1220 21955 577 22423 1098 --
NM_201267chr2----2229 130 1156
NM_201279chr222591 1220 21955 577 22423 1098 --
NM_201378chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_201379chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_201380chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_201381chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_201382chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_201383chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_201384chr861021 1006 969 906 673 626 1813 6846 787 357 290 194 39 --
NM_201434chr172719 51 2766 69 1627 --
NM_201437chr831393 590 137 ------
NM_201568chr162258 1995 1780 1625 600 141 11963 1729 1310
NM_201569chr162258 1995 1780 1625 600 141 11963 1729 1310
NM_201591chr43222 173 70 164 ----
NM_201592chr43222 173 70 164 ----
NM_201999chr4------11226
NM_203342chr192740 2381 2289 2190 1052 536 482 326 76 --21151 25 --
NM_203343chr192740 2381 2289 2190 1052 536 482 326 76 --21151 25 --
NM_203382chr571653 1627 1446 1321 1294 1196 1154 11598 --1251
NM_203446chr2131163 742 633 12077 22701 1140 --
NM_203459chr132242 2016 776 ------
NM_203463chr234691 4424 4412 13002 13494 11653
NM_205768chr121438 342 --11318 --
NM_205833chrX1206 2243 137 --1162
NM_205836chr51202 1458 ----
NM_205842chr2------1738
NM_205861chr172042 1970 1596 1414 849 615 401 11543 ----
NM_206594chr132400 647 580 23612 2806 ----
NM_206595chr132400 647 580 23612 2806 ----
NM_206853chr622870 1570 ------
NM_206854chr664131 3550 3351 1251 943 198 ------
NM_206855chr665096 4515 4316 2216 1908 1163 ------
NM_206876chr21623 33525 497 86 --23088 800
NM_206909chr898428 7708 6928 3310 3057 2704 1957 1226 991 27798 2610 27038 1428 17552
NM_206914chr1252054 1442 293 284 191 12189 1871 --
NM_207015chr342404 2273 674 98 ------
NM_207043chr141658 1420 737 381 ----21962 33
NM_207044chr141658 1420 737 381 ----21962 33
NM_207047chr141658 1420 737 381 ----21962 33
NM_207303chr1073030 2912 2562 1084 1016 689 581 21674 683 ----
NM_207321chr1031082 255 127 ----1990
NM_207366chr752299 1470 401 235 180 ----2317 131
NM_207387chr1751536 1322 1269 1253 31 21465 709 184 --
NM_207518chr1961330 969 914 455 385 311 --3931 279 262 1414
NM_212464chr1572046 1656 1528 1375 772 752 383 ----1349
NM_212467chr1562623 2233 2105 1952 1065 635 1280 11815 --
NM_212474chr23929 144 80 21000 312 ----
NM_212475chr23929 144 80 21000 312 ----
NM_212476chr23929 144 80 21000 312 ----
NM_212478chr23929 144 80 21000 312 ----
NM_212482chr23929 144 80 21000 312 ----
NM_213589chr255115 4719 2213 1548 1038 13393 24188 3961 --