TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-92b-3p
miRNA Sequence: UAUUGCACUCGUCCCGGCCUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541300 1277 737 658 ----1614
NM_000067chr82545 432 ------
NM_000084chrX66981 4509 1346 1112 431 317 26994 6312 11446 12302
NM_000093chr942479 2438 1832 1732 32502 2220 697 12260 1756
NM_000110chr13855 155 131 ------
NM_000138chr152671 601 1461 --1829
NM_000141chr1031375 177 150 31366 372 323 ----
NM_000163chr541783 1580 1469 606 12065 1208 --
NM_000170chr92456 127 ------
NM_000176chr543675 3344 957 821 ----11475
NM_000208chr1963078 2906 1656 1430 738 676 --14240 --
NM_000210chr222248 793 ----1679
NM_000212chr1712282 --1215 --
NM_000216chrX63851 2965 2779 1139 132 40 23946 2644 1528 --
NM_000217chr1255311 4597 1567 1300 720 ----25240 1474
NM_000237chr811740 ------
NM_000245chr732235 2067 1811 21887 1640 1569 --
NM_000252chrX--11527 ----
NM_000259chr15115991 5790 5553 5471 4838 4729 4592 1971 1264 1202 1067 35831 4451 2211 16187 11778
NM_000264chr912831 1412 --1202
NM_000267chr1773064 2981 2708 2480 1335 677 93 13038 ----
NM_000278chr1011572 ------
NM_000284chrX71805 1429 1400 1245 487 470 154 11939 1757 --
NM_000297chr431756 1421 214 ----12042
NM_000304chr17------1794
NM_000308chr201329 ------
NM_000314chr1063144 3126 2599 1220 1083 442 --1928 12866
NM_000315chr112314 126 ------
NM_000319chr1231196 416 356 --1892 --
NM_000321chr1351232 463 218 146 139 ------
NM_000329chr12132 63 1752 1839 --
NM_000332chr6106918 6908 5431 2455 2364 1571 1529 749 516 373 --25959 872 12782
NM_000343chr22----1132 --
NM_000358chr5--1573 ----
NM_000367chr652189 1874 1812 326 78 12251 2431 423 --
NM_000393chr22547 429 21841 1354 1324 --
NM_000408chr263373 3267 2954 2886 2655 1262 32857 2622 848 13449 --
NM_000430chr1733733 2396 526 --1899 --
NM_000448chr1133157 1019 34 12338 22484 2398 --
NM_000449chr11203 11443 ----
NM_000454chr21192 --1106 --
NM_000461chr374603 4048 1655 1409 1048 1020 650 --13243 13062
NM_000462chr1541781 743 593 556 --11831 --
NM_000489chrX32289 2194 633 22497 2231 12895 1590
NM_000503chr81737 1747 ----
NM_000531chrX----1326 --
NM_000555chrX107805 7733 7263 6842 6452 1747 1610 1548 1541 1437 36592 6074 146 37875 5615 4959 --
NM_000575chr241028 942 835 118 --132 --
NM_000594chr61752 ------
NM_000610chr1142842 2524 2512 81 ------
NM_000618chr1244736 1747 1389 785 --25345 4989 --
NM_000618chr1244736 1747 1389 785 --25345 4989 --
NM_000627chr2145 1723 ----
NM_000683chr41527 ------
NM_000684chr1021284 1235 ----11320
NM_000686chrX31490 258 24 ------
NM_000719chr1286517 5873 5052 4270 2062 1632 1175 744 11412 11531 14814
NM_000724chr1052019 1883 1762 220 94 2723 117 ----
NM_000726chr23422 278 217 11232 1962 --
NM_000788chr431306 1167 436 11329 1954 --
NM_000793chr1494837 4379 4061 3615 1911 1835 1307 942 641 ------
NM_000807chr41483 1637 ----
NM_000809chr488171 6350 6000 2798 2269 1740 1251 423 38364 7538 3380 27701 109 --
NM_000813chr574167 3959 3925 1397 1267 1079 427 --15612 --
NM_000814chr1574137 3498 1560 1082 964 805 602 13331 ----
NM_000816chr51674 ------
NM_000817chr211067 ------
NM_000824chr41287 3839 175 130 ----
NM_000826chr42993 746 ------
NM_000845chr73469 453 407 ------
NM_000857chr4--1442 ----
NM_000868chrX42517 2489 2478 611 1694 12310 --
NM_000876chr6--11428 ----
NM_000901chr432040 1687 691 --1903 1504
NM_000919chr52622 497 ----1632
NM_000941chr72325 43 ------
NM_000945chr221905 172 ------
NM_000950chrX43518 3391 2629 2488 22779 659 --23304 417
NM_000956chr1441103 419 315 86 ------
NM_000958chr531267 1169 1127 ----157
NM_000959chr163824 3432 2998 1393 862 573 23966 3334 11204 13621
NM_000965chr31170 ------
NM_000983chr141596 1226 641 85 11550 ----
NM_001001323chr1253076 2772 2667 2484 2176 12128 ----
NM_001001389chr1142842 2524 2512 81 ------
NM_001001390chr1142842 2524 2512 81 ------
NM_001001391chr1142842 2524 2512 81 ------
NM_001001392chr1152888 2570 2558 127 46 ------
NM_001001395chr1212755 2327 307 ----
NM_001001396chr144243 3294 931 235 ----13343
NM_001001419chr554953 2071 2025 1321 966 14450 1631 --
NM_001001420chr554953 2071 2025 1321 966 14450 1631 --
NM_001001436chr161696 ------
NM_001001481chr842551 980 826 579 22970 2527 --1314
NM_001001483chr111351 ------
NM_001001484chr1031856 1824 1784 31591 519 386 ----
NM_001001557chr842194 1907 1884 504 ------
NM_001001665chr292783 2723 2588 2468 2377 2180 795 599 487 1480 ----
NM_001001711chr11182 ------
NM_001001870chr174816 792 305 53 1523 ----
NM_001001890chr2163768 3184 3124 1642 1427 1247 12653 ----
NM_001001933chr1--1393 ----
NM_001001974chr1022384 2028 11959 11686 1281
NM_001002243chr22927 764 ------
NM_001002257chr233485 1309 190 13570 ----
NM_001002919chr22551 469 ----1537
NM_001003652chr18128267 6901 6767 6616 5588 2719 2628 2475 2297 1486 1349 1156 28273 430 ----
NM_001003674chr18116968 4483 4317 2766 2448 2373 1529 1383 961 665 542 46975 5062 1716 1060 24732 988 --
NM_001003675chr18116968 4483 4317 2766 2448 2373 1529 1383 961 665 542 46975 5062 1716 1060 24732 988 --
NM_001003679chr131512 380 178 11806 ----
NM_001003712chr1243958 3877 3414 400 --1714 11059
NM_001003800chr963473 3148 2884 1215 808 563 1528 11058 --
NM_001004056chr4--183 ----
NM_001004065chr973579 3463 1538 1212 754 400 100 31474 1465 140 ----
NM_001004196chr321136 417 ------
NM_001004317chr674396 3780 3392 3259 3129 1569 1166 --23447 726 --
NM_001004360chr241811 515 412 191 31457 1314 69 1447 --
NM_001004419chr1263267 3015 1518 951 741 363 ----13511
NM_001005386chr21463 ------
NM_001005463chr1011789 ------
NM_001005473chr566539 5503 4599 4501 4254 2490 --14404 --
NM_001005474chr3--11398 ----
NM_001005476chr22497 456 ------
NM_001005738chr191721 ------
NM_001005746chr23422 278 217 11232 1962 --
NM_001005747chr23422 278 217 11232 1962 --
NM_001005782chr2167 ------
NM_001006117chrY--1235 ----
NM_001006118chrY--1235 ----
NM_001006120chrY--1235 ----
NM_001006600chr551946 1561 877 656 325 22452 645 ----
NM_001006610chr161954 ------
NM_001006634chr161662 ------
NM_001006657chr232744 2213 653 2442 73 ----
NM_001007023chr1494837 4379 4061 3615 1911 1835 1307 942 641 ------
NM_001007157chr7--145 ----
NM_001007245chr71218 ------
NM_001007466chr675059 4535 3717 1646 705 60 49 24416 1409 14525 12056
NM_001007526chrY--1235 ----
NM_001007553chr11310 ------
NM_001007794chr11258 ------
NM_001008222chrX11384 ------
NM_001008225chr7--1665 --1205
NM_001008239chr1843784 3657 3614 2887 1671 ----
NM_001008391chr111264 ------
NM_001008408chr796434 6404 5845 5131 4998 4288 3993 1514 423 1843 ----
NM_001008495chr862292 2004 1594 787 390 180 11687 --1666
NM_001008539chr853762 1815 1605 498 427 45420 5341 5152 4516 11728 --
NM_001008738chr542376 539 453 320 --21864 1856 22952 2714
NM_001008756chr322375 1660 1844 --12558
NM_001008801chr1941352 782 416 388 --31513 698 347 1865
NM_001009554chr493720 3106 1865 1537 1149 425 209 192 154 156 ----
NM_001009554chr493720 3106 1865 1537 1149 425 209 192 154 156 ----
NM_001009555chr4--11787 --11760
NM_001009899chr386305 5986 5697 5539 4811 1929 1188 954 16491 35336 1381 826 16203
NM_001009909chr1143721 3121 703 284 --23472 2433 --
NM_001009993chr284562 4483 4146 2874 641 421 338 243 --21613 35 --
NM_001010861chr131723 1032 321 1669 ----
NM_001010888chrX63404 3214 3061 2983 1542 1293 24537 1516 1465 --
NM_001010891chr566595 6115 6089 6019 2165 1276 144 26199 5134 12552
NM_001010924chr102939 147 ------
NM_001010942chr1231009 933 470 21034 879 21304 1209 --
NM_001010971chr1164 11006 1849 --
NM_001010986chrX72525 2349 2177 2084 925 663 318 52403 2336 2064 1770 777 ----
NM_001011515chr4--21028 959 ----
NM_001011516chr4--21028 959 ----
NM_001011537chr332157 2028 556 ------
NM_001011666chr786583 6231 5426 4422 2107 1937 1316 193 24561 4529 21391 1383 --
NM_001011724chr131228 1299 ----
NM_001011725chr131228 1299 ----
NM_001012393chr1164501 4453 4396 4245 1439 930 --25184 4794 --
NM_001012420chr1542932 2309 1851 671 42938 2500 2320 509 ----
NM_001012423chr1542932 2309 1851 671 32938 2320 509 --12500
NM_001012751chr1051835 1452 619 611 338 11951 11806 1519
NM_001012754chr1351883 1790 1549 508 377 ------
NM_001012755chrX33668 3537 1049 24635 4524 14995 --
NM_001012761chr562689 2666 2277 2044 439 218 --12683 --
NM_001012968chrX42574 2253 1768 300 22821 698 ----
NM_001013415chr421018 116 1413 1292 11603
NM_001013620chr12158058 7645 7510 6951 6745 6505 5878 5555 2877 2773 2409 1866 1851 923 377 --22645 103 11481
NM_001013635chr121326 ------
NM_001013699chr121448 ------
NM_001013746chr732359 2012 1664 12350 ----
NM_001014764chr17--1158 ----
NM_001014797chr1055576 1856 1703 1408 556 22594 1561 16488 --
NM_001014972chr2182 ------
NM_001015048chr1473267 2839 2631 2583 2503 626 306 ------
NM_001015049chr1473267 2839 2631 2583 2503 626 306 ------
NM_001015880chr1051675 1528 1211 615 537 ----1585
NM_001015885chr20--1339 ----
NM_001015892chr51174 ------
NM_001017371chr24917 407 320 96 ------
NM_001017395chr353492 3328 2523 1138 1037 2790 164 --12536
NM_001017406chr12180 46 ------
NM_001017440chr7117853 7126 6166 2420 2195 1561 1461 1335 1115 567 153 48255 6174 1418 241 ----
NM_001017923chr142185 172 11187 ----
NM_001017926chr841394 240 197 179 21690 1551 ----
NM_001018037chr921362 325 ------
NM_001018053chr121882 361 21975 1666 ----
NM_001018067chr155190 4522 4504 4187 3613 --14019 1914
NM_001018068chr155190 4522 4504 4187 3613 --14019 1914
NM_001018069chr155190 4522 4504 4187 3613 --14019 1914
NM_001018074chr543675 3344 957 821 ----11475
NM_001018075chr543675 3344 957 821 ----11475
NM_001018076chr543675 3344 957 821 ----11475
NM_001018077chr543675 3344 957 821 ----11475
NM_001018676chr82352 99 1481 ----
NM_001018677chr82352 99 1481 ----
NM_001023567chr1552424 2324 2259 2073 674 1512 --11542
NM_001024094chr543675 3344 957 821 ----11475
NM_001024218chr141817 162 ----
NM_001024647chr1277131 5293 5159 2946 2112 771 227 36865 4728 874 15143 --
NM_001024649chr5102816 2453 1181 1130 949 941 405 361 181 150 --1493 12504
NM_001024956chr1135595 5172 889 35803 2254 1429 --1576
NM_001025076chr1076120 5601 5362 4054 3907 3885 542 21847 516 ----
NM_001025077chr10107478 6959 6720 5412 5265 5243 1900 1373 1259 259 11874 25069 385 --
NM_001025079chr383896 3790 3719 3124 2718 2550 649 183 13958 --11524
NM_001025105chr531538 201 127 --11463 --
NM_001025108chr294121 3852 3580 3420 3121 3097 1642 1171 199 --11551 43893 3827 1540 433
NM_001025201chr21661 ------
NM_001025356chr1242922 2373 1847 79 12265 --1966
NM_001025580chrX53997 3372 3245 2672 2650 --1425 --
NM_001025595chr431690 1521 586 --11300 --
NM_001025596chr111381 ------
NM_001025603chr11203 11443 ----
NM_001029858chr643374 2704 2423 1097 1738 198 --
NM_001030006chr1792437 2023 718 678 509 448 384 325 44 ------
NM_001030007chr1642958 1557 841 341 2740 505 ----
NM_001030055chr1443088 795 682 264 24291 3119 13188 --
NM_001031679chr1293211 2441 1297 1073 895 390 364 293 174 23566 3470 23073 683 --
NM_001031695chr2244188 1963 1476 1407 163 15057 14060
NM_001031710chr71937 ------
NM_001032288chr2031439 1143 226 ------
NM_001032293chr172467 204 1568 ----
NM_001032380chr1021855 536 --1583 --
NM_001032393chrX--1649 ----
NM_001033044chr121472 1249 ------
NM_001033045chr273742 3278 3082 1436 1216 508 371 13688 ----
NM_001033047chr441808 905 653 549 --1166 --
NM_001033056chr121472 1249 ------
NM_001033059chr641717 1534 811 132 --1143 1330
NM_001033112chr51592 ------
NM_001033507chr11415 ------
NM_001033557chr231184 891 344 11124 ----
NM_001033561chr173873 645 53 ------
NM_001033578chr861485 816 620 429 155 115 ----12340
NM_001033602chr1362062 1052 249 207 186 152 ------
NM_001033925chr1051640 1559 1399 853 27 ------
NM_001034837chr51777 ------
NM_001034838chr51777 ------
NM_001034845chr41943 1318 --1571
NM_001034954chr1073202 3025 3009 2664 2575 820 614 --12153 --
NM_001034955chr1073202 3025 3009 2664 2575 820 614 --12153 --
NM_001034956chr1073202 3025 3009 2664 2575 820 614 --12153 --
NM_001034957chr1073202 3025 3009 2664 2575 820 614 --12153 --
NM_001035chr111206 ------
NM_001035003chr421409 454 ------
NM_001035004chr421409 454 ------
NM_001035267chr121256 ------
NM_001037132chr762198 2151 2095 1645 1603 734 12089 ----
NM_001037133chr762198 2151 2095 1645 1603 734 12089 ----
NM_001037174chr22746 423 --12104 --
NM_001037317chr131723 1032 321 1669 ----
NM_001037553chr2144607 4424 671 75 --24007 3196 13434
NM_001039199chr2074378 4240 3686 3624 3488 1283 102 35010 4441 664 --14224
NM_001039538chr243202 2983 885 635 ------
NM_001039547chr3147596 7035 6870 6532 5700 5503 5361 5173 5065 2273 2211 2202 2081 51 11966 42666 2065 1920 1767 --
NM_001039570chr2284633 1618 1573 1377 981 919 784 535 11092 ----
NM_001039571chr2284633 1618 1573 1377 981 919 784 535 11092 ----
NM_001039585chr164081 3689 3255 1650 1119 830 24223 3591 11461 13878
NM_001039590chrX53855 2714 2490 227 179 1204 11333 --
NM_001039591chrX53855 2714 2490 227 179 1204 11333 --
NM_001039618chr1144203 1268 1078 671 ----12009
NM_001039693chr293771 3318 3034 3017 3009 2642 1230 955 293 --13251 --
NM_001039711chr11870 ------
NM_001039712chr11870 ------
NM_001039762chr1061855 1813 1699 1668 961 212 --1476 --
NM_001039840chrX106086 5606 5130 4350 2411 2227 1406 1064 477 385 24966 4182 ----
NM_001039937chr1354084 1563 666 376 189 13857 ----
NM_001040001chr641863 1491 204 66 ------
NM_001040020chr751565 1380 1217 294 77 --1466 --
NM_001040057chr741170 962 348 242 --141 --
NM_001040101chr451605 1518 1139 1027 576 --1114 --
NM_001040135chr71528 1798 ----
NM_001040214chr631989 599 465 11645 22378 1495 --
NM_001040272chr951872 1715 869 565 378 1910 --11803
NM_001040284chr1695946 5217 4872 2198 1830 1692 1023 939 827 1539 21409 36 --
NM_001040402chr443118 2698 960 198 12606 ----
NM_001040429chr1353341 1367 1072 979 334 22691 505 ----
NM_001040439chr16--11476 ----
NM_001040446chr572529 2348 2188 1708 914 407 184 12003 ----
NM_001040450chr1542867 2670 2450 1057 12479 ----
NM_001040453chr1542867 2670 2450 1057 12479 ----
NM_001040665chr764894 4380 3443 1375 1066 216 34715 3922 3642 34870 4754 1984 --
NM_001040697chr111469 ------
NM_001040712chr952859 726 555 360 335 33155 1325 675 --11243
NM_001040876chr4----1399 --
NM_001042355chr1654687 4287 3947 1309 1215 31643 1413 563 14324 --
NM_001042412chr1654687 4287 3947 1309 1215 31643 1413 563 14324 --
NM_001042413chr943405 2918 779 707 11655 13448 --
NM_001042430chr141213 ------
NM_001042453chrX31716 1520 458 ------
NM_001042473chr1042082 1945 772 456 ------
NM_001042492chr1773064 2981 2708 2480 1335 677 93 13038 ----
NM_001042494chr1553723 1382 534 182 158 ------
NM_001042495chr1553723 1382 534 182 158 ------
NM_001042496chr1553723 1382 534 182 158 ------
NM_001042497chr1553723 1382 534 182 158 ------
NM_001042498chrX11064 --1678 --
NM_001042510chr852172 1940 277 253 177 21538 621 1414 --
NM_001042511chr852172 1940 277 253 177 21538 621 1414 --
NM_001042517chr135841 758 708 684 153 2921 639 ----
NM_001042537chrX4843 517 284 100 ------
NM_001042555chr1234620 3600 1252 14799 23240 1924 --
NM_001042599chr287677 7094 6218 6039 5047 1532 1097 136 --17477 --
NM_001042601chr342829 981 653 440 2689 324 ----
NM_001042604chr344806 4667 3429 111 1240 34529 4067 202 --
NM_001042618chr14--190 ----
NM_001042646chr341968 1943 657 500 11904 ----
NM_001042683chr631325 655 639 1533 ----
NM_001042749chrX41621 741 654 536 11424 ----
NM_001042750chrX41621 741 654 536 11424 ----
NM_001042751chrX41621 741 654 536 11424 ----
NM_001044385chr243762 3327 2836 2658 3769 484 96 11601 13227
NM_001046chr542993 2170 2017 1945 33022 2943 2924 ----
NM_001050chr1741373 1238 1139 341 11436 ----
NM_001068chr31107 ------
NM_001069chr61122 ------
NM_001071775chr1331910 724 569 11285 ----
NM_001079874chr121631 209 --1427 12096
NM_001083620chr42992 745 ------
NM_001099678chr366439 6087 4956 4316 667 243 45929 5504 1331 308 26354 5045 --
NM_001100108chr1147882 6267 6208 6076 5969 5963 5632 5436 3086 3021 2372 2114 1773 625 38375 8206 528 11816 --
NM_001106chr3159571 9509 9018 8450 8229 8007 7195 6567 6250 6037 2978 2533 2069 1866 819 ------
NM_001119chr421505 1390 --186 --
NM_001121chr1031904 1752 84 ------
NM_001128chr1642958 1557 841 341 2740 505 ----
NM_001165chr111130 ------
NM_001167chrX126519 6486 6037 5442 5161 4775 4767 4177 889 651 542 307 16431 25561 1905 --
NM_001173chr1443088 795 682 264 24291 3119 13188 --
NM_001177chr1232197 1753 204 1129 --1456
NM_001186chr2132767 2314 2031 43131 2994 2840 2268 22226 968 --
NM_001198chr642406 1886 671 438 --11734 --
NM_001200chr201368 ------
NM_001201chr473878 3837 3476 3084 2756 314 248 --32858 843 529 11409
NM_001204chr277651 7019 6511 5046 4848 3007 398 12544 --1515
NM_001215chr1--1358 ----
NM_001232chr121142 1130 ----11087
NM_001241chr272421 2012 1677 1662 959 470 326 1102 1789 --
NM_001241chr272421 2012 1677 1662 959 470 326 1102 1789 --
NM_001256chr1762965 2877 2407 2184 1000 562 21798 541 --1176
NM_001270chr5------1722
NM_001282chr1792437 2023 718 678 509 448 384 325 44 ------
NM_001290chr42774 249 ------
NM_001300chr101406 ------
NM_001304chr1743801 3779 2692 1328 33053 1046 280 ----
NM_001305chr72814 787 ------
NM_001310chr1252068 1211 365 356 130 ------
NM_001315chr632247 1946 836 12050 11790 11703
NM_001316chr201480 ------
NM_001349chr2------1580
NM_001356chrX22532 2221 11793 ----
NM_001358chr41339 ------
NM_001363chrX1682 ------
NM_001364chr1164615 4585 1721 1351 410 110 1204 14222 --
NM_001390chr1863417 2712 1260 791 572 216 ------
NM_001391chr1831147 1133 1060 ------
NM_001395chrX1959 ------
NM_001396chr2152772 2719 2148 883 74 1522 ----
NM_001401chr951584 1433 557 329 248 1571 ----
NM_001412chrX93753 3305 2540 2337 2281 735 457 216 103 --13410 --
NM_001418chr11295 29 1244 1168 --
NM_001418chr11295 29 1244 1168 --
NM_001427chr741852 1812 1515 1432 21783 49 ----
NM_001429chr2221021 388 1362 --1134
NM_001430chr231857 1795 1576 1773 ----
NM_001432chr493730 3646 3398 3365 2559 2411 714 488 186 13612 11570 --
NM_001438chr183626 3544 3347 2691 2330 1151 949 697 1923 --1723
NM_001443chr2--147 ----
NM_001462chr191721 ------
NM_001483chr711010 ------
NM_001498chr631334 1322 548 21218 1194 ----
NM_001527chr6104593 4466 3818 1729 1360 1239 1020 913 614 314 24872 518 24106 2951 11159
NM_001543chr514627 ------
NM_001546chr621448 594 --1284 1959
NM_001550chr71218 ------
NM_001554chr1--1572 ----
NM_001609chr1043324 3107 2932 2736 21353 1326 1319 --
NM_001614chr171691 ------
NM_001614chr171691 ------
NM_001616chr263290 2417 1319 777 469 90 ------
NM_001634chr641717 1534 811 132 --1143 1330
NM_001650chr1843874 1423 1051 102 --33732 3530 1121 --
NM_001656chr521682 1631 11446 ----
NM_001663chr1452441 2061 1914 1814 809 32633 651 339 ----
NM_001677chr131062 915 433 21087 1025 1953 --
NM_001679chr3--1791 ----
NM_001682chr1252790 2486 2381 2198 1890 11842 ----
NM_001684chr133960 3011 648 ----13060
NM_001695chr851527 643 553 531 359 167 12922 --
NM_001698chr91178 134 --1133
NM_001699chr1911140 2431 228 41705 1591 473 465 1169
NM_001706chr32241 117 --1781 --
NM_001718chr611215 ------
NM_001730chr133304 212 71 21182 1048 11089 11006
NM_001730chr133304 212 71 21182 1048 11089 11006
NM_001744chr54535 516 202 114 ------
NM_001746chr5102816 2453 1181 1130 949 941 405 361 181 150 --1493 12504
NM_001752chr115587 149 93 49 24 ------
NM_001754chr2163768 3184 3124 1642 1427 1247 12653 ----
NM_001759chr1285303 4468 4403 4004 1750 1492 1297 722 1324 ----
NM_001777chr383896 3790 3719 3124 2718 2550 649 183 13958 --11524
NM_001796chr16--144 ----
NM_001797chr16167 ------
NM_001798chr1221119 1027 ------
NM_001806chr1942570 2547 1089 176 --1491 --
NM_001822chr21661 ------
NM_001830chrX83992 3908 3637 3534 3386 2881 1318 1128 13724 ----
NM_001839chr1--1195 ----
NM_001845chr1321243 261 11284 ----
NM_001854chr12526 380 11428 11002 --
NM_001855chr91357 ------
NM_001856chr11276 ------
NM_001858chr644828 4301 3353 1429 --15065 11792
NM_001880chr21257 ------
NM_001892chr531538 201 127 --11463 --
NM_001893chr171413 ------
NM_001894chr2221212 1146 ------
NM_001895chr2021242 1127 ------
NM_001901chr6----1351 --
NM_001918chr1128807 8653 7475 6660 6628 5842 2576 2383 1638 1505 516 319 28907 6197 67981 7881 6958 6950 758 185 18318
NM_001933chr141142 ------
NM_001949chr642762 2541 2247 72 23122 2861 33231 2145 278 --
NM_001950chr16--1753 ----
NM_001951chr8144 ------
NM_001968chr4--1277 ----
NM_001969chr14123564 3531 3398 3385 1243 1170 985 973 582 471 83 70 11571 23339 809 --
NM_001981chr132300 2239 475 21885 404 ----
NM_001995chr4--11348 ----
NM_001999chr541442 1433 1032 1018 21529 409 ----
NM_002006chr485784 5587 4340 4275 2158 2134 1179 507 35290 5055 1620 11925 12246
NM_002013chr141214 ------
NM_002015chr1343167 2554 1004 209 2804 426 ----
NM_002017chr1121191 974 11204 ----
NM_002024chrX21810 1658 --1800 11745
NM_002025chrX138892 8650 8309 7790 7510 6261 6090 2628 2601 2388 2073 785 757 ------
NM_002027chr82352 99 1481 ----
NM_002035chr1843983 3836 3400 3355 22493 950 1690 13820
NM_002037chr61282 ------
NM_002061chr181920 1859 1725 1383 1251 512 63 29 2590 255 ----
NM_002063chrX1994 ------
NM_002065chr121472 1249 ------
NM_002069chr741621 1569 264 200 21730 97 11869 --
NM_002074chr1--11757 1326 --
NM_002092chr4104055 3830 3821 3768 3603 3541 3085 1690 1197 593 24900 4479 14577 --
NM_002099chr42758 136 12057 ----
NM_002106chr41115 ------
NM_002128chr1372449 2187 1818 877 858 385 105 ------
NM_002130chr51660 21543 1387 ----
NM_002136chr121228 1602 1677 --
NM_002137chr72645 135 --22248 525 1420
NM_002148chr21195 1692 1253 --
NM_002156chr2------1443
NM_002158chr253806 3565 3276 1148 1063 32525 1124 863 --12760
NM_002210chr253509 2869 2819 2520 1193 13086 1754 13183
NM_002214chr765042 5010 4367 4117 3920 3837 1246 11215 --
NM_002222chr33537 377 178 1454 --1364
NM_002226chr141105 ------
NM_002240chr214561 544 216 149 ------
NM_002253chr4--11332 ----
NM_002264chr394645 3921 2028 1621 1320 1083 919 911 859 ------
NM_002270chr5114925 4241 4197 3604 1744 1535 1461 1190 1155 991 22 14484 1859 15303
NM_002271chr1322393 675 --1802 --
NM_002285chr294121 3852 3580 3420 3121 3097 1642 1171 199 --11551 43893 3827 1540 433
NM_002296chr161691 1539 1451 1397 1254 36 21333 633 ----
NM_002351chrX21253 124 11602 ----
NM_002356chr652115 1050 891 488 339 --22078 774 --
NM_002358chr4232 26 --1144 --
NM_002372chr51457 --2686 509 166
NM_002374chr243202 2983 885 635 ------
NM_002395chr62581 525 ----11177
NM_002398chr241265 1231 382 348 ----11509
NM_002448chr4--1716 ----
NM_002481chr1117837 5750 5188 2972 2933 2268 2072 2028 1858 1762 1043 --35699 2056 1592 --
NM_002499chr151291 --21863 775 1994
NM_002500chr251251 1239 1178 343 105 21305 1043 11271 --
NM_002515chr1441972 1549 1390 254 --11693 --
NM_002518chr251134 1049 881 170 157 21226 1089 ----
NM_002522chr1733530 996 472 2611 542 13590 --
NM_002524chr11948 ------
NM_002545chr1164501 4453 4396 4245 1439 930 --25184 4794 --
NM_002568chr81324 ------
NM_002572chr111261 ------
NM_002577chr322755 943 2575 315 12539 1486
NM_002578chrX1168 ------
NM_002594chr2012070 --12158 11664
NM_002595chr1251228 462 378 276 266 --11497 --
NM_002613chr1675044 4756 4171 4159 3810 3583 1057 15403 ----
NM_002641chrX3513 242 170 21589 39 11438 --
NM_002645chr1142163 2085 1225 1090 --1399 --
NM_002655chr865141 4543 3314 1800 1769 870 34992 1872 1241 14154 --
NM_002656chr64928 902 705 224 ------
NM_002703chr4----1526 21978 170
NM_002706chr22467 174 --159 --
NM_002709chr243581 3415 2647 2362 1186 1345 1758
NM_002710chr12171 ------
NM_002711chr71280 1338 198 1578
NM_002713chr121093 482 1141 --11007
NM_002717chr81644 ------
NM_002734chr1751866 1496 1404 510 345 --22059 248 --
NM_002736chr732199 747 550 2577 276 ----
NM_002740chr362786 2519 1067 1031 751 488 --1599 --
NM_002745chr22104301 3964 3387 3284 1629 1401 868 756 671 311 11103 12913 1784
NM_002753chr4--1722 ----
NM_002775chr101179 ------
NM_002792chr20125 ------
NM_002800chr6--135 ----
NM_002815chr171174 ------
NM_002822chr1211120 125 11573 --
NM_002833chr1531578 1293 1042 11484 ----
NM_002834chr1253604 3288 3213 986 123 23760 3721 11303 --
NM_002835chr7--1544 ----
NM_002836chr20--152 ----
NM_002837chr1263927 3426 1769 1519 869 667 23600 1392 13099 11777
NM_002839chr952859 726 555 360 335 33155 1325 675 --11243
NM_002843chr1143319 2633 1333 1293 ----1957
NM_002850chr191462 ------
NM_002851chr72685 185 --1584 --
NM_002886chr364842 2074 1405 1240 1224 622 23561 1961 ----
NM_002892chr141540 1598 ----
NM_002893chrX136 ------
NM_002904chr61159 ------
NM_002940chr4----1399 --
NM_002942chr33442 414 125 11084 182 --
NM_002951chr201213 --1273 --
NM_002957chr963511 3257 3113 3032 2525 683 ------
NM_002959chr134374 4185 2716 33783 1666 1337 ----
NM_002967chr19--1160 ----
NM_002968chr1631082 387 331 ------
NM_002971chr331010 982 916 ------
NM_002977chr23998 432 329 33455 1107 940 32666 2163 122 --
NM_002998chr842077 817 646 197 --1471 --
NM_003010chr1722277 2195 32454 2420 177 --2515 112
NM_003012chr872760 2672 2438 2154 558 543 120 1573 ----
NM_003017chr621400 1344 1205 21418 166 --
NM_003031chr161954 ------
NM_003034chr12158060 8001 7624 7529 7074 6014 5883 5602 2322 2231 1933 1875 1179 803 288 35754 2467 882 16409 --
NM_003042chr341952 1817 625 55 32075 2017 1424 1733 --
NM_003043chr384299 3648 3276 3121 2815 1706 133 115 34162 3788 1396 ----
NM_003046chr853762 1815 1605 498 427 45420 5341 5152 4516 11728 --
NM_003048chr262463 2204 1139 744 615 386 12759 --1898
NM_003051chr141907 1498 1461 73 1444 ----
NM_003054chr101282 ------
NM_003068chr81759 3824 398 386 ----
NM_003079chr1721055 779 ------
NM_003081chr20--21135 867 ----
NM_003099chr1556134 4653 2469 2150 1416 21543 370 11658 --
NM_003107chr611778 --12048 12479
NM_003108chr267226 6052 5890 5783 354 39 --12436 11432
NM_003111chr24917 407 320 96 ------
NM_003112chr773138 2804 2793 1032 943 890 793 --12963 12723
NM_003113chr21102 ------
NM_003142chr2--1249 ----
NM_003155chr83335 179 157 ------
NM_003161chr172495 175 42512 800 755 742 ----
NM_003178chr331658 193 144 --1619 22268 805
NM_003185chr20--1419 ----
NM_003187chr51174 ------
NM_003199chr1885353 4867 3841 3788 1021 863 254 211 2420 110 23743 1196 21655 1487
NM_003204chr1711306 ------
NM_003211chr1261484 1357 297 121 47 36 1680 1115 11624
NM_003221chr644016 952 717 622 13695 ----
NM_003247chr631758 680 330 ----21360 670
NM_003257chr1521252 261 ------
NM_003262chr354776 1791 1517 1157 428 14848 14460 --
NM_003274chr2162994 2264 2162 1081 985 827 12941 11824 --
NM_003291chr131675 ------
NM_003298chr376150 5321 5254 2232 941 443 88 1655 11740 --
NM_003314chr51185 ------
NM_003318chr6----1224 --
NM_003338chr1041208 715 678 609 11530 ----
NM_003339chr511263 ------
NM_003342chr1753181 2383 1059 1042 364 1143 12044 --
NM_003349chr2031439 1143 226 ------
NM_003352chr2167 ------
NM_003363chr31540 --142 --
NM_003374chr52815 675 ------
NM_003385chr2------1248
NM_003387chr252900 809 621 468 343 12486 --12719
NM_003389chr92489 398 ------
NM_003392chr354287 3580 2669 1552 466 --13064 --
NM_003400chr21313 ------
NM_003403chr141214 --1747 --
NM_003404chr2042048 1574 345 297 11807 11780 167
NM_003406chr81306 ------
NM_003411chrY21795 107 ------
NM_003412chr342947 2793 2043 665 --11186 1702
NM_003413chrX2636 131 1584 --11510
NM_003418chr33839 781 128 ------
NM_003423chr1941612 1602 976 630 32447 715 503 12028 --
NM_003441chr421326 281 ------
NM_003442chr112819 774 ------
NM_003453chr131617 ------
NM_003457chr172467 204 1568 ----
NM_003458chr343072 1594 1445 1364 --23917 1146 --
NM_003463chr6102725 2613 2199 1239 1111 1070 910 884 814 734 1273 ----
NM_003468chr243846 1447 542 341 2778 693 13085 --
NM_003469chr2--1100 ----
NM_003471chr362051 1559 863 852 373 264 11542 ----
NM_003483chr1262765 1919 887 446 203 67 12009 ----
NM_003488chr174932 778 659 634 1692 1976 --
NM_003489chr2143449 3398 3318 2871 22359 1207 ----
NM_003498chr161308 ----12703
NM_003507chr211747 11568 ----
NM_003508chr71285 ------
NM_003557chr11469 11645 --1120
NM_003566chr1263340 3180 3158 2968 2586 339 1106 ----
NM_003567chr13337 143 94 ------
NM_003574chr1833769 1583 464 13929 11414 --
NM_003583chr1243603 3419 3264 2761 23687 3519 11451 --
NM_003590chr2104065 2665 2530 1634 1557 1297 1018 728 643 406 23462 1032 ----
NM_003597chr211978 1795 12286 11405
NM_003603chr43809 691 666 1560 ----
NM_003607chr183911 3651 2718 2670 1669 1650 1054 663 14387 13970 14049
NM_003610chr20--1339 ----
NM_003615chr383796 3526 3323 3248 3226 2431 142 46 2737 256 ----
NM_003618chr26837 521 478 362 217 116 192 ----
NM_003621chr11--1517 ----
NM_003628chr22497 456 ------
NM_003631chr101733 --1153 170
NM_003659chr211114 ------
NM_003660chr191275 ------
NM_003670chr311402 ------
NM_003671chr993623 3507 3289 2470 987 519 464 257 181 1509 ----
NM_003692chr9--1262 ----
NM_003704chr41522 ------
NM_003716chr3141 ------
NM_003728chr42621 211 ------
NM_003743chr222137 290 1684 ----
NM_003750chr101615 ------
NM_003758chr1531625 643 160 ----1110
NM_003758chr1531625 643 160 ----1110
NM_003759chr453545 3274 1628 1611 1581 21530 1251 11332 13745
NM_003772chr1141258 1159 832 257 156 ----
NM_003783chr131086 931 446 2488 245 2938 29 --
NM_003794chr32888 816 ------
NM_003797chr11147 ------
NM_003799chr1884263 3278 2887 1130 947 587 366 113 1827 13299 --
NM_003822chr133054 1089 263 --12364 --
NM_003846chr11737 ------
NM_003884chr321490 570 1115 --21755 731
NM_003885chr1772639 2392 2352 2075 2046 1743 1642 --32494 1860 801 --
NM_003895chr2121817 633 ----186
NM_003913chr663919 3710 3122 514 412 260 --13138 --
NM_003914chr13--1164 ----
NM_003927chr1821045 900 2967 233 2713 281 --
NM_003939chr1043411 3391 1656 175 --23778 2875 11077
NM_003941chr752230 1762 972 315 215 ----21591 150
NM_003948chr451894 1710 1023 647 356 12464 ----
NM_003951chrX1304 ------
NM_003966chr585631 5273 4857 2193 1826 637 367 348 16367 17680 --
NM_003983chr1664439 4180 2936 2704 1259 1074 1568 1300 --
NM_003987chr1011572 ------
NM_003988chr1011649 ------
NM_003989chr1011508 ------
NM_003990chr1011508 ------
NM_004028chr1843874 1423 1051 102 --33732 3530 1121 --
NM_004050chr1442741 2544 2421 561 ----12735
NM_004056chr81724 --1440 --
NM_004067chr751549 1535 1277 1245 480 1556 ----
NM_004080chr711171 21379 1136 11054 --
NM_004093chr13103198 2996 2943 2617 2352 1235 933 752 469 225 ------
NM_004100chr672475 2307 1665 1083 549 487 479 1831 12366 --
NM_004113chr361362 626 604 430 314 195 ------
NM_004124chr142481 141 3926 669 117 12632 --
NM_004136chr1523182 1030 1802 12425 --
NM_004161chr22548 41 --1246 --
NM_004171chr11109578 9153 8128 7554 7065 6284 5858 2627 2018 1214 48171 7230 2977 1382 28096 662 --
NM_004180chr21240 ------
NM_004186chr31845 ------
NM_004225chr821263 435 ----1531
NM_004228chr191136 ------
NM_004229chrX1840 ----1339
NM_004232chr18103901 3695 3172 3110 1497 1406 1373 764 245 121 12451 --12936
NM_004235chr9--1769 --1681
NM_004240chr191115 ------
NM_004255chr151133 ------
NM_004261chr1--1866 ----
NM_004267chr31503 ------
NM_004272chr541987 457 422 288 12027 ----
NM_004331chr842473 1938 1038 717 12494 ----
NM_004337chr84413 227 175 66 12253 22161 350 --
NM_004338chr18116968 4483 4317 2766 2448 2373 1529 1383 961 665 542 46975 5062 1716 1060 24732 988 --
NM_004383chr15--1635 ----
NM_004392chr1342346 1905 722 47 21651 852 ----
NM_004419chr1021091 830 ----186
NM_004429chrX11385 ------
NM_004430chr812621 12493 12684 --
NM_004432chr93896 527 364 ------
NM_004439chr41146 ------
NM_004440chr611967 11977 ----
NM_004457chr221482 1232 11567 1512 --
NM_004458chrX62538 988 717 586 195 30 ------
NM_004459chr1721281 316 ------
NM_004474chr11890 ------
NM_004482chr22902 883 1629 ----
NM_004501chr153943 3370 2512 1515 180 43759 2540 1492 1046 ----
NM_004505chr1731891 1753 485 11571 ----
NM_004519chr8131 ------
NM_004523chr1051379 505 322 261 134 ------
NM_004525chr211484 ------
NM_004537chr122620 313 --1500 --
NM_004538chrX----1709 --
NM_004551chr11160 ------
NM_004565chr1--1749 1578 --
NM_004586chrX85440 3342 1958 1704 1642 1506 1414 36 41821 1299 1065 646 15362 --
NM_004588chr1154030 1366 1336 1274 1153 --13579 13804
NM_004593chr32623 341 1631 ----
NM_004598chr533149 2521 321 22666 2035 ----
NM_004612chr9104476 4324 4066 3945 3627 3096 1399 1390 1221 565 13108 14092 1129
NM_004643chr141625 ------
NM_004654chrY41190 943 542 156 1147 1360 11295
NM_004660chrY42239 1948 758 207 198 --11723
NM_004667chr151272 ------
NM_004670chr1051675 1528 1211 615 537 ----1585
NM_004681chrY3729 502 215 ------
NM_004709chrX41804 1177 1163 683 11775 --1721
NM_004719chr123991 929 795 11909 21849 49 12888
NM_004725chr1041171 947 594 253 11478 --1327
NM_004726chrX55489 5258 4040 3975 3674 33569 2302 1427 ----
NM_004734chr1383070 2857 2579 2263 2242 716 351 180 2416 409 11083 --
NM_004739chr111623 ------
NM_004742chr331586 1453 1232 ------
NM_004745chr875446 4742 4552 4358 2173 1446 56 24667 1126 --26565 2603
NM_004748chr1543903 3580 2965 1529 --23620 1690 --
NM_004755chr141456 ------
NM_004796chr1432258 574 405 --11961 --
NM_004798chr2022257 886 --21460 1060 23660 245
NM_004801chr241554 1086 503 119 ------
NM_004808chr1093126 3065 2929 1054 933 739 680 545 251 ------
NM_004820chr8189 ------
NM_004822chr1723974 3952 ------
NM_004824chr631321 1210 248 --1938 --
NM_004834chr2113359 2940 2586 2227 1363 1144 887 730 509 223 119 --13085 --
NM_004840chrX72333 2206 2042 1822 1599 891 841 12033 ----
NM_004841chr11341 2783 255 --1448
NM_004845chrX43954 2569 1401 198 --13016 11021
NM_004859chr1762548 2429 2398 1968 1879 522 11103 ----
NM_004860chr171168 ------
NM_004865chr61132 1174 ----
NM_004866chr544742 4321 4121 3247 64591 3848 3329 793 760 338 --1735
NM_004869chr1831718 1115 630 --21306 1089 --
NM_004872chr11397 ----130
NM_004873chr1473267 2839 2631 2583 2503 626 306 ------
NM_004879chr111373 ------
NM_004891chr2------183
NM_004898chr421837 672 1112 --11805
NM_004904chr786583 6231 5426 4422 2107 1937 1316 193 24561 4529 21391 1383 --
NM_004921chr152419 1960 1930 1813 38 ------
NM_004929chr821500 1110 1171 ----
NM_004948chr1821414 1352 ----1231
NM_004956chr764033 3921 3759 2843 403 220 11129 11176 --
NM_004960chr161120 ------
NM_004964chr1--1564 ----
NM_004967chr42517 139 ----182
NM_004985chr1274526 4341 4287 3196 1751 1640 280 24532 4488 --12950
NM_004992chrX108149 8028 7555 6752 6207 5812 2779 1724 1187 806 --37121 2249 546 --
NM_004992chrX108149 8028 7555 6752 6207 5812 2779 1724 1187 806 --37121 2249 546 --
NM_004993chr14--1402 --1266
NM_004999chr663988 3854 3062 999 542 211 --24143 3459 --
NM_005010chr762198 2151 2095 1645 1603 734 12089 ----
NM_005016chr121315 ------
NM_005020chr7--1611 ----
NM_005032chrX11067 ------
NM_005045chr71950 1244 ----
NM_005056chr1275196 5165 3832 3717 3659 3601 149 14375 --13419
NM_005058chrY--1235 ----
NM_005065chr1453958 3697 768 548 406 34059 3925 517 65096 4504 2109 1878 1817 1747 13947
NM_005066chr12649 164 ------
NM_005095chr122112 158 1382 --11785
NM_005114chr41569 ----1228
NM_005116chr2043991 3972 1143 1133 24519 3336 14431 --
NM_005121chr1772867 2842 2627 2478 1267 564 24 23093 588 ----
NM_005123chr122136 125 ------
NM_005124chr62665 378 ------
NM_005126chr332084 1693 135 1144 ----
NM_005128chr212525 158 2573 483 ----
NM_005135chr1553723 1382 534 182 158 ------
NM_005156chr974762 4277 3637 1863 1243 1187 670 14494 11360 --
NM_005159chr1531779 885 700 21728 1524 1122 12296
NM_005164chr1232263 2147 832 11744 ----
NM_005178chr19--1411 ----
NM_005194chr201389 ------
NM_005197chr1486104 5075 4824 4790 4767 4439 1416 1167 26205 1625 ----
NM_005204chr102769 681 ------
NM_005221chr71118 ------
NM_005224chr191617 ------
NM_005233chr32941 213 1389 --21742 923
NM_005235chr287677 7094 6218 6039 5047 1532 1097 136 --17477 --
NM_005238chr1142501 1388 1158 153 1648 ----
NM_005239chr2122022 529 ------
NM_005241chr321277 474 11027 11140 --
NM_005252chr141562 ------
NM_005254chr1511356 11055 --1385
NM_005277chr421774 1425 21935 1656 1570 --
NM_005324chr1741951 1339 828 448 21684 327 21463 610 --
NM_005327chr41136 1770 ----
NM_005339chr483927 3694 1571 1364 959 945 235 190 13586 --13133
NM_005342chrX--12830 ----
NM_005347chr941298 1245 1121 92 125 ----
NM_005369chrX1666 ------
NM_005385chr321794 65 1284 --12240
NM_005388chr921389 435 11213 ----
NM_005400chr262983 2884 2709 2233 1230 47 --11995 --
NM_005402chr761836 1380 1235 568 253 144 ------
NM_005406chr1821530 220 21433 1336 ----
NM_005415chr21192 ------
NM_005430chr121680 ------
NM_005433chr1832254 1751 510 22632 631 ----
NM_005436chr1053233 3002 1198 1163 924 --21087 295 --
NM_005443chr42534 177 ------
NM_005450chr171172 ------
NM_005484chr14--190 ----
NM_005491chrX52108 2021 1552 1517 606 12198 ----
NM_005494chr71557 ------
NM_005497chr17125688 5492 5285 5150 4534 4442 4382 4248 1663 1269 642 532 26093 4580 46004 5433 4748 1559 24569 1195
NM_005502chr943099 2429 158 143 33265 2924 2857 ----
NM_005504chr12136605 6202 5908 5799 5155 5113 4299 2656 2469 1257 1222 364 175 ----26389 5787
NM_005509chr521541 209 31451 1372 223 --11608
NM_005521chr101813 --1838 --
NM_005537chr134770 184 87 78 --1728 --
NM_005542chr721277 577 1709 --1423
NM_005544chr21644 ------
NM_005561chr13--1988 ----
NM_005565chr51442 ------
NM_005585chr151176 ------
NM_005596chr9146392 6320 5402 5265 5173 4992 4838 4245 2097 1993 1735 1301 687 291 25823 1850 1882 --
NM_005602chr321235 1028 11015 --11321
NM_005603chr181231 --11837 11928
NM_005604chr622446 758 --1206 --
NM_005610chr11913 ------
NM_005611chr1611302 ------
NM_005613chr111907 12032 ----
NM_005627chr63911 883 628 1997 ----
NM_005639chr1211455 ----11692
NM_005662chr81129 1355 ----
NM_005665chr134190 3530 237 24487 3631 14081 1376
NM_005676chrX--1196 ----
NM_005685chr7151 ------
NM_005717chr141228 1218 1201 293 --1809 --
NM_005721chr241017 915 698 227 1873 1361 --
NM_005722chr21463 ------
NM_005737chr232874 2559 955 11164 22478 1020 12501
NM_005739chr1542187 261 162 62 ----12418
NM_005746chr752128 1980 1872 745 389 22757 36 ----
NM_005748chr1272105 843 662 362 252 211 165 ----12283
NM_005749chr171617 ----1652
NM_005765chrX1754 ------
NM_005779chr533664 3353 187 --12736 23302 2851
NM_005795chr282657 2640 2214 984 695 306 200 158 ------
NM_005797chr1121761 230 --11486 --
NM_005801chr172143 44 1158 1778 --
NM_005832chr331449 1404 1299 11397 21469 91 --
NM_005839chr11630 1105 ----
NM_005840chrX104855 3077 2761 2754 2616 1771 1632 787 162 129 1336 ----
NM_005842chr131614 ------
NM_005861chr16------1241
NM_005871chr102954 913 ------
NM_005880chr1621066 643 ------
NM_005885chr52213 151 1644 ----
NM_005886chr161264 ------
NM_005891chr6--162 --1155
NM_005895chr1274104 3717 3157 2746 1426 649 389 13584 32912 2665 601 14172
NM_005896chr22526 106 ----1708
NM_005899chr1731303 450 271 1554 11472 --
NM_005901chr18128267 6901 6767 6616 5588 2719 2628 2475 2297 1486 1349 1156 28273 430 ----
NM_005902chr1564218 3958 2826 1345 759 380 14024 ----
NM_005903chr554953 2071 2025 1321 966 14450 1631 --
NM_005909chr523451 428 11542 --14247
NM_005920chr163250 2951 2808 1320 1283 918 11401 12593 22821 865
NM_005922chr61443 154 ----
NM_005930chr141262 ------
NM_005935chr465255 5222 5017 4119 4038 604 --21435 257 --
NM_005941chr863726 3254 2894 1390 1065 1009 1679 11577 --
NM_005944chr321136 417 ------
NM_005955chr184851 4075 3619 1457 1084 982 949 720 24924 1226 11899 13731
NM_005966chr24504 486 457 203 11969 22344 321 --
NM_005986chr132861 681 --11921 --
NM_005999chr141570 567 364 267 ------
NM_006010chr3175 ------
NM_006016chr641962 1868 322 44 ------
NM_006022chr131666 --1850 --
NM_006035chr1411259 ------
NM_006048chr12991 797 ----1255
NM_006060chr733659 3493 2959 23942 3513 13469 --
NM_006083chr5----1118 --
NM_006089chrX21617 1605 ----11311
NM_006090chr11258 ------
NM_006095chr454433 4235 3550 3444 173 34124 969 877 13294 --
NM_006099chr11862 ------
NM_006113chr121631 209 --1427 12096
NM_006129chr81373 ------
NM_006135chr131073 219 191 --11122 --
NM_006136chr72934 120 11035 ----
NM_006158chr811739 ----1404
NM_006195chr941287 1017 1005 974 --11246 --
NM_006196chr21310 --161 --
NM_006198chr21--1259 ----
NM_006206chr482928 2112 1986 1800 647 353 204 75 11933 12062 1696
NM_006226chr21934 --11189 --
NM_006241chr322337 24 12454 --21666 224
NM_006246chr143489 460 87 ------
NM_006247chr191471 ------
NM_006251chr532252 123 76 12523 1546 1209
NM_006252chr1105661 5020 4703 3027 2305 1724 1398 1250 941 192 25083 92 25786 1354 --
NM_006256chr132304 2160 977 1493 ----
NM_006264chr41557 1487 ----
NM_006265chr821041 404 1290 1541 1275
NM_006281chr821171 804 1867 ----
NM_006281chr821171 804 1867 ----
NM_006283chr854172 4144 3352 3132 1251 --34313 4288 1611 11817
NM_006300chr19175 ----12383
NM_006315chr464398 3737 3656 3618 1591 1334 13990 13867 12818
NM_006320chr44930 205 195 42 1904 ----
NM_006323chr41715 ------
NM_006330chr861641 1095 439 265 99 55 ------
NM_006345chr441403 1361 1133 318 ------
NM_006352chr121713 706 12088 ----
NM_006359chrX4843 517 284 100 ------
NM_006364chr141454 ------
NM_006380chr17113948 3772 3174 3159 3113 1660 1000 614 434 399 210 3858 620 468 ----
NM_006393chr1074458 4286 4206 2994 1436 485 398 13431 ----
NM_006410chr113468 461 390 1504 ----
NM_006415chr921023 870 ------
NM_006416chr61526 ------
NM_006420chr2033226 3064 1246 11218 --11203
NM_006434chr1073202 3025 3009 2664 2575 820 614 --12153 --
NM_006469chr121501 43 ------
NM_006482chr1243603 3419 3264 2761 23687 3519 11451 --
NM_006489chr1441972 1549 1390 254 --11693 --
NM_006496chr11734 21908 675 --11334
NM_006513chr1--1214 ----
NM_006520chrX21511 1200 1667 --1109
NM_006534chr2053026 2889 2497 2382 707 3747 599 420 12525 --
NM_006537chr15--1225 ----
NM_006538chr274072 3851 3487 3356 436 301 281 --22701 1383 14141
NM_006539chr16--1509 ----
NM_006544chr1475841 5259 4785 4548 4202 2019 544 12447 --11918
NM_006557chr941706 1590 1535 1380 1248 1426 --
NM_006559chr111171 ------
NM_006560chr111381 ------
NM_006561chr1076120 5601 5362 4054 3907 3885 542 21847 516 ----
NM_006565chr1611237 11226 ----
NM_006572chr1763407 2962 2201 2179 329 204 11352 ----
NM_006575chr141986 11468 1502 --
NM_006577chr231217 1105 368 11035 ----
NM_006599chr16108277 8067 6171 5990 5348 3262 2487 1464 1165 565 47487 5788 2516 172 27150 6636 16744
NM_006603chrX41621 741 654 536 11424 ----
NM_006611chr1221077 982 11177 1929 --
NM_006614chr333699 2592 134 --12456 --
NM_006620chr6113960 3948 3512 2999 1875 1813 1789 1586 1011 350 67 --194 --
NM_006624chr1022045 1758 21780 1580 11617 --
NM_006625chr121113 794 3939 910 66 1929 --
NM_006625chr121113 794 3939 910 66 1929 --
NM_006625chr121113 794 3939 910 66 1929 --
NM_006628chr1564269 1756 1057 1048 974 580 24515 3180 33495 3487 1365 11358
NM_006629chr1892816 2647 2236 1130 1119 987 274 155 93 --12522 --
NM_006633chr51734 ------
NM_006646chr1312844 12951 1290 1172
NM_006648chr91147 ------
NM_006654chr1234620 3600 1252 14799 23240 1924 --
NM_006713chr51223 ------
NM_006717chr943417 2326 1343 184 1287 23169 876 --
NM_006718chr64928 902 705 224 ------
NM_006724chr61443 154 ----
NM_006726chr431203 502 410 ------
NM_006729chrX135640 5629 5389 4225 4005 3993 2233 2209 1108 351 286 252 232 25553 152 11353 --
NM_006731chr925232 148 35808 5034 3903 25017 4273 --
NM_006734chr621478 338 31397 475 330 ----
NM_006750chr1678051 7690 7570 6471 5956 2363 1629 26082 2328 12013 --
NM_006751chr21859 ----1287
NM_006756chr821518 611 11338 ----
NM_006761chr171777 ------
NM_006763chr11803 ----11377
NM_006766chr831820 826 334 12640 --1720
NM_006772chr611470 ------
NM_006777chrX42849 2103 726 82 11123 1506 --
NM_006807chr1711308 ------
NM_006813chr63879 601 25 ------
NM_006827chr1443386 3256 885 837 1677 12537 --
NM_006835chr4128 ------
NM_006838chr1221756 169 1111 ----
NM_006839chr21210 ------
NM_006868chr1873100 3017 2873 2600 2501 2467 1973 12323 ----
NM_006873chr253495 2843 2814 863 46 ------
NM_006885chr1643954 1015 488 84 --22804 1433 --
NM_006887chr21499 ------
NM_006910chr161272 ------
NM_006914chr91434 1475 ----
NM_006915chrX52537 2083 1563 744 239 12570 11763 --
NM_006918chr1135595 5172 889 35803 2254 1429 --1576
NM_006920chr252056 1694 756 294 183 ------
NM_006922chr252548 2220 713 552 277 1848 11830 --
NM_006924chr1754258 3206 3164 3068 256 21148 132 ----
NM_006931chr1241917 1855 1731 549 --21445 348 1710
NM_006940chr121507 ----11190
NM_007006chr1663147 2955 2331 490 179 112 ------
NM_007007chr12134699 4693 4571 4032 3905 1507 1332 1113 995 940 786 442 293 2554 416 1848 --
NM_007010chr1751719 1625 1425 1335 36 ------
NM_007011chr1596878 6732 5748 5697 5602 5540 5406 5117 1216 ------
NM_007014chr1681743 1601 1459 1220 1105 460 316 172 ----11784
NM_007017chr51900 1664 ----
NM_007027chr31165 ------
NM_007034chr13878 691 100 1404 ----
NM_007036chr53812 271 101 ------
NM_007038chr2135827 2021 56 36011 5261 201 ----
NM_007042chr341723 1026 908 542 1558 ----
NM_007054chr561528 1388 1326 1191 300 244 11088 12693 --
NM_007068chr2231022 822 687 --1806 --
NM_007084chr1321462 1269 21417 1288 ----
NM_007114chr352651 2105 1222 760 119 22300 2034 --1183
NM_007125chrY--11389 ----
NM_007129chr131892 ------
NM_007145chr19--11407 ----
NM_007158chr11310 ------
NM_007172chr2273318 3165 2200 983 296 230 212 1955 ----
NM_007187chr13--1204 ----
NM_007197chr121248 1989 ----
NM_007203chr973579 3463 1538 1212 754 400 100 31474 1465 140 ----
NM_007207chr15957 741 699 327 158 ----1677
NM_007212chr152177 1558 632 600 190 --42274 2213 1892 1631 --
NM_007220chrX74883 3546 3101 1008 874 724 213 1386 33264 1281 272 --
NM_007222chr841394 240 197 179 21690 1551 ----
NM_007231chrX22272 2140 2897 150 22117 1672 --
NM_007249chr13118773 8301 7983 7681 7072 5940 5884 2097 1485 821 564 43744 3124 3101 1751 11997 --
NM_007317chr16_random155 ------
NM_007347chr1522020 1181 23215 350 22287 2279 --
NM_007353chr762967 2777 2746 2404 2005 1890 ------
NM_007358chr121607 513 31696 706 638 1453 --
NM_007373chr101591 --1233 --
NM_007374chr14140 ------
NM_007375chr162606 2332 1756 938 855 539 21916 297 ----
NM_012062chr122296 97 ----1332
NM_012082chr81276 1719 1143 --
NM_012084chrX142 1560 ----
NM_012092chr221657 62 --11622 --
NM_012096chr373589 3567 3521 2664 1278 962 319 --12970 1497
NM_012097chr22746 423 --12104 --
NM_012120chr632768 2458 566 --12665 1127
NM_012129chr732108 1646 59 1646 11542 --
NM_012141chr1354084 1563 666 376 189 13857 ----
NM_012158chr1321138 690 ----1199
NM_012164chr987050 7031 6389 4780 4685 1281 880 60 26979 6441 26404 2259 --
NM_012175chr111889 ------
NM_012193chr1155163 5122 3856 1665 85 --23310 1018 13823
NM_012199chr174597 4270 3804 3062 1569 1447 147 ------
NM_012214chr2106033 5646 5265 4729 4225 2308 1802 1417 1283 806 25251 1042 --1489
NM_012219chr313211 ------
NM_012223chr221315 1047 144 151 1939
NM_012233chr231177 406 368 --11151 --
NM_012234chr393492 3316 2974 2767 1373 1100 1085 867 772 12739 ----
NM_012238chr1021659 566 21526 1150 --1114
NM_012243chr11847 --1822 --
NM_012249chr223384 574 ----1634
NM_012250chr1111192 ------
NM_012259chr621164 1114 2504 24 ----
NM_012262chr155043 4178 3986 3590 3204 14014 ----
NM_012281chr742311 2119 1565 620 2744 645 ----
NM_012288chr674230 1708 1576 1514 422 377 131 ----14944
NM_012297chr422523 706 32322 1023 883 2395 386 12214
NM_012300chr552519 2495 2303 1867 1015 22572 928 ----
NM_012301chr741989 1559 871 777 11566 1283 11968
NM_012302chr151232 1193 486 149 126 ------
NM_012309chr1153507 3357 3268 827 514 ------
NM_012316chr1125155 4950 4877 4832 4770 4637 4311 3901 2065 870 787 426 15634 ----
NM_012325chr2011115 2388 306 ----
NM_012330chr1021359 671 ------
NM_012334chr534697 4099 3025 14554 1673 --
NM_012347chr613011 ------
NM_012382chr564216 3796 3574 3531 3216 663 --11644 --
NM_012395chr763386 3361 2896 2344 892 181 12657 ----
NM_012399chr2251972 1755 1469 425 116 21614 431 ----
NM_012413chr2--1402 ----
NM_012421chr1------1409
NM_012425chr1072746 2211 2045 1863 1835 1818 911 12601 ----
NM_012434chr621385 80 --11076 11573
NM_012443chr10--1146 ----
NM_012474chr11253 ------
NM_012482chr1140 ------
NM_013243chr1521087 1023 ------
NM_013254chr123542 186 123 --1628 --
NM_013255chr7128841 8650 8045 5986 5535 3463 3317 1985 1828 1229 472 91 ------
NM_013257chr861485 816 620 429 155 115 ----12340
NM_013261chr463439 3249 1330 1220 957 653 11440 11051 23752 3606
NM_013267chr12158 ------
NM_013269chr1263194 2942 1445 878 668 290 ----13438
NM_013293chr71192 ------
NM_013296chr1--192 ----
NM_013348chr1911024 ------
NM_013354chr831148 562 349 --11119 --
NM_013367chr4184 --128 --
NM_013372chr1562752 2670 2467 2252 2172 844 ------
NM_013374chr362813 2501 2001 898 120 96 2201 62 ----
NM_013380chr19181 1816 ----
NM_013438chr92234 30 1528 ----
NM_013450chr2185 ----1281
NM_013960chr8----1648 --
NM_013989chr1494837 4379 4061 3615 1911 1835 1307 942 641 ------
NM_013995chrX62107 2066 1026 622 230 95 3848 726 64 ----
NM_014003chr162365 333 ------
NM_014011chr232449 731 499 11866 42076 1009 771 526 --
NM_014016chr351124 1047 693 226 48 11207 ----
NM_014043chr331298 237 63 11249 ----
NM_014048chr1644906 1615 1430 99 24896 4207 13346 --
NM_014059chr132308 278 ------
NM_014109chr841106 999 500 180 11257 ----
NM_014110chr121093 482 1141 --11007
NM_014117chr1632707 599 179 --31869 945 503 --
NM_014153chr16--1705 ----
NM_014155chr11117467 7219 6615 6527 5843 5723 5203 2628 2204 2108 1039 14912 ----
NM_014189chr421505 1390 --186 --
NM_014190chr421857 1742 --1438 --
NM_014243chr451853 1769 847 477 121 ------
NM_014253chrX42271 1708 1682 489 12382 --1406
NM_014280chr11922 ------
NM_014309chr2244178 1953 1466 1397 153 15047 14050
NM_014313chr131447 507 80 --11355 1133
NM_014319chr1231944 1264 542 21823 95 ----
NM_014344chr112868 217 ------
NM_014363chr1351248 1146 871 845 504 ------
NM_014372chr131950 631 279 ----11802
NM_014382chr361642 1510 1495 653 498 41 --11197 --
NM_014392chr451605 1518 1139 1027 576 --1114 --
NM_014393chr832322 2290 1595 ------
NM_014397chr91306 ------
NM_014421chr442094 1686 702 189 11951 ----
NM_014423chr564395 3599 3475 2140 1042 277 15294 23678 1783 --
NM_014447chr421520 586 11690 11299 --
NM_014491chr731070 712 434 --1688 --
NM_014497chr2182 ------
NM_014515chr121204 31058 822 675 ----
NM_014574chr1421300 180 --11322 11575
NM_014592chr51777 ------
NM_014607chr222136 2096 ----125
NM_014613chr522992 538 --11159 1660
NM_014614chr211475 1360 11012 --
NM_014615chr1653623 3069 2613 1067 181 23574 3329 ----
NM_014623chr6177 ------
NM_014633chr111195 1249 --1510
NM_014636chr964168 4161 3622 3560 1121 955 ----11547
NM_014655chr122341 764 ----11979
NM_014665chr8113160 2974 2798 2520 2390 2356 1172 870 304 166 38 ------
NM_014670chr221605 284 31444 495 277 11029 --
NM_014674chr353849 3251 2502 1376 129 13968 23145 3137 23857 1095
NM_014683chr1741381 712 633 397 ----11543
NM_014689chr2--1549 ----
NM_014701chr1573431 2981 1340 1314 945 551 233 22741 2210 ----
NM_014705chr741740 1495 464 24 11535 21925 690 --
NM_014707chr731997 738 553 --1669 --
NM_014709chr21231 ------
NM_014715chr111905 ------
NM_014717chr19186 ------
NM_014721chr696786 6617 5786 5368 4716 2198 1016 829 204 1961 --16773
NM_014729chr832234 2185 476 11904 21817 746 --
NM_014739chr693953 3872 3164 3127 1415 1113 967 859 272 13680 ----
NM_014746chr244312 3757 2955 1706 --13992 --
NM_014755chr2124218 3700 3130 3079 1717 1630 1207 755 726 704 573 265 14159 12986 --
NM_014765chr162667 2450 2294 2136 2088 1926 ----11880
NM_014776chr1223096 2822 23157 2253 --1436
NM_014779chr3--11105 1914 --
NM_014787chr142672 2382 2228 1968 12169 ----
NM_014791chr91306 --1313 --
NM_014795chr211389 ------
NM_014810chr153646 3514 3477 3284 389 33063 1215 1076 23564 238 --
NM_014819chr552478 2432 981 911 70 1323 ----
NM_014826chr183911 3651 2718 2670 1669 1650 1054 663 14387 13970 14049
NM_014827chr13648 560 298 ------
NM_014828chr1472321 2085 1763 1696 972 553 187 --1965 --
NM_014836chr1021855 536 --1583 --
NM_014839chr112450 1405 1525 11960
NM_014841chr631295 870 142 11386 ----
NM_014864chr163828 3393 3347 2991 404 362 11710 11229 --
NM_014868chr12182 1905 1282 --
NM_014872chr971920 552 416 306 260 242 202 --11576 --
NM_014873chr1104729 4640 4478 4433 4186 4013 1568 1278 1088 78 3534 511 488 21254 1145 --
NM_014877chr17116978 6845 6713 5824 5474 4805 2648 1767 880 597 297 27486 1341 ----
NM_014888chr751565 1380 1217 294 77 --1466 --
NM_014891chr741395 1261 1199 1103 ------
NM_014899chr522979 647 12847 ----
NM_014900chr21246 ------
NM_014904chr1054009 3598 3574 3419 3048 ------
NM_014906chr1753290 1253 1126 566 375 13773 12679 12823
NM_014912chr1013536 43414 2192 895 683 --12956
NM_014917chr12859 638 1735 --1931
NM_014920chr673183 2723 2569 1313 455 306 87 3395 381 191 32469 1467 413 --
NM_014923chr1341993 1968 1736 333 ----11798
NM_014936chr662878 2568 1964 776 424 318 ------
NM_014946chr22901 187 31254 765 547 ----
NM_014950chr1451629 1295 1193 507 233 11089 ----
NM_014951chr1061941 1798 1622 420 400 314 --11952 --
NM_014961chr452084 1775 1429 770 417 1850 ----
NM_014962chr2082868 2433 2247 2024 1025 851 465 107 --12128 --
NM_014969chr131176 1082 396 --1956 --
NM_014970chr1----125 --
NM_014988chr452639 2021 558 412 241 42610 1718 700 340 ----
NM_014990chr1411225 ------
NM_014991chr422700 902 23262 2257 23176 2985 --
NM_014997chr732682 2455 895 ----12639
NM_015008chr353492 3328 2523 1138 1037 2790 164 --12536
NM_015009chr31612 ------
NM_015017chr111170 --1227 2526 170
NM_015018chr6141 ------
NM_015020chr1673059 2760 2611 2584 2479 865 38 --23783 159 13139
NM_015025chr252118 2004 937 320 239 --11752 --
NM_015026chr1252929 1925 1064 675 203 --11173 --
NM_015032chr1372660 2236 2166 1025 990 846 431 --2224 217 12336
NM_015040chr232926 2914 1292 23061 439 43121 3081 2073 721 --
NM_015051chr922291 553 11248 13332 --
NM_015055chr1152675 2443 626 252 114 12871 ----
NM_015057chr132575 134 1507 --1629
NM_015073chr1911880 ------
NM_015074chr174062 3865 3262 1292 1230 1098 98 --14923 --
NM_015091chr143753 685 333 ------
NM_015092chr1684521 4379 3557 1735 1537 1411 833 474 23247 544 23470 1043 --
NM_015093chr631738 1696 610 ----1717
NM_015094chr2274183 3712 3329 1257 929 474 438 --34656 3721 3373 --
NM_015097chr321901 1674 ------
NM_015107chrX12420 ------
NM_015112chr1------139
NM_015115chr443118 2698 960 198 12606 ----
NM_015133chr16--11476 ----
NM_015137chr82827 309 22608 647 --1725
NM_015138chr1562634 2043 1139 786 609 466 2647 140 --22274 1124
NM_015143chr431460 591 527 41438 1413 1228 1030 ----
NM_015147chr262995 2939 2616 2120 252 28 11183 ----
NM_015149chr161999 1867 1507 1408 139 72 ------
NM_015156chr1473552 2941 2646 1541 1244 993 389 34052 3833 2860 13479 --
NM_015186chr93503 402 390 ------
NM_015192chr2072997 2966 2349 2332 2295 530 357 12954 12460 --
NM_015199chr333031 2538 265 1529 --1739
NM_015200chr452559 2546 2538 2341 356 1738 ----
NM_015205chr1374928 4669 3573 3516 2055 929 147 25256 4934 ----
NM_015206chr1563828 3671 2742 1273 1257 1122 --11468 1230
NM_015208chr1884026 3827 3486 3242 1596 821 554 538 1815 --12938
NM_015216chr531393 1271 1141 1513 ----
NM_015225chr942914 2187 790 503 ------
NM_015226chr1622893 206 13214 --1548
NM_015230chr43238 62 50 ------
NM_015233chr1362062 1052 249 207 186 152 ------
NM_015247chr1654687 4287 3947 1309 1215 31643 1413 563 14324 --
NM_015251chr1652091 1671 754 612 110 12180 --1379
NM_015265chr252339 2044 948 924 473 31908 1788 1743 ----
NM_015272chr1651822 701 583 324 76 11859 ----
NM_015275chr1241984 1441 326 311 ------
NM_015277chr1831774 1687 1473 ----11156
NM_015278chr663316 2880 2293 2113 92 67 23290 947 11309 --
NM_015284chr111327 ------
NM_015296chr1321214 1063 1937 --1977
NM_015308chr111166 ------
NM_015310chr8158244 7816 7564 6568 5532 5370 5176 3219 1774 1443 1302 1163 1064 549 298 38345 5721 1790 45833 5625 5072 3270 --
NM_015313chr1164531 4041 1629 1610 1427 926 ----13149
NM_015315chr513441 ------
NM_015317chr232412 805 706 ------
NM_015331chr1--1596 ----
NM_015335chr1262463 2082 1817 1691 1667 162 ------
NM_015344chr861826 781 723 536 337 314 --11954 --
NM_015347chr1252965 2804 2738 2077 1811 22878 620 ----
NM_015358chr2121285 253 --2979 341 --
NM_015361chr2----1907 --
NM_015365chrX53997 3372 3245 2672 2650 --1425 --
NM_015367chr22--11545 ----
NM_015375chr184771 4715 912 850 716 528 353 247 ----24957 4802
NM_015384chr5--159 ----
NM_015385chr1073202 3025 3009 2664 2575 820 614 --12153 --
NM_015423chr1121567 1259 --11726 --
NM_015429chr331039 751 297 21138 951 ----
NM_015442chr3--1228 ----
NM_015443chr1711117 --11402 --
NM_015455chr563942 3908 3677 2922 1180 817 12602 ----
NM_015458chr865155 5092 4125 3929 2012 132 25114 4632 --25246 697
NM_015485chr12334 311 ------
NM_015497chr154885 403 380 303 ------
NM_015507chrX1106 1462 ----
NM_015534chr12757 689 ------
NM_015554chr1552805 2641 2587 2186 600 12743 11145 --
NM_015564chr543189 621 282 263 ------
NM_015567chr1321308 199 --1162 --
NM_015569chr141793 1196 990 943 34186 1125 73 ----
NM_015571chr661767 957 834 732 581 501 32543 1976 569 ----
NM_015576chr362660 2470 1000 991 666 105 12748 --12273
NM_015578chr1932107 1501 170 32014 1838 486 ----
NM_015630chr23752 446 96 1876 141 --
NM_015635chr912204 2690 541 21565 1557 --
NM_015640chr155190 4522 4504 4187 3613 --14019 1914
NM_015646chr1231009 933 470 21034 879 21304 1209 --
NM_015675chr19--1641 ----
NM_015678chr1311290 ------
NM_015691chrX62464 2299 1900 581 342 94 21158 437 12059 --
NM_015702chr2--141 ----
NM_015723chr7--1490 ----
NM_015852chr733548 2497 2275 22832 2236 ----
NM_015872chr121804 408 11578 ----
NM_015878chr832094 1835 459 2845 545 --1784
NM_015885chr113276 251 223 1882 --1324
NM_015886chr875692 4984 4915 4214 1714 1667 239 13629 34972 1617 1115 24426 916
NM_015888chr153226 2428 2293 942 229 1735 ----
NM_015902chr81607 ----130
NM_015904chr22602 550 251 38 ----
NM_015906chr164649 3217 3172 946 508 330 24264 1083 14405 24690 3600
NM_015980chr5----11626 --
NM_015986chr1741188 1086 928 68 31022 337 142 1423 --
NM_015995chr1575487 4537 3654 3637 3579 2185 1778 166 14104 --
NM_016009chr163890 3514 3380 3188 1617 1337 14182 ----
NM_016019chr721021 919 1207 ----
NM_016023chr832147 506 378 2478 420 ----
NM_016032chrX11384 ------
NM_016038chr71643 ------
NM_016040chr152554 1888 587 198 162 152 ----
NM_016041chr171339 ------
NM_016045chr2041241 743 474 131 --21707 1621 --
NM_016072chr1272340 2050 881 752 399 294 101 ------
NM_016073chr1511176 --11139 --
NM_016076chr11149 ------
NM_016081chr432247 1940 206 --12203 1666
NM_016083chr633890 2428 1223 33846 3735 3372 1932 --
NM_016096chr852172 1940 277 253 177 21538 621 1414 --
NM_016128chr3--1328 ----
NM_016132chr1562964 2489 1141 796 378 160 ------
NM_016141chr32786 658 ------
NM_016144chr51700 ------
NM_016152chr31170 ------
NM_016156chr1182312 2106 1955 1728 952 363 194 163 12391 11962 --
NM_016192chr21207 ------
NM_016200chr7--1123 ----
NM_016206chr3108325 8138 8043 7822 2922 2711 2502 2183 1756 236 26337 650 27439 7329 --
NM_016213chr151186 ------
NM_016217chr633582 2379 564 ------
NM_016218chr531177 1115 970 ----1113
NM_016220chr732359 2012 1664 12350 ----
NM_016231chr174248 95 65 33 ----11522
NM_016248chr1383950 3940 3818 3631 1422 1390 724 182 12556 13698 1845
NM_016252chr21177 191 ----
NM_016260chr2127597 6182 5911 5569 5279 4763 2319 2265 1571 1527 1448 890 37471 6805 4966 27604 7164 16249
NM_016262chr6175 ----1447
NM_016271chr182939 214 31592 574 278 21709 1537 --
NM_016277chr621286 145 --2517 40 2579 507
NM_016289chr252339 1999 1870 901 565 --1374 --
NM_016300chr31381 ------
NM_016312chr121448 1435 ----
NM_016315chr22249 168 21651 1403 ----
NM_016322chr932323 828 176 12411 32540 2400 984 11957
NM_016328chr7151 ------
NM_016376chr1743167 1589 1479 670 --13798 --
NM_016396chr1553019 1133 838 267 230 22845 711 ----
NM_016410chr91582 ------
NM_016472chr14--1986 ----
NM_016480chr51592 ------
NM_016507chr17--13154 ----
NM_016513chr673183 2723 2569 1313 455 306 87 3395 381 191 32469 1467 413 --
NM_016530chr1553851 3718 3374 1155 872 2956 909 22851 766 13130
NM_016531chr423808 805 23739 281 1509 13505
NM_016542chrX31716 1520 458 ------
NM_016570chr121381 ----176
NM_016577chr374493 4207 3459 3442 3236 3106 1630 1226 21661 1436 --
NM_016588chr61890 ------
NM_016605chr522259 616 ------
NM_016613chr432742 2727 2228 1856 ----
NM_016620chr151171 1093 915 542 333 ------
NM_016623chr84418 81 64 49 ------
NM_016631chr2121013 51 1827 2310 296 --
NM_016644chr5--1540 ----
NM_016652chr203660 340 266 11705 ----
NM_016654chr1511356 11055 --1385
NM_016824chr1031904 1752 84 ------
NM_016831chr142328 2286 2275 2254 ----1721
NM_016952chr1153142 3129 929 766 691 13395 1490 --
NM_017415chr564287 4075 3915 1786 1709 1570 32876 2836 2796 12926 --
NM_017420chr1433766 2914 2545 ------
NM_017447chr2121505 330 14351 13737 23410 1714
NM_017457chr191136 ------
NM_017582chr121812 1463 ------
NM_017593chr41422 ------
NM_017626chr1021579 460 ----11721
NM_017628chr475162 4217 3228 1241 1046 948 111 23684 1174 --1684
NM_017629chr161940 1545 705 601 445 254 11242 ----
NM_017637chr9109434 8469 7195 7048 6735 3238 2711 2034 1397 332 39106 7551 2344 --1851
NM_017643chr171773 1246 ----
NM_017645chr962948 2768 2122 960 310 97 ------
NM_017650chr786033 5417 5289 4900 4833 4023 1566 1274 36083 4727 161 ----
NM_017651chr641307 640 502 312 ------
NM_017655chr131423 1094 671 1230 ----
NM_017657chr22927 764 ------
NM_017658chr1454648 4250 3108 1670 1565 23196 596 ----
NM_017667chr71213 ------
NM_017676chr521374 651 1205 11601 --
NM_017709chr134068 3935 3885 ----1317
NM_017719chr372511 1859 811 734 598 513 214 1655 ----
NM_017734chr11196 ------
NM_017736chr1653012 2622 2513 663 278 11008 --1518
NM_017741chr472540 2378 2288 2226 2090 330 195 --11012 --
NM_017742chr1851733 631 229 170 118 1601 1306 --
NM_017745chrX1487 ----1503
NM_017746chr9--174 ----
NM_017754chr654007 3396 1837 1410 1404 25005 4524 ----
NM_017768chr14720 697 229 105 ------
NM_017769chr1482904 2642 2626 2397 2253 2098 645 579 23018 2989 ----
NM_017776chrX51090 1044 417 334 260 1500 11516 --
NM_017779chr121693 357 126 ----
NM_017799chr1441954 1895 1572 344 ------
NM_017813chr812280 31738 633 156 11993 --
NM_017822chr121271 ------
NM_017824chr1072677 2205 1689 940 693 307 25 ------
NM_017869chr161618 ------
NM_017902chr10104972 4468 4083 3915 3867 1876 1800 1333 898 841 13540 ----
NM_017919chr934056 750 514 25842 4014 13598 14534
NM_017925chr92728 443 ------
NM_017938chrX31997 809 166 22044 1699 --1638
NM_017944chr1192912 2745 1140 868 777 676 668 389 232 ------
NM_017945chr321400 264 2306 63 ----
NM_017958chr252920 2819 968 772 242 ----22871 50
NM_018017chr1031021 823 340 --11943 21006 219
NM_018027chr1063176 3074 3027 2330 2084 1201 ------
NM_018036chr1463447 3224 833 797 778 282 21069 741 ----
NM_018054chr161662 ------
NM_018064chr61322 ------
NM_018084chr222112 449 ------
NM_018086chr261927 1677 1472 590 272 28 21843 533 11354 --
NM_018105chr81176 ------
NM_018117chr101561 ------
NM_018120chr821212 297 187 179 --
NM_018126chr421310 1277 11470 ----
NM_018133chr3--12100 ----
NM_018137chr131393 1099 95 ------
NM_018139chr142139 119 1236 ----
NM_018142chr81204 --141 --
NM_018144chr101237 ------
NM_018150chr1--1372 ----
NM_018155chr352617 2272 1275 1080 842 12335 11382 --
NM_018214chr61452 1236 21099 867 --
NM_018225chr9125111 4383 4189 3992 3450 1737 1416 1408 1150 533 438 62 11767 35248 1488 218 --
NM_018230chr1180 ------
NM_018237chr101175 144 ----
NM_018238chr741142 939 301 183 ------
NM_018257chr2042288 2252 808 616 ------
NM_018279chr1262660 2580 2125 1931 86 53 1167 ----
NM_018293chr312039 22930 1837 ----
NM_018299chr842551 980 826 579 22970 2527 --1314
NM_018312chr111178 1283 ----
NM_018315chr421018 116 1413 1292 11603
NM_018317chr4--3333 312 300 ----
NM_018318chr12------1974
NM_018321chr5161 ------
NM_018325chr931629 430 118 21057 420 ----
NM_018328chr21487 ------
NM_018340chr1654827 1750 1689 1554 598 14207 24111 3811 --
NM_018351chr1264288 3773 3000 2880 1494 68 13863 ----
NM_018361chr893929 3496 3424 3262 2953 2519 2473 159 99 ------
NM_018364chr132508 1580 1544 23791 211 11290 11494
NM_018373chr14135984 5719 5678 5493 5273 4866 4181 3978 2096 1504 1436 1286 990 36095 5243 861 15469 --
NM_018374chr755116 5110 2022 1996 150 ------
NM_018375chr1431377 366 197 11273 ----
NM_018429chr531934 528 339 ----12361
NM_018444chr842077 1950 838 625 ----11449
NM_018452chr6_random63563 3169 1280 973 958 379 23624 1195 21256 1063 --
NM_018465chr91239 ------
NM_018469chr1711428 --1456 11393
NM_018489chr142328 2023 807 682 ------
NM_018490chr1141648 1357 201 96 ----11571
NM_018561chr64970 735 329 130 --1657 --
NM_018566chr164590 3794 1157 831 611 173 24817 3770 ----
NM_018569chr421545 103 --1183 --
NM_018571chr21562 ------
NM_018638chr1274228 3735 2280 2171 1948 435 352 14413 --11890
NM_018640chr1212755 2327 307 ----
NM_018650chr132172 1453 408 1128 ----
NM_018660chr873070 2785 2705 2124 492 168 138 ------
NM_018662chr164238 4179 1236 799 564 180 13542 43215 1276 1256 896 121424 1177 1157 1137 1119 1101 1069 1033 917 877 841 821
NM_018682chr71492 ------
NM_018686chr12188 ------
NM_018695chr551946 1561 877 656 325 22452 645 ----
NM_018703chr161272 ------
NM_018834chr51808 ------
NM_018837chr202687 601 ------
NM_018846chr71937 ------
NM_018847chr921977 1416 126 1280 11501
NM_018898chr542079 1792 1532 542 143 ----
NM_018899chr542079 1792 1532 542 143 ----
NM_018900chr542079 1792 1532 542 143 ----
NM_018901chr542079 1792 1532 542 143 ----
NM_018902chr542079 1792 1532 542 143 ----
NM_018903chr542079 1792 1532 542 143 ----
NM_018904chr542079 1792 1532 542 143 ----
NM_018905chr542079 1792 1532 542 143 ----
NM_018906chr542079 1792 1532 542 143 ----
NM_018907chr542079 1792 1532 542 143 ----
NM_018908chr542079 1792 1532 542 143 ----
NM_018909chr542079 1792 1532 542 143 ----
NM_018910chr542079 1792 1532 542 143 ----
NM_018911chr542079 1792 1532 542 143 ----
NM_018945chr643479 2932 2799 446 12736 ----
NM_018947chr7154846 4530 4350 4288 4154 4045 3541 3479 3344 1453 1290 1149 977 956 935 --34972 1822 1814 24139 580
NM_018963chr2121244 408 ------
NM_018970chr762673 2461 2197 487 209 134 22885 144 ----
NM_018976chr1252794 2307 656 137 110 22697 2607 32745 2720 902 --
NM_018979chr1231713 541 346 ------
NM_018999chr1074378 4074 3770 3375 791 451 227 34829 1644 778 --13879
NM_019001chr344806 4667 3429 111 1240 34529 4067 202 --
NM_019002chr2195 ------
NM_019004chr742027 1974 653 299 --3955 899 545 12101
NM_019005chr71107 ------
NM_019026chr11249 ------
NM_019027chr432016 1830 223 --21942 525 11621
NM_019028chr111351 ------
NM_019035chr441871 1665 1510 334 12094 1225 --
NM_019041chr62523 443 ------
NM_019050chr412212 190 ----
NM_019053chr1031069 783 774 ----1247
NM_019064chr171847 ------
NM_019087chr531538 1385 1370 11450 11672 --
NM_019091chr231038 254 55 ------
NM_019095chr201222 ------
NM_019117chrX52633 815 710 319 96 12983 11128 --
NM_019555chr361268 1246 1200 1188 609 180 ------
NM_019556chrX41452 1370 1045 261 --11346 11474
NM_019597chrX--1649 ----
NM_019610chr111681 --11608 --
NM_019884chr191374 ------
NM_019885chr212335 ------
NM_019903chr1031904 1752 84 ------
NM_020066chr12817 272 ----1943
NM_020116chr411176 ----11558
NM_020122chr2145253 4916 4855 4725 4051 3759 3711 3649 2225 1650 1143 576 212 91 ------
NM_020123chr1031519 1308 1181 2602 228 ----
NM_020132chr2144607 4424 671 75 --24007 3196 13434
NM_020135chr62382 172 ------
NM_020159chr421714 324 ------
NM_020177chr583084 3062 2669 2265 2254 1262 1118 505 1853 ----
NM_020199chr53415 65 30 11272 ----
NM_020226chr4----1667 --
NM_020245chr664965 4441 3623 1996 1552 611 24322 1315 14431 11962
NM_020341chr2031942 1548 446 --11925 --
NM_020346chr1131661 1215 582 --21329 165 --
NM_020357chr3136 ------
NM_020381chr661827 1553 1323 1264 513 235 --31409 592 584 --
NM_020390chr354064 3739 3261 3070 846 33688 3366 3019 2979 971 --
NM_020403chr1331379 239 189 11803 ----
NM_020428chr1911132 ------
NM_020445chr71528 1798 ----
NM_020449chrX2755 599 ------
NM_020463chr221529 1267 ------
NM_020473chrX3513 242 170 21589 39 11438 --
NM_020630chr10----1183 --
NM_020651chr231805 1680 610 ------
NM_020654chr331615 595 427 3456 292 103 ----
NM_020673chr20127768 7509 7460 7157 6526 6333 6015 5091 2083 2048 305 116 27136 5483 --12455
NM_020699chr164846 4011 3656 3629 205 82 25403 516 11416 --
NM_020708chr2042358 2254 2243 1938 22523 281 --22184 2081
NM_020727chr2183500 3199 2619 2551 2476 1312 1063 940 23346 450 ----
NM_020728chr762831 2629 2509 2057 1283 1199 --12069 1229
NM_020734chr1232767 665 76 13385 12720 --
NM_020739chr1543903 3580 2965 1529 --23620 1690 --
NM_020740chr17----1341 --
NM_020742chrX52665 2292 571 547 496 21900 1042 ----
NM_020747chr52882 169 ------
NM_020769chrX1978 ------
NM_020770chr111232 ------
NM_020772chr1798281 7768 7079 2938 2847 2256 1912 1344 865 16541 16998 --
NM_020774chr1855708 4654 4617 2015 1302 --14749 15501
NM_020779chr232744 2213 653 2442 73 ----
NM_020783chr1852294 889 555 542 491 --1859 --
NM_020801chr532530 1924 1714 ----12486
NM_020805chr1811933 1634 21587 1496 --
NM_020806chr141817 162 ----
NM_020815chr41111 ------
NM_020841chr1243958 3877 3414 400 --1714 11059
NM_020843chr15--1321 ----
NM_020844chr8117241 6946 6423 5918 5648 5548 5521 2696 882 694 431 11932 27421 6597 --
NM_020858chr1552373 2240 2145 2076 1736 ------
NM_020865chr31108 1464 ----
NM_020866chr1331011 784 744 --1749 --
NM_020868chr241811 515 412 191 31457 1314 69 1447 --
NM_020870chr432184 1874 1656 11810 ----
NM_020871chrX32173 761 629 --1593 --
NM_020909chr234040 3362 1224 24052 1410 14068 --
NM_020918chr1043575 2463 1304 670 12744 ----
NM_020940chr1032634 2036 2020 22919 299 --12510
NM_020951chr1922145 350 1321 21686 456 --
NM_020975chr1022061 2032 ----11498
NM_021003chr14----1289 --
NM_021025chr51331 ------
NM_021032chr361362 626 604 430 314 195 ------
NM_021038chr363317 3258 2407 2380 2161 362 23350 541 --1942
NM_021069chr43809 691 666 1560 ----
NM_021072chr542257 1931 901 861 22413 2285 ----
NM_021104chr121256 ------
NM_021109chrX1317 ------
NM_021109chrX1317 ------
NM_021111chr911328 21363 1157 ----
NM_021120chrX62784 2095 859 512 461 275 ------
NM_021140chrX41162 1153 784 748 ------
NM_021145chr711052 ------
NM_021148chr742465 2078 770 265 11784 2886 440 --
NM_021183chrX42550 1575 913 646 22368 2313 1607 --
NM_021190chr13914 873 415 11081 ----
NM_021194chr1----191 --
NM_021218chr96967 905 769 620 238 140 136 ----
NM_021219chr211248 ------
NM_021239chr143942 547 101 ------
NM_021240chr9----1600 --
NM_021255chr1453670 3406 314 160 83 21592 244 1400 13380
NM_021614chr51231 ------
NM_021622chr1022384 2028 11959 11686 1281
NM_021629chr375103 3213 1936 1874 1482 928 391 1995 ----
NM_021635chr631874 1743 1446 11584 1459 --
NM_021637chrX2985 116 --21334 265 --
NM_021639chr12781 300 ----1924
NM_021647chr493720 3106 1865 1537 1149 425 209 192 154 156 ----
NM_021648chr642667 2405 1812 79 ----12433
NM_021785chrX--1318 ----
NM_021813chr6105778 5559 5550 5117 4616 4548 3731 3665 3623 1502 24716 2149 14361 11345
NM_021814chr621152 327 1492 ----
NM_021911chr574167 3959 3925 1397 1267 1079 427 --15612 --
NM_021912chr1574137 3498 1560 1082 964 805 602 13331 ----
NM_021913chr1911140 2431 228 41705 1591 473 465 1169
NM_021935chr34995 957 921 207 ------
NM_021951chr92766 738 1165 2643 627 --
NM_021956chr661449 1433 547 288 160 92 11203 ----
NM_021961chr11117236 6572 5968 5492 4824 4538 2445 2262 1904 546 264 1841 27338 899 --
NM_021964chr375430 4598 2639 2162 1656 781 72 --16416 --
NM_021974chr22162 ------
NM_021978chr111512 ------
NM_021988chr2031439 1143 226 ------
NM_021998chrX31264 1190 396 11009 --1244
NM_022041chr1652112 1853 1796 782 23 32415 2273 1061 ----
NM_022048chr1586295 6262 5743 5124 2427 1939 638 545 11477 12411 --
NM_022080chr2042829 2298 2231 940 12151 ----
NM_022085chr62226 208 ------
NM_022123chr141173 ------
NM_022130chr5180 ------
NM_022154chr42861 851 ------
NM_022351chr843791 3038 1519 37 23526 780 ----
NM_022373chr71350 --21002 67 --
NM_022442chr2031439 1143 226 ------
NM_022444chr73355 181 123 1578 11474 1688
NM_022456chr1277131 5293 5159 2946 2112 771 227 36865 4728 874 15143 --
NM_022459chr1375739 5390 4553 4495 1555 308 275 34715 1393 143 12205 1790
NM_022465chr1213028 23004 2692 --12809
NM_022474chr1412681 ------
NM_022491chr1242813 784 560 136 ----1888
NM_022648chr284627 4325 3900 3570 1775 862 725 129 ------
NM_022658chr1221216 1045 1887 ----
NM_022716chr131020 752 643 13121 ----
NM_022726chr621600 546 21328 631 11686 11184
NM_022731chr11207 ------
NM_022733chr111196 ------
NM_022739chr171995 ------
NM_022763chr3--23187 3157 --1739
NM_022776chr321358 1020 ------
NM_022780chr231850 1183 22 ------
NM_022781chr942478 784 551 456 --13272 1876
NM_022810chrX1304 ------
NM_022817chr222226 1659 ----12253
NM_022828chr531747 1301 212 21684 620 ----
NM_022832chr462419 2206 2059 511 489 210 12486 ----
NM_022841chr1532651 768 298 22507 1731 12555 --
NM_022893chr242903 2748 2421 1049 32695 2600 499 11043 1325
NM_022894chr221197 394 11207 ----
NM_022898chr1453939 989 564 264 247 --1468 1220
NM_022912chr242609 1147 408 170 12978 1906 --
NM_022913chr5----1323 --
NM_022918chr1132006 1907 1417 ----1302
NM_022970chr1031375 177 150 31366 372 323 ----
NM_022977chrX62538 988 717 586 195 30 ------
NM_023000chr141540 1598 ----
NM_023001chr141540 1598 ----
NM_023009chr11598 ------
NM_023012chr121175 ------
NM_023016chr272816 2767 2177 2046 1895 423 358 ----12501
NM_023037chr13----1362 1959
NM_023039chr51282 2166 96 ----
NM_023076chr1672972 2763 2137 1864 1172 1054 627 1458 ----
NM_023079chr1741463 1238 1182 352 ----11904
NM_023927chr521048 103 ----1186
NM_024007chr562339 661 617 398 306 192 --22697 2368 --
NM_024094chr81210 ------
NM_024330chr1--1117 ----
NM_024332chrX2669 42 11375 ----
NM_024334chr311511 21870 1838 ----
NM_024336chr16--152 ----
NM_024345chr974704 1699 1566 1382 1220 1054 696 14056 --24422 1762
NM_024408chr152890 1385 991 886 812 --12920 --
NM_024422chr183506 486 310 ----1301
NM_024423chr18103714 3498 3181 3164 3047 3018 2932 1077 127 34 33993 3307 821 1988 --
NM_024491chr33615 604 29 ------
NM_024539chrX3949 442 336 ------
NM_024548chr331746 1169 489 ------
NM_024561chr132569 434 11254 ----
NM_024581chr61243 --1194 --
NM_024582chr42955 432 ------
NM_024607chr874299 4135 1801 1740 1605 974 528 14521 23441 65 --
NM_024639chr62766 125 12323 --11990
NM_024643chr141185 ------
NM_024665chr384696 4661 4516 4447 4264 3258 3239 1102 1821 ----
NM_024692chr241569 1525 1271 45 11408 1385 --
NM_024700chr121029 107 ------
NM_024721chr872524 2118 1724 964 660 173 75 --21992 398 --
NM_024757chr931058 1031 998 ----11008
NM_024770chr2105719 5341 4808 2135 2073 1145 1050 1021 864 667 16162 21468 651 --
NM_024811chr1111307 1789 --11962
NM_024814chr71376 ------
NM_024884chr1474291 3648 3285 1202 536 199 31 --1975 --
NM_024893chr201957 ----1385
NM_024900chr462321 2311 2217 1559 1433 155 --11953 --
NM_024900chr462321 2311 2217 1559 1433 155 --11953 --
NM_024915chr822674 842 1660 1602 1454
NM_024941chr551456 1447 1113 523 174 ------
NM_024944chr213392 362 33 ------
NM_024947chr389466 8536 8102 7941 3002 2844 2566 2162 26488 1905 47361 7353 6833 6578 --
NM_024948chr10----1654 --
NM_024989chr298022 7843 7108 6805 6245 3141 2273 346 150 17669 37966 6544 2230 --
NM_024991chr1073202 3025 3009 2664 2575 820 614 --12153 --
NM_024993chr221209 358 --1577 --
NM_025004chr111139 --1585 --
NM_025054chr864181 2914 2884 1325 599 272 149 ----
NM_025073chr122944 488 14366 13105 13915
NM_025134chr1672522 2315 2257 1718 311 221 132 32447 1820 162 ----
NM_025141chr152488 478 ----1494
NM_025147chr2--11181 ----
NM_025160chr123156 74 14296 1351 --
NM_025191chr163352 3034 2838 2343 941 767 32906 2800 776 ----
NM_025221chr421409 454 ------
NM_030582chr2141266 1097 283 138 ----1268
NM_030613chr5188 ------
NM_030621chr1484181 3217 3025 2765 2702 2636 1542 531 44228 2654 1203 447 --1430
NM_030625chr1042359 1673 1603 556 32258 828 753 139 --
NM_030627chr584138 3434 3254 3119 2997 1251 1241 1152 --23439 2781 13402
NM_030647chr765332 4524 2087 1891 789 53 14739 ----
NM_030648chr475554 4203 3805 2169 2056 1114 388 43963 888 822 501 24437 1224 --
NM_030650chr294228 4166 4032 2634 1655 1092 633 615 552 ------
NM_030660chr14--1402 --1266
NM_030664chr1031856 1824 1784 31591 519 386 ----
NM_030670chr1232145 603 367 22059 325 11655 --
NM_030671chr1232145 603 367 22059 325 11655 --
NM_030674chr1275826 5634 4823 4531 4058 3984 3922 ------
NM_030751chr1051699 1503 1282 240 118 ------
NM_030751chr1051699 1503 1282 240 118 ------
NM_030762chr1222020 623 ----1121
NM_030766chr12--1222 ----
NM_030780chr821681 155 11556 1546 1384
NM_030791chr142305 239 ----11461
NM_030806chr1149328 9154 8960 8922 8097 7689 7119 6092 3278 2318 1620 825 289 41 36886 6057 5860 ----
NM_030810chr62226 208 ------
NM_030816chr132982 2251 560 2621 228 22885 684 --
NM_030918chr144185 4120 3499 78 15296 25433 517 --
NM_030920chr122102 105 --11873 144
NM_030949chr6--1208 ----
NM_030962chr111468 ------
NM_030965chr13783 679 24 --2548 161 --
NM_031157chr121228 1602 1677 --
NM_031243chr72645 135 --22248 525 1420
NM_031268chr1675044 4756 4171 4159 3810 3583 1057 15403 ----
NM_031296chr422096 1803 22305 2060 1836 --
NM_031298chr17--1158 ----
NM_031411chr542079 1792 1532 542 143 ----
NM_031418chr1182675 2586 2389 725 591 388 300 239 22231 1000 2730 305 12333
NM_031419chr3--11398 ----
NM_031442chrX73149 2868 2822 2310 2194 2027 1152 ------
NM_031445chr243410 3345 2954 908 --11101 --
NM_031453chr1042263 2090 529 179 1121 --1660
NM_031468chr7117853 7126 6166 2420 2195 1561 1461 1335 1115 567 153 48255 6174 1418 241 ----
NM_031483chr2052896 763 431 118 45 21296 378 ----
NM_031844chr153943 3370 2512 1515 180 43759 2540 1492 1046 ----
NM_031845chr243202 2983 885 635 ------
NM_031847chr243202 2983 885 635 ------
NM_031849chr542079 1792 1532 542 143 ----
NM_031857chr542079 1792 1532 542 143 ----
NM_031858chr1731303 450 271 1554 11472 --
NM_031860chr542079 1792 1532 542 143 ----
NM_031862chr1731303 450 271 1554 11472 --
NM_031953chr42415 404 ----140
NM_031989chr121315 ------
NM_032012chr995094 5018 4599 4546 3571 1650 1444 1231 1190 --1385 14461
NM_032105chr1117970 5883 5321 3105 3066 2401 2205 2161 1991 1895 1176 --35832 2189 1725 --
NM_032109chr511047 ------
NM_032142chr18121 ------
NM_032144chr211416 11658 ----
NM_032149chr41148 ------
NM_032153chr352490 2453 1746 946 153 12445 ----
NM_032160chr1841546 1282 973 380 13561 13663 14345
NM_032175chr511475 1189 ----
NM_032186chr151171 1093 915 542 333 ------
NM_032189chr1364730 4471 3375 3318 1857 731 25058 4736 ----
NM_032192chr17--1744 ----
NM_032199chr1073447 2898 2423 1253 854 739 452 23886 3078 12794 --
NM_032208chr233314 2348 685 13358 12387 1707
NM_032217chr411251 --1563 --
NM_032228chr1133180 2462 1020 --2385 314 12530
NM_032256chr12148 ------
NM_032266chr21163 ------
NM_032288chr332157 2028 556 ------
NM_032291chr161444 1270 718 687 314 226 ----1202
NM_032293chr9173 1220 ----
NM_032303chr941545 1289 582 159 ------
NM_032321chr243333 2812 2662 556 ------
NM_032373chr10145281 5172 4827 4575 4111 4049 3915 2221 2110 1216 761 542 369 241 24593 1078 ----
NM_032410chr81313 ----1262
NM_032434chr22138 103 ------
NM_032435chr152207 2189 633 343 228 12139 ----
NM_032439chr102669 259 --1418 --
NM_032440chr1032543 2084 735 32894 2708 2047 --1191
NM_032446chr523712 314 23887 955 1878 --
NM_032449chr182869 2810 2699 2637 2501 1982 339 259 ------
NM_032457chr433708 2931 643 --13600 21512 1328
NM_032466chr811660 --11341 11718
NM_032468chr811660 --11341 11718
NM_032505chr341912 1734 1099 604 --1205 --
NM_032520chr161199 ------
NM_032558chr941321 1299 318 253 ------
NM_032560chr14--1748 1789 --
NM_032576chrY179 ------
NM_032582chr1731903 1765 496 11594 ----
NM_032594chr142895 319 1175 ----
NM_032813chr1341027 1018 798 227 11040 ----
NM_032826chr7115406 5142 4699 4599 1301 966 904 769 592 364 117 25019 1496 ----
NM_032859chr1373544 2828 1397 1377 602 478 43 23989 2981 1297 11413
NM_032860chr6--1183 ----
NM_032870chr61511 ------
NM_032873chr1164512 3710 3686 1425 354 157 11449 --1964
NM_032875chr171636 ------
NM_032895chr174816 792 305 53 1523 ----
NM_032961chr441055 1045 198 108 1370 ----
NM_032967chrX6985 797 335 213 172 90 1278 ----
NM_032968chrX94198 3377 1637 1597 1243 1168 788 550 174 13156 13261 2724 313
NM_032969chrX94198 3377 1637 1597 1243 1168 788 550 174 13156 13261 2724 313
NM_032971chrY61012 824 362 240 199 117 1305 ----
NM_032972chrY61012 824 362 240 199 117 1305 ----
NM_032973chrY94190 3372 1633 1596 1243 1168 788 550 174 13151 13256 2724 313
NM_032975chr1863417 2712 1260 791 572 216 ------
NM_032978chr1831147 1133 1060 ------
NM_032979chr1831147 1133 1060 ------
NM_032980chr1863417 2712 1260 791 572 216 ------
NM_032981chr1831147 1133 1060 ------
NM_032998chr11870 ------
NM_033020chr164649 3217 3172 946 508 330 24264 1083 14405 24690 3600
NM_033027chr3154 ------
NM_033081chr202135 126 ------
NM_033083chr353393 2908 2655 2428 1265 11043 ----
NM_033132chr132939 628 1335 ----
NM_033143chr423841 132 44652 4470 3651 878 ----
NM_033181chr633890 2428 1223 33846 3735 3372 1932 --
NM_033211chr51425 --21412 1276 --
NM_033222chr921422 44 --1299 1182
NM_033224chr747435 5295 5112 2429 12519 15788 27758 2459
NM_033225chr8103023 2962 2896 2405 2253 2151 1120 605 347 141 12737 23174 2519 13161
NM_033227chr52212 161 ------
NM_033260chr61557 ------
NM_033271chr14--1402 ----
NM_033285chr874431 3758 3441 3153 1369 1095 709 1638 13867 1780
NM_033305chr921362 325 ------
NM_033331chr993623 3507 3289 2470 987 519 464 257 181 1509 ----
NM_033360chr1264647 4462 4408 3317 1761 401 24653 4609 1114 13071
NM_033389chr1744853 3894 3701 831 ----160
NM_033402chr8--170 ----
NM_033426chr1432733 2699 843 1703 11162 --
NM_033427chr7--3671 265 105 ----
NM_033430chr444131 3755 2563 1623 2294 53 --1652
NM_033437chr444131 3755 2563 1623 2294 53 --1652
NM_033480chr613011 ------
NM_033481chr613011 ------
NM_033505chr2106105 5792 5477 5233 5171 5034 4195 1460 1359 670 56750 6697 5126 4264 400 15977 --
NM_033515chr621397 67 1361 ----
NM_033546chr181196 ------
NM_033551chr513441 ------
NM_033632chr421018 116 1413 1292 11603
NM_033637chr1043411 3391 1656 175 --23778 2875 11077
NM_033644chr552519 2495 2303 1867 1015 22572 928 ----
NM_033645chr552519 2495 2303 1867 1015 22572 928 ----
NM_033656chr2195992 5944 5469 4976 4010 3729 3655 475 342 15262 11076 --
NM_052820chr92489 398 ------
NM_052827chr1221119 1027 ------
NM_052832chr822938 1848 22613 875 12650 --
NM_052857chr171171 ------
NM_052879chr1223078 949 21520 601 ----
NM_052886chr82654 425 1753 ----
NM_052896chr162459 2350 1926 1668 579 560 22488 2408 ----
NM_052927chr532235 1397 781 1215 ----
NM_052937chr82467 381 ----1519
NM_052940chr1--1166 ----
NM_053016chr9127503 7391 6606 5014 3211 3149 3009 2992 1978 1015 936 120 182 ----
NM_053025chr341313 1267 588 220 --11382 --
NM_053026chr341313 1267 588 220 --11382 --
NM_053027chr341313 1267 588 220 --11382 --
NM_053028chr341313 1267 588 220 --11382 --
NM_053031chr341313 1267 588 220 --11382 --
NM_053032chr341313 1267 588 220 --11382 --
NM_053043chr796434 6404 5845 5131 4998 4288 3993 1514 423 1843 ----
NM_053067chr92234 30 ------
NM_054012chr9183 ------
NM_054016chr171760 1735 817 707 645 512 89 ------
NM_054016chr171760 1735 817 707 645 512 89 ------
NM_054016chr171760 1735 817 707 645 512 89 ------
NM_057159chr951584 1433 557 329 248 1571 ----
NM_057169chr1223096 2822 23157 2253 --1436
NM_057170chr1223096 2822 23157 2253 --1436
NM_057175chr442436 978 774 498 11023 ----
NM_058170chr141534 1191 1140 1086 11014 11582 --
NM_058241chr272321 1912 1577 1562 859 370 226 --1689 --
NM_058241chr272321 1912 1577 1562 859 370 226 --1689 --
NM_078474chr152488 478 ----1494
NM_079837chr161618 ------
NM_080546chr922256 272 21707 1679 ----
NM_080629chr12526 380 11428 11002 --
NM_080630chr12526 380 11428 11002 --
NM_080671chr222232 2139 --21580 1572 --
NM_080678chr21587 ------
NM_080683chr41557 1487 ----
NM_080684chr41557 1487 ----
NM_080685chr41557 1487 ----
NM_080723chr61428 ------
NM_080743chr622043 953 ------
NM_080759chr1342346 1905 722 47 21651 852 ----
NM_080760chr1342346 1905 722 47 21651 852 ----
NM_080832chrX41719 1213 1177 432 1214 ----
NM_080840chr20--152 ----
NM_080841chr20--152 ----
NM_080867chr14104839 4721 4691 4673 4212 4140 4059 1562 1144 510 --24044 3615 --
NM_080927chr363081 2508 1353 863 794 571 12784 ----
NM_130391chr952859 726 555 360 335 33155 1325 675 --11243
NM_130392chr952859 726 555 360 335 33155 1325 675 --11243
NM_130393chr952859 726 555 360 335 33155 1325 675 --11243
NM_130395chr62382 172 ------
NM_130434chr151455 11068 ----
NM_130436chr2152772 2719 2148 883 74 1522 ----
NM_130438chr2163349 3296 2725 2248 651 553 11099 ----
NM_130445chr2141266 1097 283 138 ----1268
NM_130469chr141854 ------
NM_130809chr552845 1203 606 299 131 ------
NM_130811chr20--21135 867 ----
NM_130838chr1541781 743 593 556 --11831 --
NM_130839chr1541781 743 593 556 --11831 --
NM_133334chr4106186 5508 5396 5104 4980 4747 4327 2154 1757 655 25640 2247 15006 13921
NM_133372chr542376 539 453 320 --21864 1856 22952 2714
NM_133445chr973653 2996 2729 2356 244 155 65 ------
NM_133478chr282557 2432 2143 1946 1734 948 751 428 22525 595 ----
NM_133493chr664599 3966 1725 905 211 25 34199 3139 798 13896 --
NM_133496chr143952 3557 2762 1629 11285 1728 13799
NM_133510chr141388 ------
NM_133638chr52566 469 ------
NM_133646chr255371 5192 4007 3810 619 25599 464 14588 --
NM_133647chr1553723 1382 534 182 158 ------
NM_134428chr91360 ------
NM_138270chrX32289 2194 633 22497 2231 12895 1590
NM_138353chr19--1431 ----
NM_138364chr4295 29 ------
NM_138371chr121266 ------
NM_138394chr2--1128 ----
NM_138395chr2------11104
NM_138423chr1531989 1708 1473 --1462 --
NM_138426chr71380 22116 432 ----
NM_138444chr1354788 4398 3072 1459 845 13090 ----
NM_138459chr663434 3413 2696 2573 1117 847 12865 ----
NM_138468chr2144946 4655 4576 3940 3878 2406 2344 2209 1794 1744 1578 1382 1195 610 32057 831 265 ----
NM_138473chr1223614 3187 11785 11730 --
NM_138558chr121093 482 1141 --11007
NM_138576chr1453939 989 564 264 247 --1468 1220
NM_138621chr274072 3851 3487 3356 436 301 281 --22701 1383 14141
NM_138643chr18----158 --
NM_138644chr18----158 --
NM_138713chr16108277 8067 6171 5990 5348 3262 2487 1464 1165 565 47487 5788 2516 172 27150 6636 16744
NM_138714chr16108277 8067 6171 5990 5348 3262 2487 1464 1165 565 47487 5788 2516 172 27150 6636 16744
NM_138731chr14113978 3865 2770 2658 1672 1621 1570 1053 914 519 71 ------
NM_138735chr241536 1086 503 119 ------
NM_138761chr191103 ------
NM_138765chr191103 ------
NM_138766chr52622 497 ----1632
NM_138782chr562319 2157 1920 1908 896 673 12423 1622 1321
NM_138792chr15--1114 1101 --
NM_138799chr242050 1988 1853 1300 2541 459 1673 1437
NM_138804chr22709 573 ------
NM_138811chr721264 1160 ------
NM_138821chr52622 497 ----1632
NM_138822chr52622 497 ----1632
NM_138927chr211251 ------
NM_138931chr32241 117 --1781 --
NM_138970chr1432258 574 405 --11961 --
NM_138980chr4--1591 ----
NM_138981chr4--1722 ----
NM_138982chr4--1591 ----
NM_139012chr632247 1946 836 12050 11790 11703
NM_139014chr632327 2026 916 12130 11870 11783
NM_139015chr121602 --11590 --
NM_139062chr171495 ------
NM_139167chr81497 ------
NM_139168chr551494 1227 797 479 453 ------
NM_139182chr43238 62 50 ------
NM_139242chr15141 ----11536
NM_139323chr2042048 1574 345 297 11807 11780 167
NM_144571chr446766 6522 2115 1043 35584 5572 4505 12467 --
NM_144574chr141153 ------
NM_144578chr1455403 4650 4592 4455 3488 ------
NM_144590chr1042984 2332 1829 287 12943 ----
NM_144599chr1585341 4804 4546 4333 3817 3570 1532 1472 25034 1466 13479 --
NM_144600chr1631655 1524 296 21397 672 1272 --
NM_144632chr212076 1754 ----
NM_144643chr4--1465 ----
NM_144664chr1152486 2446 2237 1898 139 21781 305 ----
NM_144665chr11134 ------
NM_144721chr462684 2435 2240 1782 1720 444 ------
NM_144726chr521072 195 --1861 --
NM_144728chr15957 741 699 327 158 ----1677
NM_144729chr15957 741 699 327 158 ----1677
NM_144777chr13178 ------
NM_144778chr1332686 2332 1869 12729 ----
NM_144949chr232449 731 499 11866 42076 1009 771 526 --
NM_144963chr862463 2289 2110 1743 320 98 --1103 --
NM_144967chrX1846 ------
NM_144982chr122517 98 --1686 --
NM_145020chr18----1116 --
NM_145055chr1843784 3657 3614 2887 1671 ----
NM_145159chr141105 ------
NM_145203chr133744 200 126 ------
NM_145206chr1053168 2676 789 150 141 ------
NM_145238chr11367 --1192 --
NM_145259chr256975 6726 5741 4692 436 22660 808 --12806
NM_145276chr193973 330 253 ------
NM_145290chr42270 253 ------
NM_145307chr1063873 3588 3283 2983 600 216 14184 33748 3256 80 --
NM_145686chr2113359 2940 2586 2227 1363 1144 887 730 509 223 119 --13085 --
NM_145687chr2113359 2940 2586 2227 1363 1144 887 730 509 223 119 --13085 --
NM_145690chr81306 ------
NM_145693chr282524 2453 2018 1956 1819 1666 1610 33 22588 2543 1319 --
NM_145698chr1042082 1945 772 456 ------
NM_145733chr2211202 ------
NM_145808chr732896 2133 1907 22828 2139 12693 --
NM_145891chr1661553 1384 1167 1086 644 380 278 69 ----
NM_145892chr1661553 1384 1167 1086 644 380 278 69 ----
NM_145893chr1651675 1506 1289 1208 502 2200 191 ----
NM_147150chr973579 3463 1538 1212 754 400 100 31474 1465 140 ----
NM_147175chrX31745 1359 777 --12174 --
NM_147181chr421409 454 ------
NM_147182chr421409 454 ------
NM_147183chr421409 454 ------
NM_147223chr232320 473 21 1867 ----
NM_147233chr222137 290 1684 ----
NM_148174chr832094 1835 459 2845 545 --1784
NM_148898chr731070 712 434 --1688 --
NM_148899chr731070 712 434 --1688 --
NM_148954chr6--135 ----
NM_148955chr1556134 4653 2469 2150 1416 21543 370 11658 --
NM_152221chr2221212 1146 ------
NM_152263chr1106067 5707 5180 4857 4033 2090 1181 1119 485 309 --11399 --
NM_152271chr821070 983 --1843 --
NM_152274chrX1395 ----1422
NM_152277chr551661 1610 1561 286 213 ------
NM_152283chr5298 85 ------
NM_152287chr1662333 2271 2140 2124 282 266 1309 1343 --
NM_152300chr1751719 1625 1425 1335 36 ------
NM_152332chr143945 925 166 12877 ----
NM_152388chr243762 3327 2836 2658 3769 484 96 11601 13227
NM_152399chr41823 11260 11231 --
NM_152400chr432058 1655 48 11617 ----
NM_152407chr542475 2075 1259 529 23227 999 ----
NM_152409chr573606 3141 1371 1117 1055 571 219 --13074 --
NM_152414chr811583 ------
NM_152453chr15--1186 ----
NM_152475chr1932510 2421 746 --31829 194 186 --
NM_152522chr221055 661 154 ----
NM_152527chr21185 32202 828 36 31859 1585 544 --
NM_152529chr273742 3278 3082 1436 1216 508 371 13688 ----
NM_152542chr461372 824 761 603 114 31 ------
NM_152556chr721607 551 32287 1636 815 ----
NM_152581chrX4516 381 321 248 11253 ----
NM_152594chr1532212 804 448 ------
NM_152608chr152224 1758 1671 1664 1627 11789 1532 --
NM_152609chr1----2478 418 --
NM_152621chr41124 ------
NM_152622chr5132802 2736 2591 2324 1308 984 842 761 664 441 415 235 32 21291 1035 12978 --
NM_152624chr5107438 5056 4784 2690 2430 1289 1014 844 685 179 1368 12583 --
NM_152629chr943405 2918 779 707 11655 13448 --
NM_152636chr1142948 2458 2332 821 ------
NM_152641chr1252263 2215 1130 789 762 --12532 --
NM_152672chr31231 1204 ----
NM_152688chr61645 --1291 1855
NM_152695chrX42267 1952 1782 285 12041 ----
NM_152707chr10--1407 --11009
NM_152723chr1141054 1001 828 29 11060 1356 --
NM_152724chr1072746 2211 2045 1863 1835 1818 911 12601 ----
NM_152734chr6105501 5479 5413 5151 4967 1821 1781 1760 1183 955 21348 1093 ----
NM_152745chr71162 ------
NM_152756chr583981 3729 3227 1458 1097 932 792 669 ------
NM_152758chr852141 2064 973 620 262 22731 2038 ----
NM_152785chr322375 1660 1844 --12558
NM_152789chr741170 962 348 242 --141 --
NM_152793chr785178 5102 4167 1451 1219 638 509 412 21828 1158 23358 997 --
NM_152826chr1556134 4653 2469 2150 1416 21543 370 11658 --
NM_152835chr132913 762 210 2933 620 ----
NM_152856chrX--1196 ----
NM_152857chr61146 ------
NM_152858chr61146 ------
NM_152896chr9----1633 --
NM_152924chr1596878 6732 5748 5697 5602 5540 5406 5117 1216 ------
NM_152989chr121507 ----11190
NM_152996chr141986 1892 1315 482 1829 ----
NM_152999chr764894 4380 3443 1375 1066 216 34715 3922 3642 34870 4754 1984 --
NM_153000chr181638 ------
NM_153020chr641669 1646 1487 669 11479 ----
NM_153038chr21713 ------
NM_153047chr61282 ------
NM_153048chr61282 ------
NM_153183chrX1382 ------
NM_153188chr5114925 4241 4197 3604 1744 1535 1461 1190 1155 991 22 14484 1859 15303
NM_153207chr1283877 3395 2608 1461 1032 617 159 47 21111 677 ----
NM_153261chr16----11135 1134
NM_153321chr17------1794
NM_153322chr17------1794
NM_153361chr5191 ------
NM_153365chr432383 2098 2005 12562 ----
NM_153616chr1552373 2240 2145 2076 1736 ------
NM_153617chr1552373 2240 2145 2076 1736 ------
NM_153618chr1552373 2240 2145 2076 1736 ------
NM_153619chr1563611 3478 3383 3314 2974 2379 --12423 --
NM_153620chr7--11503 ----
NM_153634chr12175 21482 474 ----
NM_153645chr2273318 3165 2200 983 296 230 212 1955 ----
NM_153689chr232262 589 83 1244 1148 1156
NM_153702chr41272 166 ----
NM_153706chr51206 ------
NM_153769chr18----158 --
NM_153819chr11----1218 --
NM_170665chr1274383 4210 3315 3247 1638 1260 673 ----14457
NM_170692chr11341 2783 255 --1448
NM_170709chr861485 816 620 429 155 115 ----12340
NM_170720chr1911024 ------
NM_170751chr631321 1210 248 --1938 --
NM_170752chr631321 1210 248 --1938 --
NM_170768chr1121619 1325 ------
NM_170775chr51231 ------
NM_171998chrX32485 785 76 12280 ----
NM_172037chr821211 145 ------
NM_172058chr81737 1747 ----
NM_172059chr81737 1747 ----
NM_172060chr81737 1747 ----
NM_172069chr231513 651 508 12333 1290 1536
NM_172070chr21461 ------
NM_172071chr136435 4751 548 35423 1853 1382 36541 5951 2247 --
NM_172103chr672475 2307 1665 1083 549 487 479 1831 12366 --
NM_172105chr672475 2307 1665 1083 549 487 479 1831 12366 --
NM_172159chr362051 1559 863 852 373 264 11542 ----
NM_172160chr362051 1559 863 852 373 264 11542 ----
NM_172193chr1421348 1263 ------
NM_172242chr10--1153 ----
NM_172373chr132395 108 ------
NM_173054chr71950 1244 ----
NM_173078chrX1451 ------
NM_173082chr651062 632 525 392 376 1270 ----
NM_173214chr16108277 8067 6171 5990 5348 3262 2487 1464 1165 565 47487 5788 2516 172 27150 6636 16744
NM_173355chr221020 56 ------
NM_173463chr463586 3513 1709 1174 783 538 13304 24335 2761 --
NM_173468chr455739 5357 3798 1817 410 55963 4921 4623 2323 2008 ----
NM_173475chr16--1505 ----
NM_173510chr2252668 1886 757 529 282 ----1109
NM_173511chr233831 3813 3462 --32609 1454 1105 --
NM_173517chr7--1433 ----
NM_173531chr1973088 2953 2719 1032 963 689 490 31354 697 574 23371 3363 --
NM_173554chr10----1216 --
NM_173557chr182639 269 ------
NM_173576chr1042283 2110 803 592 11622 11545 --
NM_173582chr11116113 5731 5253 5119 5076 2263 2220 1891 1549 1456 1261 11613 --1606
NM_173602chr1253486 2403 1490 143 22 --23683 679 --
NM_173642chr1126825 6405 6181 3202 2905 2730 2103 1922 1884 1717 1641 380 27823 404 37230 2531 1859 17986
NM_173672chr642605 582 388 92 2952 854 11578 --
NM_173683chr811097 11254 ----
NM_173694chrX72591 2415 2243 2150 991 729 384 52469 2402 2130 1836 843 ----
NM_173802chr12197 ------
NM_173808chr172998 1685 1367 1305 575 355 280 2560 383 14119 --
NM_173825chr362466 2206 1952 1890 346 243 1272 ----
NM_173829chr535258 4979 4281 45112 3803 678 94 11857 --
NM_174916chr155964 815 688 437 346 1466 ----
NM_175061chr751846 863 379 193 138 11396 ----
NM_175571chr711566 ------
NM_175605chr13188 ------
NM_175607chr361696 1664 1483 667 380 208 21154 229 ----
NM_175610chr1521252 261 ------
NM_175612chr361696 1664 1483 667 380 208 21154 229 ----
NM_175623chr1277131 5293 5159 2946 2112 771 227 36865 4728 874 15143 --
NM_175624chr1287226 5388 5254 3041 2207 866 322 42 36960 4823 969 15238 --
NM_175625chr1287226 5388 5254 3041 2207 866 322 42 36960 4823 969 15238 --
NM_175861chr12115759 5618 4946 4919 4761 4275 4129 4041 3744 2017 1781 23701 3662 ----
NM_175873chr51428 11095 11268 --
NM_175884chr731329 1054 992 ----1411
NM_175913chr201838 ------
NM_176801chr421857 1742 --1438 --
NM_176814chr731026 917 536 ------
NM_177398chr11415 ------
NM_177399chr11415 ------
NM_177424chr132003 1633 111 11978 11617 --
NM_177438chr1484181 3217 3025 2765 2702 2636 1542 531 44228 2654 1203 447 --1430
NM_177452chr1431602 595 33 ------
NM_177538chr2257971 7774 7247 7192 7058 6912 6849 6730 6534 5842 5666 5507 2713 2630 2385 2070 1736 1674 1425 1020 958 816 680 543 407 22848 102 38358 8350 7347 --
NM_177559chr2021242 1127 ------
NM_177560chr2021242 1127 ------
NM_177952chr14----1289 --
NM_177969chr22467 174 --159 --
NM_177974chr1531989 1708 1473 --1462 --
NM_177985chr22746 423 --12104 --
NM_177990chr2031942 1548 446 --11925 --
NM_178010chr121507 ----11190
NM_178011chr1092923 2483 2249 2046 1062 917 755 528 190 --13054 1208
NM_178140chr531888 721 164 --22098 638 12679
NM_178151chrX107805 7733 7263 6842 6452 1747 1610 1548 1541 1437 36592 6074 146 37875 5615 4959 --
NM_178152chrX107805 7733 7263 6842 6452 1747 1610 1548 1541 1437 36592 6074 146 37875 5615 4959 --
NM_178153chrX107805 7733 7263 6842 6452 1747 1610 1548 1541 1437 36592 6074 146 37875 5615 4959 --
NM_178234chr81262 ------
NM_178313chr21482 1454 ----
NM_178424chr52637 137 1401 ----
NM_178585chr422700 902 23262 2257 23176 2985 --
NM_178812chr841064 1055 605 517 21165 69 11153 --
NM_178815chr1032487 213 138 11074 ----
NM_180989chr1311795 ----2420 50
NM_181077chr1532317 2252 674 22323 512 --11540
NM_181291chr146698 690 658 565 490 273 1222 ----
NM_181302chr141153 ------
NM_181308chr141153 ------
NM_181332chrX52665 2292 571 547 496 21900 1042 ----
NM_181354chr821689 89 1626 ----
NM_181356chr61932 ------
NM_181358chr1104260 4156 4058 3903 3867 3755 1472 1328 1230 281 --13954 --
NM_181361chr331449 1404 1299 11397 21469 91 --
NM_181443chr2082868 2433 2247 2024 1025 851 465 107 --12128 --
NM_181481chr18116968 4483 4317 2766 2448 2373 1529 1383 961 665 542 46975 5062 1716 1060 24732 988 --
NM_181482chr18116968 4483 4317 2766 2448 2373 1529 1383 961 665 542 46975 5062 1716 1060 24732 988 --
NM_181483chr18116968 4483 4317 2766 2448 2373 1529 1383 961 665 542 46975 5062 1716 1060 24732 988 --
NM_181505chr17--1744 ----
NM_181521chr1677305 6765 6386 6284 2679 2356 1490 21388 1213 --11455
NM_181659chr2053026 2889 2497 2382 707 3747 599 420 12525 --
NM_181659chr2053026 2889 2497 2382 707 3747 599 420 12525 --
NM_181670chr121582 ------
NM_181714chr641650 1623 777 136 --1728 --
NM_181782chr632292 1467 298 ------
NM_181784chr262629 2523 1734 627 527 366 ------
NM_181836chr532542 2024 652 139 ----
NM_181838chr511263 ------
NM_182472chr41146 ------
NM_182485chr463681 3439 2980 1023 959 622 33735 3363 1015 21066 1034 12944
NM_182515chr19116656 6585 5800 5375 4765 4703 1532 1392 1014 951 63 22248 1352 ----
NM_182551chr233485 1309 190 13570 ----
NM_182625chr21145 ------
NM_182641chr1721281 316 ------
NM_182646chr463681 3439 2980 1023 959 622 33735 3363 1015 21066 1034 12944
NM_182703chr1541450 1010 564 406 ------
NM_182717chr1021492 326 ----11050
NM_182720chr1021492 326 ----11050
NM_182721chr1021492 326 ----11050
NM_182722chr1021492 326 ----11050
NM_182723chr1021492 326 ----11050
NM_182734chr2083244 3213 2596 2579 2542 777 604 94 13201 12707 --
NM_182765chr1022347 478 1784 --12057
NM_182830chr1421771 887 12010 ----
NM_182853chr1021492 326 ----11050
NM_182898chr786583 6231 5426 4422 2107 1937 1316 193 24561 4529 21391 1383 --
NM_182899chr786583 6231 5426 4422 2107 1937 1316 193 24561 4529 21391 1383 --
NM_182907chr642406 1886 671 438 --11734 --
NM_182931chr71492 ------
NM_182962chr111130 ------
NM_182975chr111113 --11161 --
NM_182978chr18--1737 ----
NM_182982chr4--183 ----
NM_183004chr14123564 3531 3398 3385 1243 1170 985 973 582 471 83 70 11571 23339 809 --
NM_183011chr1021492 326 ----11050
NM_183012chr1021492 326 ----11050
NM_183013chr1021492 326 ----11050
NM_183049chr41313 ------
NM_183227chr621286 145 --2517 40 2579 507
NM_183238chr1253279 3024 1109 767 184 23880 2923 --11547
NM_183393chr3141 ------
NM_183394chr3141 ------
NM_183422chr131666 --1850 --
NM_194247chr2144385 4287 3342 3162 3053 1717 1681 885 775 642 553 443 237 220 ------
NM_194283chr573912 3177 2633 1282 1086 326 98 ------
NM_194285chr1193415 3028 2926 2864 2727 2603 730 367 193 12419 ----
NM_194301chr1411053 ------
NM_194314chr175508 5214 1722 1457 1119 1075 268 14805 ----
NM_194328chr942478 784 551 456 --13272 1876
NM_194329chr942478 784 551 456 --13272 1876
NM_194330chr942478 784 551 456 --13272 1876
NM_194332chr942478 784 551 456 --13272 1876
NM_194434chr1833769 1583 464 13929 11414 --
NM_194442chr161691 1539 1451 1397 1254 36 21333 633 ----
NM_194463chrX3949 442 336 ------
NM_197941chr552988 2150 1045 763 714 ------
NM_197968chr131617 ------
NM_198077chr11399 1516 ----
NM_198128chr182939 214 31592 574 278 21709 1537 --
NM_198217chr134770 184 87 78 --1728 --
NM_198218chr134770 184 87 78 --1728 --
NM_198219chr134770 184 87 78 --1728 --
NM_198225chr1021855 536 --1583 --
NM_198243chr153911 775 86 ----1781
NM_198261chr121175 ------
NM_198262chr121175 ------
NM_198268chr1104260 4156 4058 3903 3867 3755 1472 1328 1230 281 --13954 --
NM_198269chr1104260 4156 4058 3903 3867 3755 1472 1328 1230 281 --13954 --
NM_198270chrX103526 3391 3203 3140 2945 2604 1143 1035 480 209 43285 2396 2328 567 ----
NM_198279chrX1889 11019 ----
NM_198336chr721189 489 1621 --1335
NM_198401chr841530 1151 499 136 ------
NM_198465chrX11070 --12504 1707
NM_198467chr72596 411 149 ----
NM_198503chr12507 97 --11560 --
NM_198567chr52456 133 ------
NM_198581chr297517 7241 6242 2376 2059 1668 1489 563 444 --55191 4900 4892 3024 1793 --
NM_198700chr111381 ------
NM_198793chr383892 3786 3715 3120 2714 2546 645 179 13954 --11520
NM_198794chr141986 11468 1502 --
NM_198859chr343952 1305 788 421 35147 2049 463 11373 --
NM_198889chr411251 --1563 --
NM_198903chr51674 ------
NM_198965chr12--148 ----
NM_198966chr12--148 ----
NM_198995chr182399 243 --173 --
NM_199000chr7----32250 2059 574 1843
NM_199051chr11259 ------
NM_199131chr1043683 3504 3165 547 --21441 309 --
NM_199132chr1941352 782 416 388 --31513 698 347 1865
NM_199136chr71444 163 ----
NM_199144chr2031439 1143 226 ------
NM_199188chr1223078 949 21520 601 ----
NM_199189chr51808 ------
NM_199190chr1223078 949 21520 601 ----
NM_199203chr2031439 1143 226 ------
NM_199320chr432138 553 123 32960 1103 632 ----
NM_199320chr432138 553 123 32960 1103 632 ----
NM_199324chr42766 472 11173 --22957 1415
NM_199355chr1631279 701 589 ----11776
NM_199421chr14104839 4721 4691 4673 4212 4140 4059 1562 1144 510 --24044 3615 --
NM_199424chr1681743 1601 1459 1220 1105 460 316 172 ----11784
NM_199436chr22901 187 31254 765 547 ----
NM_199440chr2------1443
NM_199462chr184771 4715 912 850 716 528 353 247 ----24957 4802
NM_201269chr151171 1093 915 542 333 ------
NM_201278chr1182312 2106 1955 1728 952 363 194 163 12391 11962 --
NM_201281chr1182312 2106 1955 1728 952 363 194 163 12391 11962 --
NM_201437chr821518 611 11338 ----
NM_201439chr12167 1402 ----
NM_201440chr12167 1402 ----
NM_201515chr12167 1402 ----
NM_201516chr71935 ------
NM_201570chr1052019 1883 1762 220 94 2723 117 ----
NM_201571chr1052019 1883 1762 220 94 2723 117 ----
NM_201572chr1052019 1883 1762 220 94 2723 117 ----
NM_201590chr1052019 1883 1762 220 94 2723 117 ----
NM_201591chr421774 1425 21935 1656 1570 --
NM_201592chr421774 1425 21935 1656 1570 --
NM_201593chr1052019 1883 1762 220 94 2723 117 ----
NM_201596chr1052019 1883 1762 220 94 2723 117 ----
NM_201597chr1052019 1883 1762 220 94 2723 117 ----
NM_201613chr122260 195 1239 ----
NM_201624chr111170 --1227 2526 170
NM_203327chr2043991 3972 1143 1133 24519 3336 14431 --
NM_203354chr141262 ------
NM_203355chr141262 ------
NM_203356chr141262 ------
NM_203372chr221482 1232 11567 1512 --
NM_203406chr522924 1983 2572 234 12213 12942
NM_203437chr22927 764 ------
NM_203463chr274042 3919 1618 1527 435 208 74 13893 31847 998 917 --
NM_203487chr1331379 239 189 11803 ----
NM_203504chr422523 706 32322 1023 883 2395 386 12214
NM_203505chr422523 706 32322 1023 883 2395 386 12214
NM_205768chr121713 706 12088 ----
NM_205833chrX2333 288 --1810 --
NM_205860chr133054 1089 263 --12364 --
NM_206594chr183626 3544 3347 2691 2330 1151 949 697 1923 --1723
NM_206595chr183626 3544 3347 2691 2330 1151 949 697 1923 --1723
NM_206853chr6104025 3988 3679 2887 2753 2508 912 843 741 271 2566 172 ----
NM_206854chr6105286 5249 4940 4148 4014 3769 2104 2002 1532 77 31827 1433 793 ----
NM_206855chr696251 6214 5905 5113 4979 4734 2497 1042 449 32398 1758 441 1360 --
NM_206866chr2132767 2314 2031 43131 2994 2840 2268 22226 968 --
NM_206876chr243581 3415 2647 2362 1186 1345 1758
NM_206907chr532252 123 76 12523 1546 1209
NM_206909chr8158244 7816 7564 6568 5532 5370 5176 3219 1774 1443 1302 1163 1064 549 298 38345 5721 1790 45833 5625 5072 3270 --
NM_206943chr2145 1723 ----
NM_207292chr363317 3258 2407 2380 2161 362 23350 541 --1942
NM_207293chr363317 3258 2407 2380 2161 362 23350 541 --1942
NM_207294chr363317 3258 2407 2380 2161 362 23350 541 --1942
NM_207295chr363317 3258 2407 2380 2161 362 23350 541 --1942
NM_207296chr363317 3258 2407 2380 2161 362 23350 541 --1942
NM_207297chr363342 3283 2432 2405 2186 387 23375 566 --1967
NM_207303chr1054116 1303 621 441 301 12937 ----
NM_207304chr1332573 2219 1756 12616 ----
NM_207321chr1041076 938 917 106 ------
NM_207354chr11151 ------
NM_207361chr1364892 4825 2466 2112 341 293 1895 36065 5668 387 26319 4878
NM_207435chr1231096 1080 249 ------
NM_207517chr1521992 155 11790 --11766
NM_212471chr1751866 1496 1404 510 345 --22059 248 --
NM_212472chr1751866 1496 1404 510 345 --22059 248 --
NM_212558chr983795 3285 3117 1700 1558 1462 985 788 24068 1232 --13595
NM_213589chr295545 5513 5353 2040 1575 918 736 634 35 21182 726 11364 --
NM_213606chr1052689 1992 1796 1752 294 12249 ----
NM_213609chr31150 ------