TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-933
miRNA Sequence: UGUGCGCAGGGAGACCUCUCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX------13197
NM_000084chrX11444 24249 698 --15258
NM_000109chrX1511 ----11976
NM_000125chr621035 324 --34052 3898 2864 --
NM_000168chr732962 560 316 --12946 --
NM_000176chr51820 --22591 1381 --
NM_000217chr1275106 4976 4596 3268 1299 997 444 --15216 15294
NM_000278chr1031808 376 273 ----12274
NM_000291chrX1237 ----130
NM_000314chr1033125 2863 2598 --22965 658 --
NM_000329chr11837 ----1122
NM_000399chr10----1461 --
NM_000442chr173955 403 326 --186 --
NM_000474chr71186 ------
NM_000489chrX1587 ----12683
NM_000522chr7----11219 --
NM_000828chrX----1578 --
NM_000834chr12----164 --
NM_001001396chr144260 3340 3293 2823 --14481 --
NM_001003800chr943503 3071 2883 1320 --1309 13722
NM_001003891chr221330 --1871 --
NM_001005782chr2------1240
NM_001005849chr17------1182
NM_001007026chr122362 188 --1407 --
NM_001007156chr15----1292 --
NM_001008239chr1823656 487 --13308 --
NM_001008392chr313308 12846 33524 2345 32 --
NM_001008407chr751633 1315 524 426 354 ------
NM_001008541chr10--12227 1850 --
NM_001008660chr11------1621
NM_001009996chr3------1542
NM_001010879chr191420 ------
NM_001010891chr525010 901 --1343 --
NM_001011513chr413455 ----14123
NM_001014286chr13------1321
NM_001014839chr1------11080
NM_001015877chrX--1856 ----
NM_001017999chr13940 77 59 --2453 105 --
NM_001018050chr22----12889 --
NM_001023567chr1532423 1539 673 --22385 493 --
NM_001024948chr121053 1038 --12550 13441
NM_001029863chr6------1224
NM_001029875chr522225 249 ------
NM_001031717chr3----157 --
NM_001035003chr4------11423
NM_001038493chr21145 ------
NM_001039590chrX33877 2713 1571 13087 138 --
NM_001039762chr10----1133 11732
NM_001040152chr71956 14275 14737 13537
NM_001040202chr4------12177
NM_001040424chr211640 12503 1826 --
NM_001040712chr932692 1275 725 --12320 --
NM_001042399chr12------1506
NM_001042413chr91325 --13767 --
NM_001042459chr31118 ------
NM_001043318chr143232 193 46 ----1327
NM_001046chr512016 ----12278
NM_001071775chr13------1323
NM_001116chr16------1502
NM_001148chr411704 --11439 --
NM_001174chrX1566 ----11525
NM_001189chr4--1752 11068 --
NM_001305chr7------1851
NM_001310chr1212704 --1912 11177
NM_001429chr221131 --1263 --
NM_001497chr921096 532 --11865 --
NM_001606chr9--1663 --1227
NM_001655chr1122204 496 ----1138
NM_001668chr1------21596 568
NM_001695chr81530 ----1330
NM_001701chr9----11480 --
NM_001709chr111917 ----1201
NM_001742chr711457 ------
NM_001760chr6----1161 --
NM_001782chr91277 ------
NM_001798chr12----11011 --
NM_001931chr11------1191
NM_001982chr121999 --1192 --
NM_002025chrX58308 6079 2627 784 56 19127 --18276
NM_002094chr16------1395
NM_002148chr21665 ------
NM_002226chr142753 84 --1323 --
NM_002228chr11191 --1169 --
NM_002264chr314644 --1140 --
NM_002265chr17----184 --
NM_002267chr1321599 788 ----11821
NM_002270chr521491 1189 1404 ----
NM_002334chr11------1182
NM_002398chr211230 ------
NM_002401chr171271 --12501 --
NM_002428chr1611055 --21431 1310 --
NM_002655chr824152 3313 --14623 --
NM_002709chr222646 755 --2721 68 --
NM_002731chr1----1153 --
NM_002833chr15----2529 136 --
NM_002844chr63523 424 85 --11242 --
NM_002886chr314770 ----135
NM_002906chr11----12063 11883
NM_002911chr1921631 145 ------
NM_003003chr17127 ----1231
NM_003016chr1711360 --11595 --
NM_003108chr296913 6162 2782 2751 2637 2612 1904 1677 1429 16006 ----
NM_003131chr612088 --1557 12314
NM_003255chr172930 372 --12618 --
NM_003286chr2011084 ------
NM_003339chr5------1120
NM_003458chr343745 3268 1144 99 --13587 --
NM_003471chr321848 385 ----1166
NM_003590chr21991 --1399 --
NM_003621chr11193 --127 --
NM_003645chr15----1200 --
NM_003737chr11------138
NM_003758chr151159 --1432 --
NM_003760chr1----1120 --
NM_003768chr11134 --21842 153 --
NM_003787chr1811305 --21447 1196 --
NM_003791chr16----1257 --
NM_003988chr1031885 453 350 ----12351
NM_004096chr1031558 721 595 --151 --
NM_004114chrX21123 199 ----11195
NM_004210chr10----12134 --
NM_004227chr722420 221 --2646 282 --
NM_004273chr1023467 626 2684 83 ----
NM_004302chr124675 669 556 67 --1645 --
NM_004370chr6----173 --
NM_004430chr82478 439 1563 2558 498 --
NM_004449chr2111490 --1925 --
NM_004454chr322246 1696 --1876 --
NM_004459chr17------1585
NM_004501chr1----1218 --
NM_004575chr411312 ------
NM_004612chr934065 1412 1220 13302 1198 11369
NM_004630chr1111097 --2135 117 --
NM_004663chr15------11221
NM_004687chr1722056 302 ------
NM_004711chr2221257 183 ----13348
NM_004745chr836562 1643 55 --16716 12491
NM_004781chr111470 --11733 --
NM_004805chr21208 --11076 --
NM_004824chr6----11140 --
NM_004834chr242585 798 729 118 --13163 --
NM_004865chr6----1282 1431
NM_004869chr18----11121 --
NM_004929chr8----158 --
NM_004956chr7----1173 --
NM_004973chr6--1442 ----
NM_005121chr1732626 2477 23 ----11250
NM_005154chr15----1593 --
NM_005184chr19--159 186 --
NM_005204chr10----1289 --
NM_005225chr204370 352 273 213 --1316 --
NM_005277chr4----11390 --
NM_005342chrX22286 508 --1279 --
NM_005384chr9------1118
NM_005400chr212883 --11027 --
NM_005458chr9--12361 1893 --
NM_005465chr1----1323 --
NM_005504chr1245784 4448 578 104 --22451 1986 --
NM_005578chr324130 1065 ------
NM_005598chr11238 --21286 1085 --
NM_005736chr10------1127
NM_005822chr61923 --12358 --
NM_005832chr3------11017
NM_005833chr9----1155 --
NM_005911chr2----1377 --
NM_006011chr15----14203 13779
NM_006504chr1012772 ------
NM_006517chrX------22177 107
NM_006546chr1726110 691 1820 14752 --
NM_006738chr1534346 3771 1346 175 33646 2947 706 --
NM_006795chr111548 --1287 1205
NM_006826chr221150 195 ----1858
NM_006832chr14----1149 --
NM_006931chr1231443 1346 548 --11480 --
NM_006943chr2031044 791 475 22705 23 1538 --
NM_006981chr912380 --12400 --
NM_007008chr2----1380 --
NM_007038chr2125106 2020 --1170 --
NM_007270chr72517 213 --11517 --
NM_012120chr6------1286
NM_012160chr6------1164
NM_012199chr134269 3734 1446 ----14348
NM_012234chr313268 --23675 1321 22934 296
NM_012247chr10----1972 --
NM_012281chr722461 619 --1577 --
NM_012308chr1142229 481 448 315 ------
NM_012421chr11301 --1388 --
NM_012479chr722235 25 ------
NM_013231chr141117 ----166
NM_013316chr71955 ----1317
NM_013444chrX1932 ----11147
NM_014043chr3------1628
NM_014048chr1623379 3344 ----15218
NM_014112chr811701 ----13724
NM_014212chr12----1926 --
NM_014240chr323823 2846 --11587 --
NM_014249chr15----1516 --
NM_014253chrX12366 ----1894
NM_014286chr943350 3158 3082 323 --1756 --
NM_014452chr6----1338 --
NM_014498chr3------1146
NM_014515chr121811 --1878 --
NM_014613chr51964 --32058 771 269 1211
NM_014662chr22------1421
NM_014682chr811461 --12146 11446
NM_014709chr2----1610 --
NM_014767chr1033365 194 137 --12396 --
NM_014770chr121913 --1900 --
NM_014779chr3----1272 --
NM_014810chr123476 3283 --1941 --
NM_014824chr1111966 11937 1351 --
NM_014903chr1221900 544 --12438 --
NM_014905chr2------1143
NM_014939chr18----1253 --
NM_014946chr2----1129 --
NM_014947chr122941 47 11057 22301 1935 --
NM_014969chr1----21116 270 --
NM_014974chr10----11566 --
NM_015052chr72513 153 ------
NM_015130chr411117 ------
NM_015144chr1622896 1202 13684 ----
NM_015192chr2012458 --12798 --
NM_015199chr3----1293 1423
NM_015216chr5------2345 246
NM_015263chr151485 --1170 --
NM_015299chr1423507 3049 ------
NM_015313chr1111475 ----13605
NM_015316chr14------11382
NM_015347chr1232947 2342 2092 12044 --12955
NM_015355chr17------11624
NM_015393chr453521 3260 2502 2456 2327 --186 --
NM_015459chr11----1265 --
NM_015461chr18----1172 --
NM_015472chr3192 ----1416
NM_015534chr111016 ----171
NM_015545chr71520 --1562 --
NM_015554chr1511064 12574 --12823
NM_015560chr3--12273 12796 --
NM_015888chr1----13136 --
NM_015949chr71918 ----2993 355
NM_015955chr2------1341
NM_016022chr1----1376 --
NM_016129chr4148 ----124
NM_016376chr1713874 --12802 11679
NM_016436chr20----22466 2139 1244
NM_016441chr221701 163 --179 --
NM_016490chr2------1372
NM_016592chr2021411 1063 ------
NM_017590chr222865 183 --22713 173 --
NM_017650chr735288 4757 4310 --13909 --
NM_017849chr213143 --1518 --
NM_017944chr112388 231 --1193 1327
NM_018013chr621111 199 --11166 --
NM_018014chr2----1331 --
NM_018028chr19122 ------
NM_018063chr10----1133 --
NM_018184chr322062 1897 --1137 --
NM_018287chr10----1952 --
NM_018375chr14----1104 --
NM_018437chr9------1563
NM_018584chr11351 --1482 --
NM_018689chr15--1731 22689 810 --
NM_018898chr511791 ------
NM_020122chr226063 1227 14651 --25018 1326
NM_020432chr73745 701 138 --1717 --
NM_020474chr18------1223
NM_020647chr811964 --1634 12108
NM_020689chr2021071 44 ------
NM_020718chr1634765 4030 376 24834 1531 21706 733 --
NM_020734chr1222084 729 --11107 --
NM_020747chr5----1749 --
NM_020760chr2----1512 --
NM_020764chr161934 1305 ----
NM_020765chr1173 ----1283
NM_020812chr19----1157 --
NM_020850chr16------13177
NM_020921chr1412348 --132 --
NM_020940chr1012507 ----1665
NM_020971chr19--1856 ----
NM_021076chr222559 523 ------
NM_021097chr2------12900
NM_021255chr14--1430 1999 --
NM_021813chr655777 5322 5116 4547 1342 1114 24913 4431 13862
NM_021961chr1147235 5967 897 263 --15427 21636 55
NM_021973chr41141 --1576 --
NM_022037chr21340 ------
NM_022048chr1525412 544 --25984 5385 --
NM_022644chr17----1363 --
NM_022758chr632784 2742 993 --12777 22362 958
NM_022781chr932477 455 411 --1249 --
NM_022822chr11----167 --
NM_024546chr13----11202 --
NM_024551chr1222352 658 --12263 --
NM_024665chr313503 --1960 --
NM_024721chr832117 1641 895 ------
NM_025201chr1511562 --11311 --
NM_030579chr16------13694
NM_030627chr563399 3054 2792 1250 794 44 ------
NM_030648chr412055 ----13991
NM_030906chr11----1408 --
NM_031407chrX--1158 --1443
NM_031418chr1112580 --22692 1064 1358
NM_031442chrX22903 788 ------
NM_031445chr21907 12314 1491 --
NM_032015chr11------1781
NM_032102chr1132166 592 363 --1576 --
NM_032352chr1411259 --11131 --
NM_032440chr1032209 188 152 ----1680
NM_032458chrX--11186 ----
NM_032521chr2032904 1162 343 ----12058
NM_032552chr921933 217 --162 --
NM_032682chr333144 2541 230 --23419 383 --
NM_032808chr15------11013
NM_032968chrX2310 264 ----23940 1421
NM_032973chrY2310 264 ----23932 1421
NM_032983chr7----182 --
NM_033127chr1------1565
NM_033224chr721314 251 --18019 --
NM_033426chr1412825 --12026 --
NM_033656chr2125991 1074 --1756 --
NM_052848chr1911749 ------
NM_052927chr5------1708
NM_053064chr14------13053
NM_058172chr4--21593 608 11117 --
NM_138335chr4----1618 --
NM_138385chr41195 --1220 --
NM_138927chr211817 ------
NM_138939chr3------1159
NM_139321chr2024179 347 12723 --13883
NM_144571chr41154 --25798 2631 --
NM_144579chr2135 --12128 --
NM_145206chr10----13257 --
NM_145255chr171894 ----128
NM_145349chr171637 ------
NM_146388chr19----1236 1893
NM_152374chr16518 432 391 296 63 23 1442 1335 1192
NM_152409chr512916 ------
NM_152414chr811205 ------
NM_152470chr181750 --13691 --
NM_152753chr611428 ------
NM_152756chr5----11635 --
NM_152769chr19----2921 325 --
NM_152835chr1--12013 1446 --
NM_152890chr11308 --1377 --
NM_153020chr611668 --11285 --
NM_153685chr12----1235 --
NM_153686chr4--12179 --1293
NM_153810chr1023379 3201 --1615 --
NM_170606chr7------11560
NM_170711chr19------1810
NM_171998chrX----12479 --
NM_172071chr127265 547 ----1139
NM_173156chr112201 --1155 --
NM_177968chr2----11420 --
NM_178565chr831741 390 85 1214 --152
NM_178826chr12162 1202 ----
NM_178841chr16184 ------
NM_181552chr7--1921 1299 --
NM_181672chrX----11469 --
NM_181701chr91222 ----12364
NM_181723chr8------11743
NM_182526chr14------13125
NM_182553chr11----151 --
NM_182691chr7----1163 --
NM_194272chr152954 684 --1804 --
NM_198993chr17----1378 --
NM_199168chr10----1238 11227
NM_199461chr10----2329 61 --
NM_199511chr3----188 --
NM_203301chr1411305 --11517 --
NM_203365chr2152 --1124 --
NM_207577chr11--22787 2118 12634 --