TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-934
miRNA Sequence: UGUCUACUACUGGAGACACUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000217chr1244130 3955 3862 3256 199 1114 15014
NM_001008408chr764974 4920 4082 2162 1127 501 1291 25040 1217 12091
NM_001014797chr1077672 6858 6141 5791 5097 2699 1042 31844 1778 1599 27366 5685 26493 264
NM_001039937chr1353590 3359 2693 1459 1260 --13094 23791 1297
NM_001040152chr734216 3735 973 --2578 515 24730 658
NM_001167chrX86733 5660 2035 1908 1603 1296 1098 114 ----26003 1480
NM_001417chr1241895 474 372 359 21702 1421 --11564
NM_003108chr257035 6220 5968 1301 1197 15033 --15202
NM_004171chr1169552 7427 7038 3209 1921 1186 29184 760 23161 1867 28175 1386
NM_004342chr732062 1525 730 --11552 31808 1464 451
NM_006750chr1636722 2128 876 12342 26433 1050 26567 997
NM_013255chr712137 --16962 47077 2658 722 600
NM_017637chr979285 8304 6426 3519 3219 3009 1858 11428 15853 27649 6390
NM_020673chr2086714 6147 5638 5217 789 714 449 37 26286 5385 --17645
NM_020718chr1686594 6107 4770 4480 2151 867 689 257 ----15940
NM_020772chr1798648 8335 7920 7821 7322 3402 1854 1686 113 --27172 1517 --
NM_021964chr346322 4636 2176 823 15937 --24402 2099
NM_022719chr2262652 2541 2400 1556 1333 1256 13800 13771 23676 2713
NM_033224chr7137293 7110 6918 6775 5866 3231 2005 1944 1511 882 752 727 91 27003 836 ----
NM_052907chr1263534 3462 3214 1571 1105 1008 11491 --1386
NM_080867chr1464632 4566 4306 3374 3356 1875 21355 330 --15005
NM_144778chr1322033 1718 ----11063
NM_152624chr555588 5111 802 643 148 26677 5442 36759 5859 5089 --
NM_153207chr1253642 2750 1184 1141 279 --1181 23976 3457