TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-935
miRNA Sequence: CCAGUUACCGCUUCCGCUACCGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51738 --1661 11673
NM_000081chr141692 1302 495 100 ------
NM_000084chrX146982 6755 6421 6402 6122 2632 2571 2553 1204 1075 766 743 407 65 --14874 --
NM_000093chr962497 2434 2290 2261 1991 224 ------
NM_000109chrX31970 1858 1823 ----12458
NM_000112chr5105374 4711 4653 3884 3821 1896 1670 1432 1052 281 --23450 179 --
NM_000158chr3----1652 --
NM_000165chr611317 --21281 353 --
NM_000176chr593693 3662 3383 3274 2824 2721 1094 838 628 --13280 --
NM_000210chr271444 724 603 414 406 327 297 --122 1521
NM_000210chr271444 724 603 414 406 327 297 --122 1521
NM_000210chr271444 724 603 414 406 327 297 --122 1521
NM_000217chr1235233 135 79 45286 1417 708 694 ----
NM_000230chr722504 638 22664 1949 1704 1726
NM_000248chr372916 2605 2348 2093 2042 875 351 32219 620 382 ----
NM_000252chrX31301 553 537 31541 325 49 1507 --
NM_000259chr15135933 5791 5472 4994 4839 4471 4120 2151 1740 949 735 531 133 --22500 2068 --
NM_000267chr1762565 2400 962 858 552 492 22775 286 --22533 1026
NM_000276chrX2671 506 --32156 2023 1992 1389
NM_000308chr20------1332
NM_000346chr1741833 1266 399 381 ------
NM_000362chr2221285 349 ----22670 2452
NM_000386chr172504 291 --2277 47 --
NM_000393chr251889 1421 549 375 70 31828 843 201 ----
NM_000408chr273374 3085 2739 2657 597 589 104 23192 72 ----
NM_000430chr1762793 2719 2620 2514 816 645 --13453 13603
NM_000462chr1521832 656 31592 1467 1454 ----
NM_000523chr22943 450 ----1460
NM_000551chr351401 776 407 305 200 1151 ----
NM_000555chrX136882 6804 6209 6101 5335 3081 2991 2932 2513 2072 1855 1819 591 36309 6036 4927 46844 6146 5042 1543 12566
NM_000807chr4181 1700 1485 --
NM_000814chr1544138 2765 2571 1110 1329 --24241 2853
NM_000826chr442041 1933 1808 747 12085 --1158
NM_000828chrX12113 ------
NM_000829chr1122058 2028 2668 596 22209 46 --
NM_000875chr1576166 6017 5709 5140 4731 1389 364 26274 229 15014 12314
NM_000891chr1783526 2852 2569 2538 928 557 521 449 ------
NM_000899chr1253925 3600 2951 1719 1533 24253 3072 ----
NM_000945chr271697 1342 792 769 620 350 173 --1752 --
NM_000950chrX73499 3488 2839 1197 1030 857 481 ----13219
NM_000959chr183038 2999 2746 1564 1205 390 174 91 11177 ----
NM_001001323chr1272966 2773 2668 2485 517 315 152 32762 2033 797 12178 --
NM_001001419chr574432 3339 1430 905 637 349 126 34331 1279 698 1547 --
NM_001001433chr2031263 1235 681 12956 13060 12842
NM_001001549chr722855 2799 12317 22674 2123 --
NM_001001664chr253916 922 857 728 632 34050 1130 334 22892 2732 --
NM_001001668chr1964034 3711 3077 3023 561 111 11360 23195 1610 --
NM_001001715chr134553 524 513 420 ------
NM_001001971chr1031416 211 124 11304 ----
NM_001002843chr152965 812 1399 1977 1442
NM_001003652chr18127060 7026 6182 6120 6019 5423 3199 2720 2355 1729 901 686 27777 1368 11158 17831
NM_001003674chr1846674 1112 1001 328 1385 36970 2568 1894 11498
NM_001003712chr1264000 3415 2513 1381 1132 720 23513 2476 12558 --
NM_001004317chr693926 3877 3260 1257 767 727 667 616 364 ----191
NM_001004360chr251812 1392 1348 516 309 ----11326
NM_001004419chr122304 203 64601 4178 3540 3317 1384 328 1936 --
NM_001005404chr1763916 1552 1489 1235 962 533 43843 3001 1475 489 14403 2858 81
NM_001005463chr1042588 925 635 612 21593 219 1326 --
NM_001005473chr546297 2567 2442 254 15086 35706 5361 4406 --
NM_001005739chr22684 295 ----1214
NM_001005845chr841707 1482 703 45 11596 ----
NM_001006600chr522128 689 1314 ----
NM_001007102chr631257 565 552 --11145 --
NM_001007246chr214707 285 89 46 1732 21242 312 --
NM_001007471chr92819 151 1107 --1588
NM_001008391chr112265 75 ----139
NM_001008493chr141732 1672 194 174 ------
NM_001008495chr892145 2019 1962 1631 1505 704 646 259 90 ------
NM_001008707chr141291 2615 474 1274 11272
NM_001008895chr1341454 1417 1291 1039 ------
NM_001008925chr453465 2417 690 69 47 13459 ----
NM_001009894chr1241500 1179 1068 269 1260 ----
NM_001009993chr254257 3542 1223 580 239 --21679 1191 1344
NM_001010861chr132674 1724 816 ------
NM_001010862chrX42317 2279 581 498 2788 214 1379 1297
NM_001010891chr556960 4700 2246 1662 1124 14202 12627 12442
NM_001010942chr1251037 994 471 461 21 --11011 --
NM_001011666chr775118 4532 4397 4390 2350 1922 1288 16247 21458 406 --
NM_001011708chr242907 2276 2089 1049 1454 21859 534 1699
NM_001011713chr1431344 1298 97 ------
NM_001012393chr1145084 4893 4397 2035 --1932 --
NM_001012418chr664212 2987 2667 1350 922 553 1723 11511 1681
NM_001012977chrX11192 --1411 11015
NM_001013031chr1063414 3263 2994 1383 1155 502 ------
NM_001015045chr462421 2210 2060 797 478 397 1368 1214 --
NM_001015877chrX72959 2331 2257 1914 425 205 97 ------
NM_001017371chr23421 408 119 21121 444 11265 --
NM_001017405chr42776 763 --1645 1854
NM_001017424chr181938 1866 1589 1436 1279 1238 335 64 2624 377 ----
NM_001017926chr821379 634 --11709 11402
NM_001017999chr1------1208
NM_001018037chr911252 --11364 --
NM_001018067chr1125142 4994 4940 4487 4308 3583 3419 3385 3337 1238 785 590 32129 1518 709 24092 1633 15199
NM_001024647chr1297573 7533 6868 6325 2860 1115 367 348 228 141 --1559
NM_001024660chr381482 1296 1236 576 549 322 296 279 --168 11176
NM_001024948chr173422 3228 685 679 449 357 113 1217 22836 1255 11174
NM_001024948chr173422 3228 685 679 449 357 113 1217 22836 1255 11174
NM_001025079chr383582 3400 3378 3335 1506 1476 1458 184 1483 32995 2571 121 --
NM_001025105chr531464 1050 588 1217 21165 203 --
NM_001025108chr254106 2552 894 455 383 --13831 1555
NM_001025201chr22662 59 --178 --
NM_001025252chr852757 2237 1190 637 448 --13017 --
NM_001025266chr384914 4842 4594 3582 1382 1301 914 847 34584 3169 684 33842 1709 614 --
NM_001025596chr11----1383 --
NM_001029863chr663010 2791 2488 851 834 347 13219 ----
NM_001029875chr532668 2537 2299 22105 822 ----
NM_001029883chr22550 331 ----11188
NM_001030006chr173473 124 62 12210 --2388 328
NM_001030055chr1474323 3571 3189 3089 3006 1681 191 --24312 1211 14533
NM_001031684chr271474 1434 1396 1065 985 438 307 ------
NM_001031692chr7281 25 ------
NM_001031695chr2285232 4771 3383 3295 1673 1520 1477 431 41785 1758 1751 836 25283 1902 14204
NM_001031716chr22450 81 ------
NM_001031732chr442750 1167 458 353 13327 13365 --
NM_001031812chr531570 1558 760 ----12338
NM_001032280chr6------11463
NM_001032393chrX1277 1121 ----
NM_001032394chr632386 2122 558 1398 22770 232 --
NM_001033044chr151417 1250 1161 311 88 --11475 1362
NM_001033049chr2122208 455 --3679 420 272 --
NM_001033117chr343084 2992 1727 1035 14235 34619 2971 608 --
NM_001033557chr231185 212 180 1258 ----
NM_001033566chr174981 886 159 124 --1833 --
NM_001033925chr1072147 2131 2100 1984 1817 854 28 12051 ----
NM_001034915chr881413 1365 1347 1170 1111 991 484 217 ------
NM_001037165chr748875 8801 7734 2228 16320 27109 5802 26951 3078
NM_001037954chr1183475 3015 2686 2492 2301 659 623 387 --12802 --
NM_001039580chr474763 4149 3567 1903 1454 1219 531 11279 23979 964 14458
NM_001039618chr1175222 4605 4477 2148 1924 909 191 24934 4060 15512 --
NM_001039802chr12875 347 --1207 --
NM_001039840chrX85741 4376 4000 1841 1647 1407 1115 422 24692 1146 14858 --
NM_001039937chr1344177 3733 662 377 13178 23210 1646 --
NM_001040142chr252232 539 459 371 106 --1347 --
NM_001040152chr784765 4663 3843 3752 3347 3266 1402 326 14031 11218 --
NM_001040159chr441244 1193 1140 438 ------
NM_001040202chr432539 385 170 1786 ----
NM_001040214chr632379 1946 1934 1217 1467 --
NM_001040284chr1664519 4111 3826 2067 1694 1144 13786 ----
NM_001040402chr463129 3068 2348 2055 961 905 13143 ----
NM_001040429chr1352883 2818 2762 2695 398 53485 3438 2479 2377 1327 11167 13142
NM_001040450chr1522102 518 ----1362
NM_001040665chr784878 4864 1870 1836 1621 1299 544 217 --14872 14399
NM_001040665chr784878 4864 1870 1836 1621 1299 544 217 --14872 14399
NM_001040875chr822389 2351 --22482 2198 1378
NM_001042413chr973925 3260 2919 1142 912 870 860 --23221 840 --
NM_001042506chrX----1411 11015
NM_001042510chr871941 1836 1734 1379 1356 638 254 22142 667 ----
NM_001042550chr941845 1737 662 608 1360 1434 21295 342
NM_001042555chr1264473 4298 3843 3596 1231 385 --11307 24500 3315
NM_001042599chr2137678 7310 7154 6939 6426 2767 2128 1967 1422 1098 716 622 305 12940 27341 5959 --
NM_001042604chr3104668 4530 4240 3376 3054 1392 1303 936 735 659 14560 44586 4229 3994 1115 --
NM_001042749chrX21876 1835 --1538 --
NM_001043318chr1434115 3840 3510 --22979 2734 --
NM_001043351chr162223 1558 770 393 291 104 187 11523 --
NM_001044305chr61628 11172 ----
NM_001068chr31259 ----1110
NM_001071775chr132725 439 ------
NM_001077628chr11608 --1729 --
NM_001123chr10149 --1645 --
NM_001144chr165959 253 225 102 51 ----11280
NM_001198chr632045 439 421 12101 1588 --
NM_001204chr2137222 6542 6512 3008 2888 2856 2790 2632 2580 2041 1162 1106 394 22392 2249 17279 27259 5878
NM_001227chr1031285 290 215 126 21309 208 --
NM_001256chr1762878 1830 502 184 150 38 12904 22370 1105 1422
NM_001270chr5----168 --
NM_001278chr1021144 185 1322 1835 --
NM_001293chr11----1519 --
NM_001304chr1763797 3780 3197 2792 1227 483 ------
NM_001310chr1242069 1031 961 357 12734 33039 1869 367 --
NM_001356chrX42396 2267 83 58 --12406 1284
NM_001358chr4----1341 --
NM_001364chr1144129 1199 548 327 --1412 11234
NM_001396chr2142149 1861 989 944 --1738 --
NM_001400chr111142 ----11194
NM_001401chr921456 1029 11270 ----
NM_001419chr1964865 4695 4335 4087 2970 1097 13679 --13026
NM_001432chr4103815 3741 3566 3399 3153 2379 792 429 420 233 --13648 --
NM_001438chr1113691 3628 3605 3454 3137 2876 2551 1363 1256 883 836 2715 561 12482 --
NM_001453chr61510 --11715 --
NM_001455chr633260 1968 1230 --11219 --
NM_001482chr151281 --1753 --
NM_001491chr64911 887 468 136 126 11746 --
NM_001498chr611051 --1320 --
NM_001527chr684594 4045 3814 3063 1588 1000 499 315 13355 33322 3027 280 1917
NM_001530chr1421131 1014 11008 --1818
NM_001546chr631450 595 245 ------
NM_001650chr1883766 3606 3460 1489 1387 1315 1256 937 21502 966 ----
NM_001656chr551557 1312 410 94 45 41705 1618 1545 195 1718 11920
NM_001663chr1492593 2532 2442 2371 2275 2062 1022 963 573 12486 12520 --
NM_001677chr111091 ----1274
NM_001695chr853914 2714 1425 555 402 1680 13003 --
NM_001709chr1122290 313 ------
NM_001744chr52373 143 --1165 --
NM_001752chr11--1513 1589 --
NM_001753chr71300 11619 ----
NM_001759chr1264835 4819 4742 4388 1746 768 14185 24684 623 11495
NM_001855chr94846 778 629 80 ------
NM_001920chr124738 681 554 94 1231 1159 --
NM_001938chr151881 1471 1441 1350 84 --1765 --
NM_001949chr6113232 3203 2763 2753 2551 2391 2341 2146 2121 871 825 ------
NM_001957chr432257 1504 512 1200 12196 --
NM_001969chr1463918 2841 2404 1356 1059 467 --22394 345 --
NM_002006chr495588 5367 5096 3629 3515 2227 1623 1425 110 24795 3736 35786 5402 1693 15472
NM_002015chr1393250 2398 2341 2303 2082 1005 944 913 291 ----12133
NM_002017chr1131029 975 161 11061 11320 --
NM_002024chrX2801 45 --21888 1665 --
NM_002025chrX179164 8226 8154 8025 7143 6370 5687 3180 3163 3071 3001 2320 2077 1528 1394 1275 960 37835 7490 1183 28131 6275 12382
NM_002026chr221008 803 ------
NM_002061chr141674 585 378 30 1226 2493 484 --
NM_002069chr71472 1154 11871 --
NM_002074chr1----1328 --
NM_002077chr941731 1539 1326 806 1754 21857 98 1185
NM_002128chr1332316 1970 354 2662 370 1387 12201
NM_002158chr273660 3538 3522 3408 777 678 380 ------
NM_002196chr2011066 --1769 --
NM_002210chr283574 3510 3393 2521 2171 491 203 118 --23582 756 --
NM_002214chr775486 4759 4504 708 174 164 48 44290 4009 3662 3615 11291 --
NM_002223chr1243030 405 163 23 1473 1529 --
NM_002233chr111142 --1352 --
NM_002264chr394249 3818 2029 1946 1404 1316 1059 921 860 --11030 --
NM_002267chr131545 12083 11895 1624
NM_002270chr585631 5339 4616 4237 4089 3605 1710 905 14792 ----
NM_002293chr162678 2308 2055 1763 1727 120 21992 686 --12559
NM_002310chr5105831 5323 5215 4757 4616 1643 940 895 886 189 36339 4988 4127 26035 1168 16078
NM_002317chr52256 160 ------
NM_002356chr662184 1968 1133 804 775 692 ------
NM_002358chr42550 438 --2146 28 --
NM_002480chr1231411 1091 61 1271 --11478
NM_002568chr82401 325 1385 ----
NM_002577chr384019 3999 3303 3096 2802 870 767 500 --13045 12616
NM_002594chr2042159 2071 368 231 12350 ----
NM_002595chr1251841 1204 575 262 255 11589 ----
NM_002613chr1644677 3811 2069 1548 --34993 4987 4891 13894
NM_002645chr1173128 3119 3012 2086 2026 1134 895 ------
NM_002657chr2053811 3699 1567 858 735 23587 3100 23224 2924 --
NM_002703chr451943 1842 1731 714 464 21349 175 ----
NM_002709chr253582 2363 1397 1110 651 12760 ----
NM_002716chr1173157 2784 1218 913 746 147 70 1677 23443 3422 --
NM_002731chr173161 3116 2910 2020 836 500 468 ------
NM_002734chr1731545 511 371 21504 809 11471 --
NM_002748chr1551019 968 790 347 184 ------
NM_002821chr6----1666 --
NM_002843chr1193331 3320 3260 2379 1334 1294 619 591 451 13009 13180 --
NM_002844chr61501 --11305 11340
NM_002851chr75686 615 535 186 115 --1586 --
NM_002858chr151229 933 533 332 192 ------
NM_002886chr385084 4781 4430 4038 3727 3466 1401 1225 33993 3482 615 1560 --
NM_002941chr331638 1352 1010 ------
NM_002942chr33933 416 409 ------
NM_002951chr20----1275 --
NM_002998chr852072 1990 1560 612 502 11372 1459 --
NM_003030chr331809 1647 453 21973 1780 ----
NM_003043chr363952 3494 3010 2792 1400 561 --3434 135 117 12737
NM_003045chr1354835 4660 3966 3954 3165 11171 1827 --
NM_003051chr111908 ----11464
NM_003060chr531161 1143 494 --21194 444 --
NM_003099chr15115842 5715 5274 4578 4294 2481 2470 1755 1659 1218 1145 --11682 --
NM_003112chr773036 2794 2693 1242 1099 1033 343 21144 441 ----
NM_003133chr13300 133 92 --2871 272 --
NM_003137chr621980 697 --11642 --
NM_003144chr641732 1554 1455 766 --21609 522 --
NM_003155chr84838 728 336 319 2746 384 1665 --
NM_003161chr1763573 2453 2327 1438 1383 823 1231 ----
NM_003185chr2041308 1087 1026 295 --1875 --
NM_003211chr1261527 1495 1314 483 339 298 180 1117 --
NM_003257chr1521253 262 ----11377
NM_003274chr2162995 2876 2246 1984 1830 1031 11075 62853 2164 2158 835 829 62 --
NM_003291chr134605 576 318 310 ------
NM_003298chr374799 4672 2021 1110 846 807 587 25760 4659 15834 --
NM_003319chr25967 902 801 289 164 ------
NM_003337chr531729 639 626 ------
NM_003339chr551515 1264 1049 550 82 ------
NM_003340chr451406 1310 1056 196 37 21183 492 ----
NM_003348chr1251688 1584 1370 427 323 --11695 11050
NM_003381chr62185 102 ------
NM_003404chr2061846 1648 641 492 347 298 11765 ----
NM_003406chr811363 --1406 --
NM_003410chrX42013 806 366 352 --12979 11124
NM_003412chr372894 2794 2615 1957 1916 1187 816 ------
NM_003413chrX51514 1303 724 637 127 ------
NM_003463chr621072 911 ----11114
NM_003468chr253825 3626 3400 2980 273 12910 23087 460 --
NM_003472chr631479 956 224 ------
NM_003473chr1031005 880 704 --1346 --
NM_003474chr1012039 --11868 11852
NM_003478chr1142268 2107 745 578 --13056 1958
NM_003482chr1242386 2062 1811 896 ------
NM_003483chr1232761 2315 888 ------
NM_003566chr1263181 3001 2969 2164 1270 1051 --12672 13386
NM_003583chr1243599 3420 302 74 --13682 11312
NM_003590chr263880 3266 2961 2922 2666 644 ------
NM_003603chr4--11746 1520 12030
NM_003615chr383974 3797 3588 3249 1245 548 521 106 ------
NM_003618chr23507 479 117 ------
NM_003620chr17----1284 --
NM_003633chr562369 1922 1781 830 624 163 --21713 270 --
NM_003664chr51521 ----1508
NM_003672chr131866 1621 1574 --11427 --
NM_003692chr91229 ------
NM_003701chr131902 1828 ----
NM_003758chr1531620 1458 1225 ----11215
NM_003769chr12--143 --2351 304
NM_003783chr11441 ------
NM_003787chr1841618 1423 544 488 --11462 --
NM_003796chr191555 --1169 --
NM_003850chr135587 545 537 258 157 --1109 --
NM_003873chr1042514 2240 935 477 ------
NM_003887chr242324 1870 1596 662 --22109 167 --
NM_003899chr1332592 2178 1914 1178 11601 1278
NM_003913chr644298 3920 3123 1145 34328 1396 643 23221 1091 --
NM_003939chr1074149 4045 3287 1255 488 336 209 ------
NM_003951chrX----1306 --
NM_004035chr17104944 4712 4613 1845 1413 1089 761 741 656 340 11407 24070 3638 14252
NM_004071chr2----1185 --
NM_004085chrX1296 1221 ----
NM_004114chrX21133 404 ------
NM_004124chr1443001 2561 617 258 12576 1212 --
NM_004136chr1572385 1270 1180 810 771 556 32 --2737 39 1153
NM_004161chr241565 1296 996 549 11200 192 11344
NM_004171chr11179586 9324 8705 8129 8097 8072 7992 7966 7278 7066 7004 6241 2948 2295 1700 1355 472 1726 12070 158
NM_004272chr53623 569 188 1554 --11423
NM_004277chr631716 1681 1471 --21563 1263 --
NM_004331chr872678 1999 1684 1640 840 135 62 12591 ----
NM_004370chr632140 694 397 --1611 --
NM_004414chr2121559 1223 ------
NM_004432chr93528 365 323 ------
NM_004457chr261667 1233 1055 513 340 230 1141 ----
NM_004501chr1103907 3861 3685 3166 1511 1479 588 546 274 176 ------
NM_004504chr2103041 2467 2220 2204 1884 1028 823 779 732 334 ------
NM_004505chr1751754 1533 1448 1413 1401 --11946 159
NM_004560chr93871 865 803 ------
NM_004586chrX64985 4388 4312 3921 3449 1618 --13400 24287 1001
NM_004598chr523301 2030 ------
NM_004600chr131296 440 330 11345 ----
NM_004660chrY42173 312 82 59 --32276 1944 209 1282
NM_004684chr4----1136 --
NM_004719chr1232776 2698 87 2671 71 ----
NM_004733chr3----135 --
NM_004739chr112484 443 --1625 --
NM_004834chr233192 2887 2228 1492 173 --
NM_004852chr181913907 13734 13711 11920 10978 10716 10682 10141 8741 5318 3850 3448 3217 2551 1195 949 565 154 93 --29876 3022 --
NM_004929chr841186 503 105 53 ------
NM_004956chr782926 1336 1015 928 656 626 521 508 13374 ----
NM_004960chr16----1122 --
NM_004973chr631426 1406 45 --31460 1322 323 --
NM_004985chr12124125 4042 3912 3860 3800 2976 2877 2768 1641 1520 420 48 34429 3521 799 ----
NM_004992chrX128236 8002 7191 7122 7094 6242 6208 2342 2019 1912 885 239 58395 7389 6643 1959 102 27207 6191 17281
NM_004999chr6124235 3730 3460 3021 2895 2796 1618 1569 1000 813 378 212 11043 2973 307 --
NM_005023chr551170 1006 502 268 43 ------
NM_005040chr11181 --1431 --
NM_005056chr1265457 5198 4566 2075 1420 650 1521 24470 24 --
NM_005065chr1453953 1656 1021 769 179 35377 4708 522 13642 14565
NM_005126chr341827 1562 189 148 --2436 37 --
NM_005180chr1031439 1170 94 1181 11681 --
NM_005222chr7------1293
NM_005233chr312420 --1215 --
NM_005238chr1153397 2786 1362 1276 1159 ----13493
NM_005239chr2141601 549 530 479 --22024 1821 --
NM_005242chr531451 1293 281 ----11482
NM_005271chr103856 390 44 --11212 --
NM_005324chr1771968 742 639 611 450 280 65 1724 1151 --
NM_005339chr443928 3533 2643 407 11641 --1481
NM_005347chr921695 1230 1560 194 --
NM_005358chr132606 406 --1200 --
NM_005375chr61958 ----1748
NM_005400chr2102984 2902 2745 2235 2113 2019 1996 1877 730 244 ------
NM_005402chr771726 1187 1149 552 515 328 218 179 1740 --
NM_005406chr1831498 1318 1037 ------
NM_005414chr3------172
NM_005433chr1852783 2255 1800 1792 724 32651 2359 783 ----
NM_005455chr1----11582 --
NM_005475chr1243246 1164 933 121 ----176
NM_005486chr172524 282 ------
NM_005520chr5------1123
NM_005544chr22645 293 1191 --1874
NM_005570chr1831033 803 117 ------
NM_005578chr354538 3478 1803 649 281 14732 1438 15099
NM_005587chr153927 739 392 --1403 --
NM_005595chr11173 ------
NM_005596chr985789 4510 4503 3977 2570 1885 1095 77 21965 414 12104 --
NM_005604chr632447 2407 1928 --11623 1996
NM_005665chr164191 3531 1849 1599 1288 1117 21308 1235 ----
NM_005668chr564477 3784 1695 1641 1370 618 44211 3697 1560 1361 1786 --
NM_005737chr232875 555 182 --12494 --
NM_005739chr152960 923 ------
NM_005746chr71896 1300 ----
NM_005759chr264758 4386 3796 1473 1095 271 21700 1251 31538 1503 1147 13716
NM_005786chr18----1409 --
NM_005813chr272378 2184 2125 1920 915 243 63 1821 22336 464 --
NM_005819chr143189 2982 2364 272 31169 1133 688 --11183
NM_005862chr321006 988 ------
NM_005871chr1051041 914 905 332 165 ------
NM_005899chr174565 543 273 25 --11474 --
NM_005911chr261390 1094 1012 525 501 330 --1249 --
NM_005930chr143775 353 29 137 161 --
NM_005935chr475234 5100 4145 3357 1004 605 505 --25257 1977 --
NM_006016chr661963 1663 746 360 242 46 --11870 --
NM_006035chr1421260 1033 ------
NM_006047chr2052693 2420 2358 903 148 1590 ----
NM_006080chr732644 166 55 ------
NM_006106chr1163073 3061 2968 2751 2708 830 1514 ----
NM_006136chr75943 935 355 312 121 ------
NM_006141chr1641778 1764 1006 645 --22581 991 --
NM_006153chr31455 --233 22 152
NM_006195chr951368 1195 975 897 256 ------
NM_006206chr482754 2727 2529 2378 1944 944 898 354 ------
NM_006212chr195438 5376 4535 3845 3533 2056 1760 1520 478 44419 4298 4262 3919 21314 36 --
NM_006241chr342356 771 365 51 1498 11900 12121
NM_006256chr132359 1998 1843 12028 12195 --
NM_006265chr831287 1042 542 31418 1049 584 21325 1116 --
NM_006282chr2094517 3377 3363 1882 1598 1584 1559 1297 285 --23163 989 --
NM_006287chr272549 2377 2192 2079 690 208 199 1683 ----
NM_006306chrX65110 3944 2254 1709 1185 1121 24277 686 25902 1729 14301
NM_006317chr5----1891 --
NM_006320chr42890 717 ------
NM_006352chr122083 1572 ----1709
NM_006416chr63726 528 102 ----1579
NM_006469chr161573 1502 1494 1344 416 44 ------
NM_006496chr141752 1617 654 315 1169 ----
NM_006534chr2032984 2578 2413 --13405 --
NM_006538chr264157 3882 3538 2848 1507 874 --34122 3463 2976 --
NM_006546chr1746060 4270 4091 2486 11221 36444 4501 2615 1439
NM_006559chr121191 1117 --1102 --
NM_006565chr1631174 964 379 ----1861
NM_006599chr16157768 7168 7151 6936 6676 6657 5991 2933 2488 2428 1567 702 266 175 139 57857 7638 6687 6616 230 15752 --
NM_006614chr353309 2463 2330 833 406 ----12595
NM_006622chr5----2413 389 --
NM_006624chr1052046 1795 1618 1583 1426 31789 1496 235 11738 --
NM_006628chr1573311 1786 1583 1058 693 591 582 11556 13563 --
NM_006644chr132195 60 ----1636
NM_006646chr1332913 2524 2171 12287 --12193
NM_006660chr152315 60 ------
NM_006667chrX1424 --11101 --
NM_006713chr52252 178 ------
NM_006717chr943427 3373 3353 2311 ----12677
NM_006726chr44503 411 134 86 ----11206
NM_006734chr63572 339 292 --11138 --
NM_006750chr16138053 6653 6605 6298 5870 5386 4918 1821 1710 904 262 129 31 16989 12076 25484 696
NM_006751chr22734 398 1292 ----
NM_006775chr632606 1922 74 12886 ----
NM_006777chrX32522 2104 315 ------
NM_006838chr1241798 1402 210 170 1710 11721 --
NM_006885chr1642636 2596 789 80 --43368 2956 1435 1141 14202
NM_006920chr24445 175 105 23 11748 2655 344 --
NM_006930chr531724 1705 767 1409 21350 57 --
NM_006954chr1023325 3216 --1928 --
NM_006981chr931861 817 334 --1868 1931
NM_007007chr12114549 4057 2965 1591 1333 889 718 694 611 202 173 34591 3939 3152 34751 4695 3967 --
NM_007011chr1546879 6284 5516 1217 12472 22524 1707 --
NM_007033chr11630 --1483 1142
NM_007034chr15950 879 767 692 243 ------
NM_007043chr121762 ------
NM_007050chr2097979 7472 6903 6467 6383 4962 3033 2974 840 --25258 77 --
NM_007107chr362028 1842 1496 843 362 137 ------
NM_007125chrY41274 1112 960 370 --173 --
NM_007137chrX115441 5332 5205 4967 4525 3936 3393 1535 1488 811 425 15497 ----
NM_007175chr833469 2575 97 --12720 13398
NM_007178chr121463 --1418 --
NM_007249chr13139334 8927 8774 7984 7525 6692 6337 5941 2990 2124 1380 1231 290 39413 7225 2642 18163 --
NM_007345chr1851951 1727 856 749 298 21990 557 11733 --
NM_007347chr1532942 1199 602 21070 912 22355 2215 --
NM_012096chr333481 2526 128 1425 33046 2376 321 --
NM_012120chr632754 410 212 ----12032
NM_012129chr761543 1535 544 499 480 389 --22208 908 11853
NM_012193chr1185146 2163 1632 1439 1019 1012 420 367 --31546 1273 1259 --
NM_012199chr194410 4364 3806 3747 3106 3079 1807 1193 311 --13942 --
NM_012214chr245790 4050 1016 163 36319 2106 642 16333 1668
NM_012223chr231356 1049 517 ----11319
NM_012234chr393171 2723 2612 2303 1101 935 843 834 244 1783 ----
NM_012249chr2113385 2994 2484 2397 2290 2214 1142 843 646 401 290 ------
NM_012259chr61581 1336 --2212 32
NM_012262chr1114800 4179 4126 3987 3602 3545 1738 1168 1005 816 441 25182 1657 ----
NM_012297chr432562 933 737 ------
NM_012300chr542304 2196 1016 677 12237 ----
NM_012301chr732056 798 289 2830 464 31972 1848 1561 --
NM_012308chr1172580 1980 1890 1787 1712 829 567 ------
NM_012309chr1134564 4337 3358 1933 13054 14833
NM_012334chr574605 3732 3555 3202 2948 1879 884 --1333 --
NM_012395chr793362 2983 2746 1092 851 780 680 620 586 ------
NM_012416chr931065 957 44 --11244 --
NM_012428chr152980 117 --1948 --
NM_012465chr1073379 2543 2324 1329 1077 1035 673 ------
NM_013230chrY21768 480 ----1637
NM_013254chr122543 187 --1630 --
NM_013261chr432569 2348 1221 --11053 --
NM_013283chr54851 665 193 100 ------
NM_013293chr7----1194 --
NM_013306chr11194 --1120 --
NM_013316chr72664 186 ------
NM_013396chr2131033 394 120 2959 234 ----
NM_013437chr841223 407 162 64 1373 ----
NM_013438chr97723 605 555 409 331 235 31 11376 ----
NM_013444chrX51091 1049 909 860 466 --11038 --
NM_013446chr731391 552 246 ------
NM_013448chr142748 555 ------
NM_013960chr8----1650 --
NM_014011chr262297 2110 881 778 724 365 1973 ----
NM_014048chr1654148 4069 4006 3937 344 --11160 25262 3225
NM_014109chr81281 2189 73 ----
NM_014112chr874473 4465 4158 3712 1617 1274 1233 23470 1260 12139 --
NM_014117chr163294 180 68 12375 ----
NM_014154chr331276 158 57 171 131 --
NM_014155chr1187136 6901 6551 2907 2738 2721 2109 1048 25391 449 --26681 6664
NM_014166chr1311138 2731 404 ----
NM_014253chrX31933 906 366 ------
NM_014263chr1031267 381 288 ----1109
NM_014283chr161509 1292 1243 1088 967 272 ------
NM_014393chr842120 1466 904 197 --11591 --
NM_014423chr565074 4396 3936 3893 1878 734 33816 1048 963 1464 15166
NM_014445chr352335 2083 1839 1769 371 --1476 --
NM_014494chr1692347 2338 2250 1900 1838 1660 1553 1511 660 ------
NM_014584chr1421381 581 --21462 1288 --
NM_014647chr1662071 1910 1652 1472 574 279 ------
NM_014666chr551188 1131 407 105 42 ------
NM_014670chr271606 1530 1321 1142 285 198 141 11492 ----
NM_014682chr821650 348 ------
NM_014683chr1761996 1382 634 114 108 99 --21618 1493 --
NM_014702chr633308 2428 938 33316 763 514 ----
NM_014705chr761926 1462 1338 842 633 592 11692 ----
NM_014729chr832137 1946 466 1569 1285 21953 479
NM_014751chr821523 683 --11862 21749 174
NM_014772chr181346 --1877 1549
NM_014787chr132673 2112 1969 ------
NM_014797chr642704 2257 881 56 2916 134 21257 1161 --
NM_014810chr153618 2935 2891 1389 390 23663 2470 12294 --
NM_014840chr1283259 3253 3133 3098 3015 2537 2469 1022 --12148 --
NM_014862chr1584180 3420 3001 2983 2936 2649 950 577 --14190 --
NM_014872chr912226 --11527 1263
NM_014873chr184867 4730 4503 4453 3886 3461 1146 377 11942 24268 1330 --
NM_014897chr1762856 2431 2268 644 535 411 --12591 1660
NM_014901chr511980 ------
NM_014903chr1242361 2064 883 601 --12053 --
NM_014904chr1043309 3049 970 29 13891 ----
NM_014912chr1063545 2841 2301 1234 1218 862 22175 1281 --11017
NM_014932chr361932 1887 1872 1589 757 666 ------
NM_014934chr1353538 3223 2871 939 65 --11127 --
NM_014937chr1071359 937 501 443 251 213 75 ----11238
NM_014947chr162282 2262 404 234 226 153 22662 479 23061 1041 --
NM_014969chr111034 --11179 --
NM_014982chr1463771 1212 1175 788 376 223 --11190 --
NM_014991chr443282 2735 466 412 --22069 270 --
NM_015000chr1253125 2090 1999 1970 270 --144 12771
NM_015025chr292377 2005 1987 796 696 675 584 250 65 ------
NM_015040chr263375 2946 2453 2228 1206 323 12560 ----
NM_015045chr1011906 ----11482
NM_015069chr164635 627 616 432 --1448 --
NM_015071chr576345 6327 6091 4555 1504 1062 376 14691 25065 888 1107
NM_015076chr6134488 4342 3381 1366 1265 1107 1002 884 778 748 681 486 235 24552 1522 12865 --
NM_015093chr641829 1793 1660 244 11406 ----
NM_015130chr41143 ----11030
NM_015138chr1561921 1803 1127 788 772 681 --21943 781 --
NM_015155chr1023296 226 12155 1393 --
NM_015156chr1493922 3295 3256 2875 2832 2533 1023 689 267 ------
NM_015172chr141465 1343 1041 487 ----1584
NM_015176chr161772 1389 1380 546 520 46 --11229 --
NM_015192chr2042998 2837 2741 449 21210 1084 ----
NM_015199chr352389 2204 2156 2111 730 2451 209 12966 --
NM_015206chr1533559 1274 310 13136 13547 --
NM_015215chr152865 2344 2103 1073 894 22551 2464 13057 --
NM_015268chr33736 541 165 --1627 --
NM_015271chr494203 4147 3299 3212 3115 3017 1624 354 275 11191 ----
NM_015272chr1641862 637 200 77 11896 ----
NM_015275chr1261985 1453 1442 1330 581 327 1548 ----
NM_015296chr1341215 1193 1152 904 --11065 --
NM_015310chr8178263 8044 7855 7752 6569 6251 6147 5817 5542 5177 5082 2092 1864 1170 417 386 122 17723 11060 37295 5666 5596
NM_015313chr1184532 4303 4264 4042 3967 3078 1611 1428 33843 1055 408 54062 3594 1363 718 24 --
NM_015317chr2----2708 271 --
NM_015323chr621320 1238 ----11663
NM_015336chr1272571 2390 2167 1904 1708 941 738 ------
NM_015347chr1282805 2739 2440 2078 2060 1812 875 308 ------
NM_015355chr1731392 1370 568 --1363 --
NM_015358chr2141339 1286 1186 254 ----11240
NM_015439chr64182 171 161 109 --1505 --
NM_015455chr553883 3798 3678 3420 1306 ------
NM_015465chr5----1599 --
NM_015530chr23946 827 783 --1632 --
NM_015550chr733611 1338 130 1951 --1453
NM_015559chr1811097 ----11007
NM_015564chr593190 2675 2447 1374 1305 1090 640 622 264 13244 1675 --
NM_015567chr1331309 442 82 ------
NM_015569chr1114514 3986 3908 3611 2995 1630 1341 467 427 348 334 --22941 993 --
NM_015578chr1971816 1789 1502 658 590 496 245 ------
NM_015678chr1351559 1291 646 249 133 --11229 --
NM_015878chr892167 2114 1966 1732 1493 1420 720 423 300 ------
NM_015879chr18127919 7831 7809 7467 6527 6042 5568 1876 1585 1533 1116 622 12522 28505 1335 --
NM_015902chr82809 608 ------
NM_015906chr174733 4658 4560 3579 3218 691 482 13125 11666 --
NM_016018chr82996 649 --11896 --
NM_016021chr673045 2905 2866 2461 511 459 29 --12511 --
NM_016083chr673891 3801 3535 3469 3325 3263 784 11029 21115 367 1228
NM_016087chr721756 1297 21223 476 ----
NM_016131chr24937 912 880 628 1646 1157 --
NM_016133chr231695 641 232 ------
NM_016206chr3168098 7910 7317 6966 3097 2923 2870 2184 1757 1658 1514 971 748 625 382 136 48058 3475 2300 2126 27515 2363 18441
NM_016226chr122147 61 ------
NM_016231chr1751470 1352 643 96 39 ------
NM_016289chr232340 1714 851 --1167 1904
NM_016315chr231793 1291 169 ----1252
NM_016322chr973233 3188 2692 2364 972 472 394 --23043 2604 12007
NM_016356chr632358 1063 614 12101 21851 931 --
NM_016374chr141424 1253 479 201 --2442 238 --
NM_016441chr252076 1945 1654 263 109 21633 198 ----
NM_016530chr1554049 3123 2695 938 882 13628 --1641
NM_016544chr293854 3808 3564 3494 3112 1570 1361 275 139 13884 ----
NM_016620chr12916 231 ------
NM_016631chr2141014 698 311 272 ------
NM_017412chr851426 1356 1146 374 79 173 1317 --
NM_017508chr1142421 2122 578 122 ------
NM_017545chr202233 94 --1495 --
NM_017599chr1251991 1938 1439 781 404 2494 147 ----
NM_017637chr9169435 9345 9295 9206 9047 8637 8334 7824 7779 7035 7024 3598 2888 2461 2035 400 38662 7454 3616 29148 6129 --
NM_017644chr355077 4462 3738 1596 586 23255 183 --23792 532
NM_017650chr755202 4390 3724 2399 147 --24099 246 --
NM_017658chr1444649 3222 1671 933 2960 154 14419 11272
NM_017709chr184069 3994 1088 978 786 714 602 510 13878 --1951
NM_017742chr1831721 1233 230 --11293 --
NM_017813chr885297 4992 4249 3708 2228 1329 1225 1100 34349 3571 557 23826 2069 1283
NM_017848chrX74318 4302 4156 4057 3769 2932 1434 --23495 305 --
NM_017943chr143921 767 256 ------
NM_017944chr1142119 2106 773 677 1685 --12609
NM_017994chr752375 2255 2132 1840 306 --1878 22944 147
NM_018015chrX51104 1004 356 277 75 --185 --
NM_018030chr1841057 955 320 128 --11037 --
NM_018094chrX----1267 --
NM_018098chr341002 288 220 83 11113 ----
NM_018121chr1082927 2852 2802 2688 2498 2155 525 199 --12481 --
NM_018133chr33741 703 642 --1808 --
NM_018159chrX----21642 562 11602
NM_018181chr1831887 1549 1437 --1467 --
NM_018243chr474001 3470 3383 3287 3124 3072 129 1893 13935 --
NM_018247chr642624 2335 1250 298 --1225 --
NM_018287chr105945 827 210 201 97 ------
NM_018293chr331113 1046 980 ------
NM_018325chr951548 1461 1448 537 55 11184 ----
NM_018330chr1051708 1635 1538 1410 1306 --11363 --
NM_018351chr1263987 3615 3114 3040 1878 1270 24125 976 23431 546 --
NM_018362chr1193936 3805 3296 2930 2874 2826 1359 366 60 11002 13722 31237 922 728
NM_018364chr193258 3215 3021 2978 2837 1410 984 724 68 --24033 3523 12610
NM_018373chr1496444 5720 5695 5301 5060 1961 1437 1028 331 56067 5758 866 719 620 --33994 1821 113
NM_018374chr775208 4729 4352 4333 3964 1881 160 24538 1066 35112 2017 1357 --
NM_018403chr383368 3334 3287 2713 1416 1354 1198 479 ------
NM_018444chr821745 567 --22079 2021 1628
NM_018489chr112395 --22330 592 1491
NM_018490chr1151649 1260 745 691 643 1398 ----
NM_018566chr145140 4591 3688 3124 23804 896 --1512
NM_018569chr441603 1546 1088 1002 --11431 --
NM_018638chr1284949 4465 3764 2080 1794 1272 1234 538 1502 45504 5120 4761 321 131
NM_018650chr151555 1454 867 767 193 ------
NM_018834chr531019 934 809 ------
NM_018947chr7104930 4265 3966 3749 3183 1606 1454 886 343 200 43909 1058 905 110 44290 4052 1890 1565 --
NM_018970chr782982 2674 2562 2465 2164 1190 210 191 23144 3080 32935 2193 894 --
NM_018976chr1242503 2475 1864 1799 12895 ----
NM_018979chr1272538 1763 1673 653 599 347 109 ----12163
NM_018999chr1074508 4005 3456 3153 1639 1567 452 24692 3831 14076 --
NM_019006chr15----1698 --
NM_019010chr17------1164
NM_019022chr1832861 2480 913 ----13235
NM_019080chr1311236 1316 ----
NM_019084chr1062538 2050 1845 1631 977 749 12216 ----
NM_019556chrX21053 120 ----11072
NM_019593chr2073013 2273 2032 1145 1055 670 187 12976 12950 --
NM_019610chr141682 1355 262 145 1461 ----
NM_020135chr62367 174 --1384 --
NM_020144chr721399 359 --21952 781 1516
NM_020159chr42653 325 1159 ----
NM_020177chr563186 3063 2996 2923 2655 552 22338 2152 --11010
NM_020198chr1721575 1155 --11295 --
NM_020337chr422175 2011 ------
NM_020341chr2052002 1943 1549 1340 447 ------
NM_020342chr232404 1970 917 12521 ----
NM_020432chr72602 290 12136 1276 11954
NM_020463chr251530 1236 1123 988 197 ------
NM_020640chr332128 801 721 ------
NM_020651chr251788 1720 1153 611 500 21412 326 11651 11683
NM_020666chr51645 1927 ----
NM_020699chr154848 4575 2043 1849 1696 --14013 --
NM_020718chr16105776 2334 1840 1718 1603 1158 1030 469 252 243 --34020 1755 646 15159
NM_020726chr5----1204 --
NM_020728chr752023 779 768 243 36 21171 671 33039 2922 2254 --
NM_020752chr1052241 1179 995 767 720 1391 --1407
NM_020755chr61102 11273 11086 11448
NM_020760chr261970 1941 1516 633 312 243 ------
NM_020762chr125847 200 186 105 35 ------
NM_020769chrX2979 47 ------
NM_020772chr17168484 8265 8136 7879 7629 7502 7045 5844 2774 2736 1913 1692 1551 1107 875 193 35857 2105 1903 21593 867 1433
NM_020773chr422615 2542 ------
NM_020774chr18136188 5976 5835 4996 4905 4750 4618 4483 4450 2288 755 225 127 21787 1645 11652 1681
NM_020783chr1862326 2296 2230 573 543 156 ----12306
NM_020794chr131534 415 206 --1597 --
NM_020796chr563048 1919 1873 915 817 696 22288 827 ----
NM_020801chr542531 2254 1782 817 12154 ----
NM_020834chr1411782 --157 1519
NM_020854chr1811464 1466 ----
NM_020856chr1941549 1288 147 109 ----11434
NM_020866chr132750 243 --11013 --
NM_020871chrX32518 1607 374 12465 --1596
NM_020918chr1063571 1277 1225 1088 496 401 22584 452 21023 352 --
NM_020935chr234515 3489 3332 34439 3549 1292 --1204
NM_021003chr141600 1739 1291 --
NM_021005chr154928 844 415 390 11110 ----
NM_021033chr1353373 3302 3198 574 182 --1580 12804
NM_021038chr353024 2995 2162 1293 1137 22705 222 11224 --
NM_021097chr242989 2932 2699 2091 11026 --12081
NM_021116chr7119040 8856 8475 8459 6830 6378 5778 1692 1095 1078 196 17322 --18965
NM_021183chrX52566 2424 867 688 647 1317 --1916
NM_021252chr106783 686 646 274 106 72 ------
NM_021255chr1483048 2665 2530 2494 1424 1394 812 248 43909 3371 865 804 1502 --
NM_021637chrX11149 --31336 296 267 11350
NM_021728chr141845 ------
NM_021813chr675688 5560 5484 4240 3680 3671 904 15817 1599 --
NM_021814chr661393 1153 1121 557 348 91 ------
NM_021914chr1442095 1708 635 564 1337 --22063 1962
NM_021960chr192708 2581 2508 2366 2273 794 633 452 86 --1880 --
NM_021961chr1197453 6671 6291 4814 2063 547 515 334 90 --26984 199 --
NM_021963chrX3262 230 31 --2665 565 --
NM_021964chr386447 5630 4218 2229 1244 1161 884 151 1310 1343 11018
NM_022041chr1662359 1854 623 377 357 117 12046 22114 182 12137
NM_022051chr13675 172 164 1236 --1526
NM_022133chr82375 190 ------
NM_022484chr751320 1121 1056 566 144 --1116 --
NM_022728chr73734 705 574 --182 1625
NM_022763chr363165 2355 923 718 546 355 12940 ----
NM_022771chr1231061 820 807 31047 878 677 ----
NM_022776chr321002 352 1422 --11024
NM_022824chr571915 1527 1448 1311 612 327 93 11865 ----
NM_022841chr1542502 769 753 97 1907 --1979
NM_022898chr1454437 3664 469 248 213 21841 1150 14112 --
NM_022900chr721178 1040 ------
NM_022918chr1151418 661 539 498 27 ----1236
NM_023927chr52993 941 ------
NM_024007chr542943 2611 2268 122 --12143 --
NM_024524chr383164 3068 2988 2517 2420 2244 1289 123 --12400 --
NM_024613chr831496 740 609 --11275 --
NM_024680chr111464 ------
NM_024713chr1521495 1443 ----11306
NM_024721chr852261 479 407 399 71 ------
NM_024761chr9125097 5077 4626 4340 3986 3650 2143 2058 1885 1718 696 133 --11919 13819
NM_024834chr1051592 1534 1450 94 49 11342 ----
NM_024900chr422322 504 --22029 1561 --
NM_024920chr411104 ----21163 172
NM_024947chr3109649 8538 7942 6432 3758 3450 2757 2272 1789 341 28427 618 39468 8179 7429 11571
NM_024948chr101107 --1656 --
NM_024949chr454916 4100 3392 1652 184 24874 1702 1111 13282
NM_024989chr2148157 8023 7967 7109 6905 6815 6673 6433 5327 5106 3142 1109 759 468 1453 35895 5478 2306 --
NM_024993chr241384 1335 351 166 --1579 --
NM_025054chr884212 3298 2915 1326 853 273 213 72 22819 1472 ----
NM_025134chr1662523 2365 1769 766 574 61 ------
NM_025146chr372365 2175 2139 2026 1081 571 288 1791 ----
NM_025160chr162848 1488 1175 1031 710 94 33710 1099 785 13748 --
NM_025191chr1113353 3162 3035 2929 2839 2559 2485 2344 1052 816 133 22655 2576 ----
NM_030621chr1464232 3534 1459 1216 798 192 33114 1055 304 13219 --
NM_030625chr1062261 1804 1650 748 645 162 ------
NM_030627chr5103951 3866 3455 3440 3100 2998 2976 1471 1153 114 11485 11236 --
NM_030650chr283920 3312 1180 1151 1093 901 577 371 ------
NM_030759chr10----1799 --
NM_030915chr242301 2217 1572 884 12236 ----
NM_030920chr12525 107 21525 361 --1630
NM_030940chr921408 358 --2388 79 21336 1299
NM_031296chr452720 2300 2232 2083 1880 32563 1900 1683 1912 --
NM_031431chr1341466 1251 231 138 ----11596
NM_031442chrX52869 2850 2832 2339 2033 --1522 --
NM_031483chr2013270 31376 980 928 1373 --
NM_032042chr562771 2269 2179 884 709 297 ----12632
NM_032124chr181866 --11143 1204
NM_032153chr332449 1775 854 32634 2396 2033 ----
NM_032181chr22829 790 ------
NM_032217chr421076 564 2145 108 1172 --
NM_032228chr1133341 3076 308 13132 13319 --
NM_032256chr122336 50 1274 --1656
NM_032435chr152421 2134 1842 670 452 1762 --12371
NM_032439chr1021583 670 --1420 --
NM_032440chr1062872 2186 2035 1019 736 83 21940 933 12889 12087
NM_032446chr543220 3062 1050 559 43704 3365 3195 2415 13291 11002
NM_032457chr453246 3183 3149 2487 2471 13331 1331 --
NM_032458chrX73289 2661 2587 2244 755 535 427 1179 ----
NM_032471chr631056 866 136 --191 --
NM_032521chr2042970 2669 370 158 22815 2360 31001 615 506 --
NM_032582chr1771766 1718 1556 1471 1436 1424 1385 ----159
NM_032632chr1431951 1878 1729 2283 100 21828 554 --
NM_032804chr1042595 1813 858 434 ----22442 2222
NM_032842chr711425 --41161 509 162 146 --
NM_032857chr151195 ------
NM_032859chr1342970 2842 1356 794 --22792 415 11400
NM_032873chr1194513 4131 3959 3369 2984 1324 1315 1308 795 13429 12914 --
NM_032900chr1062997 2812 1230 896 803 361 --23867 3206 --
NM_032918chr1231295 262 30 ----11278
NM_032961chr441128 863 391 161 ----21058 112
NM_032968chrX84222 3827 3378 3172 1399 1232 1169 728 12745 21664 1046 --
NM_032973chrY94214 3819 3373 3167 1634 1399 1232 1169 728 12740 33967 1658 1046 --
NM_033088chr1----1522 --
NM_033222chr921255 876 ----1302
NM_033224chr7107053 6428 5487 4897 2973 2812 2522 2345 1869 1585 12601 16722 --
NM_033389chr1784626 4347 3966 1692 1610 1401 1232 22 21803 351 24438 4221 11452
NM_033495chrX2951 418 ----1111
NM_033505chr2216785 6767 6488 6445 5728 5147 4738 4388 4373 4208 2420 2336 1779 1719 1675 1591 1456 1360 1140 1101 671 26709 5942 12160 11463
NM_052845chr1233082 1009 579 23269 1098 22385 456 --
NM_052879chr1273794 2929 2608 1367 1084 894 708 13637 1951 11123
NM_052885chr12104259 4053 3272 1415 1326 1144 958 855 290 66 --13821 --
NM_052910chr1361893 1650 1338 717 486 136 11569 ----
NM_053023chr1142564 1129 741 337 1104 --12830
NM_057749chr861396 1307 881 526 510 193 ------
NM_080546chr921797 402 --1274 --
NM_080664chr1452002 1828 285 153 26 --21866 424 --
NM_080832chrX21178 179 ------
NM_080867chr14114508 4446 4269 4141 3335 1719 1621 1287 836 546 511 --1864 23691 1421
NM_080927chr343387 1354 361 97 --23095 552 1131
NM_130446chr353924 3107 1748 682 400 --33257 1238 311 13006
NM_133265chrX53516 3331 2896 1018 695 1752 ----
NM_133329chr231501 1330 1205 11799 ----
NM_133334chr455530 5166 4323 1101 356 24613 1514 35398 4000 2217 --
NM_133445chr963794 2649 796 623 432 79 ----22714 1415
NM_133478chr232433 1735 384 --22553 1724 --
NM_133494chr1------138
NM_138333chr921750 668 1298 ----
NM_138357chr1041274 598 581 386 1610 ----
NM_138426chr742392 2233 538 381 ------
NM_138468chr286019 5625 4631 3854 2135 1686 1354 1213 36184 6076 5813 24951 1830 --
NM_138731chr1484131 3489 1438 1119 1054 853 257 231 1466 ----
NM_138771chr751511 1228 1172 240 71 1579 21275 427 --
NM_138782chr542320 1904 1614 360 11473 12237 --
NM_138959chr166779 6289 4161 2668 1328 944 1109 --1199
NM_138966chr181193 ------
NM_139076chr411460 --11339 --
NM_139207chr1291493 661 576 527 439 403 333 268 109 ------
NM_139283chr1242435 1707 918 821 --11575 --
NM_144571chr4106328 6300 6262 6115 5065 2556 1866 1736 1263 1113 1463 36524 2575 2469 --
NM_144574chr143211 154 37 ------
NM_144578chr14115278 4993 4805 4593 3549 1809 1066 866 854 536 142 1723 24652 1318 --
NM_144657chrX2646 68 2543 219 1571 --
NM_144664chr1162549 2254 2084 1705 990 203 1854 --1142
NM_144703chr2031200 1056 327 2155 41 ----
NM_144726chr541180 1073 937 492 11231 ----
NM_144778chr1342333 2039 1870 1023 1341 ----
NM_144963chr862290 1062 776 769 327 285 ----12617
NM_144976chr19----1538 --
NM_144982chr12139 --1520 1275
NM_145176chr652754 2356 2343 2281 539 2987 966 1761 --
NM_145203chr131605 1216 1202 --
NM_145307chr10104621 3443 2975 2840 1001 754 347 245 81 41 13456 54015 3750 1779 1528 1443 23876 781
NM_145735chr1342705 2660 2584 155 1184 ----
NM_147128chr731668 1067 1061 1328 --11204
NM_152261chr1242093 769 358 134 12519 --1245
NM_152271chr851124 1071 844 829 754 --11093 --
NM_152277chr542084 1318 304 214 --11612 --
NM_152280chr132808 2739 649 43046 3008 1028 1015 1354 --
NM_152387chr21862 --1963 --
NM_152409chr553075 2252 835 670 572 2597 398 ----
NM_152414chr841433 1266 1229 400 11081 ----
NM_152424chrX104255 3741 3662 3248 1768 928 760 675 629 289 11021 12936 --
NM_152450chr1541424 826 798 609 ------
NM_152519chr23394 291 255 ----11796
NM_152556chr751766 1726 1608 202 46 --1553 --
NM_152557chr72235 229 11535 ----
NM_152594chr15--12097 1806 --
NM_152608chr162281 2225 2019 1759 1672 412 --1608 --
NM_152641chr1252841 2395 2270 1802 539 --1744 --
NM_152678chr332241 1839 542 12419 11982 12531
NM_152745chr72197 163 --11027 --
NM_152753chr652045 1456 1283 753 731 --22079 1424 --
NM_152754chr763870 3724 2994 1405 980 79 13228 21386 967 --
NM_152756chr574151 3747 3223 1607 1126 1052 488 12698 13926 --
NM_152758chr832328 263 207 11222 --12067
NM_152765chr852332 2279 1542 618 231 --21778 102 --
NM_152787chrX72495 2406 1345 1235 1063 724 562 11048 23235 541 --
NM_152996chr161316 348 321 249 161 149 1722 --11693
NM_153000chr182656 639 --1238 --
NM_153035chr132954 2385 192 --22506 2234 1379
NM_153262chr172820 2203 2067 1142 1135 758 413 12508 12125 --
NM_153634chr1261486 1396 1110 1044 511 420 --21298 573 --
NM_153686chr432258 2233 1788 12131 1269 12097
NM_153689chr2102363 2069 813 715 704 467 383 307 92 84 31955 1900 334 ----
NM_172069chr232328 1851 1626 ----12226
NM_172070chr241595 664 645 462 21722 637 ----
NM_172071chr1136849 6542 6392 5889 5804 5677 5182 4747 2781 2567 1141 817 349 35269 4808 4627 12323 --
NM_172373chr1341363 1054 482 28 269 40 1110 --
NM_173468chr465915 5811 5352 4671 3799 750 24952 3907 24440 833 14862
NM_173470chrX32739 1116 541 42596 2325 846 733 1382 --
NM_173511chr253815 3390 2740 2541 743 13196 11530 21151 387
NM_173582chr11105611 4274 3945 2420 2264 2102 2094 2021 1892 399 --1347 12354
NM_173644chr2021979 788 11862 --1423
NM_173797chr51316 1279 ----
NM_173808chr184120 3265 3000 2986 1416 882 566 262 13187 ----
NM_173826chr331496 357 114 ----1655
NM_175058chr1121358 1342 ------
NM_175733chr1171443 778 729 503 486 138 70 ------
NM_175854chr1322415 507 ----1687
NM_176814chr731366 537 141 1372 1216 --
NM_178011chr1053047 994 712 615 191 13246 ----
NM_178313chr231828 1439 718 1160 --1265
NM_178505chr1073519 3493 3050 2636 1398 1241 186 23070 2483 ----
NM_180989chr1332437 135 70 22346 964 11791 --
NM_180991chr552698 2657 2600 714 549 12196 12645 --
NM_181054chr1421277 1160 21154 146 --1964
NM_181358chr174208 3580 1468 1101 725 242 179 13743 ----
NM_181705chr553665 2182 712 522 510 34985 4596 4243 ----
NM_181723chr831505 878 293 11588 --11689
NM_181782chr622196 1743 --1316 --
NM_181836chr532151 836 405 --12027 --
NM_181869chr1242413 2071 246 184 1616 31997 787 41 11086
NM_182503chr695329 4773 4419 1992 1956 1521 1373 1319 471 21944 866 11247 --
NM_182700chr761860 1804 1593 620 346 156 ----11962
NM_182830chr1421782 648 ------
NM_182926chr14----2438 64 --
NM_182975chr1--11051 11163 --
NM_194247chr2114501 4168 3782 3352 2959 1234 1216 1145 815 527 286 24174 4052 ----
NM_194285chr1173285 3077 1303 549 472 368 236 ------
NM_194314chr1175329 5215 3858 3748 3721 3689 3599 3529 2266 2196 1664 1430 1120 881 660 429 277 --11724 --
NM_194449chr182863 390 ----1658
NM_198270chrX53205 2371 1031 809 571 --23522 205 --
NM_198273chr562755 2346 1978 1016 659 312 12130 13076 --
NM_198275chr11------1249
NM_198281chr463389 1170 1137 1055 1043 341 12442 ----
NM_198506chr411114 157 --11344
NM_198513chr841985 1823 1351 688 1117 --171
NM_198581chr2127518 7242 6243 5855 3025 2795 2500 2377 1794 1669 822 39 21730 1203 76537 5594 5265 4968 4803 813 67 1207
NM_198859chr353764 789 765 664 365 --1907 --
NM_198935chr2052214 2067 1090 895 445 22075 838 1698 --
NM_199044chr172321 2130 1059 1032 832 758 538 ------
NM_201435chr121736 --1565 --
NM_201613chr121754 182 --1232
NM_203394chr126874 777 759 712 667 167 --12666 --
NM_203406chr542926 2721 2647 972 165 12496 22453 2415
NM_203463chr254930 4123 3896 3613 1848 11736 14233 1211
NM_206853chr683680 2754 503 451 383 222 191 106 24142 24 31578 914 737 --
NM_206854chr694941 4015 1764 1712 1644 1483 1452 1367 909 25403 1285 21998 406 --
NM_212559chrX------1850
NM_213589chr2115060 4913 4307 3898 3832 3656 3634 1269 721 702 627 1557 13860 11340