TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-938
miRNA Sequence: UGCCCUUAAAGGUGAACCCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX66895 6237 6097 5238 1946 439 25690 4670 25606 5571 15786
NM_000523chr2----1353 --
NM_001004065chr9----11319 --
NM_001008564chr13------1864
NM_001017440chr797241 6222 6198 2383 2190 933 544 409 201 37304 5536 2118 --11720
NM_001018067chr135091 4436 1050 ----14350
NM_001031679chr121534 21280 588 --21315 104
NM_001100108chr178108 6875 2415 2364 1920 1754 41 22546 2515 27452 2688 --
NM_001106chr3168901 8496 8399 8218 8067 7495 6383 6298 6243 3745 3564 3318 2089 1775 921 749 33845 3694 2129 ----
NM_001124chr111164 ----1535
NM_001198chr61775 ----11606
NM_001430chr231782 1246 591 ----11842
NM_001650chr1821513 1184 ----1696
NM_001681chr12----135 --
NM_001759chr1253751 3597 1614 820 218 44103 3891 3694 865 11640 --
NM_001957chr4--1151 ----
NM_002025chrX53516 3037 2647 2639 686 28793 2802 --1181
NM_002382chr1411139 --1503 --
NM_002628chr3----11025 --
NM_002709chr2----11305 --
NM_002717chr8------1216
NM_002843chr1133068 2831 2561 ----22593 138
NM_002876chr17----125 --
NM_003010chr1722162 34 ----12122
NM_003108chr2106995 6448 2794 2469 2091 1944 1932 1794 1717 1685 22514 2404 25268 2487 --
NM_003137chr61425 --12014 12217
NM_003161chr1763533 3141 1448 1021 697 354 ----1304
NM_003262chr3------1827
NM_003406chr82298 167 --11991 1579
NM_003410chrX----12663 --
NM_003750chr10----1218 --
NM_003768chr151389 391 227 221 205 2478 82 --1710
NM_004050chr1482408 2185 1929 1792 1085 670 413 141 32179 809 130 --2578 221
NM_004296chr1473764 3726 3216 1145 882 705 136 --23831 3421 1127
NM_004454chr331690 710 391 2196 64 1475 --
NM_004598chr521069 194 ----11203
NM_004842chr6----11232 --
NM_004852chr18813744 11952 11360 8631 2417 2404 2165 1875 112683 ----
NM_005254chr15----1351 --
NM_005324chr171420 --1763 12065
NM_005402chr711570 ------
NM_005596chr965783 5226 2412 950 305 115 25576 1227 --11011
NM_005693chr111149 ------
NM_005902chr1564294 4261 3426 1210 402 21 2233 27 --13111
NM_005937chr17134003 3829 3624 3495 3463 3397 3071 3017 1445 1148 435 329 58 64137 3513 850 650 583 533 ----
NM_005941chr832636 1493 663 13956 23117 3040 --
NM_005955chr175004 4675 3388 3348 958 920 327 21741 489 ----
NM_006011chr1553977 2992 1001 601 565 14245 21469 796 --
NM_006166chr12------1407
NM_006195chr9------1329
NM_006212chr155148 4723 4601 1591 391 21027 218 24975 681 --
NM_006546chr1755630 5089 4292 4205 4185 32594 2467 1979 45443 4718 1047 853 24980 4960
NM_006601chr12----1166 --
NM_006750chr1626207 554 16965 --18061
NM_007050chr2096774 6523 6268 3098 2908 2637 488 245 168 56736 6123 5009 1884 1482 16308 --
NM_007173chr1112282 --132 --
NM_007249chr1336262 2091 1661 3711 544 99 17786 16116
NM_012428chr15----1154 --
NM_013390chr921327 634 --1596 21526 1400
NM_014117chr1612358 --12462 --
NM_014423chr534865 3673 806 15542 14922 13480
NM_014491chr7----1316 --
NM_014747chr1114972 4689 4545 4505 4406 2094 1848 1777 1541 1005 915 44750 3573 2151 873 35181 682 544 21902 1731
NM_014935chr143690 3113 3052 2385 31314 1080 718 --23377 704
NM_015042chr1574194 4149 3038 2995 2633 1645 1213 33368 2942 2934 24156 3592 --
NM_015144chr1613497 --1769 --
NM_015192chr2042755 1924 1877 1154 ------
NM_015313chr1183487 1663 1200 1174 1012 814 608 203 24579 3260 ----
NM_015530chr2----1242 --
NM_017635chr11----1411 --
NM_018330chr101289 ----11387
NM_018489chr12180 94 1666 1238 11783
NM_018951chr711058 ------
NM_020337chr432149 2126 1229 ----1891
NM_020432chr71236 ------
NM_020760chr211891 ------
NM_020772chr171677 23291 683 11355 15361
NM_023940chr45925 131 122 108 46 --1880 --
NM_024345chr955878 4878 1479 1042 980 13888 --16069
NM_024524chr3----12031 --
NM_024969chr2----1633 --
NM_025134chr16----12267 --
NM_030939chr61925 --11098 --
NM_031216chr181311 --11424 --
NM_032181chr21663 ------
NM_032440chr1012122 ----1759
NM_133468chr742050 1859 757 180 32321 2041 446 --1462
NM_138340chr18------1439
NM_144778chr131285 2497 441 ----
NM_152678chr3------22656 1945
NM_152835chr112630 --1110 12110
NM_153607chr5------12976
NM_173495chrX22201 1740 22531 2158 --12135
NM_173595chr12134452 4446 4058 3908 3842 1974 1722 1712 1610 1474 887 687 533 75095 5055 4849 4086 1116 797 518 12054 --
NM_173849chr14----1240 --
NM_175736chr12153106 2910 2804 2729 2523 2503 2038 1568 1447 917 651 246 236 90 78 34856 2464 2361 11760 33055 1419 513
NM_182970chr20103926 3706 3374 3304 3293 3251 3026 2711 1613 501 2467 77 33049 1625 894 11039
NM_183397chr2095031 4131 3948 3930 3409 1701 585 525 23 13942 ----
NM_194247chr223646 560 14292 13623 13899
NM_198581chr226992 2967 16866 --1527
NM_198721chr4----141 --