TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-940
miRNA Sequence: AAGGCAGGGCCCCCGCUCCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr1--1129 1614 --
NM_000024chr51134 ------
NM_000037chr851906 766 542 174 80 --21820 236 --
NM_000038chr511307 --21499 515 --
NM_000044chrX159 ------
NM_000068chr1931339 1310 362 --11447 --
NM_000074chrX4844 786 321 201 191 ----
NM_000081chr121868 1161 11329 --11235
NM_000084chrX106166 5393 5374 5359 5231 4810 4572 4433 2715 619 15282 46330 4215 2201 1320 --
NM_000115chr1322028 1049 12491 ----
NM_000125chr6133776 3746 3455 3035 2891 2707 1481 1130 686 372 178 82 39 13028 12701 --
NM_000135chr163972 754 111 ------
NM_000141chr1031056 302 251 ------
NM_000166chrX6603 577 239 89 71 43 ------
NM_000178chr203369 264 253 ------
NM_000188chr104481 214 108 27 ------
NM_000192chr121598 --2392 346 --
NM_000212chr175981 772 598 537 60 --12144 1296
NM_000214chr2071788 1630 1592 1584 1309 310 277 --11313 --
NM_000217chr1224723 1851 13284 11269 --
NM_000232chr442676 2526 2371 415 --22531 2398 --
NM_000245chr741964 237 95 58 12173 ----
NM_000248chr372963 2919 2658 2375 2368 489 36 --12379 --
NM_000259chr1574961 4902 2021 1842 1314 649 40 13926 54944 4156 4125 1197 1153 --
NM_000267chr1752745 370 185 73 67 ----1170
NM_000276chrX42076 1954 1850 539 --1780 1860
NM_000314chr1053016 3006 1041 1019 645 ------
NM_000319chr124898 455 279 133 --11096 --
NM_000320chr43599 264 31 --152 --
NM_000332chr686580 6187 5818 4616 791 736 447 437 22375 2188 26208 285 11655
NM_000346chr1741503 1484 734 363 ------
NM_000362chr2293144 2903 2805 1288 1240 771 748 565 190 --73024 2995 1372 1368 1259 828 775 23494 3089
NM_000390chrX52948 2599 2190 1261 713 --11352 --
NM_000399chr102911 93 1968 1291 --
NM_000408chr253088 2596 2438 2141 107 1415 12698 --
NM_000425chrX4643 459 190 109 ------
NM_000430chr1773456 3057 2853 2642 2535 2483 2309 12543 12559 --
NM_000459chr93585 82 63 ----1931
NM_000461chr351714 1476 1299 1225 1210 21463 64 21309 1121 --
NM_000480chr1141446 1392 418 346 ------
NM_000484chr211428 ----1438
NM_000489chrX32424 2242 708 22984 197 32404 526 314 --
NM_000503chr841331 610 259 144 ------
NM_000522chr71406 --11225 --
NM_000533chrX41241 415 223 87 1545 ----
NM_000615chr1172831 2397 2372 920 784 705 149 --11036 --
NM_000618chr12126397 6351 6278 5853 5586 5201 5163 5153 4168 2566 2035 1208 16100 25403 293 --
NM_000621chr1311062 --31289 1155 571 --
NM_000633chr1844785 1804 1152 849 15237 3988 958 290 11465
NM_000676chr173544 215 111 ------
NM_000682chr291606 1385 720 593 470 194 105 81 62 --31835 1446 56 --
NM_000721chr172478 2284 1782 1762 731 305 221 ------
NM_000723chr1771587 1401 1387 1156 1093 1064 103 11328 61636 1414 1299 1195 482 206 --
NM_000724chr1021483 110 --1494 11408
NM_000725chr124813 649 145 122 --41004 955 937 785 --
NM_000726chr231327 1074 1030 ------
NM_000738chr118868 853 759 731 297 225 156 92 --1857 --
NM_000757chr18840 750 728 690 668 576 169 106 --3825 682 126 --
NM_000767chr1961432 1419 1115 1066 957 107 --2331 93 --
NM_000795chr1161012 948 863 727 179 45 --131 --
NM_000800chr521071 263 ----11394
NM_000806chr5395 89 81 --1155 11883
NM_000814chr1523128 59 13231 13023 --
NM_000828chrX31329 486 58 ------
NM_000837chr82372 55 ------
NM_000838chr652752 1753 698 387 155 ------
NM_000844chr31161 11009 1334 --
NM_000860chr441576 1298 1265 275 --21172 1062 --
NM_000861chr352481 2232 1974 633 321 --12622 11771
NM_000868chrX42499 1665 507 103 1967 21801 1796 --
NM_000870chr53313 252 68 --51276 1272 514 460 436 --
NM_000875chr15147035 6283 4913 4657 2379 1591 1492 1482 870 849 724 345 310 214 26987 582 66613 2822 1958 1732 951 855 --
NM_000883chr74532 512 476 291 --2576 266 --
NM_000891chr1773611 3483 1291 1204 997 785 371 --11415 --
NM_000901chr462533 2388 2368 1706 536 28 --11975 --
NM_000908chr52176 30 --1578 --
NM_000922chr111293 21055 75 ----
NM_000937chr173379 331 46 --2277 70 --
NM_000944chr4--1927 199 --
NM_000945chr241781 1528 772 690 --11480 --
NM_000949chr51852 1263 1144 --
NM_000961chr20163889 3706 3453 3323 3023 2868 2639 2555 1523 1250 1087 526 332 56 46 37 --53843 3457 2895 1266 125 --
NM_000962chr973087 3079 3036 2277 1995 1925 242 1472 23063 2245 --
NM_000964chr17101301 1208 1190 970 477 309 193 100 90 54 --2885 418 --
NM_000965chr321054 474 186 ----
NM_001001132chr2121194 132 ------
NM_001001342chr1011439 ----11127
NM_001001344chrX52490 983 890 883 190 12268 22395 1686 --
NM_001001481chr82898 396 23250 925 12611 --
NM_001001520chr19------1140
NM_001001522chr111363 --172 --
NM_001001549chr762378 2154 975 965 553 336 ------
NM_001001557chr83762 697 188 22096 2070 2873 224 1618
NM_001001560chr223527 185 168 ------
NM_001001586chr12411 51 ------
NM_001001701chr452282 2142 2131 1846 1691 --1869 --
NM_001001890chr2173205 3109 3038 1438 1377 1195 1077 12706 ----
NM_001001977chr20----1112 --
NM_001001995chrX2761 121 11274 ----
NM_001002252chr12156 --1266 --
NM_001002259chr121294 ------
NM_001002295chr1051112 1086 1074 965 791 ------
NM_001002814chr893692 3383 3318 3176 2533 1452 1326 797 52 1676 33850 78 73 --
NM_001002840chr71706 --1191 --
NM_001002860chr1464637 4245 3616 3389 1227 1220 24156 203 11108 --
NM_001002909chr1782115 2107 2069 1549 1384 834 326 200 --31837 1647 429 --
NM_001003652chr18128667 6186 5467 5377 3465 2811 2446 2322 2195 1579 551 396 38546 5600 3490 36439 1828 1615 --
NM_001003674chr18147038 6921 6910 6118 5471 4962 4647 4615 2689 2357 1950 1845 1725 1134 --12523 --
NM_001003676chr115979 638 329 219 106 --1333 --
NM_001003681chr2231452 408 278 1830 21894 417 --
NM_001003694chr32439 151 ------
NM_001003712chr1223404 1399 --11524 --
NM_001003805chr14162 ------
NM_001003891chr227810 645 599 293 142 129 58 --1117 --
NM_001004065chr953325 3213 2928 942 445 22947 733 23930 3473 13175
NM_001004105chr5136 ------
NM_001004317chr664426 3867 3111 3040 1650 586 ----13423
NM_001005209chr24736 677 59 41 ------
NM_001005336chr91563 --1121 --
NM_001005353chr11180 ------
NM_001005386chr261678 701 242 235 201 105 ------
NM_001005404chr17104067 3997 2796 1312 1280 754 331 182 174 112 14304 ----
NM_001005417chr13555 507 38 --2631 184 --
NM_001005463chr1042495 2425 2354 695 1580 1657 --
NM_001005473chr595927 5413 5044 4940 4268 2343 2331 2015 1109 1347 --26381 1549
NM_001005505chr341702 511 381 67 21606 339 31143 359 247 --
NM_001005609chrX103730 3539 3328 3264 2928 1375 990 856 696 527 13020 43557 2414 828 167 --
NM_001005732chr21176 ------
NM_001006115chr3112477 2334 2157 2151 2131 2121 2111 662 352 244 68 --22655 1719 1703
NM_001006600chr51974 ------
NM_001006657chr283031 2711 2439 2170 2113 1269 1208 595 12037 32264 2175 664 --
NM_001006933chrX----154 --
NM_001006944chr116673 528 508 254 213 75 ------
NM_001007027chr11--1268 166 --
NM_001007067chr821119 435 1742 ----
NM_001007072chr15293 29 ----158
NM_001007097chr931014 920 873 24066 111 1906 --
NM_001007098chr16823 377 327 240 209 151 --1131 --
NM_001007156chr1561875 1737 1695 1592 661 250 --1404 --
NM_001007226chr1731351 1283 982 --21134 313 --
NM_001007255chr11286 --1114 --
NM_001007271chr107834 746 199 150 70 42 29 ------
NM_001007278chr1373894 3239 1775 1766 1558 1462 920 24660 4606 2624 474 --
NM_001007471chr91862 --2633 94 --
NM_001007527chr51227 ------
NM_001007553chr12409 304 1796 ----
NM_001008220chr5143817 3764 3662 3645 3544 3533 2693 2582 898 624 474 372 309 115 --12820 --
NM_001008222chrX11267 --21356 323 --
NM_001008225chr7--1691 ----
NM_001008239chr1882423 2392 2368 1481 1383 561 407 295 --23131 1387 --
NM_001008392chr393579 3325 3227 2974 2876 2399 819 584 337 --163 11394
NM_001008564chr1321577 838 ------
NM_001008660chr113351 237 87 ------
NM_001008701chr19132885 2851 2607 2483 2382 2241 1909 1210 1201 661 652 635 524 --12835 --
NM_001009552chr82232 120 --122 --
NM_001009569chr102107 82 175 ----
NM_001009813chr192386 140 --157 --
NM_001009880chr22154555 4240 4003 3877 3807 3405 3387 3083 1751 1355 1103 1030 791 200 70 ----14440
NM_001009899chr3115654 5382 5071 4842 4504 4255 2058 1829 1781 1287 1252 --44266 2407 1573 1439 --
NM_001009993chr2123471 3442 3343 3185 3083 2954 1725 1307 1194 943 633 219 ------
NM_001010000chr1863024 2434 2407 1076 922 479 --12813 --
NM_001010854chr14393 49 26 ------
NM_001010867chr1196621 6443 6361 6034 5870 5662 5175 4641 4093 2654 2450 2065 1795 1737 1726 1549 712 358 88 --86101 5924 5249 4475 2600 2459 2092 154 --
NM_001010888chrX84507 4213 4098 3775 3764 3262 1584 1226 ------
NM_001010908chr102503 480 ------
NM_001010924chr1041224 998 822 482 ------
NM_001010938chr34226 162 111 52 --3780 296 30 --
NM_001010986chrX2547 357 11600 12493 --
NM_001011515chr431037 951 93 ------
NM_001011537chr352054 1840 1462 454 419 --1202 --
NM_001011666chr796063 6050 6027 5206 4651 4441 1674 1534 322 --14750 11035
NM_001012329chr172285 2275 1544 907 606 123 92 1406 22338 769 --
NM_001012393chr11104159 3683 1945 1850 1809 1719 1432 324 288 261 --44189 1951 884 35 --
NM_001012398chr16281 37 --1168 --
NM_001012614chr42697 189 --1484 --
NM_001012643chr195527 220 208 103 75 1515 124 --
NM_001012753chr193824 284 34 --21146 1104 --
NM_001012977chrX41425 1165 467 279 11134 ----
NM_001012979chrX1164 --154 --
NM_001012989chrX143 --1255 --
NM_001013031chr1053326 938 707 680 533 --42982 1099 1080 756 12226
NM_001013620chr12108424 7971 7782 7039 6736 6414 3153 1027 997 918 1595 45979 3071 2935 198 --
NM_001013635chr128903 890 882 827 340 282 192 36 ----1847
NM_001013690chr1291803 897 512 467 436 316 308 178 136 12493 42464 1774 1571 576 --
NM_001013693chr1122920 2598 2332 2282 2236 2166 1855 1834 615 599 522 391 --42141 1827 902 231 --
NM_001014283chr1341822 202 163 141 --1735 11854
NM_001014797chr1097711 7441 5948 5726 2837 2214 826 660 284 37921 7026 2846 17509 27864 6289
NM_001014839chr15895 769 727 386 368 --1743 --
NM_001015053chr1791136 635 461 259 222 184 138 124 115 --1640 --
NM_001015508chr81517 ------
NM_001015877chrX52549 2408 1983 1208 1150 1137 ----
NM_001015880chr1021547 1159 11120 --11075
NM_001015887chr311365 --31370 677 673 --
NM_001017395chr3123621 3418 3278 2955 2502 2327 2218 1402 1357 1067 1016 586 11407 22451 395 --
NM_001017405chr43746 88 71 --1692 --
NM_001017440chr7197486 7349 6879 6759 5940 5928 5355 5222 5113 2779 2353 2346 2074 1955 1928 1637 1617 616 206 --57268 1912 1610 1263 903 --
NM_001017523chr1241681 1249 119 49 11570 1719 --
NM_001017969chr91547 ------
NM_001018004chr15------164
NM_001018064chr9----2440 289 --
NM_001018067chr164234 4073 2060 1919 1369 287 15318 1442 --
NM_001018108chr1541925 639 615 30 12248 ----
NM_001020818chr1971731 1404 671 512 493 392 52 --41738 1463 574 113 --
NM_001024226chr141090 92 40 32 ------
NM_001024460chr631116 1050 75 --11120 --
NM_001024668chr125972 789 745 238 72 ------
NM_001024688chr822179 2071 --11595 --
NM_001024808chr1282111 1797 1034 1023 912 858 544 268 ------
NM_001024845chr18998 775 677 399 374 323 95 84 --11058 --
NM_001024934chr6----1528 1593
NM_001024948chr172921 2839 2167 2150 1346 330 273 --22636 2258 --
NM_001024948chr172921 2839 2167 2150 1346 330 273 --22636 2258 --
NM_001024948chr172921 2839 2167 2150 1346 330 273 --22636 2258 --
NM_001025068chr351716 1590 1270 1131 485 ----1188
NM_001025076chr10115205 4908 4839 4806 4207 3922 2160 2108 1261 488 24 25254 78 14160 15558
NM_001025077chr10146563 6266 6197 6164 5565 5280 2619 1846 1168 1069 884 446 424 24 46612 1436 954 913 25518 69 16916
NM_001025079chr343441 3347 1672 495 12624 21121 729 --
NM_001025081chr1851076 471 73 51 27 ------
NM_001025105chr52578 360 --11348 1584
NM_001025108chr2104177 3334 3251 3143 2555 1452 1166 885 624 475 --12829 --
NM_001025205chr32400 109 --1101 --
NM_001025266chr3124917 3797 3251 1664 1259 1093 907 693 660 535 426 388 --33824 1691 432 --
NM_001025366chr621482 611 ------
NM_001025579chr1771042 758 402 245 190 116 74 ------
NM_001025579chr1771042 758 402 245 190 116 74 ------
NM_001025580chrX33463 737 291 --33476 388 325 --
NM_001025596chr11148 --1114 --
NM_001025780chr951370 1152 1060 997 106 --21391 1024 --
NM_001029863chr643109 2506 1132 1000 22857 2840 ----
NM_001029882chr14492 129 117 109 ------
NM_001030007chr1653995 3434 3131 2747 208 --2932 528 --
NM_001030055chr1423206 1217 14437 1383 --
NM_001031677chr5--1374 1131 --
NM_001031695chr2285414 5150 5127 4760 4479 3599 877 202 --64344 3568 1889 1731 1057 616 --
NM_001031702chr32682 117 --3809 122 33 --
NM_001031732chr433187 502 96 1101 13253 --
NM_001031740chr111192 --2384 263 --
NM_001031803chr173290 202 67 ------
NM_001031804chr1653349 1179 1095 858 212 --12733 13468
NM_001032289chrX1842 --1761 --
NM_001032293chr171624 ------
NM_001032296chr1342719 2225 1063 566 --42425 805 571 373 --
NM_001033047chr432225 2180 241 --1157 --
NM_001033057chr311580 21369 1313 11801 --
NM_001033081chr171909 1891 1424 1404 1367 491 28 1280 ----
NM_001033117chr3124877 4756 4591 4429 4418 4166 3806 1918 1423 808 703 671 14230 13543 --
NM_001033518chr762680 1844 1076 712 425 350 --22155 1906 22705 207
NM_001033602chr13102675 2565 2545 2416 2201 2053 1940 1711 716 634 --22509 2480 --
NM_001033677chr12----2121 68 --
NM_001033925chr1032084 1485 173 ------
NM_001034025chr121172 --2876 176 --
NM_001034841chr1695451 4519 3528 1808 1489 1347 985 842 380 11122 44645 4128 1689 1493 24873 800
NM_001034915chr811161 --21565 452 --
NM_001035260chr1031248 321 67 ------
NM_001035511chr172005 1763 1748 1727 476 313 258 ----1139
NM_001035521chr2----1128 1592
NM_001037164chr741900 525 154 87 31914 1745 327 191 --
NM_001037290chr111382 ------
NM_001037324chr33562 292 176 --2244 193 --
NM_001037339chr131198 685 390 --41505 1210 689 194 --
NM_001037553chr21144895 4830 4640 4373 3833 3672 3659 3562 1687 1028 585 409 305 165 --33523 3519 641 24216 3721
NM_001038493chr22581 554 --2566 28 --
NM_001038493chr22581 554 --2566 28 --
NM_001038702chr532589 326 46 --1296 --
NM_001038707chr1121973 1870 1647 1442 843 831 824 708 701 462 444 24 1128 32228 1768 318 --
NM_001039547chr366187 5755 3044 2920 943 612 --67788 7627 7484 4884 2724 2162 --
NM_001039550chr24745 711 681 551 --1761 --
NM_001039574chr161066 1057 910 885 746 314 --1996 --
NM_001039582chrX2291 234 --1339 --
NM_001039583chr224371 161 126 101 --2433 119 --
NM_001039590chrX63543 2563 2468 596 372 137 --23509 376 11350
NM_001039618chr1195843 5713 5312 5025 3718 1305 429 330 238 --11411 21753 602
NM_001039619chr142127 99 --1135 --
NM_001039690chr16102137 1944 1850 1824 1786 1635 1512 824 665 406 1426 ----
NM_001039711chr1----1106 --
NM_001039802chr1----11065 --
NM_001039840chrX126020 5329 4328 4011 3853 2064 1762 1471 567 446 319 34 35058 4581 4344 25997 5016 --
NM_001039916chr1211035 --1450 --
NM_001039960chr1261667 1065 598 366 343 112 ------
NM_001040100chr32144 136 ------
NM_001040110chr771866 1856 1359 723 681 601 572 --21308 1239 --
NM_001040142chr221726 382 11502 ----
NM_001040152chr765008 4430 1470 1178 1157 347 ------
NM_001040153chr131181 --1690 --
NM_001040181chr3------1968
NM_001040214chr61415 --22045 560 --
NM_001040284chr1675867 5414 4344 3976 1268 729 24 22071 232 25057 3942 --
NM_001040429chr1342893 2218 1158 112 --11199 --
NM_001040613chr83538 167 58 21455 108 ----
NM_001040665chr7114953 4838 4695 4658 4592 4510 3528 2015 1854 1288 844 --24807 1482 --
NM_001040708chr81329 --11022 --
NM_001040709chr182581 2385 2306 2076 825 560 545 378 11838 1878 --
NM_001040715chr162988 173 1420 2839 236 --
NM_001042368chr93199 156 90 --1285 --
NM_001042404chr1--21840 1617 1121 --
NM_001042472chr203466 236 36 --2484 480 --
NM_001042473chr1061631 1601 1455 808 342 256 11739 22105 1460 --
NM_001042479chrX41680 1537 307 139 --1348 1295
NM_001042506chrX61386 1326 1175 1111 467 279 --1577 --
NM_001042533chr322815 753 22602 553 11296 --
NM_001042537chrX51994 1962 1663 542 466 1890 ----
NM_001042595chr192162 88 ------
NM_001042599chr277820 7767 7157 6289 5136 4837 39 1290 26713 5255 --
NM_001042603chr12135043 4916 4397 3503 3445 3387 3329 3272 1821 1677 967 806 757 --34655 3705 1456 --
NM_001042681chr142046 1887 841 801 ------
NM_001042683chr621224 714 ------
NM_001043318chr1493934 3916 3513 3443 3107 1356 1187 1105 921 13481 52716 1619 1381 1269 1023 --
NM_001043351chr172066 1541 1433 879 165 115 22 1725 41642 1505 781 452 --
NM_001066chr182013 1972 1559 1357 461 388 312 293 --21924 1464 12179
NM_001068chr32205 64 --1286 --
NM_001070chr17129 --154 --
NM_001077628chr11260 ------
NM_001079874chr141740 1440 466 222 --12075 1198
NM_001080418chr12478 243 ----1432
NM_001092chr1782344 1809 891 849 830 664 434 217 --41944 1903 651 503 1794
NM_001094chr172324 250 1144 ----
NM_001095chr1291658 1301 1277 1200 313 273 168 83 70 1302 ----
NM_001106chr3199657 8103 8021 7583 7441 6957 6935 6921 6645 3306 3174 2868 1673 1093 898 835 490 483 312 18593 89363 6738 3835 3800 3145 1104 504 390 --
NM_001121chr102277 233 --1363 --
NM_001148chr4--1604 ----
NM_001149chr1041062 552 336 115 ------
NM_001153chr22143 124 ------
NM_001167chrX65845 5592 4295 2250 2104 1316 --46123 5850 5286 1053 11224
NM_001172chr141101 1741 ----
NM_001187chr21----1233 --
NM_001191chr2081392 1342 1054 981 539 402 348 115 --21146 1024 --
NM_001206chr932135 595 470 42165 2115 2082 886 12368 --
NM_001220chr7----173 --
NM_001222chr1041661 659 598 187 ----1482
NM_001253chr61292 ------
NM_001259chr7156384 6377 6355 6319 6244 5977 5471 2460 2198 1651 1554 1095 1084 140 122 ------
NM_001268chr132746 376 1159 1800 --
NM_001283chr76667 535 434 116 69 59 --1273 --
NM_001304chr1743018 2934 2548 1317 32417 866 812 ----
NM_001310chr1232564 2251 980 --22993 217 --
NM_001326chr11249 32 --1409 --
NM_001332chr5----1475 --
NM_001351chr321829 1318 11814 ----
NM_001356chrX2890 27 --12549 --
NM_001364chr11124023 3807 3593 3573 3502 3284 3020 1870 1710 1438 1112 270 22971 657 23877 2983 24535 3889
NM_001365chr172317 280 --2554 35 --
NM_001386chr882360 1799 1728 1633 1568 879 819 395 ------
NM_001387chr572902 2589 2563 2538 928 798 569 12795 2808 682 1162
NM_001389chr212617 181 --1170 --
NM_001395chrX3373 57 30 --1190 --
NM_001396chr2151915 1869 1750 254 82 --11107 --
NM_001404chr11127 ------
NM_001406chr1771506 1480 1327 590 369 222 189 ------
NM_001407chr351590 639 628 274 102 --11684 --
NM_001408chr1111473 1325 1270 621 595 585 457 150 106 87 64 --171 --
NM_001419chr19104408 3703 3573 3304 3184 1942 1100 1027 537 516 1325 11319 --
NM_001423chr1261803 1354 446 409 291 179 11466 --11544
NM_001429chr22----1309 --
NM_001431chr611141 --1316 --
NM_001433chr171128 ----1330
NM_001438chr141392 783 585 328 13381 21417 333 13316
NM_001447chr5101331 1315 1257 1051 1028 1021 906 532 387 312 --2539 66 --
NM_001448chrX61540 1426 1197 699 520 206 --11550 --
NM_001455chr6114898 4794 4393 4342 4313 4149 3564 1917 1275 819 263 --31857 1807 1610 --
NM_001494chr101727 --187 --
NM_001495chr831175 897 398 --1138 --
NM_001525chr12106 40 ------
NM_001530chr14--2919 842 ----
NM_001543chr5164532 4409 4346 4205 4119 3747 3630 2982 2937 1866 1823 1599 1462 767 658 393 13780 31723 1126 351 --
NM_001552chr174970 720 693 37 --199 --
NM_001553chr4------170
NM_001617chr261218 1148 941 500 300 191 1286 2931 30 --
NM_001619chr115953 902 771 421 164 --1153 --
NM_001627chr361901 1699 1571 904 754 300 ------
NM_001649chrX62192 2175 1836 464 362 298 12367 12470 --
NM_001650chr1863466 3332 2963 2691 1518 1061 22933 1391 21332 312 --
NM_001654chrX397 85 57 ------
NM_001662chr71134 --1141 --
NM_001665chr115481 385 202 191 32 --1579 --
NM_001677chr12762 316 --1716 --
NM_001678chr1741563 1483 1344 658 --31557 309 63 1503
NM_001679chr35764 635 188 181 45 ------
NM_001701chr9----11331 --
NM_001707chr72682 631 --2700 34 --
NM_001722chr83462 234 47 ------
NM_001730chr1311124 1530 ----
NM_001742chr731749 1392 676 ------
NM_001753chr781505 1494 1429 1412 1380 1218 1162 559 1369 ----
NM_001755chr1642065 2059 854 611 --22236 772 --
NM_001759chr12135202 4783 4599 3868 3784 3557 3278 2076 1595 1529 1161 1066 112 21810 614 1705 13290
NM_001773chr161383 1293 1265 1241 545 94 1179 --1146
NM_001783chr193298 248 34 ------
NM_001806chr1942862 2532 2399 1193 ------
NM_001810chr203576 199 188 --2543 533 1193
NM_001823chr14250 31 --1198 --
NM_001839chr13180 160 131 ------
NM_001842chr95528 500 469 174 158 ------
NM_001845chr131543 1414 1156 --
NM_001858chr663359 2062 1964 1385 867 43 11638 13498 --
NM_001860chr92788 454 1942 1401 --
NM_001884chr5----1561 --
NM_001904chr331033 1006 124 162 ----
NM_001923chr113606 492 51 ------
NM_001932chr175829 769 748 648 301 ------
NM_001939chrX73849 3681 3620 3401 2920 1471 321 11363 ----
NM_001945chr541262 1130 1007 462 ----1914
NM_001949chr652756 2130 2124 680 381 --2709 224 --
NM_001964chr53389 222 177 ------
NM_001967chr31382 ------
NM_001970chr173558 528 173 1408 1466 --
NM_001981chr14878 861 313 267 --1271 --
NM_001995chr45510 397 318 173 55 --1968 --
NM_002010chr13--1205 ----
NM_002014chr122565 34 --1645 --
NM_002024chrX21376 647 ------
NM_002025chrX119093 8764 7879 6976 6254 6247 3631 3004 2283 1535 911 --18730 --
NM_002028chr1451267 982 505 422 207 11169 ----
NM_002031chr61219 ------
NM_002045chr3197 --153 --
NM_002048chr931250 887 267 1428 ----
NM_002063chrX21123 348 --133 --
NM_002069chr7----1633 --
NM_002070chr36876 801 733 388 205 147 --1345 --
NM_002089chr42611 52 ------
NM_002126chr17114145 3742 3147 2838 2795 1662 811 758 714 392 222 --43658 1005 339 54 13663
NM_002128chr131182 --1216 --
NM_002146chr1721202 199 ------
NM_002147chr174870 641 251 78 --2885 114 --
NM_002166chr21653 --1657 --
NM_002167chr13118 77 52 ------
NM_002193chr2101669 1256 1199 1191 1179 606 558 536 333 259 --11231 --
NM_002196chr202982 863 1922 ----
NM_002205chr125931 894 712 410 373 ------
NM_002214chr752059 1246 1097 950 654 --21891 1273 --
NM_002223chr1263220 1350 899 645 611 255 13972 146 --
NM_002228chr1----1501 --
NM_002232chr12972 150 2465 63 ----
NM_002246chr25400 322 86 76 51 --21266 154 --
NM_002247chr103904 797 39 --1595 --
NM_002254chr2122391 2042 1565 1552 1516 665 659 460 331 323 152 74 1895 31908 869 865 --
NM_002264chr3104874 4751 3871 3774 3739 1967 1677 1292 1240 145 13243 24910 133 24477 1175
NM_002267chr1331624 762 641 ------
NM_002270chr565686 5413 4940 1767 1396 1201 24062 3960 1569 --
NM_002274chr172116 95 --1350 --
NM_002280chr17163 ------
NM_002298chr1341609 1511 1062 414 --1489 --
NM_002305chr22139 ------
NM_002306chr14----1149 --
NM_002332chr123221 47 40 --2578 196 --
NM_002334chr115636 620 420 403 379 21351 273 3337 28 24 --
NM_002336chr1294792 1788 1648 1640 1562 1553 742 208 27 13548 11667 --
NM_002351chrX21068 296 ----1560
NM_002356chr63871 497 260 12567 ----
NM_002359chr17174189 3817 3676 3647 3607 3525 3510 3384 3314 2790 2783 1511 1334 1146 1124 815 68 --43984 3613 3280 1134 13994
NM_002373chr1551325 1229 1168 974 883 --11221 --
NM_002375chr3112325 1993 1913 1805 1600 1547 717 693 619 383 329 --2373 300 --
NM_002382chr146842 381 355 328 231 34 --11083 --
NM_002390chr17111974 1920 1907 1717 1385 778 769 688 628 591 163 --11435 --
NM_002397chr521379 155 --12234 --
NM_002401chr17122353 2342 2290 1777 991 976 617 593 555 546 208 80 --41760 804 641 623 --
NM_002406chr54819 789 404 33 --31018 710 84 --
NM_002419chr117529 456 412 384 369 92 35 ------
NM_002430chr2242102 1755 733 231 1485 150 1154
NM_002442chr124395 219 162 132 --1253 --
NM_002467chr81144 ------
NM_002469chr12------1346
NM_002473chr2271039 947 498 427 290 214 121 ------
NM_002500chr22882 152 ------
NM_002501chr19144110 3987 3932 3407 3399 2513 1435 1129 1016 995 989 904 599 349 ------
NM_002505chr631506 574 98 ------
NM_002507chr17131686 1505 1238 774 762 697 494 278 253 247 230 208 163 --11916 --
NM_002515chr141268 ----1445
NM_002522chr17143848 2587 2449 2397 1548 1477 1327 905 868 823 807 740 625 174 --21501 44 --
NM_002558chr1721165 329 --21155 1124 --
NM_002569chr1591420 1387 1258 982 463 358 348 259 126 ------
NM_002576chr1151208 1100 1004 825 495 1874 195 --
NM_002577chr363099 3082 2972 2805 2728 800 --13509 --
NM_002581chr964271 3718 1580 928 851 130 --24888 820 --
NM_002585chr11265 ------
NM_002599chr1141133 340 329 25 --11115 --
NM_002608chr2241330 476 211 108 --31535 1347 417 --
NM_002633chr11506 ------
NM_002645chr1172737 2635 2216 2154 2116 1075 552 12851 22836 1220 --
NM_002648chr681241 829 523 504 419 312 168 63 --1492 --
NM_002660chr203913 739 329 ------
NM_002687chr1431203 510 91 11088 ----
NM_002693chr152397 136 ----1104
NM_002698chr1962795 2535 2457 2031 1207 102 --42318 750 350 337 --
NM_002710chr121734 --1285 --
NM_002713chr1----1185 --
NM_002717chr81510 ----2258 38
NM_002719chr1421516 297 1744 ----
NM_002721chr93473 113 35 --1120 --
NM_002725chr183639 3523 3115 2793 1421 821 540 110 --14229 --
NM_002730chr1931080 289 217 --1478 --
NM_002731chr142977 2882 1158 518 ------
NM_002732chr9----1440 --
NM_002734chr1761530 757 618 504 235 65 --2697 118 --
NM_002738chr16--1436 2922 303 --
NM_002742chr142541 72 --2545 276 --
NM_002745chr2294464 4451 3581 3570 3517 1600 1351 1260 354 1266 24504 84 14408
NM_002747chr1851483 719 567 163 99 ------
NM_002748chr1511206 1782 1315 --
NM_002752chr54414 154 129 24 ----1159
NM_002753chr41543 --2293 145 --
NM_002753chr41543 --2293 145 --
NM_002761chr162132 112 --135 --
NM_002787chr7----1212 --
NM_002824chr123348 190 96 --1365 --
NM_002829chr931231 298 257 ------
NM_002833chr1531324 1218 407 --31331 1207 353 11182
NM_002834chr1264029 3891 3617 980 907 857 11413 1200 --
NM_002835chr73761 243 212 --1149 --
NM_002841chr31620 1248 ----
NM_002848chr1221309 836 1407 1105 --
NM_002858chr11926 --126 1261
NM_002867chr12146 54 ------
NM_002868chr1292400 2259 2230 1842 1821 827 379 363 126 ------
NM_002869chr1152127 1633 1404 135 42 --1139 --
NM_002874chr942189 938 503 179 12007 2879 340 --
NM_002886chr375203 3281 3208 1988 1801 588 192 14357 1158 --
NM_002892chr1421659 212 ------
NM_002906chr114450 378 234 95 1738 ----
NM_002930chr183264 174 73 ------
NM_002941chr3160 1353 ----
NM_002998chr831954 1624 412 --11399 --
NM_003010chr1792437 2329 2288 1882 826 746 464 227 152 --11800 --
NM_003011chr941430 1221 683 306 1465 21365 246 --
NM_003013chr4133 --1134 --
NM_003038chr262671 2594 1654 798 426 90 12500 124 --
NM_003045chr13114044 3432 3421 3318 3070 1710 1511 1036 918 794 212 --64940 4871 3635 1330 706 594 14571
NM_003047chr1151439 1176 1051 1043 907 588 543 510 313 251 202 166 103 78 27 --21115 428 11015
NM_003076chr1261424 1077 596 360 77 60 --31319 1048 64 --
NM_003081chr202886 454 --11152 --
NM_003088chr7101033 942 452 394 266 254 153 59 46 28 --1111 --
NM_003091chr20----1204 --
NM_003098chr204452 219 196 73 --1488 --
NM_003099chr15196155 5895 5875 5707 5594 4552 2432 1870 1293 1272 1237 1087 1029 1008 947 805 526 123 40 --66090 5685 5071 1574 772 212 195
NM_003107chr652582 2412 1917 679 231 ------
NM_003108chr276047 5998 1978 1810 1517 828 255 15752 35106 2587 1869 --
NM_003110chr1781117 1007 866 422 223 187 98 88 --1708 --
NM_003113chr23208 178 50 ------
NM_003118chr56754 547 409 303 240 94 ------
NM_003127chr9133 ----1106
NM_003131chr681717 1585 806 686 583 468 398 59 --3589 176 172 --
NM_003139chr111929 1266 193 --
NM_003145chr12342 140 --1365 --
NM_003155chr852028 1924 279 263 220 1787 ----
NM_003156chr1171320 1234 1222 357 316 145 54 --2209 200 --
NM_003161chr1723550 3513 31136 1073 388 21409 749 --
NM_003164chr113521 481 175 --1161 --
NM_003170chr174557 225 74 63 --2577 536 --
NM_003173chrX101316 1288 1190 1088 395 192 134 124 114 76 --2352 105 11154
NM_003178chr31160 --11440 --
NM_003179chrX4284 175 165 59 --2430 115 --
NM_003180chr192283 270 --1291 --
NM_003185chr203505 498 245 --11228 --
NM_003188chr6--1123 ----
NM_003189chr1113170 3163 2579 2392 1009 743 669 648 518 384 303 --42573 690 390 330 --
NM_003200chr19122368 2102 2013 1970 1881 1629 1496 921 584 306 269 232 --12073 --
NM_003204chr1751772 1614 1592 1494 1358 ------
NM_003205chr1541790 581 322 292 --11426 --
NM_003216chr22112783 2361 2306 2265 2060 840 733 684 123 50 32 --22719 1318 12513
NM_003234chr32534 270 11907 ----
NM_003246chr1541831 1276 754 302 --1157 --
NM_003250chr17162 ------
NM_003269chr62295 168 ------
NM_003298chr385276 5039 2448 2181 2118 1627 1360 1143 12350 54267 2185 1940 462 118 --
NM_003320chr11124178 4029 3669 3082 2706 1688 1194 934 821 733 605 165 --43266 58 54 50 177
NM_003334chrX2151 144 ------
NM_003340chr41199 ----11178
NM_003342chr1763042 2698 2485 988 865 582 --12103 --
NM_003347chr2272094 1919 1905 1736 758 370 237 --11924 --
NM_003348chr12143 11088 1255 --
NM_003367chr193447 220 207 ------
NM_003370chr195794 490 237 165 50 --268 59 --
NM_003373chr1041944 693 605 329 --31637 1481 751 --
NM_003399chrX21024 97 2835 110 11060 --
NM_003404chr2011484 21916 1885 21831 1358 --
NM_003406chr851720 1500 618 314 24 1341 21591 1429 --
NM_003410chrX32385 2016 725 ------
NM_003412chr351165 1067 1055 724 135 12898 11111 --
NM_003413chrX31220 727 575 11285 ----
NM_003459chr21131 1455 ----
NM_003462chr161759 527 375 368 317 204 1567 11239 --
NM_003471chr31920 11791 1903 --
NM_003478chr1153125 3067 1127 937 123 13311 ----
NM_003482chr1282669 1992 1880 552 520 481 373 231 1627 22377 468 --
NM_003483chr1232951 2895 2202 12835 11905 --
NM_003489chr2122972 340 ------
NM_003502chr162270 191 --2500 461 --
NM_003557chr161581 1384 1027 283 69 37 11351 41388 1314 1145 1103 --
NM_003558chr92503 260 ------
NM_003574chr1885174 5129 3880 3816 1674 1487 561 137 ------
NM_003583chr1242924 2468 1473 788 13635 1444 --
NM_003586chr163576 489 144 --1195 --
NM_003596chr73198 86 44 ------
NM_003615chr31820 --13953 --
NM_003618chr2----1100 --
NM_003624chr1981354 953 910 436 430 390 174 36 --1404 --
NM_003629chr192808 2577 2551 2269 1382 1374 1351 1334 92 --33151 3118 820 --
NM_003632chr176778 716 593 351 292 249 1196 155 --
NM_003633chr551996 1637 1017 1011 716 --12403 --
NM_003635chr10----138 --
NM_003637chr131436 487 230 1321 1422 --
NM_003644chr17236480 5980 5931 5899 5380 4983 4478 4390 4353 4229 4180 4002 2256 1052 908 777 766 747 412 296 255 208 31 16395 1595 15224
NM_003654chr115615 531 146 120 75 --1542 --
NM_003655chr171232 --1768 --
NM_003657chr20135 1124 ----
NM_003664chr5167 --1140 --
NM_003672chr131221 425 106 11207 ----
NM_003681chr21286103 6057 6037 5461 5449 5418 5322 5083 5063 4808 4776 4681 4359 4228 4035 2453 2421 2053 1815 1484 1226 948 942 935 461 405 320 78 --66122 5124 4902 4475 4049 1238 --
NM_003685chr192784 271 --1390 --
NM_003704chr43461 126 99 --1623 --
NM_003718chr7----1486 --
NM_003741chr31341 --1121 --
NM_003743chr272210 2144 1524 792 559 426 397 ------
NM_003749chr1352310 2151 1881 583 90 --21599 182 --
NM_003760chr11544 --1549 --
NM_003768chr151831 1778 1531 1466 1161 --21565 1495 --
NM_003787chr1821320 614 ----1675
NM_003794chr31763 --1436 --
NM_003822chr163134 3034 2893 664 518 25 --12543 --
NM_003877chr12----2951 302 --
NM_003913chr653562 3245 3087 1074 970 --22670 477 --
NM_003924chr441529 1374 361 281 --1247 --
NM_003939chr10114048 3601 3336 3150 1488 1389 695 417 212 66 28 11428 2630 626 --
NM_003945chr53492 185 125 --2339 105 --
NM_003948chr431704 614 123 11741 1970 --
NM_003951chrX131 --1282 --
NM_003955chr1751454 1439 1213 303 146 --11146 --
NM_003957chr112402 74 --3846 437 243 --
NM_003958chr6143921 3828 3467 3408 3177 2709 2441 1331 523 475 385 248 225 177 --33818 3181 156 22684 1145
NM_003969chr192248 137 --2125 114 --
NM_003982chr141101 --1326 --
NM_003988chr10152272 1762 1733 1727 1693 1677 1449 947 923 866 682 446 426 322 47 164 31816 892 340 1839
NM_004036chr26697 656 512 268 259 169 --1661 --
NM_004050chr14102246 2129 1887 1798 1766 787 680 617 507 457 --1857 --
NM_004056chr82170 27 --1403 --
NM_004064chr1231037 186 51 ------
NM_004077chr1241216 1074 412 377 --31247 1061 202 --
NM_004093chr1373181 3162 1101 773 693 498 400 12781 ----
NM_004096chr1081980 1688 1605 784 672 544 448 376 --2798 194 --
NM_004107chr191146 ------
NM_004112chr1731537 89 77 --165 11478
NM_004116chr24306 143 118 58 --182 --
NM_004132chr1051131 1064 465 300 197 ------
NM_004140chr175730 135 127 100 33 1247 2708 72 --
NM_004178chr123270 52 43 1243 ----
NM_004185chr12690 670 ------
NM_004186chr33297 113 21 --2589 157 1224
NM_004187chrX2407 119 11231 180 11306
NM_004200chr11132951 2835 2741 2532 2118 2099 2059 1241 1194 1018 765 759 92 --43268 1069 1045 229 --
NM_004202chrY1147 --2186 170 --
NM_004229chrX42119 1576 1546 1523 ------
NM_004235chr9169 --1753 --
NM_004238chr2126 ------
NM_004272chr53523 377 45 21326 1317 1446 --
NM_004274chr1463136 2950 782 325 273 252 32926 2820 2671 --1395
NM_004277chr61642 ----21077 332
NM_004301chr31313 1341 ----
NM_004302chr12152929 2626 2544 2491 2387 2225 2219 2190 2168 2123 1825 1102 833 530 94 --1655 --
NM_004308chr1171514 1428 603 597 564 210 192 --41185 474 313 303 --
NM_004309chr1751114 1091 909 797 227 --31121 782 216 --
NM_004311chr1092720 2510 2332 2270 2260 1261 1194 1013 71 --32250 1905 688 --
NM_004316chr1221095 1072 ------
NM_004330chr151946 --1398 --
NM_004342chr732186 335 200 ------
NM_004359chr19121 --2497 423 --
NM_004360chr163773 753 461 --11540 --
NM_004370chr682162 2126 1947 1556 1338 564 480 429 129 ----
NM_004377chr22----2466 383 --
NM_004379chr241272 366 244 120 --1188 --
NM_004393chr372236 1856 1747 1533 1465 916 375 1223 ----
NM_004397chr1183854 3600 3459 3034 1698 1660 1586 1252 ------
NM_004411chr72262 221 ------
NM_004422chr172460 365 ------
NM_004423chr3102572 2424 2200 2155 1973 690 679 634 507 223 --82063 2059 1855 1811 893 594 529 198 --
NM_004426chr1231774 1399 399 --1775 --
NM_004427chr121242 1105 11027 31095 902 402 --
NM_004428chr12841 804 1654 2267 69 --
NM_004429chrX101273 1171 1126 1079 1025 348 330 310 151 84 ------
NM_004430chr831700 1098 939 --1871 --
NM_004432chr94614 326 252 233 --11807 --
NM_004436chr1275 47 --186 --
NM_004438chr272238 1117 1088 930 540 412 291 11278 ----
NM_004444chr72349 159 ------
NM_004451chr112582 104 ----143
NM_004454chr382265 2217 2037 1988 1605 1480 137 104 ------
NM_004456chr72167 40 ------
NM_004458chrX41891 1757 769 682 --22278 1699 12427
NM_004475chr1781186 1108 1011 842 747 346 266 151 --2168 159 --
NM_004494chr15510 503 112 47 40 1533 ----
NM_004504chr222928 1897 --1562 --
NM_004529chr931175 508 387 ------
NM_004554chr14101772 1744 1598 1482 1214 651 190 141 129 52 --21336 1157 --
NM_004575chr441625 1317 619 65 ------
NM_004586chrX85421 2151 2141 1853 1759 1238 496 135 11395 1148 11289
NM_004588chr11154001 3380 3340 3239 3221 3200 2968 2804 1623 1055 830 465 347 252 198 --170 --
NM_004608chr162118 22 ------
NM_004612chr944619 4099 1275 1050 21382 1043 24517 2966 24600 4470
NM_004643chr142732 293 1228 1183 --
NM_004654chrY1371 --1375 11179
NM_004655chr174945 420 264 56 ------
NM_004687chr1751844 1597 535 438 312 11896 ----
NM_004698chr1----235 21 --
NM_004700chr12160 140 ------
NM_004705chr113755 729 571 195 ----
NM_004711chr22173390 3301 2990 2650 2578 2461 2286 1156 790 703 582 512 498 107 85 71 65 1173 43185 3033 2424 997 --
NM_004717chr741549 1472 105 48 ------
NM_004730chr511639 --192 11542
NM_004733chr31183 --1609 --
NM_004738chr2032037 836 463 --21830 120 --
NM_004739chr112558 194 ------
NM_004742chr361842 1832 1689 1432 1253 92 11780 11563 --
NM_004745chr8105935 5524 5126 4894 2579 2552 1381 539 197 84 --64901 4271 2501 1671 1156 546 12330
NM_004762chr17142036 1989 1744 1706 1364 1312 1279 1229 714 616 495 206 99 47 --1589 --
NM_004772chr531624 1262 354 --1327 --
NM_004774chr1752865 2533 2495 2286 2157 --12296 12381
NM_004781chr121106 66 1410 ----
NM_004788chr1131840 389 343 11678 12720 --
NM_004794chrX----187 --
NM_004798chr20133414 3205 3104 3030 1468 1432 918 744 686 638 608 595 41 --43113 1107 1103 300 --
NM_004800chr13176 ------
NM_004824chr631328 1071 443 ------
NM_004831chr192940 90 --1895 --
NM_004834chr22847 345 2963 718 12222 --
NM_004842chr641552 1529 1444 322 1126 21241 46 --
NM_004850chr221598 1334 ------
NM_004852chr182013888 13714 12925 12787 12713 12045 11484 10999 10844 10738 9687 9133 8881 8837 5297 3783 3359 3105 1920 370 112697 213896 2088 --
NM_004859chr1752737 2485 2472 1951 1153 12539 21910 562 --
NM_004861chr221262 --229 25 --
NM_004863chr1474934 4521 1327 1191 941 177 115 --34127 4080 306 11197
NM_004866chr5--1649 23948 1091 13478
NM_004898chr482794 2734 2723 2671 2410 2290 1961 922 1160 --12631
NM_004899chr21116 --1306 --
NM_004902chr201221 ------
NM_004905chr11181 ------
NM_004926chr142609 453 --2711 656 128
NM_004929chr821489 569 11303 ----
NM_004953chr34389 382 287 166 ------
NM_004965chr211260 --136 --
NM_004973chr641449 700 495 90 21626 1281 1704 --
NM_004992chrX238545 8058 7316 6918 6826 6778 6693 6361 5978 5832 5655 5261 5211 2876 2811 2642 2529 2295 1896 1644 1382 1363 1236 12282 78465 8181 6058 5371 3194 1455 637 --
NM_004996chr1641096 688 387 239 --1174 --
NM_005026chr161780 1605 1412 747 352 124 ------
NM_005028chr1021675 1666 1819 1836 --
NM_005063chr1063124 2978 1505 968 276 169 1630 12641 --
NM_005065chr1454373 3318 1981 1509 1467 21171 144 34787 2157 465 --
NM_005070chr22249 160 ------
NM_005080chr224917 815 305 200 --1765 1236
NM_005094chr93719 597 160 ------
NM_005095chr131754 1586 834 ------
NM_005096chrX71254 1187 992 810 420 412 250 11003 1139 --
NM_005099chr17511 247 174 161 138 125 80 --21163 883 --
NM_005109chr352065 1644 978 390 145 --4972 373 313 244 --
NM_005121chr1732702 527 167 --11343 --
NM_005124chr6--2806 103 2166 50 --
NM_005168chr2----1581 --
NM_005206chr1721093 897 1476 1405 --
NM_005207chr2253403 2719 165 39 23 --1684 12429
NM_005222chr71243 --163 --
NM_005225chr2051145 965 441 126 68 --21021 950 --
NM_005229chrX31084 933 419 --31090 801 445 --
NM_005238chr1133198 1371 30 ----13007
NM_005256chr11----1357 --
NM_005312chr992090 1868 1731 976 666 632 452 281 160 --22642 175 --
NM_005329chr1652042 1560 1443 642 239 --22312 243 --
NM_005334chrX51521 1457 1420 1407 511 --146 --
NM_005339chr443848 3661 630 158 13058 135 1109
NM_005359chr18146485 6421 6129 5251 5192 4901 4224 4068 2275 2163 1717 1636 137 99 14397 34827 2483 2190 --
NM_005375chr621157 1092 ------
NM_005378chr22588 113 ------
NM_005384chr91185 ------
NM_005386chr202712 600 --1885 --
NM_005402chr731295 532 395 1222 ----
NM_005406chr1831111 304 277 1188 ----
NM_005417chr20121669 1486 1289 1264 653 609 532 525 473 466 80 70 11818 4560 455 85 59 11701
NM_005418chr114630 262 136 98 ------
NM_005424chr12352 99 154 ----
NM_005430chr126878 658 374 345 220 203 --3664 277 180 --
NM_005433chr18134 ----22135 290
NM_005436chr1053938 3579 2804 2548 1516 13249 22671 1641 --
NM_005437chr1041481 1160 1124 72 ----1124
NM_005439chr122512 472 ------
NM_005443chr43462 149 92 ------
NM_005455chr11422 --1455 --
NM_005456chr116704 647 569 230 99 82 --1741 --
NM_005458chr942494 2191 2158 418 ------
NM_005461chr2081849 1234 597 387 92 86 50 31 --21482 507 11907
NM_005475chr1263006 2877 2406 1174 757 255 1626 42825 2021 1313 501 --
NM_005479chr1041555 1215 611 489 1531 11508 --
NM_005483chr19----199 --
NM_005493chr6----1305 --
NM_005504chr1225869 5033 12097 ----
NM_005517chr12538 486 ------
NM_005542chr72628 241 --31385 781 221 --
NM_005569chr2261231 621 520 365 211 68 --2392 230 --
NM_005578chr373150 1932 1322 1026 945 431 376 23981 1276 34040 2059 123 --
NM_005593chr121138 1485 ----
NM_005596chr964910 4738 4343 2516 1404 391 22157 1864 22371 1493 --
NM_005603chr182528 482 --1317 11376
NM_005604chr632248 2004 1952 --12349 --
NM_005607chr81878 ------
NM_005610chr1----1622 --
NM_005618chr63204 177 166 ------
NM_005634chrX3602 221 110 --197 --
NM_005639chr12----1688 --
NM_005665chr144207 1530 1120 163 24779 440 34144 1861 606 --
NM_005667chr21160 --149 --
NM_005677chr361450 1104 980 974 542 130 --1190 --
NM_005683chr221871 996 --42088 1907 960 883 --
NM_005688chr32934 852 1962 295 53 --
NM_005697chr15----143 --
NM_005708chr131140 ------
NM_005711chr5--1728 1170 --
NM_005715chr682599 2138 1973 1842 1788 1016 693 617 ------
NM_005717chr13869 114 25 --11266 --
NM_005724chr15----1300 --
NM_005730chr12183495 3385 3278 3148 3024 2916 2695 2379 2282 1442 1240 1209 1114 1096 966 735 351 199 12689 52336 2305 1296 679 615 --
NM_005736chr1071587 1555 1452 1144 492 433 88 --21355 1237 --
NM_005748chr1253377 3119 2224 824 487 1370 22425 1251 --
NM_005752chr1611013 1999 ----
NM_005766chr1381359 1340 1248 1114 927 879 293 34 --3999 133 94 --
NM_005768chr122579 533 --2656 279 --
NM_005779chr583140 2956 2634 2553 913 521 395 376 11198 ----
NM_005783chr23630 534 41 1455 ----
NM_005785chr1231801 748 127 --11776 1274
NM_005789chr1761911 1416 1334 721 231 55 22133 1834 11328 --
NM_005796chr161328 ------
NM_005819chr1103415 3378 3126 3001 2986 2319 781 434 278 250 12590 1283 13199
NM_005828chr17125062 4127 3876 3782 2001 1932 1850 1745 1305 649 633 342 --41618 1115 535 49 --
NM_005841chr42438 228 1844 1932 --
NM_005860chr1931269 1217 391 --21655 1310 --
NM_005864chr144821 578 556 121 --2230 35 --
NM_005866chr94876 855 552 121 ------
NM_005875chr3165 ------
NM_005885chr53614 329 194 ------
NM_005898chr1111001 ------
NM_005899chr173307 145 28 --11496 --
NM_005909chr553622 3606 2908 941 117 --23589 2930 --
NM_005910chr17154066 3625 3447 3024 2853 2700 2526 1481 1173 1119 715 688 636 359 92 22667 1195 42530 1419 1150 142 --
NM_005911chr241393 433 413 96 1253 ----
NM_005920chr153503 2843 2746 1493 71 --12392 --
NM_005933chr11132881 2787 2768 2678 2475 2198 2074 1957 1927 1205 814 794 754 --32792 740 285 --
NM_005934chr19122451 2362 2081 2052 1740 1714 571 161 117 101 88 66 --1459 --
NM_005935chr4115103 4750 4234 3569 1980 1547 1061 808 636 565 229 1659 33691 3283 825 --
NM_005938chrX31327 1235 1073 --3357 102 29 --
NM_005941chr853598 2983 1377 1220 563 ------
NM_005955chr1124981 4970 1953 1575 1493 1471 1334 1313 1047 881 701 66 --21706 755 --
NM_005964chr1721522 626 --1155 --
NM_005967chr125561 249 223 131 108 --1120 --
NM_005984chr224521 385 365 52 --1436 --
NM_006009chr12127 --1207 --
NM_006011chr15184238 4180 3995 3682 3444 2954 2910 2766 2704 2688 2681 1628 1138 1047 924 845 338 41 1597 23688 3408 --
NM_006015chr121053 994 1269 ----
NM_006022chr132742 76 --1355 --
NM_006037chr274923 4039 3228 3039 154 44 34 --14043 --
NM_006041chr172425 345 1133 2396 386 --
NM_006047chr2043491 924 575 369 --21291 560 --
NM_006060chr794266 3815 3676 3247 3141 2941 778 448 281 13877 14270 --
NM_006076chr7143075 3057 3030 2831 2821 2636 2345 2129 2043 1100 936 894 582 500 --53067 2024 1155 76 32 --
NM_006080chr732379 769 295 ----144
NM_006091chr1541790 558 230 211 --31547 630 517 --
NM_006094chr821908 162 12332 ----
NM_006096chr831538 1366 1284 --31270 1129 80 --
NM_006099chr12783 149 --1593 --
NM_006100chr32119 109 ------
NM_006106chr1122711 1360 --11000 --
NM_006135chr14505 343 262 184 --11054 --
NM_006141chr1612364 12826 21026 858 --
NM_006147chr11432 ------
NM_006148chr17152758 2644 2585 2270 1863 1189 931 650 588 524 465 333 302 162 23 --41935 818 814 713 --
NM_006154chr152348 215 1552 3897 751 534 1236
NM_006162chr1831747 1186 612 --11439 --
NM_006166chr1252547 1964 1053 614 433 --11607 --
NM_006176chr115708 322 112 100 78 --1579 --
NM_006186chr211200 ------
NM_006191chr122314 123 --136 --
NM_006201chrX7921 430 245 235 168 137 122 197 5456 443 435 189 104 186
NM_006202chr19101920 1816 1711 1642 1459 1344 593 169 76 52 ------
NM_006206chr432706 2568 196 11940 ----
NM_006210chr191934 --11071 --
NM_006211chr8----198 --
NM_006216chr22632 431 --1596 --
NM_006224chr17102398 2245 943 935 859 830 654 503 355 220 ------
NM_006226chr21443 ------
NM_006237chr1362089 1937 1729 830 679 72 --41620 168 109 76 1868
NM_006241chr311767 --2813 800 --
NM_006242chr2081901 1725 1446 630 537 327 65 54 12015 2859 161 --
NM_006243chr141091 862 780 23 --1713 --
NM_006246chr141976 --1145 --
NM_006252chr1106897 6296 6264 5135 5015 2154 1924 1823 1505 807 1559 27561 506 15185
NM_006268chr116925 918 893 393 364 275 11042 2279 136 --
NM_006279chr14839 790 720 151 ------
NM_006283chr894980 4751 4425 3610 897 872 817 139 43 --31425 373 69 --
NM_006285chr91269 ------
NM_006287chr222195 584 12373 32601 617 446 --
NM_006301chr122511 240 --2605 523 --
NM_006306chrX75893 5846 4958 4347 1116 520 308 14390 127 --
NM_006310chr1731274 148 35 ------
NM_006313chr1241590 1272 1217 39 ------
NM_006315chr463432 3157 1503 472 317 78 13684 24297 3044 11781
NM_006320chr4194 11010 ----
NM_006321chr362119 1767 830 665 498 82 1451 21431 621 --
NM_006322chr132932 104 ----1833
NM_006328chr111534 --1245 --
NM_006335chr11333 1945 ----
NM_006336chr921278 1077 --1462 --
NM_006352chr131373 609 271 --11501 --
NM_006373chr17141420 1385 1111 1040 572 368 345 289 280 257 251 214 151 105 --1445 --
NM_006465chr1562183 758 394 164 38 27 1523 3773 705 388 --
NM_006480chr52522 111 --180 --
NM_006494chr193764 629 56 --2211 109 --
NM_006516chr141536 1447 345 29 --21274 358 --
NM_006526chr20--11713 1435 --
NM_006532chr1951732 1693 1448 719 236 --3468 316 275 1207
NM_006538chr293739 3730 3481 2935 2612 1368 837 546 469 12880 23592 2921 13415
NM_006540chr831161 183 103 11464 11054 --
NM_006544chr1486048 5304 4553 4091 1562 1357 666 506 ----15309
NM_006547chr711581 --1156 --
NM_006555chr761896 1660 1592 1529 1396 1274 11954 21988 1821 --
NM_006557chr941764 1478 1207 625 11510 ----
NM_006559chr1--11180 ----
NM_006577chr231187 950 104 1920 --1959
NM_006589chr14481 434 161 107 --1165 --
NM_006595chr1121383 156 ------
NM_006599chr16108048 7988 7591 7286 5726 5635 1838 1370 996 163 37837 6766 6502 27529 1389 --
NM_006620chr694842 4638 3900 3226 1850 1842 1513 693 225 ------
NM_006624chr1011834 ------
NM_006628chr1574232 4009 3801 3518 3471 1158 916 --23545 1166 14031
NM_006633chr51605 197 ----
NM_006646chr136902 780 606 528 353 259 ------
NM_006670chr61455 ------
NM_006690chr20142004 1872 1782 1644 1589 1573 1509 1485 756 725 696 574 543 449 --22203 507 --
NM_006698chr2031289 1211 478 --21323 1267 --
NM_006729chrX115487 5341 4922 4882 4270 3541 2218 1592 1586 1013 596 11300 12033 --
NM_006738chr15114289 4135 4115 3921 1267 1240 1108 967 199 60 30 --33743 3339 438 --
NM_006742chr16142006 1839 1604 1568 1506 1407 1314 1294 1275 697 585 323 315 159 --11246 --
NM_006750chr16147734 7488 6226 5450 4985 4959 4893 4883 3062 2721 1995 725 665 632 25166 1856 67041 2501 2193 1261 1039 670 17710
NM_006761chr171132 ----1616
NM_006763chr191738 1706 1697 1550 1337 762 587 428 188 1259 32000 1887 1752 --
NM_006772chr661574 1234 461 309 247 103 ------
NM_006775chr622170 585 12727 294 58 1857
NM_006788chr1871944 1469 704 652 640 502 402 --1619 --
NM_006802chr171159 1125 1091 429 394 202 56 1919 ----
NM_006803chr841954 1720 1472 725 1800 183 --
NM_006815chr122473 219 ------
NM_006826chr21517 ------
NM_006832chr141125 176 ----
NM_006838chr1211239 ----1229
NM_006846chr52266 254 ------
NM_006851chr1262831 2575 2296 2244 864 357 --1386 11141
NM_006854chr73754 687 674 --41751 1653 1534 187 --
NM_006856chr125869 423 311 291 85 --21071 1031 --
NM_006874chr41207 ------
NM_006875chrX1178 --1889 --
NM_006885chr1644244 2738 1144 655 --13349 --
NM_006888chr1443244 2664 2574 190 --42648 2356 1246 1040 --
NM_006896chr731101 285 236 1790 ----
NM_006899chr203317 295 265 ------
NM_006912chr12828 198 12313 ----
NM_006930chr541970 1763 446 130 11301 ----
NM_006939chr142889 206 --1894 --
NM_006943chr20122943 2618 2587 2434 2351 2118 1058 967 949 816 693 113 --13293 --
NM_006946chr112384 94 ------
NM_006950chrX1659 --2885 646 --
NM_006951chr102768 130 --1333 --
NM_006990chr1112422 2299 2160 1786 1754 1571 1007 655 617 511 500 --2535 49 --
NM_006996chr151544 1267 745 453 53 ------
NM_006997chr10----1372 --
NM_006999chr561590 1284 1268 822 796 226 ----11325
NM_007007chr1234022 3887 685 --11226 --
NM_007008chr21310 --1168 --
NM_007010chr1731174 607 215 1590 1266 --
NM_007011chr15106521 6040 4554 4485 2533 1532 1252 1143 943 249 --64526 4314 2671 2605 562 144 --
NM_007014chr1681508 1471 1251 629 531 454 280 220 --31758 536 58 --
NM_007050chr20187648 7251 7140 6919 6654 6085 5826 5362 5316 4987 2859 2781 2495 2415 2339 2048 375 23 16961 2305 108 --
NM_007051chr11120 ------
NM_007106chr1332435 2380 101 ----12524
NM_007114chr332063 1165 568 ------
NM_007118chr54751 725 205 38 --2635 609 --
NM_007124chr621809 1641 ------
NM_007125chrY3461 161 155 --11321 --
NM_007126chr92104 69 --136 --
NM_007146chr1732847 2752 2119 ------
NM_007162chr61110 --3417 158 116 --
NM_007170chr14792 652 357 243 --2715 364 --
NM_007172chr2272790 1116 1078 992 595 511 45 1204 ----
NM_007174chr1272027 1797 1718 1515 815 671 209 --2625 154 --
NM_007178chr121448 188 ----
NM_007184chr32544 22 ------
NM_007185chr14396 285 122 86 11031 2337 170 --
NM_007189chr761535 1129 978 952 198 135 --31236 188 148 --
NM_007217chr3151 ------
NM_007236chr1592089 2003 1874 1558 779 625 481 389 366 --31720 441 159 --
NM_007245chr166745 725 714 644 205 177 --154 --
NM_007249chr13148432 7497 7007 6616 6030 3378 3259 2653 2212 2049 853 737 609 270 --33300 2394 1166 1791
NM_007260chr17736 667 502 214 194 114 94 --1592 --
NM_007275chr34355 339 323 34 1789 1314 --
NM_007286chr572128 2058 1825 1753 1304 734 492 --22076 2069 --
NM_007363chrX2429 350 --2807 118 --
NM_007365chr191987 1756 1461 854 689 680 213 148 26 --32115 1682 806 --
NM_007373chr1031589 1482 1344 ------
NM_012069chrX22698 709 1448 32067 608 585 1137
NM_012081chr563418 3341 3265 691 637 458 12534 13200 --
NM_012090chr141036 193 130 45 --1334 --
NM_012095chr10103408 3402 3273 2851 2699 1345 1331 788 494 478 --1976 --
NM_012104chr11113615 3530 1350 1332 1217 995 860 529 436 274 136 --23482 1149 --
NM_012124chr111610 --1828 --
NM_012134chr1101762 1431 1419 1267 1247 667 120 100 76 26 --11605 --
NM_012142chr152347 272 --164 --
NM_012193chr11175289 5155 4982 4554 4548 4164 4036 4010 3590 3424 2143 2002 1659 1442 679 537 142 12110 45339 3357 1643 1566 1298
NM_012199chr1113624 3246 3199 2978 2943 2918 1833 1824 1792 1723 655 13031 114547 4074 3026 3022 3018 3014 3010 3006 3002 2998 746 --
NM_012207chr102830 270 --1945 --
NM_012232chr1772080 1918 1902 1361 462 317 244 --22227 1924 --
NM_012234chr393746 2962 2461 1447 1286 1116 137 72 62 22288 684 23714 3103 --
NM_012238chr10----11215 --
NM_012242chr10--1278 ----
NM_012249chr2102749 2697 2588 2527 1388 1197 998 348 323 126 ------
NM_012281chr712146 --11946 --
NM_012282chrX3839 804 252 --1661 --
NM_012285chr17----284 26 --
NM_012290chr221324 246 1583 ----
NM_012294chr754072 3909 1163 946 867 23136 400 53694 3464 3176 1438 1345 12825
NM_012297chr442161 763 595 356 --1410 --
NM_012300chr5----1741 --
NM_012302chr131172 822 89 11102 ----
NM_012308chr11112454 2441 1826 1640 856 818 607 280 264 183 123 1734 42483 1994 953 415 --
NM_012316chr1175287 4418 4105 3875 2247 1912 1899 1856 1741 1563 1507 1322 1224 654 645 413 141 11997 53554 1754 1603 1478 1073 14411
NM_012319chr181136 --11007 --
NM_012326chr28786 770 756 737 659 309 216 54 ------
NM_012329chr1741314 1039 677 169 --11290 --
NM_012330chr1041633 1264 540 385 --1302 --
NM_012333chr121060 518 1674 1591 --
NM_012334chr594750 4349 3616 1849 1560 1316 835 354 159 --64185 1704 1587 776 591 24 --
NM_012384chr20132449 2383 2312 2196 2069 1901 1895 1810 1780 1747 1731 861 45 --1612 --
NM_012402chr113960 348 96 ----1200
NM_012434chr611363 --31245 233 24 --
NM_012448chr17112476 1956 1831 1679 1621 870 698 520 494 456 252 --32062 1864 1795 --
NM_012463chr1221822 109 --2740 604 --
NM_012464chr462795 2563 2293 1953 856 763 ------
NM_012479chr762184 2048 536 425 266 130 --1136 12173
NM_013233chr251338 1153 453 201 78 ------
NM_013236chr2251139 931 907 474 216 11274 ----
NM_013260chr1741537 480 344 211 ------
NM_013261chr453681 3661 3136 2737 2403 11277 1744 --
NM_013275chr162743 92 ------
NM_013316chr7--1337 1914 --
NM_013354chr82507 131 ------
NM_013372chr1552159 1282 940 248 118 13221 21127 136 --
NM_013381chr12----1369 1972
NM_013385chr22111677 1432 1297 1169 702 634 609 497 470 455 241 --21588 1456 --
NM_013396chr2121036 65 --158 --
NM_013399chr16101386 1183 638 618 426 294 251 144 130 32 --11271 --
NM_013411chr12869 59 --2695 414 --
NM_013438chr911696 11321 171 --
NM_013446chr731339 1085 424 --2364 143 --
NM_013449chr1292955 2362 1984 713 547 513 131 75 62 --52906 2102 693 537 333 12850
NM_013450chr211059 --21064 886 --
NM_013958chr8297 24 ------
NM_013960chr81295 1641 1566 --
NM_013995chrX52593 1616 791 263 169 --12597 --
NM_014010chr94595 574 559 125 --1550 --
NM_014011chr232575 477 143 32106 1760 232 ----
NM_014015chr163301 255 156 --1140 1762
NM_014016chr331609 601 169 ------
NM_014023chr1072770 2052 1778 955 628 422 395 --31943 1797 1177 --
NM_014039chr112867 329 ----1215
NM_014043chr321145 511 --1602 --
NM_014059chr13163 ------
NM_014112chr854071 4037 4011 3967 992 31613 434 344 2643 110 --
NM_014141chr765020 4506 3525 3299 1540 288 --34209 3933 76 --
NM_014153chr161699 --198 --
NM_014159chr32540 89 1591 ----
NM_014171chr22722 47 --1783 --
NM_014181chr242774 2652 776 671 12119 ----
NM_014212chr122939 392 ------
NM_014231chr1241623 862 454 55 --2245 241 11719
NM_014232chr1771623 1464 1338 1187 1118 488 441 --21163 270 125
NM_014253chrX62484 2302 1770 1697 129 38 1621 1423 --
NM_014271chrX1677 ------
NM_014280chr13258 214 37 1364 2641 53 --
NM_014283chr131329 1062 541 --11374 11259
NM_014286chr9223570 3248 2969 2749 2729 2546 2434 2417 2256 2241 1405 1245 1224 945 927 773 707 515 444 287 218 163 ------
NM_014288chr1295 50 ------
NM_014289chrX31435 1208 585 ------
NM_014294chr8144 --1212 --
NM_014296chr311379 --1451 --
NM_014299chr19102050 1806 1797 1644 792 698 255 243 202 139 --21552 206 --
NM_014324chr531274 907 239 --1863 --
NM_014341chr62501 279 --1549 --
NM_014342chr1131252 573 140 11469 ----
NM_014345chr61352 ------
NM_014351chr2231379 296 180 11084 11355 --
NM_014368chr971887 1347 619 538 172 127 25 --11609 --
NM_014393chr872313 1710 865 331 310 266 209 11470 3627 213 82 --
NM_014405chr17122363 2028 1813 1797 1674 1503 818 724 461 420 356 293 --21491 392 --
NM_014417chr192643 300 --1125 --
NM_014423chr5114899 4718 4678 4628 4560 4532 4346 1969 1634 521 22 1365 ----
NM_014431chr1041586 1042 447 439 --11237 11628
NM_014445chr3----21545 105 --
NM_014449chr12181 ------
NM_014472chr101271 --1167 --
NM_014480chr193819 738 681 --1539 --
NM_014498chr31359 170 ----
NM_014515chr122786 53 --1167 --
NM_014517chr34731 399 314 260 --1782 --
NM_014554chr1262007 1618 598 272 252 158 1798 22128 1622 --
NM_014571chr1132816 2673 2666 2636 2407 1997 961 635 545 467 297 83 74 --1528 --
NM_014573chr1761831 1719 1438 1392 739 423 11617 ----
NM_014575chr3----1408 --
NM_014607chr252034 1876 640 247 85 --1258 1130
NM_014636chr984133 3591 3454 3388 1023 613 442 183 23357 2655 3828 753 590 --
NM_014637chr81999 --1531 --
NM_014653chr1292052 1986 1721 708 677 659 285 271 132 --22068 681 --
NM_014661chr10153831 3510 3351 3334 3322 3278 2983 2826 2755 2591 1283 1184 787 289 150 12456 63282 3009 2769 2398 749 520 --
NM_014667chr352329 2285 1683 508 45 1231 1255 --
NM_014670chr231593 1198 469 ------
NM_014671chr72504 127 1441 1622 --
NM_014678chr224573 208 175 43 ------
NM_014682chr851756 1432 900 676 364 22115 1825 ----
NM_014683chr1742156 1699 1561 184 ------
NM_014686chr1931900 804 347 --434 30 26 22 1509
NM_014701chr1542646 2221 1206 711 23297 667 --11234
NM_014707chr72468 264 1685 12269 --
NM_014712chr164481 192 183 174 --1467 --
NM_014720chr1031325 1291 66 --1105 --
NM_014723chr20163059 2665 2474 2136 1281 1128 1093 1086 1022 984 679 440 395 380 337 317 --22055 797 12627
NM_014726chr1771135 1111 470 450 428 292 97 1231 1909 --
NM_014727chr193195 59 39 ------
NM_014729chr841635 1527 869 288 --11973 --
NM_014730chr12165202 4350 4335 4321 4058 3736 3729 3717 3654 3594 3236 2115 2104 1316 881 279 14266 43790 3434 1976 1930 13247
NM_014731chr2071620 1221 1173 722 564 157 38 --1542 --
NM_014746chr2104051 3999 3353 3196 3090 1624 1189 1023 869 766 --33223 98 32 --
NM_014747chr1265749 5468 5296 5117 5080 4596 4061 4044 3828 3792 3661 1946 1876 1461 1455 1294 1179 842 593 494 457 445 428 381 106 48 11199 75002 3963 3955 1288 1231 1125 801 --
NM_014752chr111540 ------
NM_014755chr211026 --194 13876
NM_014761chr165985 830 262 173 154 ------
NM_014764chr123475 454 70 ------
NM_014765chr132540 1034 1015 --21071 886 --
NM_014767chr10153329 3170 2735 2687 2509 2375 2329 1290 1187 1030 944 790 665 529 105 23629 567 73608 3550 3112 3085 2485 1058 479 13349
NM_014771chr163708 246 121 --3919 773 309 1388
NM_014772chr1863053 2869 2811 2391 889 856 12375 43597 3339 2855 2794 --
NM_014776chr1293145 3052 2746 2266 2204 2154 2148 1137 421 --1187 21255 330
NM_014788chr982334 2120 1929 1210 696 432 118 94 --42609 915 829 98 --
NM_014795chr2----157 --
NM_014804chr1741188 1127 1022 469 ----11245
NM_014807chr115606 520 284 278 243 --1595 --
NM_014810chr172557 2316 1411 1265 489 178 56 --11380 --
NM_014828chr1432541 996 459 11841 11996 1330
NM_014830chr12103673 3305 2657 2649 1369 1132 1061 661 221 100 23449 551 1907 --
NM_014832chr1351702 1403 1375 843 518 --2614 610 --
NM_014840chr12143285 3018 2981 2920 2783 2611 2504 2110 1033 848 408 385 184 123 --12594 --
NM_014846chr81246 1115 ----
NM_014858chr171168 839 817 361 155 130 102 ------
NM_014862chr15174193 3719 3708 2898 1676 1648 1416 1318 1245 1018 987 699 544 522 482 373 25 --189 --
NM_014868chr123674 612 234 1855 1191 --
NM_014871chr123568 546 417 --1584 --
NM_014872chr911965 --42038 1877 471 440 --
NM_014876chr2291803 1469 1438 810 717 516 370 84 78 --21776 388 --
NM_014877chr17146636 6618 6539 6321 6143 5835 5682 5600 5248 4998 2985 2603 2487 1041 26521 2193 37053 6014 5002 --
NM_014887chr131673 --162 --
NM_014893chrY72265 1468 886 571 242 145 32 12219 ----
NM_014900chr241138 407 223 202 ------
NM_014901chr592231 1830 1777 1445 420 295 238 210 98 --3215 113 35 --
NM_014903chr1272116 1653 893 825 817 698 99 12452 ----
NM_014912chr1042870 335 250 67 ------
NM_014918chr1531486 1185 173 --11077 1217
NM_014939chr18--11239 1446 --
NM_014942chr642476 933 424 107 11878 ----
NM_014943chr83940 262 98 ------
NM_014945chr571937 1502 1244 725 625 337 103 ------
NM_014946chr221132 1088 --1211 --
NM_014949chr1----1684 --
NM_014952chr1581732 1659 1500 1490 1299 673 391 64 --1837 --
NM_014956chr116891 873 850 688 313 69 --173 --
NM_014962chr2032178 1792 459 1197 158 --
NM_014974chr1041754 1523 362 229 ------
NM_014977chr14----1462 --
NM_014978chr1031311 670 258 --31662 1339 494 --
NM_014988chr421109 851 166 1855 --
NM_014989chr641953 1859 1809 116 ------
NM_014991chr452433 2080 469 273 58 11113 32619 2087 917 --
NM_014992chr142706 76 ------
NM_014994chr1592164 2157 2024 1540 787 291 190 89 63 --22328 212 11693
NM_015000chr1253017 2717 2317 878 304 1279 ----
NM_015001chr13847 351 139 ------
NM_015009chr3----162 --
NM_015015chr1951832 1267 1261 722 83 12034 22046 1533 --
NM_015020chr16113641 3631 2745 2590 1288 1179 634 593 358 252 72 13486 2638 216 --
NM_015023chr1131706 1699 1665 1539 1526 1518 672 583 359 342 312 49 30 --81726 1712 1680 1548 1254 1145 296 267 --
NM_015026chr1274746 4579 1702 977 906 886 636 13594 11027 --
NM_015037chr10----1203 --
NM_015039chr144225 3982 1615 1415 --43519 1589 434 68 --
NM_015040chr263378 2279 2179 1345 570 205 --1596 --
NM_015042chr15143780 3690 3631 3528 3286 3270 2674 1058 988 924 843 818 695 673 23975 1123 54001 3763 3305 2847 907 --
NM_015044chr1673216 3083 2857 2630 1128 1076 880 158 43233 2921 1276 329 --
NM_015045chr1011421 1566 ----
NM_015052chr72250 166 ------
NM_015057chr13139 ------
NM_015059chr15113931 3656 3426 3042 2961 1486 993 963 956 349 216 1946 23027 580 --
NM_015063chr1961421 1372 1267 1190 1062 62 ------
NM_015069chr163604 217 40 ------
NM_015071chr5175170 4928 4866 4649 4549 4532 4437 4297 4103 2282 1404 1143 1037 679 594 385 124 16019 54636 4632 4206 1114 1110 15188
NM_015073chr1941635 1464 281 53 --12073 --
NM_015074chr1124496 3573 3509 3135 1798 1672 1346 1267 1241 936 878 568 24558 3581 24645 3824 --
NM_015075chrX92055 1983 1492 607 387 319 259 191 175 --32088 1641 1540 --
NM_015076chr664433 4405 3601 1801 1369 1053 24236 628 34454 2982 2847 --
NM_015080chr116914 407 240 180 107 76 --1642 --
NM_015086chr1241551 1396 1193 519 ------
NM_015092chr1654130 3274 3191 2943 269 12964 24010 3288 --
NM_015093chr61659 1240 ----
NM_015097chr352298 1955 1664 725 662 ------
NM_015099chr173688 279 88 --3476 297 270 --
NM_015100chr131990 1780 1732 --21888 1580 --
NM_015107chrX101761 1673 893 788 582 534 524 431 86 43 --72392 1507 928 293 204 200 119 --
NM_015110chr922323 642 --32512 2010 119 --
NM_015139chr11148 ------
NM_015150chr32615 321 --1927 --
NM_015155chr1083253 2970 2283 1320 1191 1008 825 369 23334 2506 13101 --
NM_015156chr1473870 3491 2536 1340 721 224 154 13926 33526 3306 1474 --
NM_015161chr164433 404 307 119 1422 11457 --
NM_015170chr832171 1532 318 --12175 --
NM_015172chr1----11115 --
NM_015185chrX72695 2341 1099 1029 1005 400 307 --22142 955 --
NM_015192chr2032483 2089 653 --12844 --
NM_015205chr13155274 5250 2084 1926 1885 1522 1230 1196 1090 839 730 685 446 281 34 --33875 1026 538 --
NM_015210chr182291 130 --162 --
NM_015215chr132172 813 453 --1917 --
NM_015236chr4----1362 --
NM_015251chr1672321 2014 585 516 416 234 138 21942 225 ----
NM_015265chr262382 2116 1066 582 309 51 --22306 1033 --
NM_015268chr32739 88 ------
NM_015270chr12122177 2160 2154 2033 1863 1725 1654 901 881 335 161 108 --41648 470 355 311 --
NM_015271chr434266 2811 539 14151 ----
NM_015282chr252691 2500 2321 873 269 1948 42610 2483 2401 2326 12416
NM_015288chr5173796 3482 3382 2734 2623 2521 1126 949 927 661 655 629 444 407 255 232 30 --21148 617 --
NM_015291chr193320 2663 1205 1070 941 819 426 382 315 --13270 --
NM_015292chr125773 547 529 153 33 --2246 41 --
NM_015299chr14103604 3346 3086 2788 1588 1309 1121 690 231 32 22509 590 23689 3475 --
NM_015305chr1481738 1284 1271 729 642 421 191 178 21761 1716 41698 1469 497 392 --
NM_015308chr111221 ------
NM_015310chr8127877 7428 7264 6659 5649 2515 1982 1841 1626 705 581 452 45517 2580 2027 1274 27229 5469 --
NM_015313chr1184413 4141 4054 3454 1366 599 391 111 ----14081
NM_015315chr5163387 2654 2128 2112 1221 1200 1190 1122 918 692 654 575 553 464 397 350 12981 13427 --
NM_015326chr172527 2495 2337 2294 2063 633 198 --32157 1925 778 --
NM_015328chr7132770 2715 2612 2458 2166 2068 2002 879 863 710 502 107 89 1887 22552 400 --
NM_015332chr7113551 2957 2797 2465 1258 1086 573 507 366 340 332 13040 42888 2239 1262 577 --
NM_015336chr121733 --11637 --
NM_015339chr203281 91 74 ------
NM_015343chr174129 110 96 79 ------
NM_015345chr652717 2440 910 290 245 ----1711
NM_015347chr1242792 2222 2105 780 12252 22153 523 --
NM_015349chr622267 2038 --2118 107 --
NM_015353chr1762535 2449 1032 675 439 78 --42438 1922 825 226 --
NM_015367chr223643 435 80 ------
NM_015382chr14----1107 --
NM_015407chr3----1173 --
NM_015435chr811162 ------
NM_015443chr1731425 520 251 11144 31388 1049 973 --
NM_015446chr141614 1373 1300 1122 ------
NM_015447chr91778 --1686 --
NM_015453chr341739 1562 834 451 --1284 --
NM_015455chr571573 1189 1163 972 925 698 349 1887 1231 1947
NM_015460chr351837 587 206 195 35 ------
NM_015466chr3158 ------
NM_015475chr21254 --1119 --
NM_015477chr152698 243 ------
NM_015481chr1221116 1034 --1220 --
NM_015488chr2111529 1511 1366 1335 1290 1158 625 539 517 400 223 --11521 --
NM_015496chr8------1278
NM_015497chr1541111 927 827 398 ------
NM_015508chr32469 453 --1988 --
NM_015509chr1241408 1201 1161 1106 ------
NM_015534chr131125 806 92 1852 ----
NM_015550chr783566 2967 2921 2905 2547 1056 660 468 --2817 49 --
NM_015553chr654531 4259 4118 3630 3396 13643 65059 4716 4264 4145 3621 513 11563
NM_015556chr14----1173 --
NM_015564chr562678 2573 1436 1046 564 491 23283 424 ----
NM_015569chr134712 3367 1570 34457 471 275 24468 4114 --
NM_015577chr581640 1430 1399 716 558 419 218 41 2493 183 1710 1582
NM_015595chr34981 839 364 136 --2865 125 --
NM_015670chr172453 336 --190 --
NM_015680chr24629 561 192 112 --181 --
NM_015686chrX122469 2414 2245 2141 1987 1767 952 900 512 494 449 312 --12432 11821
NM_015691chrX62734 1853 874 833 765 670 --62967 2375 2367 2307 2117 748 --
NM_015711chr193289 228 152 --2700 160 1118
NM_015726chr151694 1540 1327 1308 68 --21193 50 --
NM_015850chr8202292 2149 2059 1892 1885 1869 1817 1801 1606 896 477 374 355 289 275 194 102 90 80 64 1121 1148 --
NM_015852chr743464 3049 2568 926 ----13413
NM_015872chr171373 1187 1171 659 597 372 265 ------
NM_015879chr18148589 8460 8369 8186 7887 6246 5870 3294 3220 1927 1707 521 297 107 12451 28581 1724 12962
NM_015885chr111175 ------
NM_015888chr122146 1031 ------
NM_015902chr81326 ------
NM_015906chr144736 3685 3210 1603 44043 3700 3437 1094 --1106
NM_015912chr872459 2212 2135 1966 939 860 355 --167 --
NM_015964chr165288 111 102 41 22 --1292 1130
NM_015981chr5132758 2586 2524 2395 2387 2361 2081 2015 1041 670 634 312 230 --42965 2561 523 155 --
NM_015984chr1132 --1127 --
NM_015994chr142503 210 1285 1478 --
NM_016018chr862882 2802 2035 1750 903 461 22309 2126 ----
NM_016019chr71331 --1298 --
NM_016022chr13368 299 97 --137 --
NM_016037chr1----1890 --
NM_016045chr2021577 395 --11287 --
NM_016072chr1242359 2200 2079 715 1733 ----
NM_016076chr172824 2319 1289 1215 908 321 32 --2645 458 --
NM_016081chr462059 1541 1488 1471 250 182 --1766 --
NM_016098chr61172 ------
NM_016107chr51549 ----11174
NM_016120chrX3841 790 307 ------
NM_016131chr241493 781 729 160 1916 ----
NM_016141chr32746 58 1649 ----
NM_016147chr1191106 1052 977 955 941 723 227 164 80 1281 3852 413 262 --
NM_016166chr151209 ------
NM_016179chr13----1191 --
NM_016206chr3118535 7931 7625 6737 3549 3052 2965 2141 2070 1517 570 26970 856 47630 7497 7184 2766 18174
NM_016217chr652866 2621 2492 2324 155 13419 1161 --
NM_016231chr17--1604 1468 --
NM_016257chr1123293 3058 2910 2498 2414 2336 2143 1387 1349 1012 375 129 --32859 1401 210 --
NM_016272chr2252117 1931 537 473 350 ------
NM_016284chr161125 --1155 --
NM_016312chr12188 --1387 --
NM_016319chr123591 532 45 --253 49 --
NM_016322chr962533 958 543 475 71 45 --32549 1051 1005 --
NM_016337chr141444 ------
NM_016338chr551046 389 80 59 23 1273 ----
NM_016339chr17141735 1571 1560 1523 1462 1318 695 646 602 396 344 224 168 111 11714 ----
NM_016340chr52403 254 ------
NM_016352chr771339 1089 258 216 200 192 128 11281 --11445
NM_016358chr52496 370 --1500 --
NM_016374chr12279 183 ------
NM_016396chr1552054 1973 946 617 290 --1609 --
NM_016403chr111238 ----190
NM_016433chr1241429 1137 1127 128 ------
NM_016442chr51668 2826 738 1266 --
NM_016486chr14180 120 78 38 ------
NM_016526chr11102450 2277 2226 2110 2036 1884 1798 1696 1647 325 --2956 223 134
NM_016530chr1544013 1321 605 476 1673 33104 1176 50 1983
NM_016562chrX--127 --11036
NM_016577chr393738 3504 2853 2766 1670 1479 1258 431 126 11686 14233 13813
NM_016588chr61718 ------
NM_016592chr201393 --1500 --
NM_016604chr52267 155 ------
NM_016605chr562712 2591 2043 945 301 263 --1832 --
NM_016607chrX21665 391 2683 227 ----
NM_016623chr8123 ------
NM_016626chr1841338 686 678 427 ------
NM_016628chr10----1337 --
NM_016630chr152555 510 ------
NM_016631chr212748 210 --1725 --
NM_016831chr142009 1876 1504 947 ------
NM_016952chr1193606 3486 2796 2726 1481 1452 1007 584 343 23542 2871 11157 12922
NM_017409chr124720 582 575 552 --1727 --
NM_017410chr1231285 911 305 11053 21102 387 --
NM_017413chrX102528 1963 1850 1778 901 685 427 366 113 69 21725 1659 61838 652 317 313 153 149 --
NM_017508chr1141847 899 861 771 ----11733
NM_017519chr62193 119 1257 ----
NM_017542chr151586 541 479 448 263 ------
NM_017550chr1981069 970 790 400 254 179 173 124 --1443 --
NM_017551chr1062176 2110 660 599 412 22 22408 2267 22225 605 --
NM_017553chr1541159 990 78 56 1835 21001 817 --
NM_017582chr191790 1550 1432 1284 697 670 627 377 83 1129 ----
NM_017586chr9141932 1879 1698 1646 1369 705 685 666 601 449 375 305 295 27 1477 52009 1968 1712 1708 505 11619
NM_017596chr1244592 4540 4511 4474 4318 4245 4143 4059 4014 3942 3776 3599 3506 3209 2920 1640 1419 1256 886 872 701 347 135 84 --73784 1017 759 395 163 141 22 --
NM_017602chrX4653 376 202 48 --2195 91 --
NM_017610chr1551829 1662 1419 318 23 --21862 1489 --
NM_017617chr931115 1060 187 --1512 --
NM_017633chr6113718 3706 3136 3053 2591 2575 2507 899 831 510 259 --13751 12436
NM_017634chr82516 243 ------
NM_017637chr9159114 8829 8762 8755 8514 8359 7958 7787 6438 6359 6132 6020 3636 1701 406 29349 1376 28727 7962 --
NM_017666chrX41900 1448 336 323 --21412 275 --
NM_017686chr11889 11023 ----
NM_017709chr173913 3328 2828 1178 1162 555 122 13259 1850 --
NM_017728chr17182956 2926 2383 2318 2041 1992 1970 1892 1215 1187 1149 708 500 454 407 224 184 135 --12734 --
NM_017740chr1631405 1356 395 --21281 1270 --
NM_017742chr1821794 462 ------
NM_017753chr93740 379 163 ------
NM_017772chr641131 468 260 31 ------
NM_017778chr821167 435 --1137 --
NM_017798chr2021204 118 ------
NM_017824chr1022659 1857 --12076 --
NM_017847chr12468 164 --1178 --
NM_017848chrX21745 1279 --34480 708 157 --
NM_017849chr2112916 2359 2182 2051 1244 611 500 232 222 170 144 --12386 --
NM_017851chr1561142 988 911 429 299 154 --11113 --
NM_017857chr113216 168 141 ------
NM_017873chr973067 2942 2873 2316 2266 1164 438 --62840 2382 2169 2123 1191 556 --
NM_017902chr10164778 4715 4487 4463 4390 4376 1318 1198 1174 1128 1059 780 522 234 123 26 23645 1011 45446 1560 611 205 14495
NM_017919chr9124921 4692 4680 3926 3915 3761 1687 1469 1462 1399 1002 620 --33919 3538 702 11572
NM_017922chr141505 --1107 --
NM_017925chr941830 1528 238 231 1372 1533 --
NM_017943chr142893 259 --11035 --
NM_017964chr21381 ------
NM_017987chr101501 --1262 11468
NM_017988chr121672 ------
NM_017994chr742811 2516 893 778 --153 --
NM_018014chr221181 74 21408 473 --11384
NM_018027chr1083234 2823 1052 513 371 318 172 161 13012 22040 233 --
NM_018028chr1951109 876 442 395 260 --4519 337 312 264 --
NM_018064chr6129 ------
NM_018083chr19172 ------
NM_018086chr251633 1482 1193 382 58 --21396 522 --
NM_018087chr11193 ------
NM_018092chr1631687 613 306 ------
NM_018103chr1----1318 --
NM_018113chr12--152 2398 184 --
NM_018115chr44745 693 545 528 ------
NM_018124chr1642427 2327 844 399 --12434 --
NM_018133chr341837 852 427 83 ------
NM_018144chr101232 ------
NM_018157chr1242767 2207 1228 852 --13246 --
NM_018159chrX21175 254 ----1155
NM_018184chr341355 746 631 110 --2657 235 11345
NM_018211chr12740 64 ------
NM_018214chr621146 142 --159 --
NM_018243chr463527 3376 1206 607 458 63 --42878 1227 644 39 1815
NM_018247chr642908 2878 820 799 1313 12891 1650
NM_018254chr11861 22223 879 1342 --
NM_018275chr73464 129 65 --2429 133 --
NM_018312chr1131722 848 271 --21711 1707 --
NM_018364chr183899 3711 3236 2825 1379 781 599 357 14037 1346 1103
NM_018387chr92392 369 --181 --
NM_018416chr1242511 809 600 281 12413 21640 181 --
NM_018426chr6134 --1115 --
NM_018449chr94779 299 241 135 ------
NM_018469chr1751342 198 189 133 121 --21199 347 --
NM_018471chr2--1421 ----
NM_018482chr84826 651 170 52 22423 1619 ----
NM_018489chr14711 541 370 65 --159 --
NM_018490chr112535 104 ------
NM_018509chr172102 24 --11222 1615
NM_018534chr22624 57 ------
NM_018557chr2--11686 1528 --
NM_018566chr131281 1028 254 24981 1569 22049 1255 --
NM_018569chr451474 1408 230 204 196 ------
NM_018584chr111057 ------
NM_018638chr1265328 5214 3609 3567 1935 567 11758 ----
NM_018639chr1251419 934 462 284 48 1405 11071 --
NM_018650chr151944 1605 845 678 89 1560 ----
NM_018657chr31266 ------
NM_018700chr53578 253 178 1653 ----
NM_018712chr1121106 41 21536 66 21110 235 --
NM_018713chr131080 972 774 ------
NM_018718chr781931 1699 1674 549 400 394 382 137 --1144 --
NM_018837chr201727 --1209 --
NM_018898chr532034 317 77 1147 1339 --
NM_018940chr5----1749 --
NM_018945chr6103357 3150 2729 2630 1371 1345 1035 747 303 264 13508 22261 150 13393
NM_018992chr1671251 1122 1029 545 470 230 142 --198 11283
NM_018994chr1----1564 --
NM_019008chr22173716 3662 3348 3281 3118 2818 2789 2737 1449 1194 1110 452 354 340 326 218 96 1437 33594 3579 1044 --
NM_019013chr175690 609 254 193 161 --2637 30 --
NM_019046chr103834 353 241 ------
NM_019063chr231854 625 548 --12282 --
NM_019102chr7----1404 --
NM_019106chr22132503 2420 2352 2232 2197 1356 898 727 717 661 318 283 271 12627 33205 721 105 --
NM_019114chr942356 2272 2210 1649 --32422 2243 1861 --
NM_019116chr16123750 3539 3517 3215 3101 3068 2879 1283 1125 785 666 316 --23339 2312 --
NM_019556chrX41246 438 61 37 ------
NM_019605chr1----1625 1565
NM_019606chr71153 ------
NM_019613chr173869 145 36 --1474 --
NM_019843chr22----162 --
NM_019845chr25748 613 595 98 40 --1617 --
NM_019854chr124198 163 121 56 ------
NM_019886chrX1626 --1426 --
NM_020122chr2126017 5431 5032 4862 3769 1443 1424 998 631 526 347 227 15157 34261 672 652 --
NM_020123chr101187 --11212 11066
NM_020144chr721679 266 --126 --
NM_020145chr94606 220 129 62 --2227 193 --
NM_020152chr213714 707 144 1127 ----
NM_020156chr71379 ------
NM_020159chr411169 ------
NM_020168chr15101154 1132 1116 1106 548 396 172 141 64 22 --282 78 --
NM_020177chr532380 1070 247 13139 1912 --
NM_020179chr11----1126 --
NM_020193chr1111082 --135 --
NM_020198chr1711286 ------
NM_020205chr143378 3366 1340 270 --1725 --
NM_020235chr31304 ------
NM_020310chr17112495 2042 1956 1118 839 718 380 346 244 180 50 --22785 278 --
NM_020318chr13342 318 31 ------
NM_020336chr2052889 2558 1113 643 212 --13750 --
NM_020337chr431118 630 169 --12358 1881
NM_020346chr1111559 --11347 --
NM_020362chr13848 583 112 1630 ----
NM_020426chr17282 44 --1204 --
NM_020432chr732172 132 61 11603 1362 --
NM_020438chr951342 1188 567 504 206 --1959 --
NM_020440chr192978 2924 2313 1001 846 731 634 606 399 ------
NM_020443chr1156530 6365 6029 5979 5930 5345 2588 2523 2305 1864 1491 1262 1024 769 663 21909 866 35845 2389 1445 --
NM_020447chr1522454 27 --11025 1569
NM_020466chr654198 3259 3146 452 151 24579 958 54835 4348 4202 3151 1881 --
NM_020526chr191845 1788 1431 1390 1122 738 645 217 106 --21647 298 --
NM_020640chr351765 1593 1465 834 347 --11878 1781
NM_020644chr111259 ------
NM_020647chr832186 580 414 ------
NM_020655chr1641373 1168 448 162 1458 1972 --
NM_020666chr5----1283 --
NM_020698chr1231969 251 230 --1491 --
NM_020699chr1114960 4699 4506 3890 3859 3302 1358 1219 227 218 171 11153 43818 1560 962 831 --
NM_020704chr771735 1703 1602 1022 685 172 70 163 1260 --
NM_020708chr2041748 738 460 131 --32383 2342 1893 --
NM_020734chr122832 471 12233 ----
NM_020742chrX72684 2596 2335 2287 1885 261 32 ------
NM_020747chr51859 --1937 --
NM_020752chr1082755 2535 2296 2270 1156 813 655 278 ------
NM_020755chr63391 367 139 ----11386
NM_020765chr1----145 --
NM_020768chr563112 2906 2356 1189 797 617 1143 ----
NM_020772chr17168274 8035 7072 6788 5990 5684 5669 5447 5432 2580 2249 1960 1716 897 599 354 12778 42324 2000 1996 1268 11723
NM_020775chr12191 177 --2181 25 --
NM_020778chr15144761 4008 3939 3341 3206 1821 1471 1119 781 723 598 448 429 353 14623 64849 1691 1662 1295 701 663 11748
NM_020781chr753016 2755 585 554 505 --11190 1590
NM_020791chr172513 38 156 ----
NM_020794chr11363 ------
NM_020795chr1761726 1672 713 677 631 563 --31796 1243 555 --
NM_020796chr5102631 2603 2531 2425 2266 2142 1856 968 904 80 ------
NM_020801chr541816 1738 856 778 1821 ----
NM_020810chr1463585 3387 3335 2741 793 114 --13600 --
NM_020825chr16112622 2496 2347 1479 1216 1019 700 439 425 298 142 --53686 3553 3230 1336 940 --
NM_020845chr12132467 2024 1987 1689 1647 947 941 839 745 648 547 343 156 --72282 1893 1747 1742 975 657 162 --
NM_020850chr16103189 3099 2908 2544 2359 1059 960 870 167 62 --62631 2583 2579 975 874 122 11071
NM_020854chr181148 --177 --
NM_020858chr1561731 1645 940 866 156 38 --31510 411 195 --
NM_020860chr421040 272 3259 172 161 ----
NM_020870chr43868 489 230 --21985 1422 --
NM_020872chr3--1275 ----
NM_020888chr192011 1800 1571 1490 804 703 527 298 170 --31529 812 691 --
NM_020897chr171229 1187 991 451 430 386 334 ------
NM_020926chrX1296 1331 ----
NM_020927chr1682248 2133 960 832 744 694 452 377 --12201 --
NM_020940chr1022932 1988 --12939 --
NM_020956chr19214725 4589 4341 4025 3663 3213 3162 1224 1125 1099 1051 1017 778 757 742 532 412 89 75 42 34 --64732 4624 3784 1103 569 416 11141
NM_020962chr1571545 947 911 860 717 674 650 12128 4923 808 461 429 --
NM_020971chr191331 ------
NM_020975chr1021367 469 ------
NM_020981chr22608 126 --1784 --
NM_020988chr165482 395 374 335 35 --1889 1128
NM_021025chr5----1379 --
NM_021033chr1333031 2359 506 13022 21029 695 --
NM_021038chr343277 2894 2732 804 21297 200 --1251
NM_021072chr521822 980 ------
NM_021077chr151190 --1203 --
NM_021106chr93287 69 53 --2483 62 --
NM_021117chr1172040 1654 1532 476 368 316 203 --42330 1941 1937 488 --
NM_021132chr1011153 --11253 11348
NM_021149chr164960 178 42 29 1361 2438 286 --
NM_021165chr11638 ------
NM_021174chr81591 --1687 --
NM_021183chrX21850 69 1900 1120 --
NM_021190chr1----1443 --
NM_021200chr1131027 860 89 --11121 --
NM_021215chr2051783 1636 947 475 288 --11507 --
NM_021238chr1271982 1569 1501 744 700 334 326 --21573 188 --
NM_021249chr1461707 1628 1264 587 398 35 --11383 --
NM_021255chr1422563 218 53366 1579 1500 1481 718 33530 1150 701 --
NM_021642chr131084 941 368 1870 1406 --
NM_021643chr261623 1473 1315 345 264 84 ------
NM_021648chr6102627 2045 1945 1732 1685 1084 795 551 295 92 --22378 172 --
NM_021724chr172221 22 --1267 --
NM_021813chr6174472 4166 4144 4071 4022 4008 3702 3683 3569 1651 1582 1395 1354 1059 1016 243 209 --22219 1460 --
NM_021914chr142865 228 --1451 --
NM_021960chr11200 --32287 2114 1816 --
NM_021961chr11116440 6051 5177 5165 4941 4817 4552 2677 2223 1965 1177 --66973 6103 2578 1780 1769 1757 --
NM_021964chr396352 4994 4737 4446 2599 1958 1534 1359 188 --14131 --
NM_022037chr22208 197 ------
NM_022042chr44873 400 384 214 --1927 --
NM_022048chr15116398 6207 5691 4326 2251 1947 1373 1310 257 241 65 --32377 1410 1300 34496 2122 199
NM_022049chr1----31183 479 90 --
NM_022060chr1471369 1163 1115 1075 1043 866 264 1475 21288 57 --
NM_022062chr1111210 --1611 11909
NM_022068chr181603 ------
NM_022085chr651419 1375 1015 395 29 ------
NM_022114chr1154190 4027 3621 3599 3500 3197 3139 1630 1621 1256 819 791 595 277 86 --33539 3315 990 14404
NM_022130chr5--1376 ----
NM_022166chr16246363 6224 6145 6123 5728 5454 4960 4690 4587 4385 3922 2547 2348 2335 2099 1671 1407 1272 1017 793 591 570 467 230 14967 35538 2084 182 --
NM_022343chr941174 1100 1009 942 --1845 --
NM_022465chr1281120 1080 906 489 329 310 278 64 --12388 --
NM_022470chr3262 48 1104 268 37 --
NM_022481chr52429 81 ------
NM_022484chr731245 893 60 ------
NM_022494chr102329 197 137 1449 --
NM_022574chr7122165 2054 1985 1798 1746 1452 1422 866 656 597 464 292 --52100 1836 1624 558 470 --
NM_022658chr1271195 927 347 279 258 247 137 21109 1074 21029 373 --
NM_022719chr22123732 3379 3139 3116 3088 2742 1387 582 480 310 274 201 ------
NM_022728chr7------145
NM_022733chr141177 782 333 147 ------
NM_022737chr19131256 1117 991 522 468 405 360 338 307 214 109 97 91 --11038 --
NM_022742chr71105 --1290 --
NM_022749chr871198 1123 1002 549 55 43 31 --162 1486
NM_022756chr11523 --21087 44 --
NM_022758chr662584 2257 2185 2059 1232 538 22098 356 23072 2165 12541
NM_022763chr362842 1120 971 898 778 636 ------
NM_022780chr221719 1576 --1347 --
NM_022821chr1--1476 ----
NM_022822chr113669 180 76 --3763 111 93 --
NM_022823chr2184 --1348 --
NM_022832chr432542 861 432 --11684 --
NM_022836chr111188 11344 1564 --
NM_022841chr1512694 12389 1160 --
NM_022893chr243125 2582 2518 616 ------
NM_022894chr261121 709 554 528 276 223 ------
NM_022896chr2051629 1131 1081 612 605 11665 1385 --
NM_022897chr52814 749 ------
NM_022898chr1484779 4273 3973 3863 3438 3329 3246 439 11882 33611 3430 75 --
NM_022912chr232325 2130 109 12529 ----
NM_023009chr15282 258 121 89 67 ------
NM_023034chr81108 --1235 --
NM_023067chr351330 1076 313 258 171 --31139 1116 1080 --
NM_024029chr192417 49 --1332 --
NM_024038chr191250 ------
NM_024045chr10--147 --137
NM_024056chr121143 --1641 --
NM_024071chr14171 --2449 101 --
NM_024293chr22642 142 176 5287 279 155 151 147 --
NM_024308chr172423 102 --254 47 --
NM_024328chr142173 121 ------
NM_024345chr984938 2301 2094 1816 1298 904 334 232 --35023 4751 1132 12001
NM_024408chr1122695 2638 2473 2266 2258 1293 1189 1170 1050 1030 414 354 11283 22700 589 --
NM_024496chr14--1304 ----
NM_024524chr341274 990 679 640 ------
NM_024535chr161192 --3578 388 123 --
NM_024536chr23392 282 75 --2406 299 --
NM_024541chr1041518 1500 1285 1229 --51251 1187 666 482 434 --
NM_024545chr22603 193 ------
NM_024565chr591714 1627 1510 1408 1364 606 544 519 212 --21343 549 --
NM_024567chr82699 693 ------
NM_024575chr1179 ------
NM_024612chr1721000 982 ------
NM_024645chr821409 49 ------
NM_024665chr344068 3068 1315 848 ------
NM_024676chr131118 1086 945 --2951 860 --
NM_024692chr251519 1445 758 604 598 --21371 1265 --
NM_024700chr11121 21051 316 ----
NM_024701chr1051711 1343 1171 403 68 --11739 --
NM_024705chr135972 352 318 189 118 --1856 --
NM_024742chr16111415 1363 1289 1213 780 769 721 522 424 147 102 --4608 590 404 77 11687
NM_024745chr161401 --1795 --
NM_024761chr9123268 1557 1286 1121 1088 927 669 599 509 388 319 308 --44992 4470 3849 1246 12131
NM_024762chr191709 --1583 --
NM_024771chr1182038 1728 1706 857 830 817 642 266 --21848 1564 --
NM_024779chr1261563 1443 1413 346 240 147 --11109 --
NM_024786chr51103 1356 174 1308
NM_024804chr11370 --172 --
NM_024877chr1961165 1037 1010 246 225 67 --21176 1016 --
NM_024887chr161757 866 284 171 39 32 --32049 1785 288 --
NM_024947chr347594 5813 3070 2394 19453 37546 7411 3543 16241
NM_024954chr104495 485 65 58 --3250 246 139 --
NM_024979chr1341035 341 289 34 ------
NM_025054chr842879 1379 1285 660 13993 13948 --
NM_025109chr17138 --146 --
NM_025133chr22366 28 ------
NM_025146chr352029 1941 698 651 475 --1318 --
NM_025160chr143459 3376 3253 533 --1309 --
NM_025164chr1141933 827 814 124 ------
NM_025179chr1234708 4479 4454 4341 3922 3908 3785 3711 3625 3521 3426 3210 3203 1921 1439 1374 1362 1002 557 453 309 293 38 --34687 1885 986 --
NM_025181chr2----1258 --
NM_025191chr132169 1000 469 23175 2563 11414 --
NM_025202chr281051 1028 410 349 235 215 204 23 --1222 --
NM_025204chr2261025 869 851 190 132 96 ------
NM_025251chr881115 460 408 373 336 317 159 34 ------
NM_030571chr5----1113 --
NM_030621chr1443315 982 936 246 11317 33289 1682 663 --
NM_030627chr521628 457 --12764 --
NM_030636chr761654 1431 814 418 133 91 --2790 521 --
NM_030648chr474808 4649 3724 3711 2008 1448 473 14548 34718 1780 1134 25144 3393
NM_030758chr2231149 469 265 1975 11084 --
NM_030780chr84640 208 175 31 --2604 353 --
NM_030786chr111266 --2361 276 1159
NM_030791chr141547 11330 ----
NM_030798chr73836 813 619 --1780 --
NM_030802chr171242 --1194 --
NM_030805chr211176 1460 1508 1913
NM_030806chr1228674 8616 8335 8284 7985 7503 7192 7103 6519 6264 6083 5944 3507 3438 3141 2537 2433 1875 1557 1055 420 399 22789 1109 33588 3410 1824 17390
NM_030885chr322136 1587 11762 1184 --
NM_030912chr10179 1914 1820 --
NM_030913chr14503 284 179 168 ------
NM_030914chr94631 309 112 87 1682 3101 97 72 --
NM_030915chr252142 1956 1717 831 634 1247 21901 170 --
NM_030916chr14772 674 651 127 --2937 888 --
NM_030918chr175172 4357 4152 3294 1075 324 165 --52129 1810 1699 1433 91 --
NM_030948chr6132 ------
NM_030981chr11101073 1047 991 974 887 371 363 245 233 152 --11054 --
NM_031216chr1842184 1919 1870 39 --11597 1129
NM_031412chr122987 185 ------
NM_031417chr197962 875 743 509 165 142 100 --22309 109 --
NM_031418chr1132591 574 284 12525 21999 471 --
NM_031426chr982202 2142 2053 1002 925 908 647 159 ------
NM_031434chr72319 76 --1103 --
NM_031445chr263384 2685 2251 1037 746 141 --11128 11279
NM_031449chr7152022 1904 1709 1679 1514 1468 1382 278 268 234 225 212 152 140 59 --32028 368 349 11505
NM_031483chr2093540 2871 2865 2724 2413 2212 665 248 62 --43021 2997 849 445 --
NM_031892chrX4761 730 102 60 --2931 899 --
NM_031937chr223148 100 76 ------
NM_032042chr552792 2182 1103 381 63 --1272 --
NM_032051chr222472 100 --3499 229 70 1276
NM_032102chr113739 656 411 1100 ----
NM_032153chr382580 2009 1930 1877 1786 754 418 68 ------
NM_032160chr1833849 1010 388 13961 22656 209 --
NM_032182chr1041417 1211 617 91 ------
NM_032199chr1033805 3504 2540 1935 13509 --
NM_032217chr41314 --21380 1125 --
NM_032221chr2021813 797 1347 1131 --
NM_032236chr11890 ------
NM_032239chr461454 1183 941 586 119 64 ------
NM_032268chr16103164 2628 2549 2516 2479 2327 1074 476 291 50 --22269 2177 --
NM_032283chr1101651 1429 1292 1234 742 709 451 354 56 26 --31850 284 35 --
NM_032287chr22154025 3662 3382 3215 2703 1617 1183 1113 970 951 605 529 507 374 184 --41461 939 763 117 --
NM_032320chr111662 ------
NM_032342chr9180 ------
NM_032354chr171108 --1746 --
NM_032373chr1045411 2097 810 491 15754 1304 --
NM_032382chr162556 120 ------
NM_032389chr1161075 994 289 261 191 78 ------
NM_032408chr721001 985 --11118 1242
NM_032420chr54763 742 677 624 1891 1579 --
NM_032430chr191125 --1436 --
NM_032440chr1011068 --1287 --
NM_032445chr1542289 1958 622 527 22359 1038 ----
NM_032449chr1102754 2429 2293 1094 1087 798 769 719 532 523 --2841 634 --
NM_032452chr1451368 1336 506 295 205 --31438 170 61 --
NM_032457chr453354 3253 2811 134 122 12892 ----
NM_032458chrX42879 2738 2313 210 1467 ----
NM_032512chrX31172 1075 206 ------
NM_032514chr206338 321 298 154 88 55 --3444 287 283 --
NM_032558chr91521 --2969 935 --
NM_032560chr142949 381 --1437 --
NM_032569chr1641613 1564 344 137 ------
NM_032578chr1051509 1435 980 297 269 11490 11146 --
NM_032580chr174394 376 202 189 ------
NM_032595chr17111482 1461 1384 1224 1080 564 535 403 382 231 63 --11092 --
NM_032632chr1441650 757 241 34 ------
NM_032682chr383557 3483 3322 3151 2436 905 472 344 ------
NM_032689chr191478 --11382 --
NM_032796chrX1679 --2699 145 --
NM_032808chr155930 658 170 143 66 --1679 1937
NM_032859chr1312803 12898 192 --
NM_032873chr1144222 3465 1688 261 --22802 1695 1214
NM_032881chr12272 65 --179 --
NM_032906chr42235 110 ----1243
NM_032924chr711117 --3904 850 54 --
NM_032961chr41233 --11370 --
NM_032968chrX43287 1235 817 559 ----14029
NM_032973chrY33282 1235 559 ----14021
NM_032982chr792135 1935 1782 808 649 635 202 152 97 1983 52516 1845 1046 994 922 11768
NM_032983chr772949 2749 2596 1016 966 911 416 --43330 2659 2115 567 12582
NM_033036chr1151414 433 78 66 33 --3327 295 183 --
NM_033058chr81141 1804 ----
NM_033089chr2041403 525 372 309 ------
NM_033102chr11214 --21228 35 --
NM_033117chr9160 ------
NM_033132chr135911 552 520 489 107 ------
NM_033133chr17143730 3651 3559 3217 2938 2624 2601 2594 2398 924 716 537 346 165 13275 33179 1356 946 12349
NM_033141chr1462240 1583 1539 659 326 174 1598 32071 1654 287 --
NM_033161chr921605 512 --31331 1297 23 --
NM_033211chr521716 1316 --2575 329 --
NM_033222chr92417 244 --1353 --
NM_033224chr7138010 7880 7830 7508 7287 6835 6678 4900 2172 1730 1713 1445 70 --26704 2532 12836
NM_033225chr842694 2308 2004 987 12494 12716 --
NM_033259chr34798 694 585 334 ------
NM_033260chr62712 247 ------
NM_033284chrY----150 --
NM_033285chr893899 3653 3122 1546 1324 1068 988 957 893 --1186 --
NM_033296chr42844 121 --1662 1111
NM_033315chr17121879 1855 1768 1737 1633 1384 1377 731 375 369 195 188 --1431 --
NM_033343chr1127 --173 --
NM_033389chr17104568 4236 4101 4064 3819 3176 1671 1382 1203 811 11027 2413 310 --
NM_033397chr1042234 2191 129 76 --11807 --
NM_033420chr1971223 944 392 337 161 68 29 ------
NM_033449chr591881 1853 1844 1741 1629 1489 796 568 144 --21515 1444 --
NM_033502chr6174 --178 --
NM_033512chr8112630 2339 2276 1205 1084 813 270 155 69 31 21 --52033 1129 1125 580 537 --
NM_033549chr54956 363 256 100 1279 2928 146 --
NM_033626chrX81614 1468 1255 1216 1139 418 403 374 11334 41726 1486 721 322 --
NM_033631chr1133847 3781 3724 3522 3425 3038 2977 878 559 378 251 62 25 --43851 1445 784 39 --
NM_044472chr16585 522 231 222 39 33 --1695 --
NM_052840chr1541290 1272 590 470 --31398 1347 1343 --
NM_052854chr112566 146 --192 --
NM_052882chr192810 43 --1595 --
NM_052885chr1224518 1049 11310 180 --
NM_052896chr162510 2102 929 592 200 163 --1125 --
NM_052897chr124863 843 782 70 --1789 --
NM_052898chr831860 313 145 --11637 --
NM_052905chr221169 305 11760 11826 --
NM_052907chr1284171 3894 3651 3188 3061 2942 882 248 11037 ----
NM_052910chr1352102 1507 1422 556 280 11578 ----
NM_052925chr199978 953 898 809 676 294 194 136 51 --1778 --
NM_052937chr842451 638 613 589 12569 11912 --
NM_057175chr442351 1948 150 72 --21841 119 --
NM_058170chr12372 294 ------
NM_058172chr44501 189 153 145 --11433 --
NM_058243chr19--1828 1174 --
NM_080552chr20184 --1556 --
NM_080616chr201489 --2225 70 --
NM_080617chr202963 253 --1142 --
NM_080621chr20121290 1270 1263 1222 1195 1007 952 511 478 389 292 216 --11315 --
NM_080671chr221666 350 1416 22054 1630 --
NM_080723chr61403 1214 1416 --
NM_080738chr151946 1540 1534 1342 743 ------
NM_080836chr20184320 4222 4194 4131 3896 3864 3828 3276 3093 1919 1907 1695 1497 1236 1195 952 766 409 --64001 3835 1911 1358 846 472 --
NM_080867chr1444411 3646 1459 120 11382 13490 --
NM_101395chr2162583 2537 2418 922 750 68 --1353 140
NM_130474chr117877 866 814 745 695 347 254 --2636 120 --
NM_133264chr17123823 3646 2885 2691 1284 941 765 580 543 370 284 249 13314 33096 1161 1094 --
NM_133265chrX93350 3019 3009 2964 2768 1324 1283 1271 592 --11339 --
NM_133369chr57944 868 756 729 723 669 159 --1389 1188
NM_133444chr1951781 576 437 382 187 --1401 --
NM_133452chr1971097 1071 964 877 866 390 254 --1314 --
NM_133468chr751945 1902 1813 669 375 --1379 --
NM_133478chr241727 788 683 62 1317 32579 2370 77 --
NM_138288chr1442115 1372 408 337 --11470 --
NM_138316chr1021314 117 ------
NM_138328chr17123252 3089 2666 2319 2263 2183 2064 1141 1104 1089 1067 479 ------
NM_138334chr192151 131 ------
NM_138350chr151396 948 438 307 86 --21158 1154 --
NM_138370chr22669 245 --154 --
NM_138396chr121717 ----1772
NM_138409chr61558 --21366 948 --
NM_138423chr1532304 2236 1525 --21998 520 --
NM_138426chr732095 613 328 ----1333
NM_138444chr1374057 3608 1653 476 195 141 47 11527 2734 286 --
NM_138447chr164324 289 153 111 ----1565
NM_138468chr2126022 5990 5734 5609 4872 4793 4769 4709 2073 1248 360 124 --24905 2295 15742
NM_138473chr1295049 4876 4363 4067 3699 1155 773 624 528 14552 34755 4505 4153 --
NM_138479chr141881 1739 1521 283 --11525 --
NM_138729chr1129 ------
NM_138775chr112542 37 ------
NM_138782chr542340 2240 1930 44 11561 ----
NM_138799chr221479 1399 --21275 383 --
NM_138966chr181109 ------
NM_138967chr1592466 2448 2124 1903 1708 983 874 633 346 31532 971 646 52374 2134 1746 927 356 12080
NM_139161chr195476 372 340 166 160 ------
NM_139245chr391868 1712 1684 1623 1608 1500 620 466 24 11463 ----
NM_139283chr124195 128 69 51 12463 2132 21 --
NM_144571chr4116658 6593 5686 5548 4559 4298 2745 2483 1385 851 100 11236 26831 727 --
NM_144578chr14125436 5429 5213 4761 4513 4475 4236 4090 3622 3421 939 145 34679 3819 1813 ----
NM_144591chr10----1106 --
NM_144599chr1595463 5249 3939 3779 3755 3643 3349 1407 210 11639 15056 15420
NM_144604chr16----1514 --
NM_144632chr231914 1542 439 --1945 --
NM_144720chr4--1178 ----
NM_144723chr53286 240 208 ------
NM_144778chr133905 640 564 ----11910
NM_144963chr832539 90 35 ------
NM_144967chrX2727 717 --1251 --
NM_144974chr131754 --1114 --
NM_144982chr124757 602 226 146 --1214 --
NM_145037chr311359 --1599 --
NM_145113chr1461114 627 600 503 306 188 --11355 --
NM_145117chr1192641 2442 2320 1072 1015 657 381 247 180 12063 32032 1334 1150 12826
NM_145203chr131359 ------
NM_145206chr1063050 2793 2522 2327 1176 644 --53145 2924 2095 699 517 --
NM_145207chr465363 5059 4874 3889 1429 1208 --34826 1966 807 --
NM_145239chr164178 165 152 49 --1194 --
NM_145245chr1931219 1100 82 ------
NM_145263chr451902 883 81 69 47 --12117 --
NM_145279chr181719 1659 1542 1354 1279 459 378 160 1154 1727 --
NM_145284chrX52483 1993 1984 1929 337 --1816 --
NM_145305chrX11029 21107 966 ----
NM_145313chr1031559 491 445 --2367 212 --
NM_145349chr1781834 1615 446 351 231 138 117 57 --41996 1861 219 126 1514
NM_145735chr1352556 2017 1996 1990 1955 --150 --
NM_145800chrX1754 --144 --
NM_145805chr151202 --2495 179 --
NM_145808chr762069 795 463 395 85 60 1515 164 --
NM_147192chr161327 558 446 421 331 130 --3541 404 195 --
NM_147202chr9122581 2556 2548 2299 1056 877 760 736 614 598 280 87 --22511 1036 --
NM_152237chr2271581 1273 1221 455 439 384 74 11127 2650 400 --
NM_152247chr221227 --2949 866 --
NM_152253chr22153911 3613 3394 3298 3286 3154 2971 2865 920 840 810 506 196 91 61 12653 24335 4252 --
NM_152271chr83479 414 70 ------
NM_152272chr891221 1215 1196 1042 1002 448 417 286 262 --31071 1048 213 --
NM_152275chr251516 732 469 233 200 --21863 1484 --
NM_152335chr152209 126 --1130 --
NM_152344chr1751271 1127 624 342 304 --21505 373 --
NM_152346chr179990 759 433 378 339 332 231 199 57 --4410 368 141 33 --
NM_152348chr179842 771 709 645 619 358 300 199 133 ------
NM_152384chr2111693 1656 1517 1480 1342 1305 824 784 745 497 66 --3749 488 475 --
NM_152409chr532935 855 637 32979 2286 674 32468 2200 137 --
NM_152414chr821486 1436 11307 ----
NM_152415chr8------1516
NM_152424chrX174691 4413 4211 4169 3597 3335 3289 3114 2939 1704 1523 1233 767 535 481 202 168 13626 1160 --
NM_152433chr1111183 --21252 104 --
NM_152455chr1592860 1151 1059 952 863 800 665 510 215 12615 42812 827 670 536 1958
NM_152470chr1883204 2887 1453 1344 1138 1080 341 80 12945 11051 --
NM_152487chr141127 508 496 429 ------
NM_152527chr251688 1556 851 632 164 --12196 --
NM_152550chr54438 162 80 60 ------
NM_152581chrX31360 1193 387 ------
NM_152588chr1221184 479 ----1503
NM_152594chr1511666 --198 --
NM_152608chr152533 2513 2010 563 514 --22454 590 --
NM_152641chr1221973 729 ------
NM_152663chr12256 114 ------
NM_152665chr1--11079 ----
NM_152682chr42674 561 --1197 --
NM_152688chr6----1767 --
NM_152694chrX3666 626 278 ------
NM_152704chr131126 --1325 --
NM_152721chr182158 72 ------
NM_152722chr1161755 1735 1647 1493 1457 698 --11481 --
NM_152739chr72440 189 --1780 --
NM_152749chr73967 960 745 --1297 --
NM_152754chr773163 2746 2608 2351 1425 1162 51 --11543 --
NM_152756chr523943 1129 11689 ----
NM_152896chr92722 178 ------
NM_153020chr631453 1388 342 ------
NM_153029chr16134053 4014 3953 3643 3569 3541 3258 3028 2770 2671 1281 480 243 13121 43062 2647 1401 1290 --
NM_153035chr123269 2935 21103 212 33103 460 52 --
NM_153184chr331401 745 488 21264 215 --11347
NM_153332chr863095 2529 2484 2123 2025 1319 23183 540 32812 2509 1131 1240
NM_153354chr53809 708 690 1392 ----
NM_153456chr13105904 5456 4728 4124 2396 2077 1967 1633 1150 407 12365 15625 --
NM_153607chr522915 2691 --22447 2039 --
NM_153634chr1231301 1241 514 1601 11095 --
NM_153685chr1271059 1007 969 833 754 220 117 ------
NM_153756chr171917 1794 1782 1397 562 496 424 --1566 --
NM_153812chr181866 1816 859 526 509 502 360 113 --2736 514 --
NM_170662chr32679 493 ------
NM_170707chr17834 726 597 364 357 287 72 --2916 266 --
NM_170711chr19----1774 --
NM_170721chr173926 120 111 --11222 --
NM_170768chr111327 ------
NM_172020chr791399 816 773 764 663 627 613 584 61 --12030 --
NM_172071chr1107468 6692 6369 6077 5923 5064 2223 1559 1464 1319 24860 1567 46787 6783 6159 2305 --
NM_172097chr152562 182 --1833 --
NM_173075chr451692 1302 385 368 163 ------
NM_173199chr92157 105 1356 2477 457 1495
NM_173460chr203244 210 74 ------
NM_173468chr442046 1697 1184 547 ----12159
NM_173475chr1661432 1400 1121 285 121 35 ----11405
NM_173485chr201275 1230 183 --
NM_173500chr1551375 1358 913 542 282 1338 11139 --
NM_173510chr2262462 2417 1920 1058 763 640 --1929 --
NM_173511chr263944 3255 2416 1486 357 165 11195 21512 203 --
NM_173567chr11222 ------
NM_173570chr31130 1854 ----
NM_173576chr1022142 857 --1550 --
NM_173582chr1156244 6028 5427 4882 4308 14212 11345 --
NM_173595chr12214986 4321 4298 4272 4137 3913 3333 3286 2079 1994 1697 1533 1039 910 818 710 697 424 417 371 238 --44977 2098 1851 1225 --
NM_173633chr192216 152 --147 --
NM_173681chr782057 2049 1923 1799 1746 243 232 140 --51821 1734 477 315 48 --
NM_173683chr851550 1450 1437 1291 465 ------
NM_173694chrX2613 423 21666 25 12559 --
NM_173808chr12583 476 23829 952 13621 --
NM_173822chr21244 130 ----
NM_173849chr14188 ------
NM_174911chr8113958 2680 1574 835 819 733 723 474 466 373 96 23140 1559 41493 912 284 245 --
NM_175058chr114928 553 441 394 ------
NM_175061chr742211 2159 748 647 22174 1385 ----
NM_175063chr193730 374 265 --1755 --
NM_175069chr92753 138 --127 --
NM_175733chr1162179 1968 623 489 353 21 32112 1646 1499 ----
NM_175736chr12267764 7393 7115 6408 6327 6204 5720 5680 5615 4872 2970 2846 2636 2422 1938 1915 1876 1859 1804 1295 1288 1120 1070 772 553 435 35767 2999 2416 57747 7656 3136 2838 1717 --
NM_175747chr62744 139 --11059 --
NM_175834chr12241 35 --1399 --
NM_175839chr202315 52 --2251 76 1236
NM_175854chr1342515 1846 749 125 22377 1092 1265 --
NM_176814chr711221 1194 ----
NM_176823chr1123847 3669 3591 2477 1531 1510 1366 437 423 319 251 226 --23378 70 --
NM_176871chr8133167 2936 2902 2723 2552 2539 684 643 631 574 512 376 219 13194 22283 273 --
NM_177401chr19101708 1590 1320 1300 1172 1156 745 309 274 238 --11141 --
NM_177424chr121578 62 --1755 --
NM_177539chr14788 675 338 163 3654 308 300 2590 169 --
NM_177539chr14788 675 338 163 3654 308 300 2590 169 --
NM_177999chr993630 3505 3436 2879 2829 2280 1001 186 96 --63403 2945 2732 2686 1119 497 --
NM_178313chr262172 1556 1512 747 736 641 --2812 177 --
NM_178423chr73938 250 91 11188 ----
NM_178496chr321336 187 --31254 1232 946 --
NM_178502chr124541 83 76 29 --1113 --
NM_178554chr3113392 3144 2925 2807 1434 1394 1038 895 550 144 125 --11115 --
NM_178562chr72614 314 --1780 --
NM_178812chr81463 1361 11093 --
NM_178815chr1082345 1991 1885 1873 925 669 422 272 22468 512 1555 --
NM_178831chr792948 2941 2586 2376 2232 1876 1136 394 128 ------
NM_178835chr46856 602 573 560 227 133 --1552 --
NM_178864chr115710 644 635 570 471 ------
NM_181336chr661141 1002 938 232 143 35 --1102 --
NM_181358chr143883 3683 1520 1306 2954 921 43713 3531 1675 167 23064 502
NM_181491chr9173174 3068 2859 2573 2386 2354 2348 2268 2259 2168 2005 1267 964 899 781 72 65 --52456 2397 1241 1236 1232 135
NM_181670chr121958 1389 ----
NM_181671chr173949 212 103 ------
NM_181704chr2111267 --31430 996 130 --
NM_181712chr132108 1662 183 ------
NM_181782chr652032 1881 1670 1582 123 --195 --
NM_181825chr224770 642 614 222 --3857 89 85 --
NM_181844chr1741695 1631 608 179 --11393 --
NM_182488chr132207 32 ------
NM_182509chr1481587 1087 1044 638 577 218 201 55 --21552 1522 --
NM_182546chr7----1159 --
NM_182557chr11102221 1982 1964 1881 1869 1433 1415 1388 505 478 --61903 1559 907 791 488 407 --
NM_182580chr162590 2308 1964 1873 1684 649 1847 52412 1952 1709 998 38 12187
NM_182757chr653187 2976 2330 1192 94 11084 32960 135 81 --
NM_182920chr361304 1235 1086 1023 579 297 ------
NM_182935chr362126 1812 952 858 806 119 --22175 180 --
NM_182970chr20144110 1699 1558 1449 1307 1286 1255 1162 576 544 450 336 171 137 --43604 3361 961 605 1949
NM_183238chr1233544 2441 740 --22537 613 --
NM_183416chr121692 1461 --22108 362 12060
NM_194247chr274083 3316 3245 1518 1000 543 119 ------
NM_194285chr111403 --33300 2195 58 --
NM_194314chr134261 4022 1095 24325 671 35181 4182 1974 --
NM_197939chr1721113 422 --5866 823 444 369 131 --
NM_197941chr532682 955 754 --22983 1870 --
NM_198081chr66502 487 452 407 156 59 --22497 2303 --
NM_198270chrX53108 2850 2267 1352 21 1327 ----
NM_198281chr42951 344 1703 23360 385 --
NM_198334chr112127 70 ------
NM_198392chr641538 475 139 83 --11685 1257
NM_198503chr132409 2284 565 ------
NM_198513chr841397 567 510 138 ------
NM_198526chr152867 634 --1269 --
NM_198576chr13824 705 266 --3713 230 81 --
NM_198581chr2137359 7290 6922 6555 6518 6495 5707 5550 4923 4605 2631 454 280 11536 25576 4950 --
NM_198686chr14112551 2512 2138 1667 606 512 419 387 327 227 135 --4925 791 712 284 --
NM_198834chr1741900 332 56 25 --32174 735 31 --
NM_198859chr3165071 4659 4616 4502 4295 3887 3786 3699 3677 3434 2019 1668 1031 1000 850 309 --14941 --
NM_198904chr521344 720 12117 --12081
NM_198989chr131136 --1222 --
NM_198990chr723152 3140 12289 22187 773 --
NM_199000chr7------11889
NM_199245chr1242029 1694 860 461 --81678 651 647 347 64 60 56 52 12125
NM_199262chr1772252 2244 1985 1909 939 488 392 --22256 243 --
NM_199320chr422579 665 --12310 --
NM_199423chr162551 270 --1407 --
NM_199511chr31605 --2611 102 --
NM_201280chr63576 408 89 --11586 --
NM_203301chr141300 ------
NM_203365chr24480 379 228 131 --1575 --
NM_203374chr193341 304 210 1851 ----
NM_203390chr811346 11836 21866 440 --
NM_203406chr532467 2186 1011 --1308 --
NM_203434chr921126 974 ------
NM_203459chr122517 2346 --1261 162
NM_203463chr2144596 4248 4186 3941 3864 3788 3561 3111 1794 1760 1684 1553 353 244 24734 501 1157 --
NM_205833chrX1712 1897 ----
NM_206853chr663462 1513 1450 1117 684 420 14063 ----
NM_206966chr5----159 --
NM_207009chr101384 --1205 --
NM_207043chr142192 2081 2072 1615 ----1523
NM_207111chr7132534 2520 2031 1839 1800 1711 1061 1030 907 814 780 314 278 --22578 2391 --
NM_207313chr176824 668 307 269 200 120 --1766 --
NM_207317chr5----1164 --
NM_207334chr15707 681 384 226 71 --11040 --
NM_207371chr101979 --11114 --
NM_207381chr152952 31 --3403 399 395 --
NM_207396chr131573 1235 174 --2337 201 --
NM_207577chr1182815 2697 2487 2286 2090 1038 783 114 12304 32662 2607 175 --
NM_212464chr1541898 1883 1455 57 --31822 766 123 11865
NM_212467chr1582475 2460 2032 1767 1025 238 102 39 --22399 106 12442